#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACCS	84680	hgsc.bcm.edu;bcgsc.ca	37	11	44089261	44089262	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr11:44089261_44089262insG	ENST00000263776.8	+	2	518_519	c.84_85insG	c.(85-87)gggfs	p.G29fs	ACCS_ENST00000533208.1_3'UTR|ACCS_ENST00000432284.2_Frame_Shift_Ins_p.G29fs	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	29					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GCAGTAGCCATGGGGAAGATCT	0.55																																					p.H28fs	Esophageal Squamous(158;148 1889 8077 23160 41213)	.											.	ACCS	155	0			c.84_85insG						.																																			SO:0001589	frameshift_variant	84680	exon2			TAGCCATGGGGAA	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.88dupG	11.37:g.44089265_44089265dupG	ENSP00000263776:p.Gly29fs	165.0	0.0		143.0	16.0	NM_032592	B4E219|Q8WUL4|Q96LX5	Frame_Shift_Ins	INS	ENST00000263776.8	37	CCDS7907.1																																																																																			.		0.550	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
ACTR3B	57180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	152549222	152549222	+	Silent	SNP	C	C	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:152549222C>G	ENST00000256001.8	+	10	1097	c.963C>G	c.(961-963)ctC>ctG	p.L321L	ACTR3B_ENST00000377776.3_Intron|ACTR3B_ENST00000537264.1_Silent_p.L233L|ACTR3B_ENST00000397282.2_Silent_p.L233L	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)	321						cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		ATGTCGTACTCTCAGGAGGCT	0.577																																					p.L321L		.											.	ACTR3B	514	0			c.C963G						.						119.0	103.0	109.0					7																	152549222		2203	4300	6503	SO:0001819	synonymous_variant	57180	exon10			CGTACTCTCAGGA		CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.963C>G	7.37:g.152549222C>G		217.0	0.0		225.0	62.0	NM_020445	A8MTG1|B4DFW4|Q7Z526|Q96BT2	Silent	SNP	ENST00000256001.8	37	CCDS5934.1																																																																																			.		0.577	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322803.1	NM_020445	
AKAP12	9590	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	151670985	151670985	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:151670985A>T	ENST00000253332.1	+	3	1648	c.1459A>T	c.(1459-1461)Aag>Tag	p.K487*	AKAP12_ENST00000402676.2_Nonsense_Mutation_p.K487*|AKAP12_ENST00000359755.5_Nonsense_Mutation_p.K382*|snoU13_ENST00000458767.1_RNA|AKAP12_ENST00000354675.6_Nonsense_Mutation_p.K389*			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	487	Involved in PKC-binding. {ECO:0000305}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		TCCTGATGAGAAGGTGCTGTC	0.527																																					p.K487X	Melanoma(141;1616 1805 10049 24534 51979)	.											.	AKAP12	293	0			c.A1459T						.						97.0	100.0	99.0					6																	151670985		2203	4300	6503	SO:0001587	stop_gained	9590	exon4			GATGAGAAGGTGC	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.1459A>T	6.37:g.151670985A>T	ENSP00000253332:p.Lys487*	60.0	0.0		50.0	29.0	NM_005100	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Nonsense_Mutation	SNP	ENST00000253332.1	37	CCDS5229.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211119	0.79240	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	.	.	.	4.97	2.35	0.29111	.	0.166543	0.28583	N	0.014832	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.811	0.23805	0.6029:0.2184:0.0:0.1787	.	.	.	.	X	487;487;389;382	.	ENSP00000253332:K487X	K	+	1	0	AKAP12	151712678	0.027000	0.19231	0.002000	0.10522	0.008000	0.06430	1.256000	0.32921	0.818000	0.34468	0.533000	0.62120	AAG	.		0.527	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
ARHGAP6	395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	11206890	11206890	+	Silent	SNP	C	C	T	rs151308614	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:11206890C>T	ENST00000337414.4	-	4	1907	c.1035G>A	c.(1033-1035)acG>acA	p.T345T	ARHGAP6_ENST00000413512.3_Silent_p.T154T|ARHGAP6_ENST00000380736.1_Silent_p.T142T|ARHGAP6_ENST00000534860.1_Silent_p.T170T|ARHGAP6_ENST00000380732.3_Silent_p.T377T|ARHGAP6_ENST00000303025.6_Silent_p.T142T|ARHGAP6_ENST00000380718.1_Silent_p.T345T	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	345					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGTTTGGGGACGTTGACTCAT	0.498													C|||	1	0.000264901	0.0	0.0	3775	,	,		15136	0.001		0.0	False		,,,				2504	0.0				p.T345T		.											.	ARHGAP6	227	0			c.G1035A						.	C	,,	0,3835		0,0,0,1632,571	125.0	102.0	109.0		1035,426,1035	-3.8	0.7	X	dbSNP_134	109	4,6724		0,3,1,2425,1871	no	coding-synonymous,coding-synonymous,coding-synonymous	ARHGAP6	NM_006125.2,NM_013423.2,NM_013427.2	,,	0,3,1,4057,2442	TT,TC,T,CC,C		0.0595,0.0,0.0379	,,	345/766,142/772,345/975	11206890	4,10559	2203	4300	6503	SO:0001819	synonymous_variant	395	exon4			TGGGGACGTTGAC	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1035G>A	X.37:g.11206890C>T		571.0	0.0		680.0	124.0	NM_006125	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Silent	SNP	ENST00000337414.4	37	CCDS14140.1																																																																																			C|0.999;T|0.001		0.498	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
ARHGAP4	393	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153185069	153185069	+	Intron	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:153185069G>T	ENST00000350060.5	-	6	723				ARHGAP4_ENST00000370028.3_Silent_p.L251L|ARHGAP4_ENST00000393721.1_Intron|ARHGAP4_ENST00000537206.1_Intron|ARHGAP4_ENST00000370016.1_Intron	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4						apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GAGGGTGCACGAGAAACCCAG	0.597																																					p.L251L		.											.	ARHGAP4	227	0			c.C753A						.						38.0	40.0	40.0					X																	153185069		692	1591	2283	SO:0001627	intron_variant	393	exon6			GTGCACGAGAAAC	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.682-332C>A	X.37:g.153185069G>T		140.0	0.0		201.0	29.0	NM_001164741	Q14144|Q86UY3	Silent	SNP	ENST00000350060.5	37	CCDS14736.1	.	.	.	.	.	.	.	.	.	.	g	0.290	-0.980845	0.02197	.	.	ENSG00000089820	ENST00000418750	.	.	.	0.803	-1.61	0.08399	.	.	.	.	.	T	0.16685	0.0401	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.13899	-1.0492	3	.	.	.	.	.	.	.	.	.	.	.	S	99	.	.	R	-	1	0	ARHGAP4	152838263	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.064000	0.00622	-2.769000	0.00366	-2.634000	0.00153	CGT	.		0.597	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	
ARHGEF18	23370	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	7516109	7516109	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:7516109C>T	ENST00000359920.6	+	6	1501	c.1248C>T	c.(1246-1248)acC>acT	p.T416T	ARHGEF18_ENST00000319670.9_Silent_p.T258T|CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.P374L	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	416	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				AACGCATAACCAAATACCCAG	0.572																																					p.T416T		.											.	ARHGEF18	228	0			c.C1248T						.						112.0	85.0	94.0					19																	7516109		2203	4300	6503	SO:0001819	synonymous_variant	23370	exon6			CATAACCAAATAC	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1248C>T	19.37:g.7516109C>T		107.0	0.0		130.0	25.0	NM_001130955	A8MV62|B5ME81|O60274|Q6DD92	Silent	SNP	ENST00000359920.6	37	CCDS45946.1																																																																																			.		0.572	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
ARSD	414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	2835844	2835844	+	Splice_Site	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:2835844C>T	ENST00000381154.1	-	5	939		c.e5+1		ARSD_ENST00000217890.6_Splice_Site	NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGGTTGCTTACCTTTCAATAT	0.493																																					.		.											.	ARSD	130	0			c.863+1G>A						.						43.0	36.0	39.0					X																	2835844		2203	4300	6503	SO:0001630	splice_region_variant	414	exon6			TGCTTACCTTTCA	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.863+1G>A	X.37:g.2835844C>T		110.0	0.0		143.0	37.0	NM_001669	Q9UHJ8	Splice_Site	SNP	ENST00000381154.1	37	CCDS35196.1	.	.	.	.	.	.	.	.	.	.	C	8.965	0.971620	0.18736	.	.	ENSG00000006756	ENST00000381154;ENST00000217890	.	.	.	3.12	3.12	0.35913	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8669	0.63594	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARSD	2845844	1.000000	0.71417	0.052000	0.19188	0.089000	0.18198	6.317000	0.72862	1.215000	0.43411	0.281000	0.19383	.	.		0.493	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		Intron
ASB10	136371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150883617	150883617	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:150883617C>T	ENST00000420175.2	-	2	470	c.446G>A	c.(445-447)cGc>cAc	p.R149H	ASB10_ENST00000275838.1_Missense_Mutation_p.R149H|ASB10_ENST00000434669.1_Missense_Mutation_p.R194H|ASB10_ENST00000377867.3_Missense_Mutation_p.R134H|ASB10_ENST00000422024.1_Missense_Mutation_p.R194H			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	149					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGGGCGGTGCGGCCCCCAGG	0.677																																					p.R149H		.											.	ASB10	226	0			c.G446A						.						19.0	19.0	19.0					7																	150883617		2196	4294	6490	SO:0001583	missense	136371	exon2			GCGGTGCGGCCCC	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.446G>A	7.37:g.150883617C>T	ENSP00000391137:p.Arg149His	58.0	0.0		59.0	10.0	NM_001142459	A0AVH0|Q6ZUL6	Missense_Mutation	SNP	ENST00000420175.2	37	CCDS47750.2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703764	0.48412	.	.	ENSG00000146926	ENST00000275838;ENST00000377867;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.15	5.15	0.70609	Ankyrin repeat-containing domain (4);	0.732986	0.13677	N	0.370464	T	0.50854	0.1640	L	0.44542	1.39	0.27720	N	0.945146	B;B;B	0.29270	0.027;0.24;0.081	B;B;B	0.25291	0.01;0.059;0.019	T	0.38457	-0.9660	10	0.15952	T	0.53	-6.5102	11.0942	0.48134	0.0:0.9057:0.0:0.0943	.	134;149;194	Q8WXI3-3;Q8WXI3;D5MNW9	.;ASB10_HUMAN;.	H	149;134;194;194;149	ENSP00000275838:R149H;ENSP00000367098:R134H;ENSP00000401369:R194H;ENSP00000398247:R194H;ENSP00000391137:R149H	ENSP00000275838:R149H	R	-	2	0	ASB10	150514550	0.996000	0.38824	1.000000	0.80357	0.989000	0.77384	0.339000	0.19875	2.397000	0.81536	0.491000	0.48974	CGC	.		0.677	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871	
ATM	472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108218075	108218075	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr11:108218075T>A	ENST00000452508.2	+	60	8843	c.8654T>A	c.(8653-8655)cTt>cAt	p.L2885H	C11orf65_ENST00000526725.1_Intron|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.L2885H|ATM_ENST00000525178.1_3'UTR			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2885	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TCAGCAGAACTTGTACATATA	0.308			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.L2885H		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	3419	0			c.T8654A						.						94.0	99.0	97.0					11																	108218075		2201	4295	6496	SO:0001583	missense	472	exon59	Familial Cancer Database	AT, Louis-Bar syndrome	CAGAACTTGTACA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8654T>A	11.37:g.108218075T>A	ENSP00000388058:p.Leu2885His	247.0	0.0		257.0	125.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.347909	0.82022	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.83992	-1.79;-1.79	5.52	5.52	0.82312	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.93074	0.7795	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94664	0.7851	10	0.87932	D	0	.	15.6511	0.77095	0.0:0.0:0.0:1.0	.	2885	Q13315	ATM_HUMAN	H	2885	ENSP00000278616:L2885H;ENSP00000388058:L2885H	ENSP00000278616:L2885H	L	+	2	0	ATM	107723285	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.461000	0.80834	2.090000	0.63153	0.454000	0.30748	CTT	.		0.308	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
AUTS2	26053	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	69364274	69364274	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:69364274A>C	ENST00000342771.4	+	2	633	c.312A>C	c.(310-312)aaA>aaC	p.K104N	AUTS2_ENST00000406775.2_Missense_Mutation_p.K104N|AUTS2_ENST00000403018.2_Missense_Mutation_p.K104N	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	104										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		TTCTACAGAAAGATGTAGCAC	0.433																																					p.K104N		.											.	AUTS2	92	0			c.A312C						.						59.0	55.0	57.0					7																	69364274		2203	4300	6503	SO:0001583	missense	26053	exon2			ACAGAAAGATGTA	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.312A>C	7.37:g.69364274A>C	ENSP00000344087:p.Lys104Asn	167.0	1.0		168.0	30.0	NM_001127231	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301145	0.81136	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000403018	T;T	0.34472	1.38;1.36	5.65	4.49	0.54785	.	0.000000	0.64402	D	0.000009	T	0.44435	0.1293	L	0.42245	1.32	0.27617	N	0.948462	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.996;0.997	T	0.38023	-0.9680	9	.	.	.	-9.5232	3.916	0.09224	0.7434:0.0:0.2566:0.0	.	104;104;104	Q8WXX7-2;Q8WXX7;Q6PJU5	.;AUTS2_HUMAN;.	N	104	ENSP00000385263:K104N;ENSP00000344087:K104N	.	K	+	3	2	AUTS2	69002210	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.667000	0.54547	2.371000	0.80710	0.533000	0.62120	AAA	.		0.433	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
ATXN7L1	222255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	105278897	105278897	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:105278897C>T	ENST00000419735.3	-	7	1150	c.1105G>A	c.(1105-1107)Gca>Aca	p.A369T	ATXN7L1_ENST00000477775.1_Missense_Mutation_p.A245T|ATXN7L1_ENST00000472910.1_5'UTR	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	369	Ser-rich.									endometrium(1)|large_intestine(4)|lung(5)	10						GAATCCTGTGCCGGCCCGGAT	0.507																																					p.A369T		.											.	ATXN7L1	90	0			c.G1105A						.						97.0	90.0	92.0					7																	105278897		692	1591	2283	SO:0001583	missense	222255	exon7			CCTGTGCCGGCCC	AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.1105G>A	7.37:g.105278897C>T	ENSP00000410759:p.Ala369Thr	288.0	1.0		350.0	125.0	NM_020725	A4D0Q2|B4DTS1|Q8N2T0	Missense_Mutation	SNP	ENST00000419735.3	37	CCDS47682.1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684422	0.29872	.	.	ENSG00000146776	ENST00000419735;ENST00000477775;ENST00000472195	T;T;T	0.14640	2.5;2.49;2.49	5.38	2.54	0.30619	.	1.125900	0.06660	N	0.764276	T	0.14960	0.0361	L	0.47716	1.5	0.28395	N	0.918924	P;B;B	0.43788	0.817;0.015;0.0	B;B;B	0.41764	0.366;0.008;0.0	T	0.24368	-1.0162	10	0.32370	T	0.25	.	7.6182	0.28171	0.1256:0.6872:0.1209:0.0663	.	153;245;369	A4D0Q3;Q9ULK2-3;Q9ULK2	.;.;AT7L1_HUMAN	T	369;245;245	ENSP00000410759:A369T;ENSP00000418476:A245T;ENSP00000419566:A245T	ENSP00000410759:A369T	A	-	1	0	ATXN7L1	105066133	0.002000	0.14202	0.000000	0.03702	0.859000	0.49053	1.600000	0.36762	0.319000	0.23209	0.655000	0.94253	GCA	.		0.507	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349037.2		
B9D1	27077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19261177	19261177	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:19261177A>T	ENST00000261499.4	-	3	363	c.220T>A	c.(220-222)Ttt>Att	p.F74I	B9D1_ENST00000395615.1_Missense_Mutation_p.F74I|B9D1_ENST00000575403.1_Silent_p.P49P|B9D1_ENST00000461069.2_Missense_Mutation_p.F74I|B9D1_ENST00000395616.3_Missense_Mutation_p.F74I|B9D1_ENST00000477478.2_Silent_p.P49P|B9D1_ENST00000268841.6_Missense_Mutation_p.F74I	NM_015681.3	NP_056496.1	Q9UPM9	B9D1_HUMAN	B9 protein domain 1	74	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.				camera-type eye development (GO:0043010)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|in utero embryonic development (GO:0001701)|neuroepithelial cell differentiation (GO:0060563)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)|vasculature development (GO:0001944)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)	hedgehog receptor activity (GO:0008158)			large_intestine(3)|urinary_tract(1)	4	all_cancers(12;2.04e-05)|all_epithelial(12;0.000806)|Hepatocellular(7;0.00345)|Breast(13;0.143)					GTGCTTTTAAAGGTGACATCA	0.572																																					p.F74I		.											.	B9D1	68	0			c.T220A						.						162.0	129.0	141.0					17																	19261177		2203	4300	6503	SO:0001583	missense	27077	exon3			TTTTAAAGGTGAC	BC002944	CCDS11205.1, CCDS58528.1	17p11.2	2014-09-17			ENSG00000108641	ENSG00000108641			24123	protein-coding gene	gene with protein product	"""endothelial precursor protein B9"""	614144				21493627	Standard	NM_015681		Approved	B9, EPPB9, MKS9	uc010vyr.2	Q9UPM9	OTTHUMG00000059586	ENST00000261499.4:c.220T>A	17.37:g.19261177A>T	ENSP00000261499:p.Phe74Ile	83.0	0.0		60.0	24.0	NM_015681	Q9BU22	Missense_Mutation	SNP	ENST00000261499.4	37	CCDS11205.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.896219	0.91962	.	.	ENSG00000108641	ENST00000395615;ENST00000261499;ENST00000395616;ENST00000268841;ENST00000440841	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.86356	0.5913	M	0.91920	3.255	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	D	0.88966	0.3397	10	0.62326	D	0.03	.	13.3104	0.60376	1.0:0.0:0.0:0.0	.	74	Q9UPM9	B9D1_HUMAN	I	74;74;74;74;65	ENSP00000378977:F74I;ENSP00000261499:F74I;ENSP00000378978:F74I;ENSP00000268841:F74I;ENSP00000410835:F65I	ENSP00000261499:F74I	F	-	1	0	B9D1	19201770	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.893000	0.75649	2.019000	0.59389	0.533000	0.62120	TTT	.		0.572	B9D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132494.1	NM_015681	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	52440295	52440295	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr3:52440295G>A	ENST00000460680.1	-	9	1228	c.757C>T	c.(757-759)Cag>Tag	p.Q253*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.Q235*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q253*(2)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGTACTGTCTGACGGTTCACC	0.602			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.Q253X	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,uveal_tract,malignant_melanoma,0	BAP1	1032	2	Substitution - Nonsense(2)	eye(1)|kidney(1)	c.C757T						.						128.0	96.0	107.0					3																	52440295		2203	4300	6503	SO:0001587	stop_gained	8314	exon9			CTGTCTGACGGTT	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.757C>T	3.37:g.52440295G>A	ENSP00000417132:p.Gln253*	156.0	1.0		110.0	65.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	40	8.384367	0.98786	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-9.1034	20.3731	0.98895	0.0:0.0:1.0:0.0	.	.	.	.	X	253;235	.	ENSP00000296288:Q235X	Q	-	1	0	BAP1	52415335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.819000	0.86621	2.829000	0.97493	0.650000	0.86243	CAG	.		0.602	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
BEND5	79656	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	49242456	49242456	+	Silent	SNP	C	C	T	rs548809089	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:49242456C>T	ENST00000371833.3	-	1	134	c.48G>A	c.(46-48)ctG>ctA	p.L16L	AGBL4_ENST00000371838.1_Intron|AGBL4_ENST00000371839.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	16						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						ACGACACGGGCAGCGCGTAGC	0.716													C|||	3	0.000599042	0.0	0.0	5008	,	,		6062	0.0		0.003	False		,,,				2504	0.0				p.L16L		.											.	BEND5	91	0			c.G48A						.						6.0	9.0	8.0					1																	49242456		654	1557	2211	SO:0001819	synonymous_variant	79656	exon1			CACGGGCAGCGCG	BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.48G>A	1.37:g.49242456C>T		40.0	0.0		61.0	22.0	NM_024603	D3DQ27|Q96A62|Q9HAI3	Silent	SNP	ENST00000371833.3	37	CCDS552.2																																																																																			.		0.716	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022323.1	NM_024603	
BHLHB9	80823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	102005369	102005369	+	Silent	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:102005369C>A	ENST00000372735.1	+	4	2031	c.1446C>A	c.(1444-1446)atC>atA	p.I482I	BHLHB9_ENST00000457056.1_Silent_p.I482I|BHLHB9_ENST00000448867.1_Silent_p.I482I|BHLHB9_ENST00000361229.4_Silent_p.I482I|BHLHB9_ENST00000447531.1_Silent_p.I482I			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	482					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAGACATGATCAATATGAAGG	0.363																																					p.I482I		.											.	BHLHB9	132	0			c.C1446A						.						119.0	118.0	119.0					X																	102005369		2203	4300	6503	SO:0001819	synonymous_variant	80823	exon2			CATGATCAATATG	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.1446C>A	X.37:g.102005369C>A		452.0	1.0		566.0	231.0	NM_001142530	Q9C0G2	Silent	SNP	ENST00000372735.1	37	CCDS14502.1																																																																																			.		0.363	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639	
BHMT2	23743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78376532	78376532	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr5:78376532C>T	ENST00000255192.3	+	4	347	c.281C>T	c.(280-282)gCc>gTc	p.A94V	DMGDH_ENST00000520388.1_Intron|BHMT2_ENST00000521567.1_Intron	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	94	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	AATGCTGCTGCCTGTGACCTC	0.453																																					p.A94V		.											.	BHMT2	91	0			c.C281T						.						123.0	126.0	125.0					5																	78376532		2203	4300	6503	SO:0001583	missense	23743	exon4			CTGCTGCCTGTGA		CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.281C>T	5.37:g.78376532C>T	ENSP00000255192:p.Ala94Val	209.0	0.0		249.0	18.0	NM_017614	B7Z516|Q9NXX7	Missense_Mutation	SNP	ENST00000255192.3	37	CCDS4045.1	.	.	.	.	.	.	.	.	.	.	C	35	5.571337	0.96553	.	.	ENSG00000132840	ENST00000255192;ENST00000518666	T;T	0.52754	0.65;0.65	6.16	6.16	0.99307	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	M	0.92923	3.36	0.80722	D	1	D	0.55605	0.972	P	0.48654	0.585	T	0.76801	-0.2825	10	0.72032	D	0.01	-19.1782	20.8598	0.99761	0.0:1.0:0.0:0.0	.	94	Q9H2M3	BHMT2_HUMAN	V	94;34	ENSP00000255192:A94V;ENSP00000428640:A34V	ENSP00000255192:A94V	A	+	2	0	BHMT2	78412288	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	GCC	.		0.453	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226962.2	NM_017614	
BNIP2	663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	59972472	59972472	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr15:59972472A>G	ENST00000607373.1	-	3	288	c.86T>C	c.(85-87)aTa>aCa	p.I29T	BNIP2_ENST00000415213.2_Missense_Mutation_p.I91T|BNIP2_ENST00000267859.3_Missense_Mutation_p.I150T	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2	29					apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)			NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						TATAGCTAGTATATCTGCTTC	0.328																																					p.I150T	Ovarian(174;1936 1978 6671 8240 38212)	.											.	BNIP2	228	0			c.T449C						.						61.0	57.0	59.0					15																	59972472		2188	4290	6478	SO:0001583	missense	663	exon3			GCTAGTATATCTG	U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.86T>C	15.37:g.59972472A>G	ENSP00000475320:p.Ile29Thr	56.0	0.0		49.0	28.0	NM_004330	B4DS94	Missense_Mutation	SNP	ENST00000607373.1	37		.	.	.	.	.	.	.	.	.	.	A	9.080	0.999026	0.19121	.	.	ENSG00000140299	ENST00000267859;ENST00000415213	T;T	0.38887	1.11;1.11	5.54	-1.04	0.10068	.	0.483859	0.24991	N	0.033995	T	0.14227	0.0344	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.21008	-1.0258	9	.	.	.	-3.1838	5.3354	0.15955	0.589:0.0:0.2908:0.1202	.	29;91	Q12982;Q12982-2	BNIP2_HUMAN;.	T	150;91	ENSP00000267859:I150T;ENSP00000412767:I91T	.	I	-	2	0	BNIP2	57759764	0.008000	0.16893	0.547000	0.28179	0.893000	0.52053	1.171000	0.31896	-0.171000	0.10797	0.460000	0.39030	ATA	.		0.328	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470740.1	NM_004330	
BSN	8927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49688366	49688366	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr3:49688366A>G	ENST00000296452.4	+	4	1954	c.1840A>G	c.(1840-1842)Act>Gct	p.T614A		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	614					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCGAGTCCCCACTAAAGCTGA	0.622																																					p.T614A		.											.	BSN	97	0			c.A1840G						.						108.0	125.0	119.0					3																	49688366		2203	4300	6503	SO:0001583	missense	8927	exon4			GTCCCCACTAAAG	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.1840A>G	3.37:g.49688366A>G	ENSP00000296452:p.Thr614Ala	95.0	0.0		53.0	15.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	A	5.094	0.202992	0.09704	.	.	ENSG00000164061	ENST00000296452	T	0.16457	2.34	5.34	1.77	0.24775	.	0.781774	0.12420	N	0.470499	T	0.03348	0.0097	N	0.00436	-1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42224	-0.9464	10	0.02654	T	1	.	6.606	0.22726	0.1366:0.0:0.732:0.1315	.	614	Q9UPA5	BSN_HUMAN	A	614	ENSP00000296452:T614A	ENSP00000296452:T614A	T	+	1	0	BSN	49663370	0.003000	0.15002	0.004000	0.12327	0.522000	0.34438	0.538000	0.23160	0.055000	0.16094	-0.290000	0.09829	ACT	.		0.622	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
C14orf39	317761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	60945061	60945061	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr14:60945061G>C	ENST00000321731.3	-	5	439	c.280C>G	c.(280-282)Cag>Gag	p.Q94E		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	94					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		AATTGGTCCTGCATATAATCT	0.279																																					p.Q94E		.											.	C14orf39	94	0			c.C280G						.						76.0	75.0	76.0					14																	60945061		2201	4295	6496	SO:0001583	missense	317761	exon5			GGTCCTGCATATA	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.280C>G	14.37:g.60945061G>C	ENSP00000324920:p.Gln94Glu	311.0	0.0		252.0	63.0	NM_174978	Q08AQ4	Missense_Mutation	SNP	ENST00000321731.3	37	CCDS9746.1	.	.	.	.	.	.	.	.	.	.	G	5.630	0.300924	0.10678	.	.	ENSG00000179008	ENST00000321731;ENST00000555476	T;T	0.44083	1.84;0.93	5.56	-1.51	0.08664	.	0.607073	0.16633	N	0.205985	T	0.40719	0.1128	M	0.62723	1.935	0.20821	N	0.999844	B	0.20052	0.041	B	0.20384	0.029	T	0.41484	-0.9506	10	0.49607	T	0.09	0.432	16.3264	0.82983	0.0:0.0:0.307:0.693	.	94	Q8N1H7	S6OS1_HUMAN	E	94;65	ENSP00000324920:Q94E;ENSP00000451665:Q65E	ENSP00000324920:Q94E	Q	-	1	0	C14orf39	60014814	0.997000	0.39634	0.154000	0.22540	0.030000	0.12068	0.487000	0.22356	-0.494000	0.06669	0.650000	0.86243	CAG	.		0.279	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
ERICH3	127254	ucsc.edu;bcgsc.ca	37	1	75114955	75114955	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:75114955C>T	ENST00000326665.5	-	2	286	c.68G>A	c.(67-69)gGg>gAg	p.G23E		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		23										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GTTAAAATACCCAGCCAGGTG	0.348																																					p.G23E		.											.	C1orf173	94	0			c.G68A						.						115.0	112.0	113.0					1																	75114955		2203	4300	6503	SO:0001583	missense	127254	exon2			AAATACCCAGCCA																												ENST00000326665.5:c.68G>A	1.37:g.75114955C>T	ENSP00000322609:p.Gly23Glu	73.0	0.0		39.0	4.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962312	0.74016	.	.	ENSG00000178965	ENST00000326665	T	0.24538	1.85	5.57	5.57	0.84162	.	.	.	.	.	T	0.42268	0.1195	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.28776	-1.0033	9	0.72032	D	0.01	-26.4787	18.3037	0.90172	0.0:1.0:0.0:0.0	.	23	Q5RHP9	CA173_HUMAN	E	23	ENSP00000322609:G23E	ENSP00000322609:G23E	G	-	2	0	C1orf173	74887543	1.000000	0.71417	0.998000	0.56505	0.785000	0.44390	3.960000	0.56752	2.622000	0.88805	0.591000	0.81541	GGG	.		0.348	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
C1S	716	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	7169973	7169973	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:7169973A>C	ENST00000406697.1	+	6	828	c.200A>C	c.(199-201)tAt>tCt	p.Y67S	C1S_ENST00000402681.3_Intron|C1S_ENST00000328916.3_Missense_Mutation_p.Y67S|C1S_ENST00000360817.5_Missense_Mutation_p.Y67S			P09871	C1S_HUMAN	complement component 1, s subcomponent	67	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	AACTGTGCGTATGACTCAGTG	0.463																																					p.Y67S	GBM(156;750 1943 12971 24779 31015)	.											.	C1S	91	0			c.A200C						.						128.0	116.0	120.0					12																	7169973		2203	4300	6503	SO:0001583	missense	716	exon3			GTGCGTATGACTC		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.200A>C	12.37:g.7169973A>C	ENSP00000385035:p.Tyr67Ser	92.0	1.0		97.0	23.0	NM_201442	D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Missense_Mutation	SNP	ENST00000406697.1	37	CCDS31735.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323902	0.81580	.	.	ENSG00000182326	ENST00000406697;ENST00000328916;ENST00000360817;ENST00000382222;ENST00000423384;ENST00000413211;ENST00000403949	T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1	5.77	5.77	0.91146	CUB (5);	0.000000	0.38548	N	0.001648	T	0.50360	0.1611	M	0.83384	2.64	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.52646	-0.8548	10	0.45353	T	0.12	.	16.1024	0.81184	1.0:0.0:0.0:0.0	.	67	P09871	C1S_HUMAN	S	67;67;67;49;67;67;67	ENSP00000385035:Y67S;ENSP00000328173:Y67S;ENSP00000354057:Y67S;ENSP00000399892:Y67S;ENSP00000406643:Y67S;ENSP00000384464:Y67S	ENSP00000328173:Y67S	Y	+	2	0	C1S	7040234	1.000000	0.71417	0.988000	0.46212	0.813000	0.45954	7.903000	0.87398	2.200000	0.70718	0.459000	0.35465	TAT	.		0.463	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	NM_001734	
C22orf34	348645	bcgsc.ca;mdanderson.org	37	22	50017062	50017062	+	Silent	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr22:50017062G>A	ENST00000444628.1	-	5	1903	c.832C>T	c.(832-834)Cta>Tta	p.L278L	C22orf34_ENST00000405854.1_Intron|C22orf34_ENST00000400023.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	0										pancreas(1)	1						CGGCTGCATAGGATGCAAGCT	0.662																																					.		.											.	.	.	0			.						.																																			SO:0001819	synonymous_variant	348645	.			TGCATAGGATGCA	BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.832C>T	22.37:g.50017062G>A		76.0	2.0		90.0	16.0	.	Q147Y0|Q5R3D1|Q6ZTN8	RNA	SNP	ENST00000444628.1	37																																																																																				.		0.662	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_026997	
CACNA1C	775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	2788717	2788717	+	Silent	SNP	G	G	A	rs200638007	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:2788717G>A	ENST00000347598.4	+	44	5343	c.5343G>A	c.(5341-5343)gcG>gcA	p.A1781A	CACNA1C_ENST00000399655.1_Silent_p.A1733A|CACNA1C_ENST00000335762.5_Silent_p.A1758A|CACNA1C_ENST00000402845.3_Silent_p.A1752A|CACNA1C_ENST00000399629.1_Silent_p.A1750A|CACNA1C_ENST00000399597.1_Silent_p.A1733A|CACNA1C_ENST00000399638.1_Silent_p.A1761A|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399591.1_Silent_p.A1741A|CACNA1C_ENST00000399595.1_Silent_p.A1741A|CACNA1C_ENST00000344100.3_Silent_p.A1774A|CACNA1C_ENST00000399649.1_Silent_p.A1739A|CACNA1C_ENST00000406454.3_Silent_p.A1733A|CACNA1C_ENST00000399603.1_Silent_p.A1733A|CACNA1C_ENST00000399621.1_Silent_p.A1752A|CACNA1C_ENST00000327702.7_Silent_p.A1733A|CACNA1C_ENST00000399634.1_Silent_p.A1733A|CACNA1C_ENST00000399637.1_Silent_p.A1752A|CACNA1C_ENST00000399644.1_Silent_p.A1733A|CACNA1C_ENST00000399601.1_Silent_p.A1733A|CACNA1C_ENST00000399617.1_Silent_p.A1733A|CACNA1C_ENST00000399641.1_Silent_p.A1733A|CACNA1C_ENST00000399606.1_Silent_p.A1753A	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1781					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A1268A(1)|p.A1811A(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TCAACAAGGCGGGCAGCAGCC	0.647													G|||	5	0.000998403	0.0038	0.0	5008	,	,		16413	0.0		0.0	False		,,,				2504	0.0				p.A1781A		.											Q6YL47_HUMAN,NS,carcinoma,0	CACNA1C	34	2	Substitution - coding silent(2)	ovary(2)	c.G5343A						.	G	,,,,,,,,,,,,,,,,,,,,,,	5,4249		0,5,2122	45.0	57.0	53.0		5199,5343,5322,5199,5283,5259,5256,5256,5256,5250,5223,5223,5217,5199,5199,5199,5199,5190,5166,5199,5199,5166,5343	-3.4	0.1	12		53	1,8451		0,1,4225	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CACNA1C	NM_000719.6,NM_001129827.1,NM_001129829.1,NM_001129830.1,NM_001129831.1,NM_001129832.1,NM_001129833.1,NM_001129834.1,NM_001129835.1,NM_001129836.1,NM_001129837.1,NM_001129838.1,NM_001129839.1,NM_001129840.1,NM_001129841.1,NM_001129842.1,NM_001129843.1,NM_001129844.1,NM_001129846.1,NM_001167623.1,NM_001167624.1,NM_001167625.1,NM_199460.2	,,,,,,,,,,,,,,,,,,,,,,	0,6,6347	AA,AG,GG		0.0118,0.1175,0.0472	,,,,,,,,,,,,,,,,,,,,,,	1733/2139,1781/2187,1774/2180,1733/2174,1761/2167,1753/2159,1752/2158,1752/2158,1752/2158,1750/2156,1741/2147,1741/2147,1739/2145,1733/2139,1733/2139,1733/2139,1733/2139,1730/2136,1722/2128,1733/2139,1733/2174,1722/2199,1781/2222	2788717	6,12700	2127	4226	6353	SO:0001819	synonymous_variant	775	exon44			CAAGGCGGGCAGC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5343G>A	12.37:g.2788717G>A		51.0	0.0		74.0	19.0	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	ENST00000347598.4	37	CCDS44788.1																																																																																			G|0.999;A|0.001		0.647	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
CAMTA1	23261	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	7724363	7724363	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:7724363T>G	ENST00000303635.7	+	9	1963	c.1756T>G	c.(1756-1758)Ttc>Gtc	p.F586V	CAMTA1_ENST00000439411.2_Missense_Mutation_p.F586V	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	586					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GCAGATGGACTTCAGCGCCAT	0.682			T	WWTR1	epitheliod hemangioendothelioma																																p.F586V		.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	520	0			c.T1756G						.						41.0	47.0	45.0					1																	7724363		2203	4300	6503	SO:0001583	missense	23261	exon9			ATGGACTTCAGCG	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1756T>G	1.37:g.7724363T>G	ENSP00000306522:p.Phe586Val	69.0	0.0		53.0	19.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	t	19.16	3.774626	0.70107	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.29655	1.56;1.56	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.50531	0.1621	L	0.53249	1.67	0.58432	D	0.999999	D	0.63880	0.993	D	0.70227	0.968	T	0.52011	-0.8632	10	0.66056	D	0.02	-20.8085	15.2091	0.73206	0.0:0.0:0.0:1.0	.	586	Q9Y6Y1	CMTA1_HUMAN	V	586	ENSP00000306522:F586V;ENSP00000402561:F586V	ENSP00000306522:F586V	F	+	1	0	CAMTA1	7646950	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.195000	0.72088	2.012000	0.59069	0.404000	0.27445	TTC	.		0.682	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
DRC7	84229	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57734093	57734093	+	Missense_Mutation	SNP	C	C	A	rs376601948		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr16:57734093C>A	ENST00000360716.3	+	5	636	c.415C>A	c.(415-417)Ccc>Acc	p.P139T	RP11-405F3.4_ENST00000563062.1_RNA|CCDC135_ENST00000394337.4_Missense_Mutation_p.P139T|CCDC135_ENST00000336825.8_Missense_Mutation_p.P139T			Q8IY82	CC135_HUMAN		139					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						CACACTGATGCCCTACCCCGA	0.577																																					p.P139T		.											.	CCDC135	90	0			c.C415A						.						150.0	139.0	143.0					16																	57734093		2198	4300	6498	SO:0001583	missense	84229	exon4			CTGATGCCCTACC																												ENST00000360716.3:c.415C>A	16.37:g.57734093C>A	ENSP00000353942:p.Pro139Thr	119.0	0.0		104.0	17.0	NM_032269	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	ENST00000360716.3	37	CCDS10787.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725091	0.68959	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	D;D;D	0.81908	-1.55;-1.55;-1.55	5.39	4.44	0.53790	.	0.386968	0.29715	N	0.011392	D	0.90923	0.7147	M	0.85041	2.73	0.37232	D	0.905732	D;D	0.76494	0.999;0.999	D;D	0.71656	0.974;0.931	D	0.93255	0.6638	10	0.66056	D	0.02	-27.6046	12.9337	0.58301	0.0:0.9222:0.0:0.0778	.	139;139	Q8IY82-2;Q8IY82	.;CC135_HUMAN	T	139	ENSP00000377869:P139T;ENSP00000338938:P139T;ENSP00000353942:P139T	ENSP00000338938:P139T	P	+	1	0	CCDC135	56291594	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.861000	0.39438	1.275000	0.44379	0.453000	0.30009	CCC	.		0.577	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433323.2		
CD163L1	283316	hgsc.bcm.edu;bcgsc.ca	37	12	7556293	7556293	+	Missense_Mutation	SNP	C	C	T	rs151328196	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:7556293C>T	ENST00000313599.3	-	6	1303	c.1246G>A	c.(1246-1248)Gtc>Atc	p.V416I	CD163L1_ENST00000416109.2_Missense_Mutation_p.V426I|CD163L1_ENST00000396630.1_Missense_Mutation_p.V416I			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	416	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CTGCCAAAGACGCTGAACGGA	0.463																																					p.V416I		.											.	CD163L1	100	0			c.G1246A						.	C	ILE/VAL	0,4406		0,0,2203	185.0	170.0	175.0		1246	-3.9	0.0	12	dbSNP_134	175	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CD163L1	NM_174941.4	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	416/1454	7556293	2,13004	2203	4300	6503	SO:0001583	missense	283316	exon6			CAAAGACGCTGAA	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1246G>A	12.37:g.7556293C>T	ENSP00000315945:p.Val416Ile	156.0	0.0		131.0	9.0	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	37	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	C	3.433	-0.115637	0.06881	0.0	2.33E-4	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630;ENST00000545926	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	2.22	-3.92	0.04155	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.09862	0.0242	N	0.08118	0	0.09310	N	1	B;B	0.23058	0.079;0.079	B;B	0.18871	0.023;0.023	T	0.31223	-0.9951	9	0.05721	T	0.95	.	4.435	0.11547	0.0:0.2712:0.1845:0.5442	.	426;416	E7EVK4;Q9NR16	.;C163B_HUMAN	I	416;426;416;62	ENSP00000315945:V416I;ENSP00000393474:V426I;ENSP00000379871:V416I;ENSP00000439921:V62I	ENSP00000315945:V416I	V	-	1	0	CD163L1	7447560	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.753000	0.00791	-1.236000	0.02542	0.563000	0.77884	GTC	C|0.999;T|0.001		0.463	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
CD1D	912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158151319	158151319	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:158151319G>A	ENST00000368171.3	+	3	635	c.136G>A	c.(136-138)Ggc>Agc	p.G46S		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	46					antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					GCGCACCGACGGCTTGGCGTG	0.637																																					p.G46S		.											.	CD1D	92	0			c.G136A						.						114.0	127.0	123.0					1																	158151319		2203	4300	6503	SO:0001583	missense	912	exon3			ACCGACGGCTTGG	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.136G>A	1.37:g.158151319G>A	ENSP00000357153:p.Gly46Ser	66.0	0.0		104.0	17.0	NM_001766	D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	ENST00000368171.3	37	CCDS1173.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257100	0.59321	.	.	ENSG00000158473	ENST00000368171	T	0.14640	2.49	4.44	-1.63	0.08345	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.991118	0.08194	N	0.983361	T	0.03783	0.0107	L	0.41710	1.295	0.09310	N	1	P	0.49559	0.925	B	0.42282	0.382	T	0.37502	-0.9703	10	0.31617	T	0.26	-0.5456	7.4421	0.27190	0.0938:0.0:0.2371:0.6691	.	46	P15813	CD1D_HUMAN	S	46	ENSP00000357153:G46S	ENSP00000357153:G46S	G	+	1	0	CD1D	156417943	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.232000	0.17891	-0.412000	0.07519	0.655000	0.94253	GGC	.		0.637	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766	
CD47	961	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	107799113	107799113	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr3:107799113A>C	ENST00000361309.5	-	2	230	c.125T>G	c.(124-126)tTt>tGt	p.F42C	CD47_ENST00000355354.7_Missense_Mutation_p.F42C	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule	42	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			ATTAGTAACAAAGCATGGAAT	0.343																																					p.F42C		.											.	CD47	91	0			c.T125G						.						132.0	115.0	120.0					3																	107799113		1848	4085	5933	SO:0001583	missense	961	exon2			GTAACAAAGCATG		CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000361309.5:c.125T>G	3.37:g.107799113A>C	ENSP00000355361:p.Phe42Cys	181.0	0.0		152.0	40.0	NM_198793	A8K198|D3DN59|Q53Y71|Q96A60	Missense_Mutation	SNP	ENST00000361309.5	37	CCDS43126.1	.	.	.	.	.	.	.	.	.	.	A	8.461	0.855309	0.17106	.	.	ENSG00000196776	ENST00000355354;ENST00000361309	T;T	0.02656	4.21;4.21	6.04	0.876	0.19138	Immunoglobulin-like (1);CD47 immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.480890	0.03663	N	0.242905	T	0.03348	0.0097	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.21225	0.043;0.043;0.053;0.053	B;B;B;B	0.13407	0.005;0.005;0.009;0.009	T	0.45411	-0.9263	10	0.46703	T	0.11	.	1.852	0.03171	0.3905:0.2733:0.0731:0.2631	.	42;42;42;42	Q08722-2;Q08722-3;E9PB22;Q08722	.;.;.;CD47_HUMAN	C	42	ENSP00000347512:F42C;ENSP00000355361:F42C	ENSP00000347512:F42C	F	-	2	0	CD47	109281803	0.000000	0.05858	0.002000	0.10522	0.021000	0.10359	0.641000	0.24720	0.129000	0.18514	-0.488000	0.04728	TTT	.		0.343	CD47-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000102793.1	NM_001777	
CDC45	8318	broad.mit.edu;bcgsc.ca	37	22	19471437	19471437	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr22:19471437A>G	ENST00000407835.1	+	6	651	c.395A>G	c.(394-396)gAc>gGc	p.D132G	CDC45_ENST00000483431.1_3'UTR|CDC45_ENST00000263201.1_Missense_Mutation_p.D132G|CDC45_ENST00000437685.2_Missense_Mutation_p.D132G|CDC45_ENST00000404724.3_Missense_Mutation_p.D86G			O75419	CDC45_HUMAN	cell division cycle 45	132					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						GCCTATGAAGACATCTTCAGG	0.423																																					p.D132G		.											.	CDC45	227	0			c.A395G						.						111.0	101.0	105.0					22																	19471437		2203	4300	6503	SO:0001583	missense	8318	exon5			ATGAAGACATCTT	AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.395A>G	22.37:g.19471437A>G	ENSP00000385240:p.Asp132Gly	105.0	0.0		126.0	7.0	NM_003504	B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Missense_Mutation	SNP	ENST00000407835.1	37	CCDS13762.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.820313	0.90873	.	.	ENSG00000093009	ENST00000407835;ENST00000438587;ENST00000437685;ENST00000263201;ENST00000404724	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.97	5.78	5.78	0.91487	.	0.226762	0.45867	D	0.000334	T	0.48572	0.1507	M	0.86178	2.8	0.80722	D	1	P;P;P;P;B	0.39131	0.656;0.661;0.571;0.656;0.428	P;P;B;P;B	0.49140	0.532;0.601;0.312;0.532;0.409	T	0.52808	-0.8526	10	0.62326	D	0.03	-19.3563	16.1167	0.81309	1.0:0.0:0.0:0.0	.	132;127;86;132;132	E9PDH7;B4E092;B4DDB4;B4DDU3;O75419	.;.;.;.;CDC45_HUMAN	G	132;120;132;132;86	ENSP00000385240:D132G;ENSP00000397434:D120G;ENSP00000405726:D132G;ENSP00000263201:D132G;ENSP00000384978:D86G	ENSP00000263201:D132G	D	+	2	0	CDC45	17851437	1.000000	0.71417	0.985000	0.45067	0.890000	0.51754	8.909000	0.92647	2.204000	0.70986	0.528000	0.53228	GAC	.		0.423	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	NM_003504	
CDH26	60437	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	58564047	58564047	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr20:58564047T>A	ENST00000244047.5	+	9	1423	c.1112T>A	c.(1111-1113)cTt>cAt	p.L371H	CDH26_ENST00000348616.4_Missense_Mutation_p.L371H			Q8IXH8	CAD26_HUMAN	cadherin 26	371	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			AGAGGAAAGCTTCAGCCGCCA	0.567																																					p.L371H		.											.	CDH26	93	0			c.T1112A						.						65.0	74.0	71.0					20																	58564047		2203	4300	6503	SO:0001583	missense	60437	exon9			GAAAGCTTCAGCC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1112T>A	20.37:g.58564047T>A	ENSP00000244047:p.Leu371His	72.0	0.0		108.0	17.0	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	T	15.00	2.703421	0.48412	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.52057	0.68;0.68	5.02	1.48	0.22813	.	0.454465	0.21490	N	0.073687	T	0.54481	0.1861	M	0.65975	2.015	0.09310	N	1	D	0.60575	0.988	P	0.61328	0.887	T	0.48258	-0.9051	10	0.14656	T	0.56	.	7.5032	0.27530	0.0:0.2565:0.0:0.7435	.	371	Q8IXH8-4	.	H	371	ENSP00000244047:L371H;ENSP00000339390:L371H	ENSP00000244047:L371H	L	+	2	0	CDH26	57997442	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.133000	0.10451	0.044000	0.15775	0.533000	0.62120	CTT	.		0.567	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
CEACAM16	388551	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45206800	45206800	+	Silent	SNP	C	C	A	rs534225927	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:45206800C>A	ENST00000405314.2	+	2	316	c.219C>A	c.(217-219)ggC>ggA	p.G73G	CEACAM16_ENST00000587331.1_Silent_p.G73G|CTB-171A8.1_ENST00000590796.1_RNA			Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16	73					sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)				endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				TGAGCACAGGCGATGAGACTC	0.667																																					p.G73G		.											.	CEACAM16	23	0			c.C219A						.						25.0	28.0	27.0					19																	45206800		2069	4191	6260	SO:0001819	synonymous_variant	388551	exon3			CACAGGCGATGAG		CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000405314.2:c.219C>A	19.37:g.45206800C>A		98.0	1.0		142.0	20.0	NM_001039213	A7LI12	Silent	SNP	ENST00000405314.2	37	CCDS54278.1																																																																																			.		0.667	CEACAM16-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		XM_371177	
CHCHD6	84303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126445955	126445955	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr3:126445955C>T	ENST00000290913.3	+	2	215	c.122C>T	c.(121-123)cCc>cTc	p.P41L	CHCHD6_ENST00000508789.1_Missense_Mutation_p.P41L	NM_032343.2	NP_115719.1	Q9BRQ6	MIC25_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 6	41					cellular response to DNA damage stimulus (GO:0006974)|cristae formation (GO:0042407)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(3)|lung(3)	8						ATGAAGGAGCCCAGCTCTCCA	0.507																																					p.P41L		.											.	CHCHD6	90	0			c.C122T						.						132.0	128.0	130.0					3																	126445955		2203	4300	6503	SO:0001583	missense	84303	exon2			AGGAGCCCAGCTC	BC006123	CCDS3041.1	3q21.3	2012-04-17			ENSG00000159685	ENSG00000159685		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28184	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 23"", ""coiled-coil-helix cristae morphology 1"""	615634				17624330, 22228767	Standard	NM_032343		Approved	MGC13016, PPP1R23, CHCM1	uc003ejf.2	Q9BRQ6	OTTHUMG00000159601	ENST00000290913.3:c.122C>T	3.37:g.126445955C>T	ENSP00000290913:p.Pro41Leu	222.0	0.0		205.0	51.0	NM_032343	D6R9U0|D6RIB4|H8Y0Y7	Missense_Mutation	SNP	ENST00000290913.3	37	CCDS3041.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869381	0.32977	.	.	ENSG00000159685	ENST00000290913;ENST00000508789	T;T	0.50001	0.76;0.76	4.25	3.35	0.38373	.	0.425221	0.25639	N	0.029295	T	0.42765	0.1217	M	0.64404	1.975	0.09310	N	1	P;B	0.38677	0.642;0.376	B;B	0.38106	0.265;0.173	T	0.25152	-1.0140	10	0.30854	T	0.27	-1.019	9.5581	0.39351	0.0:0.7739:0.2261:0.0	.	41;41	D6R9U0;Q9BRQ6	.;CHCH6_HUMAN	L	41	ENSP00000290913:P41L;ENSP00000422912:P41L	ENSP00000290913:P41L	P	+	2	0	CHCHD6	127928645	0.007000	0.16637	0.014000	0.15608	0.047000	0.14425	1.825000	0.39081	0.950000	0.37743	0.591000	0.81541	CCC	.		0.507	CHCHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356432.1	NM_032343	
CPD	1362	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	28772898	28772898	+	Silent	SNP	G	G	T	rs187666987	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:28772898G>T	ENST00000225719.4	+	12	2809	c.2733G>T	c.(2731-2733)gcG>gcT	p.A911A	CPD_ENST00000543464.2_Silent_p.A664A	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	911	Carboxypeptidase-like 3.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						ACCTTTCAGCGGAGAATGGTT	0.418																																					p.A911A		.											.	CPD	92	0			c.G2733T						.						84.0	85.0	84.0					17																	28772898		2203	4300	6503	SO:0001819	synonymous_variant	1362	exon12			TTCAGCGGAGAAT	U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.2733G>T	17.37:g.28772898G>T		247.0	1.0		166.0	52.0	NM_001304	B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Silent	SNP	ENST00000225719.4	37	CCDS11257.1																																																																																			G|0.999;A|0.000		0.418	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256214.3	NM_001304	
CSMD1	64478	ucsc.edu;bcgsc.ca	37	8	2836265	2836265	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr8:2836265T>C	ENST00000520002.1	-	56	8993	c.8438A>G	c.(8437-8439)aAc>aGc	p.N2813S	CSMD1_ENST00000602723.1_Missense_Mutation_p.N2755S|CSMD1_ENST00000400186.3_Missense_Mutation_p.N2755S|CSMD1_ENST00000542608.1_Missense_Mutation_p.N2754S|CSMD1_ENST00000602557.1_Missense_Mutation_p.N2813S|CSMD1_ENST00000537824.1_Missense_Mutation_p.N2812S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2813	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTCAGGGAAGTTCTGTTGCCC	0.428																																					p.N2812S		.											.	CSMD1	86	0			c.A8435G						.						79.0	73.0	75.0					8																	2836265		1874	4113	5987	SO:0001583	missense	64478	exon55			GGGAAGTTCTGTT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8438A>G	8.37:g.2836265T>C	ENSP00000430733:p.Asn2813Ser	91.0	0.0		39.0	4.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	T	0.057	-1.234167	0.01505	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.08	-2.06	0.07298	Complement control module (2);Sushi/SCR/CCP (3);	0.200463	0.43579	D	0.000543	T	0.18173	0.0436	N	0.00538	-1.39	0.32945	D	0.518945	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.15052	0.001;0.002;0.012	T	0.39921	-0.9590	10	0.02654	T	1	.	5.9323	0.19146	0.0:0.3201:0.1303:0.5496	.	2813;2813;2754	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	S	2755;2813;2674;2812;2754	ENSP00000383047:N2755S;ENSP00000430733:N2813S;ENSP00000441462:N2812S;ENSP00000446243:N2754S	ENSP00000320445:N2674S	N	-	2	0	CSMD1	2823672	0.716000	0.27956	0.001000	0.08648	0.334000	0.28698	0.327000	0.19663	-0.669000	0.05289	-0.461000	0.05368	AAC	.		0.428	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CSTF2	1478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100078295	100078295	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:100078295G>T	ENST00000372972.2	+	4	338	c.322G>T	c.(322-324)Gcc>Tcc	p.A108S	CSTF2_ENST00000415585.2_Missense_Mutation_p.A108S|SNORA9_ENST00000365361.1_RNA	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	108	Interactions with CSTF3 and SYMPK.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						TGGCACTGGTGCCCCTGTCAT	0.458																																					p.A108S		.											.	CSTF2	131	0			c.G322T						.						112.0	92.0	99.0					X																	100078295		2203	4300	6503	SO:0001583	missense	1478	exon4			ACTGGTGCCCCTG	BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.322G>T	X.37:g.100078295G>T	ENSP00000362063:p.Ala108Ser	123.0	0.0		163.0	25.0	NM_001325	Q5H951|Q6LA74|Q8N502	Missense_Mutation	SNP	ENST00000372972.2	37	CCDS14473.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.927118	0.52759	.	.	ENSG00000101811	ENST00000415585;ENST00000372972;ENST00000458320;ENST00000413437	T;T;T	0.16597	2.53;2.54;2.33	5.44	5.44	0.79542	.	0.094221	0.64402	D	0.000001	T	0.17152	0.0412	N	0.21282	0.65	0.58432	D	0.999998	B;B;B	0.17465	0.006;0.022;0.006	B;B;B	0.32022	0.027;0.139;0.027	T	0.07868	-1.0750	10	0.33141	T	0.24	-8.8036	18.4238	0.90602	0.0:0.0:1.0:0.0	.	108;108;108	E7EWR4;P33240-2;P33240	.;.;CSTF2_HUMAN	S	108;108;108;99	ENSP00000387996:A108S;ENSP00000362063:A108S;ENSP00000415705:A99S	ENSP00000362063:A108S	A	+	1	0	CSTF2	99964951	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.015000	0.70791	2.292000	0.77174	0.544000	0.68410	GCC	.		0.458	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058926.1	NM_001325	
DLGAP5	9787	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	55618447	55618447	+	Silent	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr14:55618447G>T	ENST00000247191.2	-	17	2550	c.2334C>A	c.(2332-2334)atC>atA	p.I778I	DLGAP5_ENST00000395425.2_Silent_p.I778I	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	778					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						CTTCTTCTAAGATGCTATTTT	0.313																																					p.I778I		.											.	DLGAP5	92	0			c.C2334A						.						66.0	67.0	66.0					14																	55618447		2201	4298	6499	SO:0001819	synonymous_variant	9787	exon17			TTCTAAGATGCTA	D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.2334C>A	14.37:g.55618447G>T		218.0	1.0		166.0	53.0	NM_014750	A8MTM6|B4DRM8|Q86T11|Q8NG58	Silent	SNP	ENST00000247191.2	37	CCDS9723.1																																																																																			.		0.313	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276908.2	NM_014750	
DMBT1	1755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	124329720	124329720	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr10:124329720C>T	ENST00000338354.3	+	3	240	c.134C>T	c.(133-135)gCa>gTa	p.A45V	DMBT1_ENST00000368956.2_Missense_Mutation_p.A45V|DMBT1_ENST00000368955.3_Missense_Mutation_p.A45V|DMBT1_ENST00000359586.6_Missense_Mutation_p.A45V|DMBT1_ENST00000344338.3_Missense_Mutation_p.A45V|DMBT1_ENST00000330163.4_Missense_Mutation_p.A45V|DMBT1_ENST00000368909.3_Missense_Mutation_p.A45V			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	45					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CCAACTGTAGCAGAAGGTAAG	0.532																																					p.A45V	Ovarian(182;93 2026 18125 22222 38972)	.											.	DMBT1	494	0			c.C134T						.						118.0	118.0	118.0					10																	124329720		1873	4107	5980	SO:0001583	missense	1755	exon3			CTGTAGCAGAAGG		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.134C>T	10.37:g.124329720C>T	ENSP00000342210:p.Ala45Val	173.0	0.0		175.0	47.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	C	7.673	0.687306	0.14973	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.25912	1.85;1.83;1.77;1.85;1.83;1.77;1.8	1.52	-2.51	0.06365	.	.	.	.	.	T	0.17916	0.0430	N	0.14661	0.345	0.09310	N	1	P;P;B;D;P	0.58620	0.73;0.813;0.0;0.983;0.801	B;B;B;P;B	0.56042	0.194;0.219;0.0;0.79;0.36	T	0.09596	-1.0667	9	0.23891	T	0.37	.	2.0989	0.03675	0.2501:0.3872:0.0:0.3628	.	45;45;45;45;45	F8WEF7;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	V	45	ENSP00000342210:A45V;ENSP00000343175:A45V;ENSP00000327747:A45V;ENSP00000357905:A45V;ENSP00000357951:A45V;ENSP00000357952:A45V;ENSP00000352593:A45V	ENSP00000331522:A45V	A	+	2	0	DMBT1	124319710	0.001000	0.12720	0.005000	0.12908	0.004000	0.04260	-1.454000	0.02381	-0.671000	0.05274	-1.206000	0.01644	GCA	.		0.532	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
DNASE2	1777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12987092	12987092	+	Silent	SNP	A	A	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:12987092A>C	ENST00000222219.3	-	6	887	c.795T>G	c.(793-795)tcT>tcG	p.S265S	DNASE2_ENST00000538460.1_Silent_p.S210S	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	265					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						CCGAGCAGTTAGAGGGCAGGA	0.552																																					p.S265S		.											.	DNASE2	90	0			c.T795G						.						68.0	63.0	65.0					19																	12987092		2203	4300	6503	SO:0001819	synonymous_variant	1777	exon6			GCAGTTAGAGGGC	AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.795T>G	19.37:g.12987092A>C		121.0	0.0		135.0	21.0	NM_001375	B2RD06|B7Z4K6|O43910	Silent	SNP	ENST00000222219.3	37	CCDS12284.1																																																																																			.		0.552	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451790.1		
DNASE2	1777	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	12991796	12991796	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:12991796T>C	ENST00000222219.3	-	2	349	c.257A>G	c.(256-258)aAc>aGc	p.N86S	CTD-2265O21.7_ENST00000592400.1_RNA|DNASE2_ENST00000538460.1_Missense_Mutation_p.N86S	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	86					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						CTGGCTGGTGTTGCTCCGGTA	0.672																																					p.N86S		.											.	DNASE2	90	0			c.A257G						.						35.0	36.0	35.0					19																	12991796		2203	4300	6503	SO:0001583	missense	1777	exon2			CTGGTGTTGCTCC	AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.257A>G	19.37:g.12991796T>C	ENSP00000222219:p.Asn86Ser	91.0	0.0		82.0	16.0	NM_001375	B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	ENST00000222219.3	37	CCDS12284.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.148669	0.57151	.	.	ENSG00000105612	ENST00000222219;ENST00000538460	T;T	0.14516	2.5;2.5	5.37	3.27	0.37495	.	0.233910	0.43747	D	0.000532	T	0.22003	0.0530	M	0.65320	2	0.09310	N	1	D;B	0.61697	0.99;0.274	P;B	0.60173	0.87;0.18	T	0.11494	-1.0585	10	0.36615	T	0.2	.	1.9604	0.03385	0.164:0.0879:0.1712:0.577	.	86;86	B7Z4K6;O00115	.;DNS2A_HUMAN	S	86	ENSP00000222219:N86S;ENSP00000445988:N86S	ENSP00000222219:N86S	N	-	2	0	DNASE2	12852796	0.649000	0.27322	0.054000	0.19295	0.102000	0.19082	3.575000	0.53870	0.866000	0.35629	0.459000	0.35465	AAC	.		0.672	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451790.1		
DOCK11	139818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	117788710	117788710	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:117788710C>T	ENST00000276202.7	+	43	4904	c.4841C>T	c.(4840-4842)aCc>aTc	p.T1614I	DOCK11_ENST00000276204.6_Missense_Mutation_p.T1614I	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1614	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TATGCAAGCACCCCAGAGCTC	0.433																																					p.T1614I		.											.	DOCK11	93	0			c.C4841T						.						98.0	90.0	92.0					X																	117788710		2203	4300	6503	SO:0001583	missense	139818	exon43			CAAGCACCCCAGA	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.4841C>T	X.37:g.117788710C>T	ENSP00000276202:p.Thr1614Ile	240.0	0.0		267.0	99.0	NM_144658	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308485	0.81247	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.18960	2.18;2.18	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	M	0.84433	2.695	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.87578	0.998;0.99	T	0.62267	-0.6890	10	0.87932	D	0	-15.9869	17.5152	0.87771	0.0:1.0:0.0:0.0	.	1614;1614	A6NIW2;Q5JSL3	.;DOC11_HUMAN	I	1614	ENSP00000276204:T1614I;ENSP00000276202:T1614I	ENSP00000276202:T1614I	T	+	2	0	DOCK11	117672738	1.000000	0.71417	0.977000	0.42913	0.982000	0.71751	7.480000	0.81109	2.062000	0.61559	0.600000	0.82982	ACC	.		0.433	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
DST	667	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	56417839	56417846	+	Frame_Shift_Del	DEL	TCAGTGAC	TCAGTGAC	-			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	TCAGTGAC	TCAGTGAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:56417839_56417846delTCAGTGAC	ENST00000361203.3	-	57	15118_15125	c.15111_15118delGTCACTGA	c.(15109-15120)aagtcactgatcfs	p.KSLI5037fs	DST_ENST00000370754.5_Frame_Shift_Del_p.KSLI5217fs|DST_ENST00000370769.4_Frame_Shift_Del_p.KSLI5039fs|DST_ENST00000421834.2_Frame_Shift_Del_p.KSLI2951fs|DST_ENST00000446842.2_Frame_Shift_Del_p.KSLI4713fs|DST_ENST00000370788.2_Frame_Shift_Del_p.KSLI2951fs|DST_ENST00000244364.6_Frame_Shift_Del_p.KSLI2625fs|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	5037					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACCTTCTGGATCAGTGACTTATTCTCAT	0.385																																					p.2625_2628del		.											.	DST	523	0			c.7875_7882del						.																																			SO:0001589	frameshift_variant	667	exon42			TCTGGATCAGTGA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.15111_15118delGTCACTGA	6.37:g.56417839_56417846delTCAGTGAC	ENSP00000354508:p.Lys5037fs	102.0	0.0		129.0	11.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Frame_Shift_Del	DEL	ENST00000361203.3	37																																																																																				.		0.385	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DUSP6	1848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	89743032	89743032	+	Nonstop_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:89743032C>A	ENST00000279488.7	-	3	2376	c.1145G>T	c.(1144-1146)tGa>tTa	p.*382L	DUSP6_ENST00000547291.1_Nonstop_Mutation_p.*257L|DUSP6_ENST00000308385.6_Nonstop_Mutation_p.*236L|DUSP6_ENST00000547140.1_5'Flank	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	0					cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						TGGGGTCTTTCACGTAGATTG	0.542																																					p.X382L	Colon(132;3456 5224)	.											.	DUSP6	846	0			c.G1145T						.						115.0	114.0	114.0					12																	89743032		2203	4300	6503	SO:0001578	stop_lost	1848	exon3			GTCTTTCACGTAG	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.1145G>T	12.37:g.89743032C>A		83.0	0.0		80.0	20.0	NM_001946	O75109|Q53Y75|Q9BSH6	Missense_Mutation	SNP	ENST00000279488.7	37	CCDS9033.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.720300	0.68959	.	.	ENSG00000139318	ENST00000279488;ENST00000308385;ENST00000547291	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	.	.	.	L	382;236;257	.	.	X	-	2	2	DUSP6	88267163	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.745000	0.85046	2.835000	0.97688	0.650000	0.86243	TGA	.		0.542	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
EFHC2	80258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	44091923	44091923	+	Splice_Site	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:44091923C>T	ENST00000420999.1	-	10	1507	c.1424G>A	c.(1423-1425)gGa>gAa	p.G475E		NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	475	DM10 3. {ECO:0000255|PROSITE- ProRule:PRU00665}.						calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						ACCAGCAATTCCTATAAAAAA	0.388																																					p.G475E		.											.	EFHC2	135	0			c.G1424A						.						25.0	21.0	22.0					X																	44091923		1829	4061	5890	SO:0001630	splice_region_variant	80258	exon10			GCAATTCCTATAA	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.1424-1G>A	X.37:g.44091923C>T		98.0	0.0		154.0	66.0	NM_025184	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	ENST00000420999.1	37	CCDS55405.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970907	0.74246	.	.	ENSG00000183690	ENST00000333807;ENST00000420999	D;D	0.94457	-3.43;-3.43	5.85	4.98	0.66077	Uncharacterised domain DM10 (2);	0.000000	0.85682	D	0.000000	D	0.98267	0.9426	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99164	1.0862	10	0.87932	D	0	.	16.045	0.80714	0.0:0.8693:0.1307:0.0	.	475	Q5JST6	EFHC2_HUMAN	E	475;503	ENSP00000333823:G475E;ENSP00000404232:G503E	ENSP00000333823:G475E	G	-	2	0	EFHC2	43976867	1.000000	0.71417	0.347000	0.25668	0.027000	0.11550	6.917000	0.75782	1.213000	0.43380	0.600000	0.82982	GGA	.		0.388	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056312.2	NM_025184	Missense_Mutation
ENAM	10117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71508293	71508293	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr4:71508293C>G	ENST00000396073.3	+	9	1431	c.1150C>G	c.(1150-1152)Cct>Gct	p.P384A	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	384					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CAAAGCTTACCCTCCTACTTC	0.443																																					p.P384A		.											.	ENAM	93	0			c.C1150G						.						118.0	124.0	122.0					4																	71508293		2203	4300	6503	SO:0001583	missense	10117	exon9			GCTTACCCTCCTA	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1150C>G	4.37:g.71508293C>G	ENSP00000379383:p.Pro384Ala	239.0	0.0		305.0	53.0	NM_031889	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	C	0.643	-0.812528	0.02798	.	.	ENSG00000132464	ENST00000396073	T	0.29655	1.56	5.93	1.24	0.21308	.	0.829650	0.10838	N	0.628532	T	0.09555	0.0235	N	0.02181	-0.65	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.30179	-0.9987	10	0.25106	T	0.35	0.4012	1.1226	0.01728	0.2366:0.3887:0.1927:0.182	.	384	Q9NRM1	ENAM_HUMAN	A	384	ENSP00000379383:P384A	ENSP00000379383:P384A	P	+	1	0	ENAM	71727157	0.000000	0.05858	0.003000	0.11579	0.070000	0.16714	-0.132000	0.10467	-0.081000	0.12662	0.655000	0.94253	CCT	.		0.443	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
EPGN	255324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	75174267	75174267	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr4:75174267C>T	ENST00000413830.1	+	1	78	c.17C>T	c.(16-18)cCa>cTa	p.P6L	EPGN_ENST00000514968.1_Missense_Mutation_p.P6L|EPGN_ENST00000509145.1_Missense_Mutation_p.P6L|EPGN_ENST00000505212.1_Missense_Mutation_p.P6L|EPGN_ENST00000502358.1_Missense_Mutation_p.P6L|EPGN_ENST00000332112.4_Missense_Mutation_p.P6L|EPGN_ENST00000503098.1_Missense_Mutation_p.P6L	NM_001270989.1	NP_001257918.1	Q6UW88	EPGN_HUMAN	epithelial mitogen	6					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|MAP kinase kinase activity (GO:0004708)	p.P6>?(1)		breast(3)|liver(1)|lung(1)|skin(1)	6			Lung(101;0.196)			TTGGGAGTTCCAATATCAGTC	0.333																																					p.P6L		.											.	EPGN	90	1	Complex(1)	skin(1)	c.C17T						.						171.0	175.0	173.0					4																	75174267		2203	4300	6503	SO:0001583	missense	255324	exon1			GAGTTCCAATATC		CCDS59475.1, CCDS59476.1, CCDS59477.1, CCDS59478.1, CCDS59479.1	4q13.3	2012-12-07	2012-12-07						17470	protein-coding gene	gene with protein product			"""epithelial mitogen homolog (mouse)"""				Standard	NM_001270989		Approved	epigen, EPG, PRO9904, ALGV3072	uc003hic.2	Q6UW88		ENST00000413830.1:c.17C>T	4.37:g.75174267C>T	ENSP00000411898:p.Pro6Leu	391.0	0.0		343.0	43.0	NM_001270993	A1BMM3|A1BMM4|A1BMM5|A1BMM6|A1BMM7|A1BMM8|A8K090	Missense_Mutation	SNP	ENST00000413830.1	37	CCDS59478.1	.	.	.	.	.	.	.	.	.	.	C	9.887	1.203093	0.22121	.	.	ENSG00000182585	ENST00000413830;ENST00000332112;ENST00000514968;ENST00000503098;ENST00000502358;ENST00000509145;ENST00000505212	T;T	0.22539	1.98;1.95	5.37	4.52	0.55395	.	0.481200	0.18618	N	0.135964	T	0.19685	0.0473	L	0.48362	1.52	0.09310	N	1	B;B;B;B;B;B;B	0.19073	0.019;0.002;0.021;0.01;0.033;0.008;0.006	B;B;B;B;B;B;B	0.19946	0.012;0.009;0.021;0.009;0.027;0.01;0.015	T	0.13045	-1.0524	10	0.33940	T	0.23	-1.3249	10.7778	0.46361	0.0:0.9103:0.0:0.0897	.	6;6;6;6;6;6;6	Q6UW88-7;Q6UW88;Q6UW88-3;Q6UW88-5;Q6UW88-4;Q6UW88-6;Q6UW88-2	.;EPGN_HUMAN;.;.;.;.;.	L	6	ENSP00000411898:P6L;ENSP00000330375:P6L	ENSP00000330375:P6L	P	+	2	0	EPGN	75393131	0.003000	0.15002	0.015000	0.15790	0.986000	0.74619	1.635000	0.37134	1.380000	0.46344	0.462000	0.41574	CCA	.		0.333	EPGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362738.1	NM_001013442	
ERBB3	2065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56487230	56487230	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:56487230A>G	ENST00000267101.3	+	12	1816	c.1376A>G	c.(1375-1377)aAt>aGt	p.N459S	ERBB3_ENST00000415288.2_Missense_Mutation_p.N400S|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000553131.1_5'Flank	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	459					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ATAAGTGCCAATAGGCAGCTC	0.512																																					p.N459S		.											.	ERBB3	1403	0			c.A1376G						.						93.0	94.0	94.0					12																	56487230		2203	4300	6503	SO:0001583	missense	2065	exon12			GTGCCAATAGGCA	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1376A>G	12.37:g.56487230A>G	ENSP00000267101:p.Asn459Ser	142.0	0.0		94.0	24.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.773507	0.90108	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	D;D	0.91631	-2.88;-2.88	5.16	5.16	0.70880	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000002	D	0.96926	0.8996	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.97855	1.0277	10	0.87932	D	0	.	14.1129	0.65134	1.0:0.0:0.0:0.0	.	459;459	B4DGQ7;P21860	.;ERBB3_HUMAN	S	459;400	ENSP00000267101:N459S;ENSP00000408340:N400S	ENSP00000267101:N459S	N	+	2	0	ERBB3	54773497	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	8.331000	0.90022	2.162000	0.67917	0.533000	0.62120	AAT	.		0.512	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	65303132	65303132	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:65303132C>A	ENST00000370621.3	-	25	4281	c.3755G>T	c.(3754-3756)aGa>aTa	p.R1252I	EYS_ENST00000503581.1_Missense_Mutation_p.R1252I|EYS_ENST00000370616.2_Missense_Mutation_p.R1252I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1252					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GGGATCTGTTCTTTGAAAGAT	0.388																																					p.R1252I		.											.	EYS	660	0			c.G3755T						.						139.0	123.0	128.0					6																	65303132		692	1591	2283	SO:0001583	missense	346007	exon25			TCTGTTCTTTGAA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.3755G>T	6.37:g.65303132C>A	ENSP00000359655:p.Arg1252Ile	258.0	0.0		320.0	49.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	C	11.04	1.521155	0.27211	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.82081	-1.57;-1.56;-1.56	4.73	3.85	0.44370	.	.	.	.	.	T	0.67543	0.2904	N	0.19112	0.55	0.45150	D	0.998168	P;P	0.48016	0.904;0.845	P;B	0.48921	0.595;0.311	T	0.68565	-0.5375	9	0.33940	T	0.23	.	13.167	0.59577	0.0:0.8396:0.1604:0.0	.	1252;1252	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	I	1252	ENSP00000424243:R1252I;ENSP00000359655:R1252I;ENSP00000359650:R1252I	ENSP00000359650:R1252I	R	-	2	0	EYS	65359853	0.429000	0.25530	0.035000	0.18076	0.184000	0.23303	0.948000	0.29096	0.969000	0.38237	-0.175000	0.13238	AGA	.		0.388	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150932949	150932949	+	Splice_Site	SNP	C	C	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr5:150932949C>G	ENST00000261800.5	-	5	3958		c.e5-1			NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2						epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTGCCTTGATCTGAAAGGAGG	0.587																																					.		.											.	FAT2	96	0			c.3946-1G>C						.						56.0	43.0	47.0					5																	150932949		2203	4300	6503	SO:0001630	splice_region_variant	2196	exon6			CTTGATCTGAAAG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.3946-1G>C	5.37:g.150932949C>G		85.0	0.0		99.0	17.0	NM_001447	O75091|Q9NSR7	Splice_Site	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321669	0.81580	.	.	ENSG00000086570	ENST00000261800	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3976	0.90504	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAT2	150913142	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.382000	0.79729	2.583000	0.87209	0.561000	0.74099	.	.		0.587	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	Intron
FBLN7	129804	broad.mit.edu;mdanderson.org	37	2	112942913	112942913	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:112942913C>A	ENST00000331203.2	+	7	1215	c.944C>A	c.(943-945)cCa>cAa	p.P315Q	FBLN7_ENST00000409667.3_Missense_Mutation_p.P181Q|FBLN7_ENST00000409450.3_Missense_Mutation_p.P269Q|FBLN7_ENST00000409903.1_Missense_Mutation_p.P315Q	NM_001128165.1|NM_153214.2	NP_001121637.1|NP_694946.2	Q53RD9	FBLN7_HUMAN	fibulin 7	315	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						AAGACGTCTCCATTGTGAGTA	0.587																																					p.P315Q		.											.	FBLN7	69	0			c.C944A						.						98.0	82.0	87.0					2																	112942913		2203	4300	6503	SO:0001583	missense	129804	exon7			CGTCTCCATTGTG		CCDS2095.1, CCDS46391.1	2q13	2010-06-15			ENSG00000144152	ENSG00000144152		"""Fibulins"""	26740	protein-coding gene	gene with protein product		611551				17699513	Standard	NM_153214		Approved	FLJ37440, TM14	uc002tho.1	Q53RD9	OTTHUMG00000153267	ENST00000331203.2:c.944C>A	2.37:g.112942913C>A	ENSP00000331411:p.Pro315Gln	64.0	0.0		63.0	10.0	NM_153214	A0JNV1|A0JNV2|Q5H9P5|Q8N9G0	Missense_Mutation	SNP	ENST00000331203.2	37	CCDS2095.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859171	0.71834	.	.	ENSG00000144152	ENST00000331203;ENST00000409903;ENST00000409667;ENST00000409450;ENST00000441565;ENST00000272559	D;T;D;D;D;D	0.91740	-2.9;-1.44;-2.9;-2.9;-2.9;-2.9	5.37	5.37	0.77165	EGF-like calcium-binding (2);	0.153445	0.64402	D	0.000014	D	0.95768	0.8623	M	0.73962	2.25	0.58432	D	0.999997	P;P;P;D	0.89917	0.853;0.881;0.842;1.0	P;P;P;D	0.91635	0.549;0.7;0.682;0.999	D	0.94615	0.7808	10	0.33940	T	0.23	-15.5367	18.7029	0.91627	0.0:1.0:0.0:0.0	.	181;269;315;315	Q53RD9-4;Q53RD9-2;Q53RD9;B8ZZC1	.;.;FBLN7_HUMAN;.	Q	315;315;181;269;209;137	ENSP00000331411:P315Q;ENSP00000386295:P315Q;ENSP00000386822:P181Q;ENSP00000387000:P269Q;ENSP00000388025:P209Q;ENSP00000272559:P137Q	ENSP00000272559:P137Q	P	+	2	0	FBLN7	112659384	0.671000	0.27521	0.863000	0.33907	0.565000	0.35776	5.656000	0.67988	2.513000	0.84729	0.561000	0.74099	CCA	.		0.587	FBLN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330505.1	NM_153214	
FHOD3	80206	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	34261446	34261446	+	Frame_Shift_Del	DEL	A	A	-	rs201006691		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr18:34261446delA	ENST00000359247.4	+	12	1358	c.1358delA	c.(1357-1359)gagfs	p.E453fs	FHOD3_ENST00000445677.1_Frame_Shift_Del_p.E415fs|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000590592.1_Frame_Shift_Del_p.E628fs|FHOD3_ENST00000257209.4_Frame_Shift_Del_p.E453fs	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	453					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CAGCACCAAGAGTCACTGGCA	0.473																																					p.E453fs		.											.	FHOD3	139	0			c.1358delA						.						103.0	106.0	105.0					18																	34261446		2203	4300	6503	SO:0001589	frameshift_variant	80206	exon12			ACCAAGAGTCACT	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1358delA	18.37:g.34261446delA	ENSP00000352186:p.Glu453fs	366.0	0.0		253.0	139.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Frame_Shift_Del	DEL	ENST00000359247.4	37																																																																																				.		0.473	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152281525	152281525	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:152281525G>A	ENST00000368799.1	-	3	5872	c.5837C>T	c.(5836-5838)gCt>gTt	p.A1946V	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1946	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.A1946V(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTCCCAAGCAGATCCAAG	0.562									Ichthyosis																												p.A1946V		.											.	FLG	106	1	Substitution - Missense(1)	large_intestine(1)	c.C5837T						.						250.0	237.0	242.0					1																	152281525		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCCCAAGCAGATC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5837C>T	1.37:g.152281525G>A	ENSP00000357789:p.Ala1946Val	683.0	0.0		734.0	151.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	3.101	-0.184746	0.06340	.	.	ENSG00000143631	ENST00000368799	T	0.01787	4.64	2.54	-2.28	0.06826	.	.	.	.	.	T	0.00468	0.0015	L	0.41824	1.3	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.46762	-0.9168	9	0.31617	T	0.26	-4.2776	0.552	0.00664	0.2588:0.1884:0.3614:0.1915	.	1946	P20930	FILA_HUMAN	V	1946	ENSP00000357789:A1946V	ENSP00000357789:A1946V	A	-	2	0	FLG	150548149	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.608000	0.02068	-0.570000	0.06022	-1.754000	0.00674	GCT	.		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FN1	2335	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	216248174	216248174	+	Missense_Mutation	SNP	C	C	T	rs140153061		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:216248174C>T	ENST00000359671.1	-	30	4919	c.4654G>A	c.(4654-4656)Gat>Aat	p.D1552N	FN1_ENST00000356005.4_Missense_Mutation_p.D1552N|FN1_ENST00000443816.1_Missense_Mutation_p.D1552N|FN1_ENST00000336916.4_Missense_Mutation_p.D1552N|FN1_ENST00000432072.2_Missense_Mutation_p.D1643N|FN1_ENST00000323926.6_Missense_Mutation_p.D1643N|FN1_ENST00000354785.4_Missense_Mutation_p.D1643N|FN1_ENST00000357009.2_Missense_Mutation_p.D1552N|FN1_ENST00000490833.1_5'UTR|FN1_ENST00000357867.4_Missense_Mutation_p.D1552N|FN1_ENST00000421182.1_Missense_Mutation_p.D1552N|FN1_ENST00000345488.5_Missense_Mutation_p.D1552N|FN1_ENST00000346544.3_Missense_Mutation_p.D1552N|FN1_ENST00000446046.1_Missense_Mutation_p.D1552N			P02751	FINC_HUMAN	fibronectin 1	1552	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TCCTGAACATCGGTCACTTGC	0.478													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18702	0.0		0.0	False		,,,				2504	0.0				p.D1643N		.											.	FN1	584	0			c.G4927A						.						190.0	166.0	174.0					2																	216248174		2203	4300	6503	SO:0001583	missense	2335	exon31			GAACATCGGTCAC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4654G>A	2.37:g.216248174C>T	ENSP00000352696:p.Asp1552Asn	254.0	1.0		224.0	41.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	27.4	4.824993	0.90955	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44	6.16	5.29	0.74685	.	0.072569	0.56097	N	0.000026	T	0.70798	0.3265	M	0.69463	2.115	0.23425	N	0.997709	D;D;D;P;D;D;D;P;D;D;D;D	0.89917	1.0;1.0;1.0;0.904;0.994;1.0;1.0;0.62;1.0;1.0;1.0;1.0	D;D;D;P;D;D;D;P;D;D;D;D	0.91635	0.999;0.996;0.997;0.514;0.928;0.998;0.999;0.514;0.999;0.997;0.997;0.998	T	0.66192	-0.5985	10	0.66056	D	0.02	.	15.319	0.74105	0.0:0.9338:0.0:0.0662	.	1343;1552;1643;1643;1552;1552;1552;1552;1553;1552;1552;1643	Q68CX6;F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.;.	N	1552;1643;1552;1552;1643;1553;1552;1552;1552;1552;1552;1552;1643;1552;359	ENSP00000394423:D1552N;ENSP00000323534:D1643N;ENSP00000338200:D1552N;ENSP00000350534:D1552N;ENSP00000346839:D1643N;ENSP00000352696:D1552N;ENSP00000265312:D1552N;ENSP00000273049:D1552N;ENSP00000349509:D1552N;ENSP00000410422:D1552N;ENSP00000415018:D1552N;ENSP00000399538:D1643N;ENSP00000348285:D1552N;ENSP00000416139:D359N	ENSP00000265313:D1553N	D	-	1	0	FN1	215956419	1.000000	0.71417	0.986000	0.45419	0.993000	0.82548	4.497000	0.60367	1.626000	0.50381	0.650000	0.86243	GAT	C|0.999;T|0.000		0.478	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
GABRQ	55879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	151806785	151806785	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:151806785C>T	ENST00000370306.2	+	1	149	c.129C>T	c.(127-129)gtC>gtT	p.V43V		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	43					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGCCCGAAGTCGTCCTGAACC	0.627																																					p.V43V		.											.	GABRQ	133	0			c.C129T						.						95.0	76.0	83.0					X																	151806785		2203	4300	6503	SO:0001819	synonymous_variant	55879	exon1			CGAAGTCGTCCTG	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.129C>T	X.37:g.151806785C>T		188.0	0.0		254.0	48.0	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Silent	SNP	ENST00000370306.2	37	CCDS14707.1																																																																																			.		0.627	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
GALNT6	11226	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51773444	51773444	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:51773444G>A	ENST00000543196.2	-	2	327	c.122C>T	c.(121-123)cCg>cTg	p.P41L	GALNT6_ENST00000356317.3_Missense_Mutation_p.P41L|GALNT6_ENST00000603203.1_5'Flank			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	41					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CTTCAGCCACGGCTTCTCTGT	0.587																																					p.P41L		.											.	GALNT6	92	0			c.C122T						.						63.0	67.0	66.0					12																	51773444		2203	4300	6503	SO:0001583	missense	11226	exon3			AGCCACGGCTTCT	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.122C>T	12.37:g.51773444G>A	ENSP00000444171:p.Pro41Leu	95.0	1.0		96.0	23.0	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Missense_Mutation	SNP	ENST00000543196.2	37	CCDS8813.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687359	0.48097	.	.	ENSG00000139629	ENST00000543196;ENST00000356317	T;T	0.35605	1.3;1.3	4.52	2.71	0.32032	.	0.113653	0.64402	N	0.000009	T	0.30978	0.0782	L	0.49126	1.545	0.80722	D	1	B	0.18968	0.032	B	0.13407	0.009	T	0.15122	-1.0448	10	0.56958	D	0.05	.	9.9718	0.41759	0.17:0.0:0.83:0.0	.	41	Q8NCL4	GALT6_HUMAN	L	41	ENSP00000444171:P41L;ENSP00000348668:P41L	ENSP00000348668:P41L	P	-	2	0	GALNT6	50059711	1.000000	0.71417	0.092000	0.20876	0.864000	0.49448	4.558000	0.60789	0.845000	0.35118	0.655000	0.94253	CCG	.		0.587	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
GH1	2688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61995228	61995228	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:61995228C>T	ENST00000323322.5	-	4	390	c.348G>A	c.(346-348)gtG>gtA	p.V116V	GH1_ENST00000351388.4_Silent_p.V76V|GH1_ENST00000458650.2_Silent_p.V101V|GH1_ENST00000342364.4_Intron|CSHL1_ENST00000392824.4_Intron	NM_000515.3	NP_000506.2	P01241	SOMA_HUMAN	growth hormone 1	116					bone maturation (GO:0070977)|glucose transport (GO:0015758)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|growth hormone receptor binding (GO:0005131)|metal ion binding (GO:0046872)|prolactin receptor binding (GO:0005148)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	19						TGAGGAACTGCACGGGCTCCA	0.612																																					p.V116V		.											.	GH1	522	0			c.G348A						.						58.0	60.0	59.0					17																	61995228		2203	4300	6503	SO:0001819	synonymous_variant	2688	exon4			GAACTGCACGGGC	M13438	CCDS11653.1, CCDS11654.1, CCDS45760.1	17q22-q24	2014-01-30				ENSG00000259384		"""Endogenous ligands"""	4261	protein-coding gene	gene with protein product	"""pituitary growth hormone"", ""somatotropin"""	139250				6306568	Standard	XM_005257218		Approved	GH-N, GHN, GH, hGH-N	uc002jdj.3	P01241		ENST00000323322.5:c.348G>A	17.37:g.61995228C>T		111.0	0.0		99.0	28.0	NM_000515	A6NEF6|Q14405|Q16631|Q5EB53|Q9HBZ1|Q9UMJ7|Q9UNL5	Silent	SNP	ENST00000323322.5	37	CCDS11653.1																																																																																			.		0.612	GH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417708.1	NM_000515	
GNA15	2769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3162793	3162793	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:3162793C>T	ENST00000262958.3	+	7	1159	c.901C>T	c.(901-903)Cct>Tct	p.P301S		NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	301					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.P301S(1)		large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		TTCCCCAGGCCCTAAGCAGGA	0.632											OREG0025150	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P301S		.											.	GNA15	229	1	Substitution - Missense(1)	skin(1)	c.C901T						.						52.0	40.0	44.0					19																	3162793		2203	4300	6503	SO:0001583	missense	2769	exon7			CCAGGCCCTAAGC		CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.901C>T	19.37:g.3162793C>T	ENSP00000262958:p.Pro301Ser	54.0	0.0	609	42.0	11.0	NM_002068	E9KL40|E9KL47|O75247|Q53XK2	Missense_Mutation	SNP	ENST00000262958.3	37	CCDS12104.1	.	.	.	.	.	.	.	.	.	.	c	16.25	3.069436	0.55539	.	.	ENSG00000060558	ENST00000262958	D	0.88124	-2.34	4.42	4.42	0.53409	.	0.333185	0.24583	U	0.037298	D	0.88962	0.6580	L	0.41632	1.29	0.42246	D	0.991955	D	0.61080	0.989	D	0.63703	0.917	D	0.87432	0.2389	10	0.30078	T	0.28	.	14.5094	0.67774	0.0:1.0:0.0:0.0	.	301	P30679	GNA15_HUMAN	S	301	ENSP00000262958:P301S	ENSP00000262958:P301S	P	+	1	0	GNA15	3113793	0.997000	0.39634	0.971000	0.41717	0.293000	0.27360	3.588000	0.53964	1.991000	0.58162	0.561000	0.74099	CCT	.		0.632	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2	NM_002068	
GNAS	2778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57484420	57484420	+	Missense_Mutation	SNP	C	C	T	rs11554273		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr20:57484420C>T	ENST00000371085.3	+	8	1025	c.601C>T	c.(601-603)Cgt>Tgt	p.R201C	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.R830C|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844C|GNAS_ENST00000371095.3_Missense_Mutation_p.R187C|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000306090.10_Missense_Mutation_p.R187C|GNAS_ENST00000265620.7_Missense_Mutation_p.R186C|GNAS_ENST00000354359.7_Missense_Mutation_p.R202C	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201C(228)|p.R844C(9)|p.R201S(5)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCTTCGCTGCCGTGTCCTGAC	0.428			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.R844C	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	GNAS,colon,carcinoma,0	GNAS	4767	242	Substitution - Missense(242)	pituitary(141)|pancreas(35)|large_intestine(14)|ovary(12)|thyroid(10)|adrenal_gland(7)|biliary_tract(6)|parathyroid(5)|liver(3)|kidney(3)|testis(2)|upper_aerodigestive_tract(2)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)	c.C2530T						.						80.0	78.0	79.0					20																	57484420		2203	4300	6503	SO:0001583	missense	2778	exon8			CGCTGCCGTGTCC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.601C>T	20.37:g.57484420C>T	ENSP00000360126:p.Arg201Cys	163.0	0.0		213.0	35.0	NM_080425	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	37	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215896	0.79352	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99466	-5.95;-5.95;-5.95;-5.95;-5.95;-2.99;-5.95	5.53	4.53	0.55603	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99775	0.9907	H	0.99732	4.735	0.80722	D	1	D;D;D;D	0.89917	0.999;0.983;0.979;1.0	D;P;P;D	0.97110	0.939;0.845;0.643;1.0	D	0.96814	0.9599	10	0.87932	D	0	.	13.0593	0.58997	0.2437:0.7563:0.0:0.0	rs11554273	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	C	844;830;187;201;202;186;187	ENSP00000360141:R844C;ENSP00000360143:R830C;ENSP00000360136:R187C;ENSP00000360126:R201C;ENSP00000346328:R202C;ENSP00000265620:R186C;ENSP00000304472:R187C	ENSP00000265620:R186C	R	+	1	0	GNAS	56917815	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	4.055000	0.57441	2.596000	0.87737	0.563000	0.77884	CGT	C|1.000		0.428	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
GPR142	350383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72368126	72368126	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:72368126C>T	ENST00000335666.4	+	4	824	c.776C>T	c.(775-777)gCc>gTc	p.A259V		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	259						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CGCTACACTGCCCTGTGCCAC	0.682																																					p.A259V		.											.	GPR142	93	0			c.C776T						.						69.0	52.0	58.0					17																	72368126		2202	4300	6502	SO:0001583	missense	350383	exon4			ACACTGCCCTGTG	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.776C>T	17.37:g.72368126C>T	ENSP00000335158:p.Ala259Val	76.0	0.0		61.0	13.0	NM_181790	A4CYJ8|Q86SL3	Missense_Mutation	SNP	ENST00000335666.4	37	CCDS11698.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267772	0.59540	.	.	ENSG00000257008	ENST00000335666	T	0.52057	0.68	4.99	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.053906	0.64402	D	0.000001	T	0.69287	0.3094	M	0.80183	2.485	0.39780	D	0.972283	P;D	0.71674	0.911;0.998	P;D	0.71870	0.78;0.975	T	0.77275	-0.2648	10	0.87932	D	0	-22.7095	15.6433	0.77025	0.1379:0.8621:0.0:0.0	.	259;1221	Q7Z601;Q8NGB0	GP142_HUMAN;.	V	259	ENSP00000335158:A259V	ENSP00000335158:A259V	A	+	2	0	GPR142	69879721	1.000000	0.71417	0.995000	0.50966	0.018000	0.09664	5.650000	0.67944	1.430000	0.47334	-0.147000	0.13772	GCC	.		0.682	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
GPR63	81491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	97246895	97246895	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:97246895C>A	ENST00000229955.3	-	2	1058	c.713G>T	c.(712-714)gGc>gTc	p.G238V	GPR63_ENST00000417980.1_Missense_Mutation_p.G238V	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		AGCCTGGTAGCCTGGATTGGT	0.463																																					p.G238V		.											.	GPR63	92	0			c.G713T						.						78.0	83.0	81.0					6																	97246895		2203	4300	6503	SO:0001583	missense	81491	exon2			TGGTAGCCTGGAT	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.713G>T	6.37:g.97246895C>A	ENSP00000229955:p.Gly238Val	149.0	0.0		71.0	21.0	NM_030784	Q9UJH3	Missense_Mutation	SNP	ENST00000229955.3	37	CCDS5036.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444645	0.63178	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.35236	1.32;1.32;1.32	5.2	5.2	0.72013	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	N	0.25825	0.765	0.80722	D	1	B	0.34061	0.436	P	0.47118	0.538	T	0.25641	-1.0126	10	0.52906	T	0.07	-3.6581	19.0987	0.93265	0.0:1.0:0.0:0.0	.	238	Q9BZJ6	GPR63_HUMAN	V	262;238;238;238	ENSP00000393170:G238V;ENSP00000229955:G238V;ENSP00000358273:G238V	ENSP00000229955:G238V	G	-	2	0	GPR63	97353616	1.000000	0.71417	0.286000	0.24833	0.974000	0.67602	4.588000	0.60999	2.595000	0.87683	0.650000	0.86243	GGC	.		0.463	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
GPRASP1	9737	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101911927	101911927	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:101911927C>T	ENST00000361600.5	+	5	3887	c.3086C>T	c.(3085-3087)aCg>aTg	p.T1029M	GPRASP1_ENST00000444152.1_Missense_Mutation_p.T1029M|GPRASP1_ENST00000537097.1_Missense_Mutation_p.T1029M|GPRASP1_ENST00000415986.1_Missense_Mutation_p.T1029M|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1029	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TGCAGGTCCACGTGTTCAGTT	0.557																																					p.T1029M		.											.	GPRASP1	131	0			c.C3086T						.						137.0	121.0	127.0					X																	101911927		2203	4300	6503	SO:0001583	missense	9737	exon3			GGTCCACGTGTTC	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3086C>T	X.37:g.101911927C>T	ENSP00000355146:p.Thr1029Met	193.0	1.0		243.0	49.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	C	0.876	-0.730348	0.03135	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.08720	3.06;3.06;3.06;3.06	2.84	-2.94	0.05581	.	.	.	.	.	T	0.04952	0.0133	N	0.22421	0.69	0.09310	N	1	D	0.60160	0.987	P	0.44597	0.454	T	0.16778	-1.0391	9	0.51188	T	0.08	1.2535	1.3696	0.02208	0.1286:0.3385:0.2124:0.3204	.	1029	Q5JY77	GASP1_HUMAN	M	1029	ENSP00000393691:T1029M;ENSP00000409420:T1029M;ENSP00000355146:T1029M;ENSP00000445683:T1029M	ENSP00000355146:T1029M	T	+	2	0	GPRASP1	101798583	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.584000	0.05800	-1.014000	0.03379	0.284000	0.19432	ACG	.		0.557	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
GRIA3	2892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	122538727	122538727	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:122538727A>G	ENST00000371251.1	+	10	1514	c.1462A>G	c.(1462-1464)Aaa>Gaa	p.K488E	GRIA3_ENST00000371256.5_Missense_Mutation_p.K488E|GRIA3_ENST00000264357.5_Missense_Mutation_p.K488E|GRIA3_ENST00000542149.1_Missense_Mutation_p.K488E|GRIA3_ENST00000541091.1_Missense_Mutation_p.K472E			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	488					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TCCAGAGACTAAAATATGGAA	0.393																																					p.K488E		.											.	GRIA3	134	0			c.A1462G						.						213.0	187.0	196.0					X																	122538727		2203	4300	6503	SO:0001583	missense	2892	exon10			GAGACTAAAATAT	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1462A>G	X.37:g.122538727A>G	ENSP00000360297:p.Lys488Glu	461.0	0.0		529.0	102.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	A	18.07	3.541857	0.65198	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	T;T;T;T;T	0.76709	1.13;1.13;1.13;1.13;-1.04	5.4	5.4	0.78164	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.89536	0.6743	M	0.90198	3.095	0.80722	D	1	P;D;D	0.63046	0.948;0.992;0.99	P;D;D	0.76071	0.719;0.987;0.979	D	0.90987	0.4832	10	0.54805	T	0.06	.	13.7182	0.62710	1.0:0.0:0.0:0.0	.	472;488;488	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	E	488;488;488;488;472	ENSP00000264357:K488E;ENSP00000446146:K488E;ENSP00000360302:K488E;ENSP00000360297:K488E;ENSP00000446440:K472E	ENSP00000264357:K488E	K	+	1	0	GRIA3	122366408	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.287000	0.95975	1.904000	0.55121	0.412000	0.27726	AAA	.		0.393	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
GTF2IRD1	9569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73944105	73944105	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:73944105C>T	ENST00000265755.3	+	9	1525	c.1132C>T	c.(1132-1134)Cgg>Tgg	p.R378W	GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.R410W|GTF2IRD1_ENST00000476977.1_Missense_Mutation_p.R378W|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.R378W|GTF2IRD1_ENST00000489094.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	378				R -> Q (in Ref. 5; AAF21796). {ECO:0000305}.	multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R378W(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CGTGCCCTACCGGAAGATTGC	0.607																																					p.R410W		.											GTF2IRD1,NS,carcinoma,0	GTF2IRD1	94	1	Substitution - Missense(1)	ovary(1)	c.C1228T						.						69.0	59.0	62.0					7																	73944105		2203	4300	6503	SO:0001583	missense	9569	exon9			CCCTACCGGAAGA	AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.1132C>T	7.37:g.73944105C>T	ENSP00000265755:p.Arg378Trp	91.0	0.0		121.0	27.0	NM_001199207	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	c	19.69	3.873889	0.72180	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337;ENST00000476977	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	4.46	-2.05	0.07321	.	0.000000	0.85682	D	0.000000	T	0.46927	0.1418	N	0.19112	0.55	0.52501	D	0.999952	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.993;0.957;0.996;0.974	T	0.52245	-0.8601	10	0.87932	D	0	-25.9307	17.2233	0.86963	0.259:0.7409:0.0:0.0	.	410;378;378;378	Q6DSU6;E9PFE2;Q9UHL9;Q9UHL9-2	.;.;GT2D1_HUMAN;.	W	378;410;378;378	ENSP00000265755:R378W;ENSP00000397566:R410W;ENSP00000408477:R378W;ENSP00000418383:R378W	ENSP00000265755:R378W	R	+	1	2	GTF2IRD1	73582041	1.000000	0.71417	0.996000	0.52242	0.862000	0.49288	2.453000	0.44970	-0.142000	0.11354	-0.535000	0.04281	CGG	.		0.607	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
HIST1H4B	8366	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26027241	26027241	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:26027241C>A	ENST00000377364.3	-	1	239	c.240G>T	c.(238-240)aaG>aaT	p.K80N		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	80					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						CAGTGACAGTCTTGCGCTTGG	0.537											OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K80N		.											.	HIST1H4B	70	0			c.G240T						.						113.0	97.0	102.0					6																	26027241		2203	4300	6503	SO:0001583	missense	8366	exon1			GACAGTCTTGCGC	X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.240G>T	6.37:g.26027241C>A	ENSP00000366581:p.Lys80Asn	168.0	1.0	783	198.0	30.0	NM_003544	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377364.3	37	CCDS4572.1	.	.	.	.	.	.	.	.	.	.	c	17.22	3.334950	0.60853	.	.	ENSG00000124529	ENST00000377364	T	0.71222	-0.55	4.65	1.88	0.25563	.	0.000000	0.56097	U	0.000032	T	0.65678	0.2714	.	.	.	0.36216	D	0.851672	.	.	.	.	.	.	T	0.69064	-0.5244	7	0.87932	D	0	.	9.135	0.36868	0.0:0.7522:0.0:0.2478	.	.	.	.	N	80	ENSP00000366581:K80N	ENSP00000366581:K80N	K	-	3	2	HIST1H4B	26135220	1.000000	0.71417	0.998000	0.56505	0.141000	0.21300	2.448000	0.44926	0.642000	0.30620	0.563000	0.77884	AAG	.		0.537	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040079.2	NM_003544	
HIST1H4E	8367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26204899	26204899	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:26204899G>C	ENST00000360441.4	+	1	42	c.27G>C	c.(25-27)aaG>aaC	p.K9N		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	9					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				AAGGCGGAAAGGGACTGGGTA	0.542																																					p.K9N		.											.	HIST1H4E	69	0			c.G27C						.						78.0	81.0	80.0					6																	26204899		2203	4300	6503	SO:0001583	missense	8367	exon1			CGGAAAGGGACTG	Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.27G>C	6.37:g.26204899G>C	ENSP00000353624:p.Lys9Asn	139.0	0.0		159.0	35.0	NM_003545	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000360441.4	37	CCDS4593.1	.	.	.	.	.	.	.	.	.	.	.	5.613	0.297818	0.10622	.	.	ENSG00000198518	ENST00000360441	.	.	.	2.2	-4.41	0.03590	.	0.000000	0.85682	U	0.000000	T	0.57770	0.2076	.	.	.	0.46279	D	0.998965	.	.	.	.	.	.	T	0.66744	-0.5846	6	0.87932	D	0	.	12.694	0.56992	0.1659:0.0:0.8341:0.0	.	.	.	.	N	9	.	ENSP00000353624:K9N	K	+	3	2	HIST1H4E	26312878	0.196000	0.23350	0.001000	0.08648	0.001000	0.01503	-0.473000	0.06615	-1.637000	0.01531	-1.063000	0.02288	AAG	.		0.542	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545	
IGSF9	57549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159912756	159912756	+	Missense_Mutation	SNP	C	C	A	rs113355407		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:159912756C>A	ENST00000368094.1	-	3	441	c.244G>T	c.(244-246)Gtg>Ttg	p.V82L	IGSF9_ENST00000361509.3_Missense_Mutation_p.V82L	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	82	Ig-like 1.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.V82M(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CTCTTACCCACGTAATCAGGG	0.572																																					p.V82L		.											IGSF9,NS,carcinoma,0	IGSF9	156	1	Substitution - Missense(1)	ovary(1)	c.G244T						.						51.0	53.0	52.0					1																	159912756		2203	4300	6503	SO:0001583	missense	57549	exon3			TACCCACGTAATC	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.244G>T	1.37:g.159912756C>A	ENSP00000357073:p.Val82Leu	93.0	0.0		97.0	20.0	NM_001135050		Missense_Mutation	SNP	ENST00000368094.1	37	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673316	0.29693	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.27104	1.69;1.69	4.66	3.67	0.42095	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34603	N	0.003831	T	0.05135	0.0137	N	0.12182	0.205	0.29140	N	0.879086	B;B	0.19331	0.003;0.035	B;B	0.20577	0.002;0.03	T	0.31586	-0.9938	9	.	.	.	.	10.8919	0.47000	0.0:0.6766:0.3233:0.0	.	82;82	Q9P2J2;C9JI81	TUTLA_HUMAN;.	L	82	ENSP00000355049:V82L;ENSP00000357073:V82L	.	V	-	1	0	IGSF9	158179380	0.011000	0.17503	1.000000	0.80357	0.975000	0.68041	1.071000	0.30666	2.290000	0.77057	0.557000	0.71058	GTG	C|0.500;T|0.500		0.572	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
IL13RA1	3597	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	117895250	117895250	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:117895250T>A	ENST00000371666.3	+	6	893	c.826T>A	c.(826-828)Tac>Aac	p.Y276N	IL13RA1_ENST00000371642.1_Missense_Mutation_p.Y276N|IL13RA1_ENST00000481868.1_3'UTR	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	276	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						TAATGTTTTCTACGTAAGGTT	0.294																																					p.Y276N		.											.	IL13RA1	554	0			c.T826A						.						96.0	96.0	96.0					X																	117895250		2203	4299	6502	SO:0001583	missense	3597	exon6			GTTTTCTACGTAA	U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.826T>A	X.37:g.117895250T>A	ENSP00000360730:p.Tyr276Asn	325.0	1.0		402.0	82.0	NM_001560	O95646|Q5JSL4|Q99656|Q9UDY5	Missense_Mutation	SNP	ENST00000371666.3	37	CCDS14573.1	.	.	.	.	.	.	.	.	.	.	T	9.861	1.196347	0.22037	.	.	ENSG00000131724	ENST00000371666;ENST00000371642	D;D	0.92299	-1.95;-3.01	6.14	-6.32	0.01995	Fibronectin, type III (1);Immunoglobulin-like fold (1);	1.996830	0.01961	N	0.043354	D	0.82318	0.5011	L	0.40543	1.245	0.09310	N	1	B;B;B	0.33345	0.409;0.409;0.004	B;B;B	0.20955	0.032;0.032;0.002	T	0.72497	-0.4275	10	0.25751	T	0.34	1.4932	1.0474	0.01572	0.313:0.3063:0.1114:0.2693	.	276;276;276	Q5JSL4;P78552;Q9UDY5	.;I13R1_HUMAN;.	N	276	ENSP00000360730:Y276N;ENSP00000360705:Y276N	ENSP00000360705:Y276N	Y	+	1	0	IL13RA1	117779278	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.276000	0.08514	-1.158000	0.02811	-0.373000	0.07131	TAC	.		0.294	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058009.1	NM_001560	
IL6ST	3572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	55272094	55272094	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr5:55272094G>A	ENST00000381298.2	-	3	325	c.13C>T	c.(13-15)Cag>Tag	p.Q5*	IL6ST_ENST00000522633.2_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000381287.4_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000577363.1_5'UTR|IL6ST_ENST00000381286.3_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000536319.1_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000381294.3_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000502326.3_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000381293.2_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000336909.5_Nonsense_Mutation_p.Q5*|IL6ST_ENST00000396816.1_Nonsense_Mutation_p.Q5*	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	5					ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				AGCCAAGTCTGCAACGTCAAC	0.338			O		hepatocellular ca																																p.Q5X		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	290	0			c.C13T						.						78.0	70.0	72.0					5																	55272094		2203	4300	6503	SO:0001587	stop_gained	3572	exon3			AAGTCTGCAACGT	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.13C>T	5.37:g.55272094G>A	ENSP00000370698:p.Gln5*	299.0	0.0		336.0	89.0	NM_175767	A0N0L4|Q5FC04|Q9UQ41	Nonsense_Mutation	SNP	ENST00000381298.2	37	CCDS3971.1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222041	0.39300	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294;ENST00000381287;ENST00000536319;ENST00000381293;ENST00000381286;ENST00000522633;ENST00000542298	.	.	.	4.7	-4.85	0.03142	.	2.036040	0.02176	N	0.060126	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4118	0.21696	0.1612:0.0:0.2807:0.558	.	.	.	.	X	5	.	ENSP00000338799:Q5X	Q	-	1	0	IL6ST	55307851	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.257000	0.08745	-0.787000	0.04510	0.585000	0.79938	CAG	.		0.338	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
IMMT	10989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	86408465	86408465	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:86408465G>C	ENST00000410111.3	-	2	463	c.76C>G	c.(76-78)Cca>Gca	p.P26A	IMMT_ENST00000449247.2_Missense_Mutation_p.P26A|IMMT_ENST00000254636.5_5'UTR|IMMT_ENST00000442664.2_Missense_Mutation_p.P26A|IMMT_ENST00000409051.2_Missense_Mutation_p.P26A	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	26					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GGTCGCAATGGACGGAGGACA	0.448																																					p.P26A		.											.	IMMT	91	0			c.C76G						.						73.0	71.0	72.0					2																	86408465		1926	4130	6056	SO:0001583	missense	10989	exon2			GCAATGGACGGAG	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.76C>G	2.37:g.86408465G>C	ENSP00000387262:p.Pro26Ala	90.0	0.0		84.0	18.0	NM_006839	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	CCDS46355.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988149	0.74589	.	.	ENSG00000132305	ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715	T;T;T;T	0.35236	1.34;1.35;1.35;1.32	5.55	4.68	0.58851	.	0.283448	0.38778	N	0.001572	T	0.46852	0.1414	L	0.34521	1.04	0.49582	D	0.999804	P;D;P;D;D;D;P;D;P	0.89917	0.944;0.999;0.908;1.0;1.0;0.97;0.944;0.97;0.908	P;D;P;D;D;P;P;P;P	0.91635	0.837;0.998;0.692;0.997;0.999;0.837;0.837;0.837;0.692	T	0.29088	-1.0023	10	0.23891	T	0.37	-14.0586	13.9895	0.64357	0.0735:0.0:0.9265:0.0	.	26;26;26;26;26;26;26;26;26	F5GZ32;B9A067;B4DKR1;Q05DN3;B4E2B5;F8W9I1;Q16891-2;Q16891-3;Q16891	.;.;.;.;.;.;.;.;IMMT_HUMAN	A	26	ENSP00000396899:P26A;ENSP00000387262:P26A;ENSP00000407788:P26A;ENSP00000387227:P26A	ENSP00000366526:P26A	P	-	1	0	IMMT	86261976	1.000000	0.71417	0.974000	0.42286	0.799000	0.45148	5.915000	0.69973	1.359000	0.45940	0.655000	0.94253	CCA	.		0.448	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
IQGAP1	8826	broad.mit.edu;bcgsc.ca	37	15	91020963	91020963	+	Silent	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr15:91020963T>C	ENST00000268182.5	+	26	3295	c.3171T>C	c.(3169-3171)agT>agC	p.S1057S	IQGAP1_ENST00000560738.1_Silent_p.S485S	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1057	C1.|Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGGTTGTAAGTTTCAACCGTG	0.408																																					p.S1057S		.											.	IQGAP1	950	0			c.T3171C						.						100.0	103.0	102.0					15																	91020963		2198	4298	6496	SO:0001819	synonymous_variant	8826	exon26			TGTAAGTTTCAAC	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.3171T>C	15.37:g.91020963T>C		94.0	0.0		93.0	5.0	NM_003870	A7MBM3	Silent	SNP	ENST00000268182.5	37	CCDS10362.1																																																																																			.		0.408	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
IQSEC2	23096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53279675	53279675	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:53279675C>T	ENST00000375368.5	-	4	2253	c.2053G>A	c.(2053-2055)Gat>Aat	p.D685N	IQSEC2_ENST00000375365.2_Missense_Mutation_p.D490N|IQSEC2_ENST00000396435.3_Missense_Mutation_p.D695N			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	685					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTCTCGTTATCTCCACCATCA	0.622																																					p.D695N		.											.	IQSEC2	178	0			c.G2083A						.						76.0	58.0	64.0					X																	53279675		2203	4300	6503	SO:0001583	missense	23096	exon5			CGTTATCTCCACC	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2053G>A	X.37:g.53279675C>T	ENSP00000364517:p.Asp685Asn	175.0	0.0		214.0	49.0	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	37		.	.	.	.	.	.	.	.	.	.	c	24.3	4.510902	0.85389	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.51071	2.04;2.03;0.72	5.23	5.23	0.72850	.	0.782783	0.12603	N	0.454541	T	0.65923	0.2738	L	0.52905	1.665	0.80722	D	1	D;D	0.89917	1.0;0.971	D;P	0.71870	0.975;0.776	T	0.64964	-0.6283	10	0.66056	D	0.02	.	16.614	0.84902	0.0:1.0:0.0:0.0	.	695;490	Q5JU85-2;Q5JU85-3	.;.	N	695;685;490	ENSP00000379712:D695N;ENSP00000364517:D685N;ENSP00000364514:D490N	ENSP00000364514:D490N	D	-	1	0	IQSEC2	53296400	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.572000	0.82409	2.181000	0.69327	0.597000	0.82753	GAT	.		0.622	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
ITIH3	3699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52835121	52835121	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr3:52835121C>T	ENST00000449956.2	+	11	1348	c.1342C>T	c.(1342-1344)Cgg>Tgg	p.R448W	ITIH3_ENST00000416872.2_Missense_Mutation_p.R448W	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	448	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		TGGGTTTGCCCGGCGCATTTA	0.517																																					p.R448W		.											.	ITIH3	93	0			c.C1342T						.						68.0	71.0	70.0					3																	52835121		1947	4128	6075	SO:0001583	missense	3699	exon11			TTTGCCCGGCGCA		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.1342C>T	3.37:g.52835121C>T	ENSP00000415769:p.Arg448Trp	79.0	0.0		60.0	26.0	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	ENST00000449956.2	37	CCDS46845.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388894	0.82902	.	.	ENSG00000162267	ENST00000398670;ENST00000536431;ENST00000273291;ENST00000416872;ENST00000449956	D;D	0.83591	-1.74;-1.74	5.33	4.46	0.54185	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.92254	0.7543	M	0.91140	3.18	0.50039	D	0.999849	P;D	0.89917	0.589;1.0	B;D	0.91635	0.156;0.999	D	0.93459	0.6809	10	0.66056	D	0.02	-14.4835	13.0138	0.58745	0.0:0.9216:0.0:0.0784	.	448;448	E7ET33;Q06033	.;ITIH3_HUMAN	W	448;436;443;448;448	ENSP00000413922:R448W;ENSP00000415769:R448W	ENSP00000273291:R443W	R	+	1	2	ITIH3	52810161	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.160000	0.58164	1.493000	0.48517	-0.136000	0.14681	CGG	.		0.517	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
JMJD1C	221037	ucsc.edu;bcgsc.ca	37	10	64967085	64967085	+	Silent	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr10:64967085G>A	ENST00000399262.2	-	10	4562	c.4344C>T	c.(4342-4344)tgC>tgT	p.C1448C	JMJD1C_ENST00000402544.1_Silent_p.C1229C|JMJD1C_ENST00000542921.1_Silent_p.C1266C|JMJD1C_ENST00000399251.1_Silent_p.C1229C	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1448					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TGCTGACCTTGCATTCTTGTT	0.408																																					p.C1448C		.											.	JMJD1C	275	0			c.C4344T						.						119.0	121.0	121.0					10																	64967085		2031	4203	6234	SO:0001819	synonymous_variant	221037	exon10			GACCTTGCATTCT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.4344C>T	10.37:g.64967085G>A		45.0	0.0		34.0	4.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	1.950	-0.441579	0.04604	.	.	ENSG00000171988	ENST00000327520	.	.	.	5.72	4.81	0.61882	.	.	.	.	.	T	0.62208	0.2409	.	.	.	0.43703	D	0.996162	.	.	.	.	.	.	T	0.60535	-0.7244	4	.	.	.	-1.4035	10.4017	0.44233	0.0693:0.0:0.795:0.1358	.	.	.	.	V	134	.	.	A	-	2	0	JMJD1C	64637091	1.000000	0.71417	0.935000	0.37517	0.985000	0.73830	4.463000	0.60128	1.395000	0.46643	0.591000	0.81541	GCA	.		0.408	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
KAT6A	7994	ucsc.edu;bcgsc.ca	37	8	41806816	41806816	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr8:41806816T>C	ENST00000396930.3	-	11	2207	c.1664A>G	c.(1663-1665)cAg>cGg	p.Q555R	KAT6A_ENST00000265713.2_Missense_Mutation_p.Q555R|KAT6A_ENST00000406337.1_Missense_Mutation_p.Q555R|KAT6A_ENST00000485568.1_Missense_Mutation_p.Q555R	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	555	Catalytic.|Interaction with PML.|Interaction with RUNX1-1.|MYST-type HAT.|Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CTTCATGTGCTGCTGCAGAAT	0.338																																					p.Q555R		.											.	.	.	0			c.A1664G						.						60.0	55.0	57.0					8																	41806816		2202	4299	6501	SO:0001583	missense	7994	exon11			ATGTGCTGCTGCA	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.1664A>G	8.37:g.41806816T>C	ENSP00000380136:p.Gln555Arg	72.0	0.0		34.0	4.0	NM_001099412	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	37	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	13.81	2.349452	0.41599	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721;ENST00000485568	T;T;T;T	0.81247	0.56;0.56;0.56;-1.47	5.24	5.24	0.73138	.	0.086033	0.50627	D	0.000119	T	0.56093	0.1962	N	0.02403	-0.565	0.50171	D	0.999851	B;B	0.22080	0.0;0.064	B;B	0.20384	0.001;0.029	T	0.59429	-0.7456	10	0.02654	T	1	-19.0956	15.4604	0.75353	0.0:0.0:0.0:1.0	.	555;555	A5PLL3;Q92794	.;KAT6A_HUMAN	R	555;555;555;135;555	ENSP00000265713:Q555R;ENSP00000385888:Q555R;ENSP00000380136:Q555R;ENSP00000430606:Q555R	ENSP00000265713:Q555R	Q	-	2	0	KAT6A	41925973	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.991000	0.56973	2.116000	0.64780	0.482000	0.46254	CAG	.		0.338	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
AREL1	9870	ucsc.edu;bcgsc.ca	37	14	75136704	75136704	+	Silent	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr14:75136704A>G	ENST00000356357.4	-	14	2249	c.1734T>C	c.(1732-1734)gcT>gcC	p.A578A	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	578	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGGTGAAGCGAGCTCGGACCA	0.522																																					p.A578A		.											.	KIAA0317	525	0			c.T1734C						.						85.0	85.0	85.0					14																	75136704		1944	4126	6070	SO:0001819	synonymous_variant	9870	exon14			GAAGCGAGCTCGG	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1734T>C	14.37:g.75136704A>G		72.0	0.0		52.0	5.0	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Silent	SNP	ENST00000356357.4	37	CCDS41971.1																																																																																			.		0.522	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
KIAA1522	57648	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	33236078	33236078	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:33236078C>T	ENST00000373480.1	+	6	1224	c.1121C>T	c.(1120-1122)tCc>tTc	p.S374F	KIAA1522_ENST00000401073.2_Missense_Mutation_p.S433F|KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000373481.3_Missense_Mutation_p.S385F	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	374	Ser-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				TCCACCCTCTCCTCTAAGGGT	0.652																																					p.S433F		.											.	KIAA1522	90	0			c.C1298T						.						29.0	31.0	30.0					1																	33236078		1986	4142	6128	SO:0001583	missense	57648	exon6			CCCTCTCCTCTAA	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.1121C>T	1.37:g.33236078C>T	ENSP00000362579:p.Ser374Phe	35.0	0.0		28.0	5.0	NM_020888	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	37	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648316	0.47258	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.18338	2.22;2.24;2.25	4.59	3.6	0.41247	.	0.000000	0.64402	D	0.000007	T	0.35335	0.0928	L	0.56769	1.78	0.37336	D	0.910161	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.67548	0.952;0.952;0.952	T	0.39663	-0.9603	10	0.62326	D	0.03	-15.7991	14.3553	0.66733	0.0:0.8511:0.1489:0.0	.	385;374;433	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	F	433;385;374	ENSP00000383851:S433F;ENSP00000362580:S385F;ENSP00000362579:S374F	ENSP00000362579:S374F	S	+	2	0	KIAA1522	33008665	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	5.270000	0.65547	2.253000	0.74438	0.561000	0.74099	TCC	.		0.652	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
KLF11	8462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	10188154	10188154	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:10188154C>T	ENST00000305883.1	+	3	852	c.690C>T	c.(688-690)tcC>tcT	p.S230S	KLF11_ENST00000535335.1_Silent_p.S213S|KLF11_ENST00000540845.1_Silent_p.S213S	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	230					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		ACTTGGTGTCCTGTCAGCCCT	0.527																																					p.S230S	Melanoma(56;431 1507 23687 50789)	.											.	KLF11	228	0			c.C690T						.						101.0	95.0	97.0					2																	10188154		2203	4300	6503	SO:0001819	synonymous_variant	8462	exon3			GGTGTCCTGTCAG	AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.690C>T	2.37:g.10188154C>T		58.0	0.0		62.0	20.0	NM_003597	B4DZE7|Q9EPF4	Silent	SNP	ENST00000305883.1	37	CCDS1668.1																																																																																			.		0.527	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000239202.3	NM_003597	
KLHL21	9903	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	6661869	6661869	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:6661869T>A	ENST00000377658.4	-	1	1060	c.1009A>T	c.(1009-1011)Atc>Ttc	p.I337F	KLHL21_ENST00000467612.1_Intron|KLHL21_ENST00000377663.3_Missense_Mutation_p.I337F|KLHL21_ENST00000463043.1_Intron	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	337					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		GTCACGTAGATGTCATTGCCC	0.662																																					p.I337F		.											.	KLHL21	514	0			c.A1009T						.						32.0	29.0	30.0					1																	6661869		2193	4295	6488	SO:0001583	missense	9903	exon1			CGTAGATGTCATT	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.1009A>T	1.37:g.6661869T>A	ENSP00000366886:p.Ile337Phe	101.0	1.0		82.0	25.0	NM_014851	B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	ENST00000377658.4	37	CCDS30575.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.857982	0.71834	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	D;D	0.85484	-1.99;-1.99	4.55	4.55	0.56014	Galactose oxidase, beta-propeller (1);	0.052014	0.85682	D	0.000000	D	0.91643	0.7359	M	0.94063	3.49	0.80722	D	1	P;D	0.57571	0.922;0.98	P;P	0.52957	0.627;0.714	D	0.93040	0.6456	10	0.51188	T	0.08	.	13.514	0.61530	0.0:0.0:0.0:1.0	.	337;337	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	F	337	ENSP00000366886:I337F;ENSP00000366891:I337F	ENSP00000366886:I337F	I	-	1	0	KLHL21	6584456	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	6.043000	0.71004	2.035000	0.60131	0.459000	0.35465	ATC	.		0.662	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1	NM_014851	
KLRK1	22914	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10541374	10541374	+	Silent	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:10541374G>A	ENST00000240618.6	-	2	176	c.36C>T	c.(34-36)agC>agT	p.S12S	RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Silent_p.S12S|KLRC4-KLRK1_ENST00000539300.1_3'UTR	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	12					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						ACATACCCCAGCTGTGTCGAG	0.388																																					p.S12S		.											.	.	.	0			c.C36T						.						95.0	86.0	89.0					12																	10541374		2203	4300	6503	SO:0001819	synonymous_variant	0	exon7			ACCCCAGCTGTGT	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.36C>T	12.37:g.10541374G>A		69.0	0.0		46.0	8.0	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Silent	SNP	ENST00000240618.6	37	CCDS8623.1																																																																																			.		0.388	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
LARGE	9215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	33670547	33670547	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr22:33670547C>T	ENST00000354992.2	-	16	2708	c.2137G>A	c.(2137-2139)Gac>Aac	p.D713N	LARGE_ENST00000437602.2_Missense_Mutation_p.D664N|LARGE_ENST00000337431.2_Missense_Mutation_p.D661N|LARGE_ENST00000402320.1_Missense_Mutation_p.D661N|LARGE_ENST00000452586.2_Missense_Mutation_p.D512N|LARGE_ENST00000397394.2_Missense_Mutation_p.D713N	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	713					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				TTGGTAATGTCGAAGCTGGGG	0.527											OREG0026497	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D713N	Colon(70;397 1175 4573 19089 45288)	.											.	LARGE	92	0			c.G2137A						.						155.0	127.0	137.0					22																	33670547		2203	4300	6503	SO:0001583	missense	9215	exon16			TAATGTCGAAGCT	AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.2137G>A	22.37:g.33670547C>T	ENSP00000347088:p.Asp713Asn	148.0	0.0	841	187.0	41.0	NM_004737	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	ENST00000354992.2	37	CCDS13912.1	.	.	.	.	.	.	.	.	.	.	C	36	5.686561	0.96784	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602	T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	M	0.88775	2.98	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.998;0.913;0.981;0.998	T	0.60120	-0.7325	10	0.62326	D	0.03	0.0016	20.8598	0.99761	0.0:1.0:0.0:0.0	.	664;512;661;713	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	N	713;661;713;661;512;664	ENSP00000347088:D713N;ENSP00000336636:D661N;ENSP00000380549:D713N;ENSP00000385223:D661N;ENSP00000407917:D512N;ENSP00000388544:D664N	ENSP00000336636:D661N	D	-	1	0	LARGE	32000547	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.348000	0.79366	2.937000	0.99478	0.650000	0.86243	GAC	.		0.527	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642	
LBR	3930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225609820	225609820	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:225609820C>A	ENST00000338179.2	-	3	450	c.325G>T	c.(325-327)Gca>Tca	p.A109S	LBR_ENST00000272163.4_Missense_Mutation_p.A109S|LBR_ENST00000487054.1_5'Flank	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	109					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		TCCCTCCTTGCTTCCTTAATG	0.493																																					p.A109S		.											.	LBR	228	0			c.G325T						.						93.0	90.0	91.0					1																	225609820		2203	4300	6503	SO:0001583	missense	3930	exon3			TCCTTGCTTCCTT	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.325G>T	1.37:g.225609820C>A	ENSP00000339883:p.Ala109Ser	69.0	0.0		76.0	16.0	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	37	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	C	6.172	0.400008	0.11696	.	.	ENSG00000143815	ENST00000272163;ENST00000338179;ENST00000425080	D;D;T	0.96685	-4.09;-4.09;0.63	5.1	-0.241	0.13043	.	0.982188	0.08369	N	0.956357	D	0.89918	0.6854	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.77667	-0.2502	10	0.08599	T	0.76	-12.4429	3.909	0.09194	0.1489:0.3148:0.0:0.5364	.	109;109	C9JXK0;Q14739	.;LBR_HUMAN	S	109	ENSP00000272163:A109S;ENSP00000339883:A109S;ENSP00000388059:A109S	ENSP00000272163:A109S	A	-	1	0	LBR	223676443	0.000000	0.05858	0.009000	0.14445	0.946000	0.59487	0.026000	0.13599	-0.116000	0.11893	0.655000	0.94253	GCA	.		0.493	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141598619	141598619	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:141598619C>T	ENST00000389484.3	-	30	5953	c.4982G>A	c.(4981-4983)cGt>cAt	p.R1661H		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1661					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTATAAATTACGTGACACCCA	0.373										TSP Lung(27;0.18)																											p.R1661H	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.G4982A						.						135.0	125.0	129.0					2																	141598619		2203	4300	6503	SO:0001583	missense	53353	exon30			AAATTACGTGACA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4982G>A	2.37:g.141598619C>T	ENSP00000374135:p.Arg1661His	193.0	0.0		170.0	45.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463445	0.84425	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91740	-2.9	5.44	5.44	0.79542	Six-bladed beta-propeller, TolB-like (1);	0.066897	0.56097	U	0.000027	D	0.93969	0.8069	M	0.64260	1.97	0.48341	D	0.999635	D	0.67145	0.996	P	0.53689	0.732	D	0.94199	0.7448	10	0.62326	D	0.03	.	19.2577	0.93952	0.0:1.0:0.0:0.0	.	1661	Q9NZR2	LRP1B_HUMAN	H	1661;1599	ENSP00000374135:R1661H	ENSP00000374135:R1661H	R	-	2	0	LRP1B	141315089	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.978000	0.56881	2.563000	0.86464	0.460000	0.39030	CGT	.		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRRC32	2615	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	76371941	76371941	+	Silent	SNP	G	G	T	rs180783243		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr11:76371941G>T	ENST00000407242.2	-	3	938	c.696C>A	c.(694-696)gcC>gcA	p.A232A	LRRC32_ENST00000260061.5_Silent_p.A232A|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000404995.1_Silent_p.A232A|LRRC32_ENST00000464145.1_Intron	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	232					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						CCGTCTGAAAGGCCTCGATGC	0.617																																					p.A232A		.											.	LRRC32	90	0			c.C696A						.						44.0	47.0	46.0					11																	76371941		2200	4292	6492	SO:0001819	synonymous_variant	2615	exon3			CTGAAAGGCCTCG	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.696C>A	11.37:g.76371941G>T		85.0	0.0		80.0	20.0	NM_005512	Q86V06	Silent	SNP	ENST00000407242.2	37	CCDS8245.1																																																																																			G|0.999;C|0.001		0.617	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
EDF1	8721	ucsc.edu;bcgsc.ca	37	9	139755018	139755018	+	IGR	SNP	G	G	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr9:139755018G>C	ENST00000224073.1	-	0	640				MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000445819.1_Missense_Mutation_p.G1205A|MAMDC4_ENST00000317446.2_Missense_Mutation_p.G1126A	NM_003792.2	NP_003783.1	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1						endothelial cell differentiation (GO:0045446)|multicellular organismal development (GO:0007275)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			lung(1)	1	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TCCTAGGATGGTGTCACCCTC	0.547																																					p.G1126A		.											.	MAMDC4	156	0			c.G3377C						.						69.0	57.0	61.0					9																	139755018		2202	4299	6501	SO:0001628	intergenic_variant	158056	exon27			AGGATGGTGTCAC	AJ005259	CCDS7011.1, CCDS7012.1, CCDS65193.1	9q34.3	2009-11-06			ENSG00000107223	ENSG00000107223			3164	protein-coding gene	gene with protein product	"""multiprotein bridging factor-1"""	605107				9813014, 15112053	Standard	NM_003792		Approved	EDF-1	uc004cjt.1	O60869	OTTHUMG00000020948		9.37:g.139755018G>C		64.0	0.0		45.0	4.0	NM_206920	Q5T5T2|Q9UIM1	Missense_Mutation	SNP	ENST00000224073.1	37	CCDS7011.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.299|0.299	-0.975240|-0.975240	0.02215|0.02215	.|.	.|.	ENSG00000177943|ENSG00000177943	ENST00000317446;ENST00000445819|ENST00000413647	T;T|.	0.01981|.	4.59;4.52|.	3.47|3.47	-5.33|-5.33	0.02713|0.02713	.|.	1.811830|.	0.03136|.	N|.	0.165934|.	T|T	0.34687|0.34687	0.0906|0.0906	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	B;B|.	0.25904|.	0.07;0.137|.	B;B|.	0.28011|.	0.024;0.085|.	T|T	0.41070|0.41070	-0.9529|-0.9529	10|5	0.36615|.	T|.	0.2|.	9.7879|9.7879	11.3772|11.3772	0.49735|0.49735	0.2491:0.0:0.7509:0.0|0.2491:0.0:0.7509:0.0	.|.	1205;1126|.	Q6UXC1;Q6UXC1-2|.	AEGP_HUMAN;.|.	A|C	1126;1205|1190	ENSP00000319388:G1126A;ENSP00000411339:G1205A|.	ENSP00000319388:G1126A|.	G|W	+|+	2|3	0|0	MAMDC4|MAMDC4	138874839|138874839	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.024000|0.024000	0.10985|0.10985	-1.323000|-1.323000	0.02692|0.02692	-0.959000|-0.959000	0.03618|0.03618	-0.367000|-0.367000	0.07326|0.07326	GGT|TGG	.		0.547	EDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055143.1		
MAP3K14	9020	broad.mit.edu;ucsc.edu;mdanderson.org	37	17	43367973	43367973	+	RNA	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:43367973T>C	ENST00000344686.2	-	0	247							Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase 14						cellular response to mechanical stimulus (GO:0071260)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|T cell costimulation (GO:0031295)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|NF-kappaB-inducing kinase activity (GO:0004704)|protein kinase activity (GO:0004672)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27						ACAGGGCTCTTCTCCACGGCC	0.582																																					.		.											.	MAP3K14	1453	0			.						.						93.0	100.0	98.0					17																	43367973		2012	4180	6192			9020	.			GGCTCTTCTCCAC	Y10256	CCDS74079.1	17q21.31	2014-06-16			ENSG00000006062	ENSG00000006062	2.7.11.25	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6853	protein-coding gene	gene with protein product	"""serine/threonine protein-kinase"""	604655				9020361	Standard	NM_003954		Approved	NIK, HSNIK, FTDCR1B, HS	uc002iiw.1	Q99558	OTTHUMG00000180364		17.37:g.43367973T>C		322.0	0.0		281.0	55.0	.	A8K2D8|D3DX67|Q8IYN1	RNA	SNP	ENST00000344686.2	37		.	.	.	.	.	.	.	.	.	.	T	14.61	2.587948	0.46110	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.81	4.71	0.59529	.	0.222293	0.40064	N	0.001181	T	0.36026	0.0952	.	.	.	0.31591	N	0.653833	P	0.39665	0.682	B	0.30401	0.115	T	0.54483	-0.8287	7	0.72032	D	0.01	.	10.987	0.47528	0.0:0.0:0.1563:0.8436	.	47	Q99558	M3K14_HUMAN	E	47	.	ENSP00000342059:K47E	K	-	1	0	MAP3K14	40723756	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	3.293000	0.51779	0.998000	0.38996	0.379000	0.24179	AAG	.		0.582	MAP3K14-201	KNOWN	basic	processed_transcript	processed_transcript		NM_003954	
MDN1	23195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	90371908	90371908	+	Silent	SNP	T	T	C	rs549598677	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:90371908T>C	ENST00000369393.3	-	87	14578	c.14463A>G	c.(14461-14463)tcA>tcG	p.S4821S	MDN1_ENST00000428876.1_Silent_p.S4821S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4821					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TATCTTTGTTTGAATTGCCAC	0.358																																					p.S4821S		.											.	MDN1	100	0			c.A14463G						.						237.0	214.0	222.0					6																	90371908		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon87			TTTGTTTGAATTG	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.14463A>G	6.37:g.90371908T>C		735.0	0.0		565.0	146.0	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	37	CCDS5024.1																																																																																			.		0.358	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
MIA3	375056	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	222802656	222802656	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:222802656delG	ENST00000344922.5	+	4	2119	c.2094delG	c.(2092-2094)cagfs	p.Q698fs	MIA3_ENST00000344441.6_Frame_Shift_Del_p.Q698fs|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	698					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		AGGCAATGCAGGGCACAGAGG	0.468																																					p.Q698fs		.											.	MIA3	98	0			c.2094delG						.						91.0	93.0	92.0					1																	222802656		1992	4177	6169	SO:0001589	frameshift_variant	375056	exon4			AATGCAGGGCACA		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.2094delG	1.37:g.222802656delG	ENSP00000340900:p.Gln698fs	147.0	0.0		153.0	27.0	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Frame_Shift_Del	DEL	ENST00000344922.5	37	CCDS41470.1																																																																																			.		0.468	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
MMP15	4324	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	58079051	58079051	+	Missense_Mutation	SNP	G	G	A	rs372389085		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr16:58079051G>A	ENST00000219271.3	+	10	2496	c.1711G>A	c.(1711-1713)Gac>Aac	p.D571N		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	571					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	CCGATGGCCCGACGTGGCCCG	0.726																																					p.D571N		.											.	MMP15	713	0			c.G1711A						.						11.0	13.0	12.0					16																	58079051		2193	4287	6480	SO:0001583	missense	4324	exon10			TGGCCCGACGTGG	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.1711G>A	16.37:g.58079051G>A	ENSP00000219271:p.Asp571Asn	28.0	0.0		70.0	32.0	NM_002428	A0A2U6|Q14111	Missense_Mutation	SNP	ENST00000219271.3	37	CCDS10792.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033833	0.75504	.	.	ENSG00000102996	ENST00000219271	T	0.16597	2.33	4.65	3.68	0.42216	.	0.107611	0.64402	D	0.000009	T	0.08492	0.0211	N	0.08118	0	0.58432	D	0.999999	P	0.45827	0.867	B	0.38880	0.284	T	0.29088	-1.0023	10	0.32370	T	0.25	.	12.3011	0.54874	0.0:0.1851:0.8149:0.0	.	571	P51511	MMP15_HUMAN	N	571	ENSP00000219271:D571N	ENSP00000219271:D571N	D	+	1	0	MMP15	56636552	1.000000	0.71417	0.961000	0.40146	0.466000	0.32739	6.250000	0.72435	1.163000	0.42636	0.555000	0.69702	GAC	.		0.726	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428	
MSN	4478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	64957171	64957171	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:64957171C>T	ENST00000360270.5	+	10	1394	c.1222C>T	c.(1222-1224)Cgg>Tgg	p.R408W		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	408					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						GCAGGCCTCCCGGGACCAGAA	0.542			T	ALK	ALCL																																p.R408W		.		Dom	yes		X	Xq11.2-q12	4478	moesin		L	.	MSN	1086	0			c.C1222T						.						26.0	25.0	26.0					X																	64957171		2203	4300	6503	SO:0001583	missense	4478	exon10			GCCTCCCGGGACC	M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1222C>T	X.37:g.64957171C>T	ENSP00000353408:p.Arg408Trp	275.0	0.0		324.0	46.0	NM_002444		Missense_Mutation	SNP	ENST00000360270.5	37	CCDS14382.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307067	0.60305	.	.	ENSG00000147065	ENST00000360270	D	0.86366	-2.11	4.97	3.12	0.35913	Ezrin/radixin/moesin, C-terminal (1);	0.475980	0.25132	N	0.032895	D	0.88020	0.6325	L	0.44542	1.39	0.23820	N	0.996756	P	0.37573	0.6	P	0.51453	0.67	T	0.81217	-0.1033	10	0.87932	D	0	.	11.7058	0.51597	0.3168:0.6832:0.0:0.0	.	408	P26038	MOES_HUMAN	W	408	ENSP00000353408:R408W	ENSP00000353408:R408W	R	+	1	2	MSN	64873896	0.954000	0.32549	0.135000	0.22099	0.968000	0.65278	1.925000	0.40074	0.450000	0.26774	0.594000	0.82650	CGG	.		0.542	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056981.1	NM_002444	
MTMR3	8897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	30415674	30415674	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr22:30415674G>A	ENST00000401950.2	+	17	2368	c.2026G>A	c.(2026-2028)Gcc>Acc	p.A676T	MTMR3_ENST00000333027.3_Missense_Mutation_p.A676T|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000406629.1_Missense_Mutation_p.A676T|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000323630.5_Missense_Mutation_p.A540T|MTMR3_ENST00000351488.3_Missense_Mutation_p.A676T	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	676					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			GCCGGGGGGTGCCGAGCTTTC	0.632																																					p.A676T		.											.	MTMR3	292	0			c.G2026A						.						52.0	62.0	59.0					22																	30415674		2203	4300	6503	SO:0001583	missense	8897	exon17			GGGGGTGCCGAGC	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2026G>A	22.37:g.30415674G>A	ENSP00000384651:p.Ala676Thr	71.0	0.0		70.0	18.0	NM_153050	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	ENST00000401950.2	37	CCDS13870.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410194	0.83340	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.94931	-3.34;-3.32;-3.56;-3.37;-3.32	5.8	5.8	0.92144	.	2.069360	0.01706	N	0.027425	D	0.93628	0.7965	L	0.27053	0.805	0.80722	D	1	D;D;D	0.54397	0.957;0.966;0.957	P;P;P	0.50490	0.642;0.524;0.642	T	0.80339	-0.1424	10	0.02654	T	1	.	19.0512	0.93046	0.0:0.0:1.0:0.0	.	676;676;676	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	T	676;676;540;676;676	ENSP00000384651:A676T;ENSP00000331649:A676T;ENSP00000318070:A540T;ENSP00000307271:A676T;ENSP00000384077:A676T	ENSP00000318070:A540T	A	+	1	0	MTMR3	28745674	1.000000	0.71417	0.211000	0.23655	0.573000	0.36030	7.463000	0.80869	2.735000	0.93741	0.655000	0.94253	GCC	.		0.632	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9087246	9087246	+	Silent	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:9087246G>T	ENST00000397910.4	-	1	4772	c.4569C>A	c.(4567-4569)atC>atA	p.I1523I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1523	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCAAACTCCTGATTCCTAGGT	0.468																																					p.I1523I		.											.	MUC16	566	0			c.C4569A						.						285.0	266.0	272.0					19																	9087246		1998	4160	6158	SO:0001819	synonymous_variant	94025	exon1			ACTCCTGATTCCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4569C>A	19.37:g.9087246G>T		210.0	0.0		298.0	54.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MYOCD	93649	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12626295	12626295	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:12626295G>T	ENST00000343344.4	+	5	385	c.385G>T	c.(385-387)Gtg>Ttg	p.V129L	MYOCD_ENST00000425538.1_Missense_Mutation_p.V129L|MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Missense_Mutation_p.V33L			Q8IZQ8	MYCD_HUMAN	myocardin	129					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CATTCTTCCTGTGGATTCTGC	0.478																																					p.V129L		.											.	MYOCD	93	0			c.G385T						.						122.0	124.0	124.0					17																	12626295		2203	4300	6503	SO:0001583	missense	93649	exon5			CTTCCTGTGGATT	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.385G>T	17.37:g.12626295G>T	ENSP00000341835:p.Val129Leu	145.0	1.0		112.0	42.0	NM_001146312	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781415	0.49891	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	T	0.52983	0.64	5.33	3.28	0.37604	.	0.543957	0.19750	N	0.106905	T	0.41259	0.1151	L	0.58101	1.795	0.36866	D	0.888651	B;B;B	0.21147	0.052;0.001;0.0	B;B;B	0.19148	0.024;0.0;0.0	T	0.47484	-0.9114	10	0.45353	T	0.12	-13.5981	8.3373	0.32221	0.254:0.0:0.746:0.0	.	33;129;129	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	L	129;129;33	ENSP00000341835:V129L	ENSP00000341835:V129L	V	+	1	0	MYOCD	12567020	1.000000	0.71417	0.841000	0.33234	0.996000	0.88848	4.641000	0.61375	1.452000	0.47756	0.561000	0.74099	GTG	.		0.478	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
NASP	4678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46083194	46083194	+	Silent	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:46083194G>A	ENST00000350030.3	+	14	2304	c.2217G>A	c.(2215-2217)ccG>ccA	p.P739P	NASP_ENST00000530073.1_3'UTR|NASP_ENST00000351223.3_Silent_p.P400P|NASP_ENST00000372052.4_Silent_p.P373P|NASP_ENST00000402363.3_Silent_p.P741P|NASP_ENST00000537798.1_Silent_p.P675P	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	739					blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					AACAAGAGCCGGAGGTGAACG	0.493																																					p.P739P		.											.	NASP	91	0			c.G2217A						.						102.0	89.0	94.0					1																	46083194		2203	4300	6503	SO:0001819	synonymous_variant	4678	exon14			AGAGCCGGAGGTG	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.2217G>A	1.37:g.46083194G>A		47.0	0.0		35.0	12.0	NM_002482	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Silent	SNP	ENST00000350030.3	37	CCDS524.1	.	.	.	.	.	.	.	.	.	.	G	9.102	1.004302	0.19199	.	.	ENSG00000132780	ENST00000531612	.	.	.	4.56	0.242	0.15498	.	.	.	.	.	T	0.51075	0.1653	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.39702	-0.9601	4	.	.	.	-3.0E-4	5.2561	0.15548	0.3982:0.0:0.4699:0.1319	.	.	.	.	Q	239	.	.	R	+	2	0	NASP	45855781	0.095000	0.21747	0.995000	0.50966	0.984000	0.73092	-0.075000	0.11431	0.245000	0.21373	0.563000	0.77884	CGG	.		0.493	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
NEK6	10783	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	127074912	127074912	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr9:127074912C>T	ENST00000320246.5	+	3	360	c.215C>T	c.(214-216)gCt>gTt	p.A72V	NEK6_ENST00000546191.1_Missense_Mutation_p.A72V|NEK6_ENST00000539416.1_Missense_Mutation_p.A97V|NEK6_ENST00000373600.3_Missense_Mutation_p.A106V|NEK6_ENST00000394199.2_Missense_Mutation_p.A106V|NEK6_ENST00000540326.1_Missense_Mutation_p.A90V|NEK6_ENST00000373603.1_Missense_Mutation_p.A72V|NEK6_ENST00000545174.1_Missense_Mutation_p.A72V	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	72	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						AAGACAGTGGCTCTGAAGAAG	0.607																																					p.A106V	NSCLC(122;934 1785 18647 44295 45571)	.											.	NEK6	334	0			c.C317T						.						67.0	53.0	58.0					9																	127074912		2203	4300	6503	SO:0001583	missense	10783	exon4			CAGTGGCTCTGAA	AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.215C>T	9.37:g.127074912C>T	ENSP00000319734:p.Ala72Val	49.0	0.0		26.0	6.0	NM_001166171	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Missense_Mutation	SNP	ENST00000320246.5	37	CCDS6854.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039895	0.93630	.	.	ENSG00000119408	ENST00000373603;ENST00000540326;ENST00000373600;ENST00000320246;ENST00000545174;ENST00000444973;ENST00000373596;ENST00000425237;ENST00000423785;ENST00000394199;ENST00000546191;ENST00000422297;ENST00000539416;ENST00000447379	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.61040	1.69;1.69;1.69;1.69;1.69;0.14;1.69;0.14;1.69;1.69;1.69;0.14;1.69;1.69	5.09	5.09	0.68999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67202	0.2868	L	0.49126	1.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.61893	-0.6969	10	0.02654	T	1	.	17.4721	0.87648	0.0:1.0:0.0:0.0	.	106;72;90	Q9HC98-2;Q9HC98;Q9HC98-3	.;NEK6_HUMAN;.	V	72;90;106;72;72;72;72;72;106;106;72;72;97;72	ENSP00000362705:A72V;ENSP00000441469:A90V;ENSP00000362702:A106V;ENSP00000319734:A72V;ENSP00000442636:A72V;ENSP00000389517:A72V;ENSP00000362698:A72V;ENSP00000403087:A72V;ENSP00000399847:A106V;ENSP00000377749:A106V;ENSP00000441426:A72V;ENSP00000411401:A72V;ENSP00000439651:A97V;ENSP00000403414:A72V	ENSP00000319734:A72V	A	+	2	0	NEK6	126114733	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.345000	0.79718	0.563000	0.77884	GCT	.		0.607	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054016.1	NM_014397	
NEO1	4756	broad.mit.edu;bcgsc.ca	37	15	73558728	73558728	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr15:73558728A>G	ENST00000339362.5	+	17	2917	c.2470A>G	c.(2470-2472)Agt>Ggt	p.S824G	NEO1_ENST00000558964.1_Missense_Mutation_p.S824G|NEO1_ENST00000560262.1_Missense_Mutation_p.S824G|NEO1_ENST00000261908.6_Missense_Mutation_p.S824G			Q92859	NEO1_HUMAN	neogenin 1	824	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						CCTGTATGAGAGTGCTGTGAC	0.443																																					p.S824G		.											.	NEO1	116	0			c.A2470G						.						133.0	122.0	126.0					15																	73558728		2198	4297	6495	SO:0001583	missense	4756	exon16			TATGAGAGTGCTG	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.2470A>G	15.37:g.73558728A>G	ENSP00000341198:p.Ser824Gly	141.0	0.0		124.0	6.0	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	37	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.841053	0.91197	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.24151	1.87;1.87	5.5	5.5	0.81552	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.41558	0.1164	L	0.50333	1.59	0.80722	D	1	D;P;P;D	0.65815	0.995;0.89;0.945;0.995	P;P;P;P	0.58780	0.845;0.659;0.799;0.834	T	0.19516	-1.0303	10	0.54805	T	0.06	-17.5155	15.9138	0.79496	1.0:0.0:0.0:0.0	.	824;824;562;824	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	G	824;562;824	ENSP00000341198:S824G;ENSP00000261908:S824G	ENSP00000261908:S824G	S	+	1	0	NEO1	71345781	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	9.257000	0.95545	2.216000	0.71823	0.533000	0.62120	AGT	.		0.443	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
NFATC4	4776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24845640	24845640	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr14:24845640G>A	ENST00000250373.4	+	9	2338	c.2197G>A	c.(2197-2199)Gaa>Aaa	p.E733K	NFATC4_ENST00000554591.1_Missense_Mutation_p.E796K|NFATC4_ENST00000556759.1_Missense_Mutation_p.E268K|NFATC4_ENST00000554966.1_Missense_Mutation_p.E746K|NFATC4_ENST00000554050.1_Missense_Mutation_p.E733K|NFATC4_ENST00000554661.1_Missense_Mutation_p.E663K|NFATC4_ENST00000556279.1_Missense_Mutation_p.E765K|NFATC4_ENST00000424781.2_Missense_Mutation_p.E746K|NFATC4_ENST00000413692.2_Missense_Mutation_p.E796K|NFATC4_ENST00000555453.1_Missense_Mutation_p.E721K|NFATC4_ENST00000553879.1_Missense_Mutation_p.E663K|NFATC4_ENST00000555590.1_Missense_Mutation_p.E746K|NFATC4_ENST00000555167.1_Missense_Mutation_p.E268K|NFATC4_ENST00000539237.2_Missense_Mutation_p.E765K|NFATC4_ENST00000555393.1_Missense_Mutation_p.E21K|NFATC4_ENST00000555802.1_Missense_Mutation_p.E21K|NFATC4_ENST00000557767.1_Missense_Mutation_p.E21K|NFATC4_ENST00000553708.1_Missense_Mutation_p.E733K|NFATC4_ENST00000556169.1_Missense_Mutation_p.E721K|NFATC4_ENST00000557451.1_Missense_Mutation_p.E663K|NFATC4_ENST00000554344.1_Missense_Mutation_p.E663K|NFATC4_ENST00000553469.1_Missense_Mutation_p.E765K|NFATC4_ENST00000422617.3_Missense_Mutation_p.E721K|NFATC4_ENST00000554473.1_Missense_Mutation_p.E268K	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	733	Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CCCTGCTTGCGAAACTCCTTA	0.617																																					p.E796K		.											.	NFATC4	92	0			c.G2386A						.						59.0	63.0	62.0					14																	24845640		2203	4300	6503	SO:0001583	missense	4776	exon10			GCTTGCGAAACTC	BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.2197G>A	14.37:g.24845640G>A	ENSP00000250373:p.Glu733Lys	147.0	0.0		108.0	23.0	NM_001198967	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	ENST00000250373.4	37	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021647	0.35701	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453;ENST00000554473;ENST00000556759;ENST00000555167;ENST00000557767;ENST00000555393;ENST00000555802	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56776	3.26;3.26;3.28;3.27;3.27;3.27;3.28;3.27;3.28;3.29;3.27;2.96;2.96;2.96;2.95;2.95;2.95;2.96;1.55;1.53;1.52;0.44;0.47	5.13	5.13	0.70059	.	0.000000	0.64402	D	0.000017	T	0.32406	0.0828	N	0.19112	0.55	0.27737	N	0.944606	B;B;B;B;B;B;B;B;B;B;B;B;B	0.33198	0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.401;0.279	B;B;B;B;B;B;B;B;B;B;B;B;B	0.26770	0.03;0.044;0.044;0.044;0.044;0.044;0.044;0.044;0.073;0.073;0.073;0.044;0.02	T	0.13335	-1.0513	10	0.09590	T	0.72	-5.1132	13.9397	0.64048	0.0:0.0:1.0:0.0	.	721;721;765;765;746;746;746;796;796;721;765;796;733	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	K	796;796;746;746;746;765;765;765;733;733;733;663;663;663;721;663;721;721;268;268;268;21;21;21	ENSP00000388910:E796K;ENSP00000452039:E796K;ENSP00000451224:E746K;ENSP00000450644:E746K;ENSP00000388668:E746K;ENSP00000439350:E765K;ENSP00000452270:E765K;ENSP00000451502:E765K;ENSP00000451151:E733K;ENSP00000250373:E733K;ENSP00000450590:E733K;ENSP00000452349:E663K;ENSP00000450469:E663K;ENSP00000450733:E663K;ENSP00000451454:E721K;ENSP00000451284:E663K;ENSP00000396788:E721K;ENSP00000450686:E721K;ENSP00000450810:E268K;ENSP00000451183:E268K;ENSP00000451395:E268K;ENSP00000451801:E21K;ENSP00000451590:E21K	ENSP00000250373:E733K	E	+	1	0	NFATC4	23915480	0.813000	0.29090	0.997000	0.53966	0.918000	0.54935	2.738000	0.47401	2.667000	0.90743	0.561000	0.74099	GAA	.		0.617	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
NFE2L1	4779	hgsc.bcm.edu;bcgsc.ca	37	17	46128958	46128959	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:46128958_46128959insC	ENST00000362042.3	+	2	1094_1095	c.478_479insC	c.(478-480)gccfs	p.A160fs	NFE2L1_ENST00000585291.1_Frame_Shift_Ins_p.A160fs|NFE2L1_ENST00000357480.5_Frame_Shift_Ins_p.A160fs|NFE2L1_ENST00000361665.3_Frame_Shift_Ins_p.A160fs	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	160	Asp/Glu-rich (acidic).				anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.V163fs*14(1)		cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGGGCTGTAGCCCCCCCAGTC	0.589																																					p.A160fs		.											.	NFE2L1	91	1	Insertion - Frameshift(1)	kidney(1)	c.478_479insC						.																																			SO:0001589	frameshift_variant	4779	exon2			GCTGTAGCCCCCC	AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.485dupC	17.37:g.46128965_46128965dupC	ENSP00000354855:p.Ala160fs	65.0	0.0		63.0	19.0	NM_003204	D3DTU3|D3DTU5|Q12877|Q96FN6	Frame_Shift_Ins	INS	ENST00000362042.3	37	CCDS11524.1																																																																																			.		0.589	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443019.1	NM_003204	
NFS1	9054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34286442	34286442	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr20:34286442C>T	ENST00000374092.4	-	2	238	c.168G>A	c.(166-168)ctG>ctA	p.L56L	ROMO1_ENST00000374078.1_5'Flank|NFS1_ENST00000540053.1_5'UTR|NFS1_ENST00000541387.1_Silent_p.L56L|NFS1_ENST00000374085.1_5'UTR|NFS1_ENST00000306750.3_Silent_p.L56L|ROMO1_ENST00000397416.1_5'Flank|ROMO1_ENST00000374072.1_5'Flank|ROMO1_ENST00000336695.4_5'Flank|ROMO1_ENST00000374077.3_5'Flank|NFS1_ENST00000397425.1_5'UTR	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	56					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	AGAGAGGTCGCAGCACTGGCC	0.532																																					p.L56L		.											.	NFS1	92	0			c.G168A						.						52.0	57.0	56.0					20																	34286442		2203	4300	6503	SO:0001819	synonymous_variant	9054	exon2			AGGTCGCAGCACT	AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.168G>A	20.37:g.34286442C>T		260.0	0.0		337.0	51.0	NM_021100	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Silent	SNP	ENST00000374092.4	37	CCDS13262.1																																																																																			.		0.532	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078936.4	NM_021100	
NLGN4X	57502	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	5811323	5811323	+	Silent	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:5811323A>G	ENST00000381095.3	-	6	2613	c.1986T>C	c.(1984-1986)acT>acC	p.T662T	NLGN4X_ENST00000538097.1_Silent_p.T662T|NLGN4X_ENST00000275857.6_Silent_p.T662T|NLGN4X_ENST00000381092.1_Silent_p.T662T|NLGN4X_ENST00000381093.2_Silent_p.T682T	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	662					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CAATGAGGACAGTTGTGTCCT	0.522																																					p.T662T		.											.	NLGN4X	195	0			c.T1986C						.						221.0	200.0	207.0					X																	5811323		2203	4300	6503	SO:0001819	synonymous_variant	57502	exon6			GAGGACAGTTGTG	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.1986T>C	X.37:g.5811323A>G		739.0	1.0		896.0	334.0	NM_181332	Q6UX10|Q9ULG0	Silent	SNP	ENST00000381095.3	37	CCDS14126.1																																																																																			.		0.522	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
NMU	10874	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	56475318	56475318	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr4:56475318A>C	ENST00000264218.3	-	4	353	c.248T>G	c.(247-249)tTt>tGt	p.F83C	NMU_ENST00000515325.1_5'UTR|NMU_ENST00000507338.1_Missense_Mutation_p.F83C|NMU_ENST00000511469.1_Missense_Mutation_p.F67C|NMU_ENST00000505262.1_Missense_Mutation_p.F83C	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	83					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		CATAATCATAAAGCAAAGCTC	0.358																																					p.F83C		.											.	NMU	650	0			c.T248G						.						116.0	115.0	115.0					4																	56475318		2203	4300	6503	SO:0001583	missense	10874	exon4			ATCATAAAGCAAA	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.248T>G	4.37:g.56475318A>C	ENSP00000264218:p.Phe83Cys	131.0	0.0		194.0	33.0	NM_006681		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	.	.	.	.	.	.	.	.	.	.	A	12.54	1.968839	0.34754	.	.	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.55588	0.51;0.51;1.35;0.51	5.51	-0.0158	0.13974	.	0.597682	0.17095	N	0.187215	T	0.43875	0.1267	L	0.52573	1.65	0.09310	N	1	D	0.59357	0.985	P	0.46796	0.527	T	0.35674	-0.9779	10	0.56958	D	0.05	-12.8858	3.17	0.06549	0.6336:0.1195:0.1228:0.124	.	83	P48645	NMU_HUMAN	C	67;83;83;83;83	ENSP00000422399:F67C;ENSP00000264218:F83C;ENSP00000424246:F83C;ENSP00000422870:F83C	ENSP00000264218:F83C	F	-	2	0	NMU	56170075	0.055000	0.20627	0.004000	0.12327	0.420000	0.31355	1.456000	0.35201	0.161000	0.19458	0.533000	0.62120	TTT	.		0.358	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
NOS2	4843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26088234	26088234	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:26088234C>T	ENST00000313735.6	-	23	3057	c.2824G>A	c.(2824-2826)Ggc>Agc	p.G942S		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	942	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CTGCAGACGCCGTGGTGCAGG	0.627																																					p.G942S		.											.	NOS2	156	0			c.G2824A						.						55.0	47.0	50.0					17																	26088234		2203	4299	6502	SO:0001583	missense	4843	exon23			AGACGCCGTGGTG	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2824G>A	17.37:g.26088234C>T	ENSP00000327251:p.Gly942Ser	182.0	0.0		133.0	38.0	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	C	34	5.349011	0.95807	.	.	ENSG00000007171	ENST00000313735;ENST00000379105	D	0.88818	-2.43	4.76	4.76	0.60689	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.96738	0.8935	H	0.98133	4.155	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98534	1.0629	10	0.87932	D	0	.	16.8272	0.85934	0.0:1.0:0.0:0.0	.	942	P35228	NOS2_HUMAN	S	942;903	ENSP00000327251:G942S	ENSP00000327251:G942S	G	-	1	0	NOS2	23112361	1.000000	0.71417	0.977000	0.42913	0.957000	0.61999	7.764000	0.85297	2.225000	0.72522	0.456000	0.33151	GGC	.		0.627	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
NOTCH4	4855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32181471	32181471	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:32181471C>A	ENST00000375023.3	-	14	2452	c.2314G>T	c.(2314-2316)Gtg>Ttg	p.V772L	NOTCH4_ENST00000465528.1_5'UTR	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	772	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TCACCAGACACACAGTAGTCA	0.527																																					p.V772L		.											.	NOTCH4	1321	0			c.G2314T						.						115.0	107.0	110.0					6																	32181471		1509	2708	4217	SO:0001583	missense	4855	exon14			CAGACACACAGTA		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2314G>T	6.37:g.32181471C>A	ENSP00000364163:p.Val772Leu	87.0	0.0		115.0	20.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	C	5.248	0.231209	0.09969	.	.	ENSG00000204301	ENST00000375023	T	0.61274	0.12	3.88	3.0	0.34707	EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	1.143020	0.06809	N	0.790025	T	0.17109	0.0411	N	0.02802	-0.49	0.53688	D	0.999977	B	0.10296	0.003	B	0.13407	0.009	T	0.42849	-0.9427	10	0.87932	D	0	.	4.9258	0.13892	0.0:0.6603:0.221:0.1188	.	772	Q99466	NOTC4_HUMAN	L	772	ENSP00000364163:V772L	ENSP00000364163:V772L	V	-	1	0	NOTCH4	32289449	0.000000	0.05858	0.895000	0.35142	0.005000	0.04900	-0.327000	0.07955	2.169000	0.68431	0.561000	0.74099	GTG	.		0.527	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
NPY5R	4889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	164271533	164271533	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr4:164271533T>G	ENST00000515560.1	+	4	1630	c.108T>G	c.(106-108)agT>agG	p.S36R	NPY5R_ENST00000506953.1_Missense_Mutation_p.S36R|NPY5R_ENST00000338566.3_Missense_Mutation_p.S36R			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	36					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				ATAAAAGCAGTGTAGATGACT	0.388																																					p.S36R	Melanoma(139;1287 1774 9781 19750 25599)	.											.	NPY5R	523	0			c.T108G						.						99.0	95.0	96.0					4																	164271533		2203	4300	6503	SO:0001583	missense	4889	exon4			AAGCAGTGTAGAT	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.108T>G	4.37:g.164271533T>G	ENSP00000423917:p.Ser36Arg	335.0	0.0		374.0	89.0	NM_006174	Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	37	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.563312	0.27915	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.37235	1.21;1.21;1.21	5.35	0.222	0.15288	.	0.356841	0.23442	N	0.048125	T	0.25344	0.0616	L	0.32530	0.975	0.46061	D	0.998848	B	0.13594	0.008	B	0.15870	0.014	T	0.06338	-1.0832	10	0.52906	T	0.07	.	10.306	0.43680	0.0:0.446:0.0:0.554	.	36	Q15761	NPY5R_HUMAN	R	36	ENSP00000339377:S36R;ENSP00000423917:S36R;ENSP00000423474:S36R	ENSP00000339377:S36R	S	+	3	2	NPY5R	164490983	0.982000	0.34865	0.995000	0.50966	0.967000	0.64934	-0.013000	0.12678	-0.100000	0.12241	-0.274000	0.10170	AGT	.		0.388	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174	
OAS1	4938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	113344971	113344971	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:113344971G>T	ENST00000202917.5	+	1	390	c.127G>T	c.(127-129)Gaa>Taa	p.E43*	RP1-71H24.1_ENST00000552784.1_RNA|OAS1_ENST00000553185.1_Nonsense_Mutation_p.E43*|OAS1_ENST00000452357.2_Nonsense_Mutation_p.E43*|OAS1_ENST00000551241.1_Nonsense_Mutation_p.E43*|OAS1_ENST00000445409.2_Nonsense_Mutation_p.E43*	NM_016816.2	NP_058132.2	P00973	OAS1_HUMAN	2'-5'-oligoadenylate synthetase 1, 40/46kDa	43	Interaction with dsRNA.				cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|protein oligomerization (GO:0051259)|purine nucleotide biosynthetic process (GO:0006164)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)|skin(1)	16						GTTCCTGAAGGAAAGGTGCTT	0.522																																					p.E43X		.											.	OAS1	70	0			c.G127T						.						233.0	198.0	210.0					12																	113344971		2203	4300	6503	SO:0001587	stop_gained	4938	exon1			CTGAAGGAAAGGT	X04371	CCDS31905.1, CCDS41838.1, CCDS44980.1	12q24.2	2014-05-21	2011-07-21				2.7.7.-		8086	protein-coding gene	gene with protein product		164350	"""2',5'-oligoadenylate synthetase 1 (40-46 kD)"""	OIAS		9344649, 9325053	Standard	XM_006719434		Approved	OIASI, IFI-4	uc001tud.3	P00973		ENST00000202917.5:c.127G>T	12.37:g.113344971G>T	ENSP00000202917:p.Glu43*	332.0	0.0		305.0	92.0	NM_001032409	A8K4N8|P04820|P29080|P29081|P78485|P78486|Q16700|Q16701|Q1PG42|Q3ZM01|Q53GC5|Q53YA4|Q6A1Z3|Q6IPC6|Q6P7N9|Q96J61	Nonsense_Mutation	SNP	ENST00000202917.5	37	CCDS41838.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679336	0.88542	.	.	ENSG00000089127	ENST00000202917;ENST00000445409;ENST00000452357;ENST00000550883;ENST00000549820;ENST00000551241;ENST00000377508;ENST00000553185;ENST00000550689	.	.	.	5.26	5.26	0.73747	.	0.116612	0.38720	N	0.001581	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-46.8389	14.245	0.65983	0.0:0.0:1.0:0.0	.	.	.	.	X	43;43;43;43;43;43;43;43;39	.	ENSP00000202917:E43X	E	+	1	0	OAS1	111829354	0.992000	0.36948	0.996000	0.52242	0.424000	0.31475	1.935000	0.40173	2.746000	0.94184	0.655000	0.94253	GAA	.		0.522	OAS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405896.2		
OR10X1	128367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158549059	158549059	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:158549059T>C	ENST00000368150.1	-	1	630	c.631A>G	c.(631-633)Aca>Gca	p.T211A		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					ATGAATTCTGTGTGGTTACTG	0.428																																					p.T211A		.											.	OR10X1	69	0			c.A631G						.						96.0	96.0	96.0					1																	158549059		2203	4300	6503	SO:0001583	missense	128367	exon1			ATTCTGTGTGGTT	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.631A>G	1.37:g.158549059T>C	ENSP00000357132:p.Thr211Ala	159.0	0.0		235.0	39.0	NM_001004477	Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	T	6.748	0.506903	0.12883	.	.	ENSG00000186400	ENST00000368150	T	0.00069	8.77	4.8	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.128800	0.35466	N	0.003199	T	0.00039	0.0001	N	0.16790	0.44	0.09310	N	1	P	0.43857	0.819	B	0.43838	0.433	T	0.00001	-1.2759	10	0.62326	D	0.03	.	4.874	0.13648	0.1654:0.0883:0.0:0.7463	.	211	Q8NGY0	O10X1_HUMAN	A	211	ENSP00000357132:T211A	ENSP00000357132:T211A	T	-	1	0	OR10X1	156815683	0.000000	0.05858	0.364000	0.25888	0.018000	0.09664	-0.008000	0.12788	0.809000	0.34255	0.460000	0.39030	ACA	.		0.428	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477	
OR52M1	119772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4567048	4567048	+	Silent	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr11:4567048T>C	ENST00000360213.1	+	1	628	c.628T>C	c.(628-630)Ttg>Ctg	p.L210L		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTTCTGGTGTTGATCCTGGA	0.522																																					p.L210L		.											.	OR52M1	68	0			c.T628C						.						259.0	244.0	249.0					11																	4567048		2201	4298	6499	SO:0001819	synonymous_variant	119772	exon1			CTGGTGTTGATCC	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.628T>C	11.37:g.4567048T>C		324.0	0.0		374.0	78.0	NM_001004137		Silent	SNP	ENST00000360213.1	37	CCDS31353.1																																																																																			.		0.522	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137	
OR51G1	79324	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4945133	4945133	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr11:4945133A>G	ENST00000321961.2	-	1	504	c.437T>C	c.(436-438)aTg>aCg	p.M146T	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCTTAGCCCCATCTTGACAAT	0.537																																					p.M146T		.											.	OR51G1	70	0			c.T437C						.						103.0	87.0	92.0					11																	4945133		2201	4298	6499	SO:0001583	missense	79324	exon1			AGCCCCATCTTGA	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.437T>C	11.37:g.4945133A>G	ENSP00000322546:p.Met146Thr	44.0	0.0		50.0	10.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	37	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	A	3.259	-0.151529	0.06585	.	.	ENSG00000176879	ENST00000321961	T	0.38240	1.15	4.2	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	0.149941	0.30911	U	0.008626	T	0.32376	0.0827	L	0.60012	1.86	0.09310	N	1	B	0.22683	0.073	B	0.25987	0.065	T	0.27706	-1.0066	10	0.49607	T	0.09	.	6.8733	0.24133	0.8007:0.0:0.1993:0.0	.	146	Q8NGK1	O51G1_HUMAN	T	146	ENSP00000322546:M146T	ENSP00000322546:M146T	M	-	2	0	OR51G1	4901709	0.018000	0.18449	0.546000	0.28166	0.272000	0.26649	1.655000	0.37345	0.653000	0.30826	0.455000	0.32223	ATG	.		0.537	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
PCDH8	5100	ucsc.edu;bcgsc.ca	37	13	53422356	53422356	+	Silent	SNP	A	A	G	rs373005195		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr13:53422356A>G	ENST00000377942.3	-	1	419	c.216T>C	c.(214-216)tcT>tcC	p.S72S	PCDH8_ENST00000338862.4_Silent_p.S72S	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	72	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CCCGGAGCAGAGAGCTGTTGA	0.672																																					p.S72S	GBM(36;25 841 9273 49207)	.											.	PCDH8	153	0			c.T216C						.	A	,	0,4406		0,0,2203	70.0	72.0	72.0		216,216	2.7	1.0	13		72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PCDH8	NM_002590.3,NM_032949.2	,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,	72/1071,72/974	53422356	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5100	exon1			GAGCAGAGAGCTG	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.216T>C	13.37:g.53422356A>G		33.0	0.0		41.0	5.0	NM_032949	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Silent	SNP	ENST00000377942.3	37	CCDS9438.1																																																																																			.		0.672	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
PCDHA7	56141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140216086	140216086	+	Silent	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr5:140216086G>T	ENST00000525929.1	+	1	2118	c.2118G>T	c.(2116-2118)gcG>gcT	p.A706A	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000378125.3_Silent_p.A706A|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	706					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCATCTGCGCGGTGTCCAGTC	0.617																																					p.A706A	NSCLC(160;258 2013 5070 22440 28951)	.											.	PCDHA7	94	0			c.G2118T						.						120.0	101.0	107.0					5																	140216086		2203	4300	6503	SO:0001819	synonymous_variant	56141	exon1			CTGCGCGGTGTCC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2118G>T	5.37:g.140216086G>T		364.0	0.0		490.0	279.0	NM_031852	O75282	Silent	SNP	ENST00000525929.1	37	CCDS54918.1																																																																																			.		0.617	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140222188	140222188	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr5:140222188C>T	ENST00000531613.1	+	1	1282	c.1282C>T	c.(1282-1284)Cgg>Tgg	p.R428W	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.R428W|PCDHA6_ENST00000527624.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	428	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTAACCGCGCGGGACGGGGG	0.632																																					p.R428W		.											.	PCDHA8	92	0			c.C1282T						.						77.0	72.0	74.0					5																	140222188		2194	4262	6456	SO:0001583	missense	56140	exon1			ACCGCGCGGGACG	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1282C>T	5.37:g.140222188C>T	ENSP00000434655:p.Arg428Trp	322.0	0.0		339.0	58.0	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	37	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	C	6.302	0.423734	0.11928	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.01804	4.63;4.63	3.72	0.308	0.15815	Cadherin (5);Cadherin-like (1);	0.000000	0.33732	U	0.004611	T	0.01320	0.0043	N	0.17922	0.545	0.09310	N	1	P;P	0.39665	0.682;0.631	B;B	0.35931	0.214;0.136	T	0.51116	-0.8746	10	0.66056	D	0.02	.	8.5805	0.33626	0.4619:0.4082:0.1299:0.0	.	428;428	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	W	428	ENSP00000434655:R428W;ENSP00000367363:R428W	ENSP00000367363:R428W	R	+	1	2	PCDHA8	140202372	0.000000	0.05858	0.004000	0.12327	0.117000	0.20001	-1.572000	0.02136	0.144000	0.18951	0.306000	0.20318	CGG	.		0.632	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PEAK1	79834	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	77407621	77407621	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr15:77407621T>C	ENST00000560626.2	-	7	4593	c.4118A>G	c.(4117-4119)cAc>cGc	p.H1373R	PEAK1_ENST00000312493.4_Missense_Mutation_p.H1373R			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AGCCAAGCTGTGATAATACTG	0.428																																					p.H1373R		.											.	.	.	0			c.A4118G						.						69.0	62.0	64.0					15																	77407621		1918	4135	6053	SO:0001583	missense	0	exon8			AAGCTGTGATAAT		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4118A>G	15.37:g.77407621T>C	ENSP00000452796:p.His1373Arg	78.0	0.0		64.0	9.0	NM_024776	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.032294	0.75504	.	.	ENSG00000173517	ENST00000312493	T	0.70516	-0.49	5.35	5.35	0.76521	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000001	T	0.81418	0.4818	M	0.62723	1.935	0.58432	D	0.999991	D	0.89917	1.0	D	0.69307	0.963	T	0.82827	-0.0265	10	0.56958	D	0.05	-9.3876	15.328	0.74182	0.0:0.0:0.0:1.0	.	1373	Q9H792	PEAK1_HUMAN	R	1373	ENSP00000309230:H1373R	ENSP00000309230:H1373R	H	-	2	0	AC087465.1	75194676	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.040000	0.89188	2.044000	0.60594	0.459000	0.35465	CAC	.		0.428	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
PDE8A	5151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	85660890	85660890	+	Silent	SNP	T	T	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr15:85660890T>A	ENST00000310298.4	+	18	1806	c.1554T>A	c.(1552-1554)ggT>ggA	p.G518G	PDE8A_ENST00000557957.1_Silent_p.G446G|PDE8A_ENST00000394553.1_Silent_p.G518G|PDE8A_ENST00000339708.5_Silent_p.G472G			O60658	PDE8A_HUMAN	phosphodiesterase 8A	518					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	TTTATCTTGGTCTCAAAATGT	0.393																																					p.G518G		.											.	PDE8A	94	0			c.T1554A						.						244.0	218.0	227.0					15																	85660890		2203	4299	6502	SO:0001819	synonymous_variant	5151	exon17			TCTTGGTCTCAAA	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.1554T>A	15.37:g.85660890T>A		343.0	0.0		406.0	92.0	NM_002605	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Silent	SNP	ENST00000310298.4	37	CCDS10336.1																																																																																			.		0.393	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
PIWIL1	9271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130830386	130830386	+	Silent	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:130830386A>G	ENST00000245255.3	+	4	551	c.279A>G	c.(277-279)acA>acG	p.T93T		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	93					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GTGTGAATACAAGGCAGAACC	0.378																																					p.T93T		.											.	PIWIL1	92	0			c.A279G						.						138.0	130.0	133.0					12																	130830386		2203	4300	6503	SO:0001819	synonymous_variant	9271	exon4			GAATACAAGGCAG	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.279A>G	12.37:g.130830386A>G		153.0	0.0		161.0	28.0	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	ENST00000245255.3	37	CCDS9268.1																																																																																			.		0.378	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
POLE	5426	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	133240672	133240672	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:133240672T>G	ENST00000320574.5	-	23	2667	c.2624A>C	c.(2623-2625)aAt>aCt	p.N875T	POLE_ENST00000535270.1_Missense_Mutation_p.N848T	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	875					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GAAGACAAAATTTTCTGGGAA	0.522								DNA polymerases (catalytic subunits)																													p.N875T		.											.	POLE	233	0			c.A2624C						.						193.0	191.0	192.0					12																	133240672		2203	4300	6503	SO:0001583	missense	5426	exon23			ACAAAATTTTCTG		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2624A>C	12.37:g.133240672T>G	ENSP00000322570:p.Asn875Thr	244.0	0.0		214.0	59.0	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	37	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.661486	0.67700	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.14893	4.08;4.08;4.09;2.47	5.57	5.57	0.84162	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.000000	0.85682	D	0.000000	T	0.35335	0.0928	M	0.70787	2.145	0.80722	D	1	D;P	0.53312	0.959;0.887	P;P	0.54346	0.749;0.733	T	0.12372	-1.0550	10	0.72032	D	0.01	.	15.7723	0.78180	0.0:0.0:0.0:1.0	.	848;875	F5H1D6;Q07864	.;DPOE1_HUMAN	T	875;886;848;655;810	ENSP00000322570:N875T;ENSP00000406383:N886T;ENSP00000445753:N848T;ENSP00000442519:N655T	ENSP00000322570:N875T	N	-	2	0	POLE	131750745	1.000000	0.71417	1.000000	0.80357	0.193000	0.23685	7.990000	0.88215	2.133000	0.65898	0.519000	0.50382	AAT	.		0.522	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
RAB9A	9367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	13727290	13727290	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:13727290G>A	ENST00000464506.1	+	3	704	c.425G>A	c.(424-426)tGc>tAc	p.C142Y	RAB9A_ENST00000243325.5_3'UTR	NM_001195328.1|NM_004251.4	NP_001182257.1|NP_004242.1	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	142					GTP catabolic process (GO:0006184)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7						CAAGCTTGGTGCAGGGACAAC	0.478																																					p.C142Y		.											.	RAB9A	660	0			c.G425A						.						102.0	102.0	102.0					X																	13727290		2203	4300	6503	SO:0001583	missense	9367	exon3			CTTGGTGCAGGGA	U44103	CCDS14156.1	Xp22.2	2010-04-19	2007-01-15	2007-01-15	ENSG00000123595	ENSG00000123595		"""RAB, member RAS oncogene"""	9792	protein-coding gene	gene with protein product		300284	"""RAB9, member RAS oncogene family"""	RAB9		9126495	Standard	NM_004251		Approved		uc010neh.3	P51151	OTTHUMG00000021156	ENST00000464506.1:c.425G>A	X.37:g.13727290G>A	ENSP00000420127:p.Cys142Tyr	83.0	0.0		102.0	20.0	NM_004251	A8K390|Q6ICN1	Missense_Mutation	SNP	ENST00000464506.1	37	CCDS14156.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736739	0.69304	.	.	ENSG00000123595	ENST00000464506	T	0.76709	-1.04	5.51	4.61	0.57282	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88187	0.6369	M	0.82433	2.59	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.89168	0.3535	9	.	.	.	-6.3705	15.4544	0.75302	0.0:0.1349:0.8651:0.0	.	142	P51151	RAB9A_HUMAN	Y	142	ENSP00000420127:C142Y	.	C	+	2	0	RAB9A	13637211	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.212000	0.95126	2.296000	0.77279	0.594000	0.82650	TGC	.		0.478	RAB9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055802.1	NM_004251	
RBM33	155435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	155556582	155556582	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:155556582A>T	ENST00000401878.3	+	15	3254	c.3056A>T	c.(3055-3057)cAg>cTg	p.Q1019L	RBM33_ENST00000341148.3_5'UTR	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	1019							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		GTGGGACCACAGCCTGCCCGC	0.662																																					p.Q1019L		.											.	RBM33	23	0			c.A3056T						.						14.0	17.0	16.0					7																	155556582		2012	4177	6189	SO:0001583	missense	155435	exon15			GACCACAGCCTGC	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.3056A>T	7.37:g.155556582A>T	ENSP00000384160:p.Gln1019Leu	101.0	0.0		106.0	26.0	NM_053043	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	ENST00000401878.3	37	CCDS5941.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.62|18.62	3.662602|3.662602	0.67700|0.67700	.|.	.|.	ENSG00000184863|ENSG00000184863	ENST00000401878|ENST00000392761	T|.	0.49720|.	0.77|.	5.91|5.91	3.46|3.46	0.39613|0.39613	.|.	0.192886|.	0.24886|.	U|.	0.034812|.	T|T	0.57858|0.57858	0.2082|0.2082	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	B;D|.	0.67145|.	0.001;0.996|.	B;D|.	0.62955|.	0.004;0.909|.	T|T	0.50874|0.50874	-0.8776|-0.8776	10|5	0.29301|.	T|.	0.29|.	.|.	8.2904|8.2904	0.31954|0.31954	0.7294:0.1386:0.0:0.1319|0.7294:0.1386:0.0:0.1319	.|.	737;1019|.	B4DVQ2;Q96EV2|.	.;RBM33_HUMAN|.	L|C	1019|792	ENSP00000384160:Q1019L|.	ENSP00000384160:Q1019L|.	Q|S	+|+	2|1	0|0	RBM33|RBM33	155249343|155249343	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.697000|0.697000	0.40408|0.40408	1.709000|1.709000	0.37909|0.37909	0.441000|0.441000	0.26529|0.26529	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.		0.662	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317225.3	NM_001008408	
IPO4	79711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24646590	24646590	+	IGR	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr14:24646590G>T	ENST00000354464.6	-	0	3646				REC8_ENST00000311457.3_Splice_Site|REC8_ENST00000559919.1_Splice_Site	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4						DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		CTCCTGCAGAGTAAGGGCAAG	0.547																																					.		.											.	REC8	90	0			c.734+1G>T						.						86.0	88.0	87.0					14																	24646590		1941	4134	6075	SO:0001628	intergenic_variant	9985	exon10			TGCAGAGTAAGGG	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801		14.37:g.24646590G>T		249.0	0.0		220.0	51.0	NM_005132	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Splice_Site	SNP	ENST00000354464.6	37	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841284	0.51057	.	.	ENSG00000100918	ENST00000311457;ENST00000447460	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7542	0.62926	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	REC8	23716430	0.999000	0.42202	0.957000	0.39632	0.245000	0.25701	4.453000	0.60061	2.630000	0.89119	0.561000	0.74099	.	.		0.547	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
RPP30	10556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	92638835	92638835	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr10:92638835A>G	ENST00000371703.3	+	5	557	c.286A>G	c.(286-288)Agg>Ggg	p.R96G	Y_RNA_ENST00000410373.1_RNA|RPP30_ENST00000413330.1_Missense_Mutation_p.R96G	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	96					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						AACTTCTTCAAGGGCCCGGCT	0.323																																					p.R96G		.											.	RPP30	226	0			c.A286G						.						94.0	98.0	97.0					10																	92638835		2203	4298	6501	SO:0001583	missense	10556	exon5			TCTTCAAGGGCCC	BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.286A>G	10.37:g.92638835A>G	ENSP00000360768:p.Arg96Gly	129.0	0.0		81.0	21.0	NM_006413	B2R799|E9PB02	Missense_Mutation	SNP	ENST00000371703.3	37	CCDS7411.1	.	.	.	.	.	.	.	.	.	.	A	9.820	1.185527	0.21870	.	.	ENSG00000148688	ENST00000371703;ENST00000413330;ENST00000371705;ENST00000277882;ENST00000414836	T;T;T	0.43688	0.95;0.94;0.94	5.64	4.54	0.55810	Polymerase/histidinol phosphatase-like (1);	0.331224	0.36374	N	0.002637	T	0.24160	0.0585	L	0.27053	0.805	0.28451	N	0.91634	B;B;B	0.33318	0.007;0.086;0.408	B;B;B	0.28305	0.015;0.056;0.088	T	0.09952	-1.0651	10	0.23302	T	0.38	-13.7417	7.1899	0.25821	0.6981:0.1784:0.0:0.1234	.	96;96;96	B4DJR3;P78346;E9PB02	.;RPP30_HUMAN;.	G	96;96;96;118;50	ENSP00000360768:R96G;ENSP00000389182:R96G;ENSP00000277882:R118G	ENSP00000277882:R118G	R	+	1	2	RPP30	92628815	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.303000	0.33470	2.152000	0.67230	0.528000	0.53228	AGG	.		0.323	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049347.1	NM_006413	
SBNO2	22904	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	1109390	1109390	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:1109390C>T	ENST00000361757.3	-	29	3486	c.3249G>A	c.(3247-3249)gcG>gcA	p.A1083A	SBNO2_ENST00000587024.1_Silent_p.A1073A|SBNO2_ENST00000438103.2_Silent_p.A1026A	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	1083					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTTCTGCTCCGCCAGCAGGC	0.726																																					p.A1083A		.											.	.	.	0			c.G3249A						.						6.0	9.0	8.0					19																	1109390		1888	4040	5928	SO:0001819	synonymous_variant	22904	exon29			CTGCTCCGCCAGC	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.3249G>A	19.37:g.1109390C>T		12.0	0.0		27.0	13.0	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Silent	SNP	ENST00000361757.3	37	CCDS45894.1																																																																																			.		0.726	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
SERPIND1	3053	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	21133628	21133628	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr22:21133628A>G	ENST00000215727.5	+	2	311	c.28A>G	c.(28-30)Att>Gtt	p.I10V	SERPIND1_ENST00000406799.1_Missense_Mutation_p.I10V|PI4KA_ENST00000255882.6_Intron|PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000466162.1_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	10					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	CGCACTTCTCATTTTCCTCAT	0.537																																					p.I10V		.											.	SERPIND1	414	0			c.A28G						.						66.0	67.0	67.0					22																	21133628		2203	4300	6503	SO:0001583	missense	3053	exon2			CTTCTCATTTTCC	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.28A>G	22.37:g.21133628A>G	ENSP00000215727:p.Ile10Val	46.0	0.0		36.0	5.0	NM_000185	B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	ENST00000215727.5	37	CCDS13783.1	.	.	.	.	.	.	.	.	.	.	A	6.002	0.368776	0.11352	.	.	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.83335	-1.71;-1.71	5.37	-10.7	0.00240	.	1.117670	0.06465	N	0.730158	T	0.57784	0.2077	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.48163	-0.9059	10	0.19590	T	0.45	.	6.6775	0.23102	0.0767:0.3708:0.3546:0.1979	.	10;10	Q8IVC0;P05546	.;HEP2_HUMAN	V	10	ENSP00000215727:I10V;ENSP00000384050:I10V	ENSP00000215727:I10V	I	+	1	0	SERPIND1	19463628	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-2.871000	0.00720	-3.481000	0.00155	-1.074000	0.02243	ATT	.		0.537	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
SERPINE1	5054	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100771835	100771835	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:100771835A>G	ENST00000223095.4	+	2	318	c.161A>G	c.(160-162)aAc>aGc	p.N54S	SERPINE1_ENST00000445463.2_Missense_Mutation_p.N39S	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	54					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	AAGGACCGCAACGTGGTTTTC	0.607																																					p.N54S		.											.	SERPINE1	652	0			c.A161G						.						78.0	72.0	74.0					7																	100771835		2203	4300	6503	SO:0001583	missense	5054	exon2			ACCGCAACGTGGT	M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.161A>G	7.37:g.100771835A>G	ENSP00000223095:p.Asn54Ser	100.0	0.0		125.0	13.0	NM_000602	B7Z4S0|F8WD53	Missense_Mutation	SNP	ENST00000223095.4	37	CCDS5711.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.672056	0.88348	.	.	ENSG00000106366	ENST00000223095;ENST00000445463;ENST00000441467	D;D	0.92299	-3.01;-3.01	5.57	5.57	0.84162	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.96297	0.8792	M	0.86573	2.825	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.96875	0.9642	10	0.87932	D	0	.	13.6911	0.62547	1.0:0.0:0.0:0.0	.	39;54	F8WD53;P05121	.;PAI1_HUMAN	S	54;39;39	ENSP00000223095:N54S;ENSP00000396766:N39S	ENSP00000223095:N54S	N	+	2	0	SERPINE1	100558555	1.000000	0.71417	0.912000	0.35992	0.827000	0.46813	7.735000	0.84939	2.119000	0.64992	0.533000	0.62120	AAC	.		0.607	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347458.1	NM_000602	
SEZ6L	23544	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26695027	26695027	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr22:26695027G>A	ENST00000248933.6	+	5	1335	c.1240G>A	c.(1240-1242)Gtg>Atg	p.V414M	SEZ6L_ENST00000360929.3_Missense_Mutation_p.V414M|SEZ6L_ENST00000404234.3_Missense_Mutation_p.V414M|SEZ6L_ENST00000343706.4_Missense_Mutation_p.V414M|SEZ6L_ENST00000403121.1_Missense_Mutation_p.V187M|SEZ6L_ENST00000529632.2_Missense_Mutation_p.V414M|SEZ6L_ENST00000402979.1_Missense_Mutation_p.V187M			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	414	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CTCAGGTGGGGTGGCCCACTT	0.602																																					p.V414M		.											.	SEZ6L	95	0			c.G1240A						.						59.0	50.0	53.0					22																	26695027		2203	4300	6503	SO:0001583	missense	23544	exon5			GGTGGGGTGGCCC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1240G>A	22.37:g.26695027G>A	ENSP00000248933:p.Val414Met	95.0	0.0		142.0	25.0	NM_021115	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687116	0.48097	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	4.55	0.988	0.19796	Complement control module (2);Sushi/SCR/CCP (3);	0.755278	0.11315	N	0.576686	T	0.67487	0.2898	L	0.57536	1.79	0.50467	D	0.999872	P;P;P;P;P;P;P	0.50272	0.707;0.922;0.906;0.933;0.887;0.922;0.87	P;P;P;P;P;P;P	0.53224	0.626;0.721;0.564;0.689;0.594;0.721;0.721	T	0.65001	-0.6274	10	0.51188	T	0.08	.	4.2935	0.10890	0.2834:0.3834:0.3332:0.0	.	414;414;187;414;414;414;414	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	M	414;414;414;414;414;187;187	ENSP00000384772:V414M;ENSP00000437037:V414M;ENSP00000354185:V414M;ENSP00000248933:V414M;ENSP00000342661:V414M;ENSP00000384838:V187M;ENSP00000384733:V187M	ENSP00000248933:V414M	V	+	1	0	SEZ6L	25025027	0.004000	0.15560	0.999000	0.59377	0.827000	0.46813	0.581000	0.23819	0.508000	0.28173	-0.258000	0.10820	GTG	.		0.602	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
SLC17A6	57084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	22398984	22398984	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr11:22398984G>A	ENST00000263160.3	+	12	1884	c.1447G>A	c.(1447-1449)Gct>Act	p.A483T		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	483					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						CTTCCTGATCGCTGCCCTAGT	0.458																																					p.A483T		.											.	SLC17A6	580	0			c.G1447A						.						87.0	81.0	83.0					11																	22398984		2203	4300	6503	SO:0001583	missense	57084	exon12			CTGATCGCTGCCC	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1447G>A	11.37:g.22398984G>A	ENSP00000263160:p.Ala483Thr	342.0	0.0		319.0	62.0	NM_020346	A6NKS2	Missense_Mutation	SNP	ENST00000263160.3	37	CCDS7856.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503201	0.85176	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.54675	0.56	5.98	5.98	0.97165	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.63474	0.2514	L	0.38649	1.16	0.80722	D	1	D	0.76494	0.999	P	0.62184	0.899	T	0.57768	-0.7754	10	0.37606	T	0.19	.	20.4434	0.99119	0.0:0.0:1.0:0.0	.	483	Q9P2U8	VGLU2_HUMAN	T	483;371	ENSP00000263160:A483T	ENSP00000263160:A483T	A	+	1	0	SLC17A6	22355560	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	9.869000	0.99810	2.838000	0.97847	0.655000	0.94253	GCT	.		0.458	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
SLC8A1	6546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	40656071	40656071	+	Silent	SNP	T	T	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:40656071T>A	ENST00000403092.1	-	2	1383	c.1350A>T	c.(1348-1350)acA>acT	p.T450T	SLC8A1_ENST00000408028.2_Silent_p.T450T|SLC8A1_ENST00000542756.1_Silent_p.T450T|SLC8A1_ENST00000405901.3_Silent_p.T450T|SLC8A1_ENST00000542024.1_Silent_p.T450T|SLC8A1_ENST00000405269.1_Silent_p.T450T|SLC8A1_ENST00000332839.4_Silent_p.T450T|SLC8A1_ENST00000406391.2_Silent_p.T450T|SLC8A1_ENST00000402441.1_Silent_p.T450T|SLC8A1_ENST00000406785.2_Silent_p.T450T			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	450	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CAGCATTTGCTGTGCCATCCT	0.443																																					p.T450T		.											.	SLC8A1	93	0			c.A1350T						.						85.0	76.0	79.0					2																	40656071		2203	4300	6503	SO:0001819	synonymous_variant	6546	exon1			ATTTGCTGTGCCA		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1350A>T	2.37:g.40656071T>A		83.0	0.0		70.0	10.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	ENST00000403092.1	37	CCDS1806.1																																																																																			.		0.443	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
SREBF1	6720	broad.mit.edu;bcgsc.ca	37	17	17718247	17718247	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr17:17718247T>C	ENST00000261646.5	-	14	2688	c.2504A>G	c.(2503-2505)gAt>gGt	p.D835G	SREBF1_ENST00000395757.1_Missense_Mutation_p.D581G|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000338854.5_Missense_Mutation_p.D835G|SREBF1_ENST00000355815.4_Missense_Mutation_p.D865G	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	835					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CCCGAGGGCATCCGAGAATTC	0.627																																					p.D865G		.											.	SREBF1	91	0			c.A2594G						.						19.0	18.0	18.0					17																	17718247		2178	4286	6464	SO:0001583	missense	6720	exon15			AGGGCATCCGAGA	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2504A>G	17.37:g.17718247T>C	ENSP00000261646:p.Asp835Gly	96.0	0.0		83.0	6.0	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	ENST00000261646.5	37	CCDS11189.1	.	.	.	.	.	.	.	.	.	.	t	13.03	2.115278	0.37339	.	.	ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161;ENST00000447641	T;T;T;T	0.14391	2.51;2.51;2.51;2.51	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.32556	0.0833	L	0.57536	1.79	0.80722	D	1	D;D;B	0.61697	0.983;0.99;0.016	P;D;B	0.67725	0.899;0.953;0.036	T	0.01635	-1.1307	10	0.48119	T	0.1	-21.2039	15.1097	0.72346	0.0:0.0:0.0:1.0	.	835;865;454	P36956;P36956-4;A8MTU8	SRBP1_HUMAN;.;.	G	835;865;835;581;454;672;761;160	ENSP00000345822:D835G;ENSP00000348069:D865G;ENSP00000261646:D835G;ENSP00000379106:D581G	ENSP00000261646:D835G	D	-	2	0	SREBF1	17658972	0.998000	0.40836	0.975000	0.42487	0.866000	0.49608	4.075000	0.57584	2.060000	0.61445	0.454000	0.30748	GAT	.		0.627	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
SV2A	9900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149881036	149881036	+	Missense_Mutation	SNP	G	G	A	rs200303127	byFrequency	TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:149881036G>A	ENST00000369146.3	-	7	1757	c.1267C>T	c.(1267-1269)Cgg>Tgg	p.R423W	SV2A_ENST00000369145.1_Missense_Mutation_p.R423W	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	423					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CTCAAGGCCCGGACCCCCCAG	0.562													G|||	2	0.000399361	0.0	0.0	5008	,	,		15847	0.001		0.001	False		,,,				2504	0.0				p.R423W		.											.	SV2A	97	0			c.C1267T						.						65.0	67.0	66.0					1																	149881036		2203	4300	6503	SO:0001583	missense	9900	exon7			AGGCCCGGACCCC	AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1267C>T	1.37:g.149881036G>A	ENSP00000358142:p.Arg423Trp	173.0	0.0		274.0	36.0	NM_014849	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	ENST00000369146.3	37	CCDS940.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	21.4	4.142934	0.77888	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.70282	0.55;-0.47	5.38	5.38	0.77491	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.060191	0.64402	D	0.000005	T	0.77130	0.4085	M	0.66506	2.035	0.38814	D	0.955478	D	0.76494	0.999	D	0.72982	0.979	T	0.78959	-0.1998	10	0.62326	D	0.03	-24.5597	11.5436	0.50679	0.0:0.0:0.8218:0.1781	.	423	Q7L0J3	SV2A_HUMAN	W	423	ENSP00000358142:R423W;ENSP00000358141:R423W	ENSP00000358141:R423W	R	-	1	2	SV2A	148147660	0.281000	0.24258	1.000000	0.80357	0.977000	0.68977	0.034000	0.13776	2.813000	0.96785	0.655000	0.94253	CGG	G|0.999;A|0.000		0.562	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033754.1		
SYMPK	8189	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	46319169	46319169	+	Silent	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:46319169G>A	ENST00000245934.7	-	26	3871	c.3627C>T	c.(3625-3627)gaC>gaT	p.D1209D	RSPH6A_ENST00000221538.3_5'Flank|RSPH6A_ENST00000597055.1_5'Flank|SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1209					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GCCCCGAGTCGTCATCCATGC	0.672																																					p.D1209D		.											.	SYMPK	91	0			c.C3627T						.						17.0	18.0	17.0					19																	46319169		2187	4274	6461	SO:0001819	synonymous_variant	8189	exon26			CGAGTCGTCATCC	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3627C>T	19.37:g.46319169G>A		104.0	0.0		113.0	17.0	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	37	CCDS12676.2																																																																																			.		0.672	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
TCEAL4	79921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	102842040	102842040	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:102842040A>T	ENST00000472745.1	+	3	989	c.437A>T	c.(436-438)cAt>cTt	p.H146L	TCEAL4_ENST00000468024.1_Missense_Mutation_p.H146L|TCEAL4_ENST00000472484.1_Missense_Mutation_p.H146L|TCEAL4_ENST00000372629.4_Missense_Mutation_p.H289L|TCEAL4_ENST00000494801.1_Missense_Mutation_p.H146L|TCEAL4_ENST00000415568.2_Missense_Mutation_p.H146L			Q96EI5	TCAL4_HUMAN	transcription elongation factor A (SII)-like 4	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|skin(2)	6						GAGGCCATACATGATATGAAT	0.428																																					p.H146L		.											.	TCEAL4	130	0			c.A437T						.						122.0	124.0	123.0					X																	102842040		2203	4300	6503	SO:0001583	missense	79921	exon3			CCATACATGATAT	AF314542	CCDS14510.2, CCDS76004.1	Xq22.2	2014-03-21			ENSG00000133142	ENSG00000133142			26121	protein-coding gene	gene with protein product						14702039, 16221301	Standard	XM_005262192		Approved	FLJ21174, WEX7	uc004ekn.3	Q96EI5	OTTHUMG00000022103	ENST00000472745.1:c.437A>T	X.37:g.102842040A>T	ENSP00000424314:p.His146Leu	185.0	0.0		227.0	90.0	NM_001006935	Q8WY12|Q9H2H1|Q9H775	Missense_Mutation	SNP	ENST00000472745.1	37	CCDS14510.2	.	.	.	.	.	.	.	.	.	.	A	13.49	2.252635	0.39797	.	.	ENSG00000133142	ENST00000372629;ENST00000468024;ENST00000472484;ENST00000415568;ENST00000414064;ENST00000472745;ENST00000494801	T;T;T;T;T;T	0.10763	2.84;2.84;2.84;2.84;2.84;2.84	3.99	2.78	0.32641	.	0.000000	0.48767	D	0.000166	T	0.25005	0.0607	M	0.65975	2.015	0.09310	N	1	D	0.76494	0.999	D	0.72338	0.977	T	0.02498	-1.1150	10	0.62326	D	0.03	.	6.6592	0.23004	0.759:0.241:0.0:0.0	.	146	Q96EI5	TCAL4_HUMAN	L	289;146;146;146;117;146;146	ENSP00000361712:H289L;ENSP00000421857:H146L;ENSP00000421156:H146L;ENSP00000415564:H146L;ENSP00000424314:H146L;ENSP00000427494:H146L	ENSP00000361712:H289L	H	+	2	0	TCEAL4	102728696	0.918000	0.31147	0.011000	0.14972	0.699000	0.40488	1.903000	0.39858	0.682000	0.31407	0.352000	0.21897	CAT	.		0.428	TCEAL4-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252339.2	NM_024863	
TCOF1	6949	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	149769583	149769583	+	Silent	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr5:149769583T>C	ENST00000504761.2	+	19	3180	c.3180T>C	c.(3178-3180)acT>acC	p.T1060T	TCOF1_ENST00000377797.3_Silent_p.T1060T|TCOF1_ENST00000439160.2_Silent_p.T1060T|TCOF1_ENST00000451292.1_Silent_p.T1097T|TCOF1_ENST00000513346.1_Silent_p.T1097T|TCOF1_ENST00000323668.7_Silent_p.T983T|TCOF1_ENST00000445265.2_Silent_p.T983T			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1060					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GACCAGCCACTCAGGTACCTG	0.592																																					p.T1060T		.											.	TCOF1	155	0			c.T3180C						.						41.0	32.0	35.0					5																	149769583		2203	4300	6503	SO:0001819	synonymous_variant	6949	exon19			AGCCACTCAGGTA		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3180T>C	5.37:g.149769583T>C		82.0	2.0		146.0	88.0	NM_001135243	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Silent	SNP	ENST00000504761.2	37	CCDS54936.1																																																																																			.		0.592	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
TDRD1	56165	broad.mit.edu;bcgsc.ca	37	10	115963274	115963274	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr10:115963274A>G	ENST00000369280.1	+	8	1389	c.929A>G	c.(928-930)gAc>gGc	p.D310G	TDRD1_ENST00000422662.1_Missense_Mutation_p.D19G|TDRD1_ENST00000251864.2_Missense_Mutation_p.D310G|TDRD1_ENST00000369282.1_Missense_Mutation_p.D310G|TDRD1_ENST00000369281.2_Missense_Mutation_p.D310G			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	310					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		CATGAAAAAGACTATATTCCT	0.358																																					p.D310G		.											.	TDRD1	90	0			c.A929G						.						68.0	68.0	68.0					10																	115963274		2203	4300	6503	SO:0001583	missense	56165	exon8			AAAAAGACTATAT	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.929A>G	10.37:g.115963274A>G	ENSP00000358286:p.Asp310Gly	99.0	0.0		109.0	5.0	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	37		.	.	.	.	.	.	.	.	.	.	A	5.547	0.285765	0.10513	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.15603	3.04;3.04;3.04;2.41;3.04	5.45	4.32	0.51571	Maternal tudor protein (1);	0.689366	0.14892	N	0.292328	T	0.10337	0.0253	N	0.16833	0.445	0.22591	N	0.998953	B;B;B;B;B	0.19073	0.002;0.005;0.033;0.004;0.027	B;B;B;B;B	0.20577	0.017;0.007;0.03;0.006;0.02	T	0.34576	-0.9823	10	0.22109	T	0.4	-5.2051	8.3938	0.32544	0.9081:0.0:0.0919:0.0	.	19;310;310;310;310	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	G	310;310;310;19;310	ENSP00000358288:D310G;ENSP00000251864:D310G;ENSP00000358287:D310G;ENSP00000402794:D19G;ENSP00000358286:D310G	ENSP00000251864:D310G	D	+	2	0	TDRD1	115953264	0.957000	0.32711	0.083000	0.20561	0.174000	0.22865	3.451000	0.52964	0.932000	0.37266	0.383000	0.25322	GAC	.		0.358	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
THRAP3	9967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	36757042	36757042	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:36757042C>T	ENST00000354618.5	+	6	2037	c.1813C>T	c.(1813-1815)Cag>Tag	p.Q605*	THRAP3_ENST00000466743.1_3'UTR|THRAP3_ENST00000469141.2_Nonsense_Mutation_p.Q605*	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	605	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CAAAAAGGAACAGGAGTTTCG	0.458			T	USP6	aneurysmal bone cysts																																p.Q605X	Pancreas(129;785 1795 20938 23278 32581)	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3	663	0			c.C1813T						.						114.0	104.0	107.0					1																	36757042		2203	4300	6503	SO:0001587	stop_gained	9967	exon6			AAGGAACAGGAGT	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1813C>T	1.37:g.36757042C>T	ENSP00000346634:p.Gln605*	267.0	0.0		213.0	67.0	NM_005119	D3DPS5|Q5VTK6	Nonsense_Mutation	SNP	ENST00000354618.5	37	CCDS405.1	.	.	.	.	.	.	.	.	.	.	C	41	9.154439	0.99084	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-17.844	19.0579	0.93074	0.0:1.0:0.0:0.0	.	.	.	.	X	605	.	ENSP00000346634:Q605X	Q	+	1	0	THRAP3	36529629	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.734000	0.68580	2.827000	0.97445	0.650000	0.86243	CAG	.		0.458	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
TMEM151B	441151	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44241031	44241031	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr6:44241031A>T	ENST00000451188.2	+	2	641	c.364A>T	c.(364-366)Atg>Ttg	p.M122L	TMEM151B_ENST00000438774.2_Missense_Mutation_p.M122L|RP11-444E17.6_ENST00000505802.1_Missense_Mutation_p.H34L	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	122						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						CTTCCTGCTCATGTTGTACGC	0.617																																					p.M122L		.											.	.	.	0			c.A364T						.						250.0	191.0	209.0					6																	44241031		692	1591	2283	SO:0001583	missense	441151	exon2			CTGCTCATGTTGT	AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.364A>T	6.37:g.44241031A>T	ENSP00000393161:p.Met122Leu	155.0	1.0		165.0	28.0	NM_001137560	Q5T9V7	Missense_Mutation	SNP	ENST00000451188.2	37	CCDS47437.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.450712	0.84101	.	.	ENSG00000178233	ENST00000451188;ENST00000438774;ENST00000430110	.	.	.	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.45094	0.1325	M	0.74647	2.275	0.58432	D	0.999996	B;B	0.30455	0.28;0.015	B;B	0.22152	0.038;0.028	T	0.49447	-0.8939	9	0.22109	T	0.4	.	14.3984	0.67027	1.0:0.0:0.0:0.0	.	122;122	Q8IW70;Q8IW70-2	T151B_HUMAN;.	L	122	.	ENSP00000410997:M122L	M	+	1	0	TMEM151B	44349009	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.139000	0.94554	1.986000	0.57962	0.374000	0.22700	ATG	.		0.617	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040740.2	NM_001039704	
TREX2	11219	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152710779	152710779	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:152710779C>T	ENST00000334497.2	-	11	1380	c.239G>A	c.(238-240)cGc>cAc	p.R80H	TREX2_ENST00000370232.1_Missense_Mutation_p.R80H|TREX2_ENST00000330912.2_Missense_Mutation_p.R37H|TREX2_ENST00000338525.2_Missense_Mutation_p.R37H|TREX2_ENST00000402951.1_Missense_Mutation_p.R80H|TREX2_ENST00000370231.2_Missense_Mutation_p.R37H|HAUS7_ENST00000484394.1_5'Flank|TREX2_ENST00000414588.1_Missense_Mutation_p.R79H|TREX2_ENST00000393862.2_Missense_Mutation_p.R37H			Q9BQ50	TREX2_HUMAN	three prime repair exonuclease 2	80					DNA catabolic process, exonucleolytic (GO:0000738)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)	nucleus (GO:0005634)	3'-5'-exodeoxyribonuclease activity (GO:0008296)|exodeoxyribonuclease III activity (GO:0008853)|magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)			endometrium(4)|large_intestine(2)|lung(3)|ovary(2)	11	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAGGGAGGAGCGGTGGACAGC	0.657								Editing and processing nucleases																													p.R37H		.											.	TREX2	227	0			c.G110A						.						41.0	42.0	41.0					X																	152710779		2202	4299	6501	SO:0001583	missense	11219	exon2			GAGGAGCGGTGGA	AF151107	CCDS35437.1	Xq28	2012-05-08			ENSG00000183479	ENSG00000183479			12270	protein-coding gene	gene with protein product		300370				10391904	Standard	NM_080701		Approved		uc011myp.2	Q9BQ50	OTTHUMG00000159319	ENST00000334497.2:c.239G>A	X.37:g.152710779C>T	ENSP00000334993:p.Arg80His	115.0	0.0		177.0	56.0	NM_080701	Q45F08|Q9UN77	Missense_Mutation	SNP	ENST00000334497.2	37		.	.	.	.	.	.	.	.	.	.	C	15.78	2.933924	0.52866	.	.	ENSG00000183479	ENST00000393862;ENST00000330912;ENST00000338525;ENST00000334497;ENST00000370232;ENST00000402951;ENST00000414588;ENST00000370231	T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92	5.04	4.18	0.49190	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.572588	0.14640	U	0.307244	T	0.41949	0.1181	L	0.55990	1.75	0.30388	N	0.78124	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.40572	-0.9556	10	0.72032	D	0.01	0.6256	5.8999	0.18960	0.1883:0.7104:0.0:0.1013	.	79;80	Q06S70;Q9BQ50	.;TREX2_HUMAN	H	37;37;37;80;80;80;79;37	ENSP00000377442:R37H;ENSP00000333441:R37H;ENSP00000345218:R37H;ENSP00000334993:R80H;ENSP00000359252:R80H;ENSP00000386078:R80H;ENSP00000401692:R79H;ENSP00000359251:R37H	ENSP00000333441:R37H	R	-	2	0	TREX2	152363973	0.994000	0.37717	0.959000	0.39883	0.346000	0.29079	2.519000	0.45546	0.913000	0.36797	0.529000	0.55759	CGC	.		0.657	TREX2-001	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000060966.1	NM_080701	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179440745	179440745	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:179440745G>C	ENST00000591111.1	-	276	65415	c.65191C>G	c.(65191-65193)Cct>Gct	p.P21731A	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P14307A|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P14432A|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P20804A|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P23372A|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P14499A|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21731	Ig-like 114.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGGAGCAGGACGACCTTTA	0.418																																					p.P23372A		.											.	TTN	636	0			c.C70114G						.						143.0	145.0	144.0					2																	179440745		1920	4118	6038	SO:0001583	missense	7273	exon326			GAGCAGGACGACC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65191C>G	2.37:g.179440745G>C	ENSP00000465570:p.Pro21731Ala	68.0	0.0		56.0	13.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	13.62	2.292531	0.40594	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81	5.61	5.61	0.85477	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.90356	0.6982	M	0.93638	3.44	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	D	0.92310	0.5857	9	0.87932	D	0	.	19.635	0.95728	0.0:0.0:1.0:0.0	.	14307;14432;14499;21731	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	20804;14307;14499;14432;14305	ENSP00000343764:P20804A;ENSP00000434586:P14307A;ENSP00000340554:P14499A;ENSP00000352154:P14432A	ENSP00000340554:P14499A	P	-	1	0	TTN	179148991	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.869000	0.99810	2.656000	0.90262	0.655000	0.94253	CCT	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TUBA8	51807	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18604433	18604433	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr22:18604433G>A	ENST00000330423.3	+	2	264	c.191G>A	c.(190-192)cGg>cAg	p.R64Q	TUBA8_ENST00000316027.6_5'UTR	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	64					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						CATGTGCCCCGGGCCGTCATG	0.552																																					p.R64Q		.											.	TUBA8	90	0			c.G191A						.						72.0	62.0	65.0					22																	18604433		2203	4300	6503	SO:0001583	missense	51807	exon2			TGCCCCGGGCCGT	AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.191G>A	22.37:g.18604433G>A	ENSP00000333326:p.Arg64Gln	189.0	1.0		203.0	80.0	NM_018943	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	ENST00000330423.3	37	CCDS13751.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972990	0.74246	.	.	ENSG00000183785	ENST00000330423;ENST00000416740	D;D	0.82081	-1.57;-1.57	5.06	5.06	0.68205	Tubulin/FtsZ, GTPase domain (4);	0.058929	0.64402	N	0.000002	D	0.94761	0.8309	H	0.98155	4.16	0.58432	D	0.999997	D;D;D	0.89917	0.993;1.0;1.0	P;D;D	0.83275	0.811;0.986;0.996	D	0.96716	0.9529	10	0.87932	D	0	.	17.7806	0.88522	0.0:0.0:1.0:0.0	.	88;64;63	C9J2C0;Q9NY65;Q7Z3M3	.;TBA8_HUMAN;.	Q	64;88	ENSP00000333326:R64Q;ENSP00000412646:R88Q	ENSP00000333326:R64Q	R	+	2	0	TUBA8	16984433	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	9.869000	0.99810	2.509000	0.84616	0.561000	0.74099	CGG	.		0.552	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	NM_018943	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216073535	216073535	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:216073535C>T	ENST00000307340.3	-	40	7862	c.7476G>A	c.(7474-7476)tcG>tcA	p.S2492S	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Silent_p.S2492S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2492	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CATAGCTTAACGATGCAGAAG	0.368										HNSCC(13;0.011)																											p.S2492S		.											.	USH2A	115	0			c.G7476A						.						116.0	100.0	105.0					1																	216073535		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon40			GCTTAACGATGCA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7476G>A	1.37:g.216073535C>T		71.0	0.0		83.0	19.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
VAT1L	57687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77896666	77896666	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr16:77896666T>A	ENST00000302536.2	+	4	754	c.601T>A	c.(601-603)Tgt>Agt	p.C201S	VAT1L_ENST00000563850.1_3'UTR	NM_020927.1	NP_065978.1	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport 1-like	201							oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(10)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24						GGCTCAGCTGTGTTCCACTGT	0.488																																					p.C201S		.											.	VAT1L	90	0			c.T601A						.						182.0	151.0	162.0					16																	77896666		2198	4300	6498	SO:0001583	missense	57687	exon4			CAGCTGTGTTCCA	AB046796	CCDS32492.1	16q23.1	2014-09-09	2013-08-23		ENSG00000171724	ENSG00000171724			29315	protein-coding gene	gene with protein product			"""vesicle amine transport protein 1 homolog (T. californica)-like"""			10997877	Standard	NM_020927		Approved	KIAA1576	uc002ffg.1	Q9HCJ6	OTTHUMG00000176845	ENST00000302536.2:c.601T>A	16.37:g.77896666T>A	ENSP00000303129:p.Cys201Ser	133.0	0.0		137.0	39.0	NM_020927	Q8IYW8	Missense_Mutation	SNP	ENST00000302536.2	37	CCDS32492.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.054490	0.75960	.	.	ENSG00000171724	ENST00000302536	T	0.29142	1.58	5.93	5.93	0.95920	Alcohol dehydrogenase, C-terminal (1);Quinone oxidoreductase/zeta-crystallin, conserved site (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	L	0.48986	1.54	0.80722	D	1	P	0.39831	0.69	B	0.36666	0.23	T	0.06826	-1.0805	10	0.51188	T	0.08	-11.2408	16.0558	0.80805	0.0:0.0:0.0:1.0	.	201	Q9HCJ6	VAT1L_HUMAN	S	201	ENSP00000303129:C201S	ENSP00000303129:C201S	C	+	1	0	VAT1L	76454167	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	2.281000	0.76405	0.533000	0.62120	TGT	.		0.488	VAT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434010.1	NM_020927	
VEPH1	79674	ucsc.edu;bcgsc.ca	37	3	157031412	157031412	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr3:157031412T>C	ENST00000362010.2	-	11	2315	c.2008A>G	c.(2008-2010)Aag>Gag	p.K670E	RP11-550I24.2_ENST00000475102.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.K670E|RP11-550I24.2_ENST00000494885.1_RNA|RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000543418.1_Intron	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	670						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			ATATTTACCTTCTGCTGTGGA	0.433																																					p.K670E		.											.	VEPH1	155	0			c.A2008G						.						60.0	61.0	60.0					3																	157031412		2203	4300	6503	SO:0001583	missense	79674	exon11			TTACCTTCTGCTG	AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.2008A>G	3.37:g.157031412T>C	ENSP00000354919:p.Lys670Glu	41.0	0.0		40.0	4.0	NM_001167912	D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	ENST00000362010.2	37	CCDS3179.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.621527	0.66787	.	.	ENSG00000197415	ENST00000362010;ENST00000392832	T;T	0.16073	2.37;2.37	5.01	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.35998	0.0951	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	P	0.62740	0.906	T	0.11060	-1.0603	10	0.87932	D	0	-0.6932	11.0611	0.47948	0.0:0.0:0.156:0.844	.	670	Q14D04	MELT_HUMAN	E	670	ENSP00000354919:K670E;ENSP00000376577:K670E	ENSP00000354919:K670E	K	-	1	0	VEPH1	158514106	1.000000	0.71417	0.972000	0.41901	0.529000	0.34654	6.912000	0.75753	0.803000	0.34113	0.397000	0.26171	AAG	.		0.433	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351845.3	NM_024621	
VWA3B	200403	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	98744813	98744813	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:98744813G>T	ENST00000477737.1	+	6	1018	c.814G>T	c.(814-816)Gcc>Tcc	p.A272S	VWA3B_ENST00000451075.2_Missense_Mutation_p.A122S|VWA3B_ENST00000435344.1_Missense_Mutation_p.A272S	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	272										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GTCCTTCAACGCCAGAGGAGA	0.517																																					p.A272S		.											.	VWA3B	139	0			c.G814T						.						127.0	124.0	125.0					2																	98744813		1969	4159	6128	SO:0001583	missense	200403	exon6			TTCAACGCCAGAG	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.814G>T	2.37:g.98744813G>T	ENSP00000417955:p.Ala272Ser	151.0	1.0		112.0	23.0	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	37	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942582	0.73672	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.17528	7.17;7.17;2.27	5.24	5.24	0.73138	.	0.092747	0.47093	D	0.000259	T	0.36110	0.0955	M	0.71581	2.175	0.24700	N	0.993262	P;D;D	0.64830	0.923;0.994;0.978	P;P;P	0.61533	0.474;0.89;0.745	T	0.15065	-1.0450	10	0.33940	T	0.23	.	13.6975	0.62589	0.0:0.155:0.845:0.0	.	122;272;272	B7Z7Q7;Q502W6;Q502W6-8	.;VWA3B_HUMAN;.	S	272;272;122	ENSP00000401959:A272S;ENSP00000417955:A272S;ENSP00000389463:A122S	ENSP00000411168:A272S	A	+	1	0	VWA3B	98111245	1.000000	0.71417	0.985000	0.45067	0.916000	0.54674	5.124000	0.64709	2.607000	0.88179	0.655000	0.94253	GCC	.		0.517	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
ZBED1	9189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	2407376	2407376	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:2407376G>A	ENST00000381223.4	-	2	1588	c.1385C>T	c.(1384-1386)aCg>aTg	p.T462M	ZBED1_ENST00000381218.3_Missense_Mutation_p.T462M|ZBED1_ENST00000381222.2_Missense_Mutation_p.T462M|ZBED1_ENST00000515319.1_5'Flank|DHRSX_ENST00000334651.5_Intron	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	462					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GATCTCGGGCGTCTCCTGGTA	0.592																																					p.T462M		.											.	ZBED1	40	0			c.C1385T						.	G	MET/THR,MET/THR,MET/THR,	0,4406		0,0,2203	181.0	169.0	173.0		1385,1385,1385,	2.2	0.1	X		173	1,8591		0,1,4295	no	missense,missense,missense,intron	ZBED1,DHRSX	NM_001171135.1,NM_001171136.1,NM_004729.3,NM_145177.2	81,81,81,	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,	462/695,462/695,462/695,	2407376	1,12997	2203	4296	6499	SO:0001583	missense	9189	exon2			TCGGGCGTCTCCT	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.1385C>T	X.37:g.2407376G>A	ENSP00000370621:p.Thr462Met	319.0	0.0		387.0	84.0	NM_001171135	Q96BY4	Missense_Mutation	SNP	ENST00000381223.4	37	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	G	5.159	0.215005	0.09810	0.0	1.16E-4	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218	T;T;T	0.22539	1.95;1.95;1.95	3.06	2.18	0.27775	Ribonuclease H-like (1);	0.646554	0.12663	N	0.449481	T	0.12475	0.0303	.	.	.	0.09310	N	1	P	0.37708	0.606	B	0.28465	0.09	T	0.13150	-1.0520	9	0.34782	T	0.22	.	9.2617	0.37616	0.1168:0.0:0.8832:0.0	.	462	O96006	ZBED1_HUMAN	M	462	ENSP00000370621:T462M;ENSP00000370620:T462M;ENSP00000370616:T462M	ENSP00000370616:T462M	T	-	2	0	ZBED1	2417376	1.000000	0.71417	0.050000	0.19076	0.049000	0.14656	6.158000	0.71851	0.207000	0.20607	0.519000	0.50382	ACG	G|0.999;A|0.001		0.592	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729	
ZCCHC4	29063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	25351159	25351159	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr4:25351159G>T	ENST00000302874.4	+	7	829	c.805G>T	c.(805-807)Gaa>Taa	p.E269*	ZCCHC4_ENST00000505451.1_3'UTR	NM_024936.2	NP_079212.2	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	269							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)	9		Breast(46;0.0503)				AGATAAAGGCGAAGGAATCAT	0.403																																					p.E269X		.											.	ZCCHC4	70	0			c.G805T						.						209.0	198.0	201.0					4																	25351159		1881	4106	5987	SO:0001587	stop_gained	29063	exon7			AAAGGCGAAGGAA	AF161537	CCDS43218.1	4p15.31	2014-02-18			ENSG00000168228	ENSG00000168228		"""Zinc fingers, CCHC domain containing"""	22917	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 4"""	611792				11042152	Standard	NM_024936		Approved	HSPC052, FLJ23024, ZGRF4	uc003grl.4	Q9H5U6	OTTHUMG00000160563	ENST00000302874.4:c.805G>T	4.37:g.25351159G>T	ENSP00000303468:p.Glu269*	228.0	0.0		321.0	41.0	NM_024936	B2RXF6|B4DRD8|B7ZW20|Q5IW78|Q96AN7	Nonsense_Mutation	SNP	ENST00000302874.4	37	CCDS43218.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.183110|4.183110	0.78677|0.78677	.|.	.|.	ENSG00000168228|ENSG00000168228	ENST00000302874|ENST00000505412	.|.	.|.	.|.	5.4|5.4	2.38|2.38	0.29361|0.29361	.|.	0.873879|.	0.10271|.	N|.	0.694758|.	.|T	.|0.31918	.|0.0812	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.34254	.|-0.9836	.|3	0.08179|.	T|.	0.78|.	-18.5719|-18.5719	3.8923|3.8923	0.09123|0.09123	0.2244:0.0:0.5893:0.1863|0.2244:0.0:0.5893:0.1863	.|.	.|.	.|.	.|.	X|L	269|133	.|.	ENSP00000303468:E269X|.	E|R	+|+	1|2	0|0	ZCCHC4|ZCCHC4	24960257|24960257	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.996000|0.996000	0.88848|0.88848	1.230000|1.230000	0.32612|0.32612	0.558000|0.558000	0.29135|0.29135	0.655000|0.655000	0.94253|0.94253	GAA|CGA	.		0.403	ZCCHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361151.1		
ZDHHC17	23390	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	77203532	77203532	+	Silent	SNP	T	T	C	rs376206630		TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr12:77203532T>C	ENST00000426126.2	+	5	1087	c.438T>C	c.(436-438)taT>taC	p.Y146Y	ZDHHC17_ENST00000359019.4_Silent_p.Y96Y|ZDHHC17_ENST00000334822.5_Silent_p.Y146Y	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	146					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						TAATGAAATATGGTGCAGATC	0.368																																					p.Y146Y		.											.	.	.	0			c.T438C						.	T		0,3742		0,0,1871	97.0	89.0	92.0		438	5.5	1.0	12		92	1,8217		0,1,4108	no	coding-synonymous	ZDHHC17	NM_015336.2		0,1,5979	CC,CT,TT		0.0122,0.0,0.0084		146/633	77203532	1,11959	1871	4109	5980	SO:0001819	synonymous_variant	23390	exon5			GAAATATGGTGCA	AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.438T>C	12.37:g.77203532T>C		71.0	0.0		90.0	26.0	NM_015336	B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Silent	SNP	ENST00000426126.2	37	CCDS44946.1																																																																																			.		0.368	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406555.1	NM_015336	
ZDHHC5	25921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57466174	57466174	+	Silent	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr11:57466174C>T	ENST00000287169.3	+	11	2628	c.1266C>T	c.(1264-1266)tcC>tcT	p.S422S	ZDHHC5_ENST00000527985.1_Silent_p.S369S	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	422					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						ATCCACTATCCAGTGGCTCAC	0.577																																					p.S422S		.											.	ZDHHC5	226	0			c.C1266T						.						86.0	76.0	79.0					11																	57466174		2201	4296	6497	SO:0001819	synonymous_variant	25921	exon11			ACTATCCAGTGGC	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.1266C>T	11.37:g.57466174C>T		111.0	0.0		117.0	19.0	NM_015457	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Silent	SNP	ENST00000287169.3	37	CCDS7965.1																																																																																			.		0.577	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393694.1	NM_015457	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	77765482	77765482	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr8:77765482C>T	ENST00000521891.2	+	10	6773	c.6325C>T	c.(6325-6327)Ctc>Ttc	p.L2109F	ZFHX4_ENST00000518282.1_Missense_Mutation_p.L2083F|ZFHX4_ENST00000050961.6_Missense_Mutation_p.L2064F|ZFHX4_ENST00000455469.2_Missense_Mutation_p.L2064F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2064					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTCTGCAGACCTCACCCAACT	0.522										HNSCC(33;0.089)																											p.L2109F		.											.	ZFHX4	98	0			c.C6325T						.						33.0	35.0	34.0					8																	77765482		2064	4206	6270	SO:0001583	missense	79776	exon10			GCAGACCTCACCC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6325C>T	8.37:g.77765482C>T	ENSP00000430497:p.Leu2109Phe	135.0	0.0		158.0	37.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491534	0.44249	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.55588	0.51;0.57;0.54;0.53	3.54	2.64	0.31445	.	0.182351	0.26317	U	0.025071	T	0.59487	0.2197	L	0.36672	1.1	0.54753	D	0.999987	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.87578	0.986;0.998;0.994	T	0.56786	-0.7921	10	0.42905	T	0.14	.	11.1432	0.48415	0.1861:0.8138:0.0:0.0	.	2064;2064;2109	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	F	2109;2093;2064;2064;2083	ENSP00000430497:L2109F;ENSP00000399605:L2064F;ENSP00000050961:L2064F;ENSP00000430848:L2083F	ENSP00000050961:L2064F	L	+	1	0	ZFHX4	77928037	1.000000	0.71417	0.891000	0.34965	0.899000	0.52679	4.720000	0.61944	0.820000	0.34516	0.455000	0.32223	CTC	.		0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	22155549	22155549	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:22155549T>C	ENST00000397126.4	-	4	2435	c.2287A>G	c.(2287-2289)Acc>Gcc	p.T763A	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	763					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TAACTAAGGGTTGAGGACCAC	0.353																																					p.T763A		.											.	ZNF208	7	0			c.A2287G						.						28.0	30.0	30.0					19																	22155549		1937	4150	6087	SO:0001583	missense	7757	exon4			TAAGGGTTGAGGA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2287A>G	19.37:g.22155549T>C	ENSP00000380315:p.Thr763Ala	47.0	0.0		46.0	16.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.605183	0.00842	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.35048	1.33	2.28	-4.55	0.03441	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31918	0.0812	.	.	.	0.09310	N	1	D	0.61080	0.989	D	0.64877	0.93	T	0.13176	-1.0519	8	0.09843	T	0.71	.	0.423	0.00459	0.3996:0.1744:0.1393:0.2867	.	663	O43345	ZN208_HUMAN	A	763;663	ENSP00000380315:T763A	ENSP00000380315:T763A	T	-	1	0	ZNF208	21947389	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-7.399000	0.00037	-2.102000	0.00845	0.232000	0.17820	ACC	.		0.353	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22156821	22156821	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:22156821T>C	ENST00000397126.4	-	4	1163	c.1015A>G	c.(1015-1017)Aag>Gag	p.K339E	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTGTAGGGCTTCTCTCCAGCA	0.388																																					p.K339E		.											.	ZNF208	7	0			c.A1015G						.						51.0	53.0	52.0					19																	22156821		2052	4204	6256	SO:0001583	missense	7757	exon4			AGGGCTTCTCTCC	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1015A>G	19.37:g.22156821T>C	ENSP00000380315:p.Lys339Glu	96.0	0.0		131.0	24.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178930	0.57692	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.27104	1.69	2.69	2.69	0.31865	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28764	0.0713	.	.	.	0.27764	N	0.943723	D	0.54601	0.967	P	0.47346	0.544	T	0.10847	-1.0612	8	0.72032	D	0.01	.	9.5425	0.39260	0.0:0.0:0.0:1.0	.	339	O43345	ZN208_HUMAN	E	339	ENSP00000380315:K339E	ENSP00000380315:K339E	K	-	1	0	ZNF208	21948661	0.004000	0.15560	0.001000	0.08648	0.005000	0.04900	1.251000	0.32862	0.860000	0.35481	0.260000	0.18958	AAG	.		0.388	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF449	203523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	134494230	134494230	+	Silent	SNP	G	G	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chrX:134494230G>A	ENST00000339249.4	+	5	926	c.786G>A	c.(784-786)ttG>ttA	p.L262L		NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	262					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GTCCCATTTTGCAAAAAGACT	0.393																																					p.L262L		.											.	ZNF449	132	0			c.G786A						.						59.0	62.0	61.0					X																	134494230		2184	4255	6439	SO:0001819	synonymous_variant	203523	exon5			CATTTTGCAAAAA	AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.786G>A	X.37:g.134494230G>A		439.0	0.0		476.0	71.0	NM_152695	Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Silent	SNP	ENST00000339249.4	37	CCDS14649.1																																																																																			.		0.393	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058411.1	NM_152695	
ZNF540	163255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38102620	38102620	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr19:38102620A>G	ENST00000592533.1	+	5	771	c.439A>G	c.(439-441)Aaa>Gaa	p.K147E	ZNF540_ENST00000316433.4_Missense_Mutation_p.K147E|ZNF540_ENST00000589117.1_Missense_Mutation_p.K115E|ZNF540_ENST00000343599.5_Missense_Mutation_p.K147E|ZNF540_ENST00000586792.1_3'UTR	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	147					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AATCGTCTCTAAAAAAATGTC	0.368																																					p.K147E		.											.	ZNF540	153	0			c.A439G						.						91.0	98.0	96.0					19																	38102620		2203	4299	6502	SO:0001583	missense	163255	exon5			GTCTCTAAAAAAA	AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.439A>G	19.37:g.38102620A>G	ENSP00000466274:p.Lys147Glu	168.0	0.0		183.0	73.0	NM_152606	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	ENST00000592533.1	37	CCDS12506.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.568645	0.00895	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.08634	3.07	1.85	-2.13	0.07144	.	.	.	.	.	T	0.04318	0.0119	N	0.26130	0.795	0.09310	N	1	B;B	0.20459	0.045;0.027	B;B	0.08055	0.003;0.001	T	0.47100	-0.9143	9	0.07030	T	0.85	.	6.5073	0.22202	0.5598:0.0:0.4402:0.0	.	115;147	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	E	147;115	ENSP00000324598:K147E	ENSP00000324598:K147E	K	+	1	0	ZNF540	42794460	0.000000	0.05858	0.000000	0.03702	0.147000	0.21601	-0.941000	0.03925	-0.581000	0.05937	0.172000	0.16884	AAA	.		0.368	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459481.1	NM_152606	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	88964869	88964869	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr7:88964869C>A	ENST00000333190.4	+	4	3182	c.2573C>A	c.(2572-2574)tCa>tAa	p.S858*		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	858							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GACTCTTACTCAATAGAGAAA	0.403										HNSCC(36;0.09)																											p.S858X		.											.	ZNF804B	101	0			c.C2573A						.						59.0	59.0	59.0					7																	88964869		2203	4300	6503	SO:0001587	stop_gained	219578	exon4			CTTACTCAATAGA	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2573C>A	7.37:g.88964869C>A	ENSP00000329638:p.Ser858*	130.0	0.0		152.0	21.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Nonsense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	39	7.614829	0.98390	.	.	ENSG00000182348	ENST00000333190	.	.	.	5.19	3.21	0.36854	.	0.790576	0.11417	N	0.566226	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0219	11.4841	0.50344	0.0:0.8285:0.0:0.1715	.	.	.	.	X	858	.	ENSP00000329638:S858X	S	+	2	0	ZNF804B	88802805	0.899000	0.30636	0.011000	0.14972	0.052000	0.14988	2.925000	0.48884	1.402000	0.46780	0.655000	0.94253	TCA	.		0.403	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
CCDC185	164127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	223567608	223567609	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr1:223567608_223567609TG>CT	ENST00000366875.3	+	1	894_895	c.791_792TG>CT	c.(790-792)cTG>cCT	p.L264P		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		264										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		GCCCTGGTGCTGACCCGTCTCA	0.624																																					p.L264P		.											.	.	.	0			.						.																																			SO:0001583	missense	164127	.			TGGTGCTGACCCG																												Exception_encountered	1.37:g.223567608_223567609delinsCT	ENSP00000355840:p.Leu264Pro	142.0	0.0		182.0	26.0	.	Q8N746|Q8NA93	Missense_Mutation	DNP	ENST00000366875.3	37	CCDS1537.1																																																																																			.		0.624	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
TBC1D8	11138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	101666978	101666979	+	Missense_Mutation	DNP	CC	CC	GA			TCGA-DD-A118-01A-11D-A12Z-10	TCGA-DD-A118-11A-11D-A12Z-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	48d84dbb-ab16-4a9d-8a01-2700d8c457d6	c8499913-0f62-4b43-a7d4-49fb5e292768	g.chr2:101666978_101666979CC>GA	ENST00000376840.4	-	5	710_711	c.711_712GG>TC	c.(709-714)ctGGat>ctTCat	p.D238H	TBC1D8_ENST00000409318.1_Missense_Mutation_p.D253H			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	238					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						AACACCTCATCCAGGTTCAGGA	0.515																																					p.D253H		.											.	.	.	0			.						.																																			SO:0001583	missense	11138	.			CCTCATCCAGGTT	AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.711_712delinsGA	2.37:g.101666978_101666979delinsGA	ENSP00000366036:p.Asp238His	160.0	0.0		146.0	55.0	.	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	DNP	ENST00000376840.4	37	CCDS46375.1																																																																																			.		0.515	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376092.1	NM_007063	
