#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A1BG	1	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58864542	58864542	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:58864542A>T	ENST00000263100.3	-	3	153	c.92T>A	c.(91-93)cTg>cAg	p.L31Q	CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	31	Ig-like V-type 1.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CTCTGCCCACAGGCTGGGCTG	0.617																																					p.L31Q		.											.	A1BG	90	0			c.T92A						.						98.0	99.0	98.0					19																	58864542		2203	4300	6503	SO:0001583	missense	1	exon3			GCCCACAGGCTGG		CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.92T>A	19.37:g.58864542A>T	ENSP00000263100:p.Leu31Gln	104.0	0.0		73.0	39.0	NM_130786	A8K052|Q68CK0|Q8IYJ6|Q96P39	Missense_Mutation	SNP	ENST00000263100.3	37	CCDS12976.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.108224	0.56291	.	.	ENSG00000121410	ENST00000263100	T	0.01379	4.96	3.17	3.17	0.36434	Immunoglobulin-like fold (1);	0.254751	0.20647	N	0.088285	T	0.10252	0.0251	M	0.93978	3.48	0.30286	N	0.790812	D	0.89917	1.0	D	0.97110	1.0	T	0.01476	-1.1345	10	0.87932	D	0	.	8.0905	0.30797	1.0:0.0:0.0:0.0	.	31	P04217	A1BG_HUMAN	Q	31	ENSP00000263100:L31Q	ENSP00000263100:L31Q	L	-	2	0	A1BG	63556354	0.031000	0.19500	0.558000	0.28319	0.155000	0.21991	2.184000	0.42575	1.685000	0.51034	0.460000	0.39030	CTG	.		0.617	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466930.1	NM_130786	
ABCG8	64241	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	44073332	44073332	+	Silent	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:44073332G>T	ENST00000272286.2	+	3	294	c.204G>T	c.(202-204)ctG>ctT	p.L68L		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	68	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	TTGAGCAGCTGGCTCAGTTCA	0.532																																					p.L68L		.											.	ABCG8	94	0			c.G204T						.						67.0	67.0	67.0					2																	44073332		2203	4300	6503	SO:0001819	synonymous_variant	64241	exon3			GCAGCTGGCTCAG	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.204G>T	2.37:g.44073332G>T		157.0	1.0		115.0	44.0	NM_022437	Q53QN8	Silent	SNP	ENST00000272286.2	37	CCDS1815.1																																																																																			.		0.532	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437	
ABCA12	26154	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	215815649	215815649	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:215815649T>C	ENST00000272895.7	-	45	7025	c.6806A>G	c.(6805-6807)aAg>aGg	p.K2269R	AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.K1951R	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2269	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGCTATAATCTTTTTGTGGAT	0.408																																					p.K2269R	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12	99	0			c.A6806G						.						159.0	156.0	157.0					2																	215815649		2203	4300	6503	SO:0001583	missense	26154	exon45			ATAATCTTTTTGT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6806A>G	2.37:g.215815649T>C	ENSP00000272895:p.Lys2269Arg	302.0	1.0		219.0	21.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	7.534	0.659218	0.14645	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.79940	-1.32;-1.32	5.61	5.61	0.85477	ABC transporter-like (1);	0.092747	0.45606	D	0.000360	T	0.57080	0.2029	N	0.05330	-0.07	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.16289	0.003;0.015	T	0.54899	-0.8224	10	0.02654	T	1	.	8.4345	0.32778	0.0:0.1152:0.0:0.8848	.	2269;1951	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	R	2269;1951	ENSP00000272895:K2269R;ENSP00000374312:K1951R	ENSP00000272895:K2269R	K	-	2	0	ABCA12	215523894	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.427000	0.52785	2.133000	0.65898	0.454000	0.30748	AAG	.		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ACAT2	39	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	160196246	160196246	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:160196246G>C	ENST00000367048.4	+	5	2295	c.535G>C	c.(535-537)Gac>Cac	p.D179H	ACAT2_ENST00000541436.1_Missense_Mutation_p.D208H	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	179					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AGAAGATCAGGACAAGGTTGC	0.403																																					p.D179H		.											.	ACAT2	91	0			c.G535C						.						97.0	88.0	91.0					6																	160196246		2203	4300	6503	SO:0001583	missense	39	exon5			GATCAGGACAAGG	AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.535G>C	6.37:g.160196246G>C	ENSP00000356015:p.Asp179His	70.0	0.0		118.0	73.0	NM_005891	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Missense_Mutation	SNP	ENST00000367048.4	37	CCDS5268.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037509	0.93630	.	.	ENSG00000120437	ENST00000367048;ENST00000541436	D;D	0.97232	-4.3;-4.3	5.8	5.8	0.92144	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.99351	0.9772	H	0.99299	4.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98532	1.0628	10	0.87932	D	0	6.2818	20.0693	0.97712	0.0:0.0:1.0:0.0	.	208;179	B7Z233;Q9BWD1	.;THIC_HUMAN	H	179;208	ENSP00000356015:D179H;ENSP00000437850:D208H	ENSP00000356015:D179H	D	+	1	0	ACAT2	160116236	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	9.188000	0.94921	2.758000	0.94735	0.563000	0.77884	GAC	.		0.403	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042912.1	NM_005891	
ACSF2	80221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48551103	48551103	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr17:48551103A>G	ENST00000300441.4	+	13	1657	c.1553A>G	c.(1552-1554)gAg>gGg	p.E518G	ACSF2_ENST00000504392.1_Missense_Mutation_p.E475G|ACSF2_ENST00000541920.1_Missense_Mutation_p.E358G|ACSF2_ENST00000427954.2_Missense_Mutation_p.E543G|ACSF2_ENST00000502667.1_Missense_Mutation_p.E505G|ACSF2_ENST00000506085.1_3'UTR	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	518					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CGGGGTGGTGAGAACATCTAC	0.557																																					p.E518G		.											.	ACSF2	68	0			c.A1553G						.						121.0	111.0	115.0					17																	48551103		2203	4300	6503	SO:0001583	missense	80221	exon13			GTGGTGAGAACAT	AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1553A>G	17.37:g.48551103A>G	ENSP00000300441:p.Glu518Gly	109.0	0.0		96.0	40.0	NM_025149	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	ENST00000300441.4	37	CCDS11567.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.846154	0.91277	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	5.1	5.1	0.69264	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.82898	0.5137	H	0.98682	4.3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.89623	0.3850	10	0.87932	D	0	-31.4005	14.5483	0.68047	1.0:0.0:0.0:0.0	.	505;543;475;518	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	G	518;358;475;543;505	ENSP00000300441:E518G;ENSP00000437987:E358G;ENSP00000425964:E475G;ENSP00000401831:E543G;ENSP00000421884:E505G	ENSP00000300441:E518G	E	+	2	0	ACSF2	45906102	1.000000	0.71417	0.994000	0.49952	0.966000	0.64601	7.134000	0.77268	1.918000	0.55548	0.402000	0.26972	GAG	.		0.557	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367423.3	NM_025149	
ACTL8	81569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	18152300	18152300	+	Silent	SNP	G	G	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:18152300G>C	ENST00000375406.1	+	3	603	c.387G>C	c.(385-387)ctG>ctC	p.L129L		NM_030812.2	NP_110439.2	Q9H568	ACTL8_HUMAN	actin-like 8	129					epithelial cell differentiation (GO:0030855)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	28		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		CGGTCCTCCTGGCCGACCAGC	0.587											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L129L		.											.	ACTL8	72	0			c.G387C						.						91.0	76.0	81.0					1																	18152300		2203	4300	6503	SO:0001819	synonymous_variant	81569	exon3			CCTCCTGGCCGAC	AK057339	CCDS183.1	1p36.2-p35	2009-03-25			ENSG00000117148	ENSG00000117148			24018	protein-coding gene	gene with protein product	"""cancer/testis antigen 57"""						Standard	NM_030812		Approved	CT57	uc001bat.3	Q9H568	OTTHUMG00000002512	ENST00000375406.1:c.387G>C	1.37:g.18152300G>C		120.0	0.0	723	123.0	52.0	NM_030812	Q13104|Q96M75	Silent	SNP	ENST00000375406.1	37	CCDS183.1																																																																																			.		0.587	ACTL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007143.1	NM_030812	
ADAM2	2515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	39644537	39644537	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr8:39644537G>T	ENST00000265708.4	-	10	950	c.847C>A	c.(847-849)Caa>Aaa	p.Q283K	ADAM2_ENST00000347580.4_Missense_Mutation_p.Q264K|ADAM2_ENST00000521880.1_Missense_Mutation_p.Q283K|ADAM2_ENST00000379853.2_Intron	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	283	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		ATCTTCCCTTGAAAGGTTGCA	0.294																																					p.Q283K		.											.	ADAM2	227	0			c.C847A						.						121.0	105.0	110.0					8																	39644537		2203	4300	6503	SO:0001583	missense	2515	exon10			TCCCTTGAAAGGT	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.847C>A	8.37:g.39644537G>T	ENSP00000265708:p.Gln283Lys	392.0	0.0		308.0	110.0	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.558849	0.27827	.	.	ENSG00000104755	ENST00000347580;ENST00000265708;ENST00000521880	T;T;T	0.09445	2.98;2.98;2.98	5.11	2.17	0.27698	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.09423	0.0232	L	0.43923	1.385	0.26343	N	0.977337	B;B;B	0.29909	0.041;0.22;0.261	B;B;B	0.29663	0.098;0.064;0.105	T	0.32188	-0.9916	8	.	.	.	.	7.7227	0.28742	0.0:0.1607:0.5071:0.3321	.	283;264;283	B4DWY7;Q99965-2;Q99965	.;.;ADAM2_HUMAN	K	264;283;283	ENSP00000343854:Q264K;ENSP00000265708:Q283K;ENSP00000429352:Q283K	.	Q	-	1	0	ADAM2	39763694	0.999000	0.42202	0.876000	0.34364	0.557000	0.35523	0.411000	0.21115	0.130000	0.18549	0.585000	0.79938	CAA	.		0.294	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
ADAMTS10	81794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	8651042	8651042	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:8651042C>T	ENST00000597188.1	-	22	2894	c.2624G>A	c.(2623-2625)aGg>aAg	p.R875K	ADAMTS10_ENST00000595838.1_Missense_Mutation_p.R362K|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.R875K	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	875	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						GGCGCGCTGCCTTTTGGGCAG	0.662											OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R875K		.											.	ADAMTS10	229	0			c.G2624A						.						27.0	27.0	27.0					19																	8651042		2202	4293	6495	SO:0001583	missense	81794	exon22			CGCTGCCTTTTGG	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.2624G>A	19.37:g.8651042C>T	ENSP00000471851:p.Arg875Lys	71.0	0.0	81	63.0	22.0	NM_030957	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.312787	0.40895	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.60171	0.21	4.14	4.14	0.48551	.	0.076752	0.52532	U	0.000067	T	0.32041	0.0816	N	0.11892	0.195	0.43364	D	0.995444	B;B;B	0.15719	0.004;0.003;0.014	B;B;B	0.16289	0.013;0.015;0.014	T	0.16364	-1.0405	10	0.06099	T	0.92	.	9.3885	0.38359	0.0:0.9019:0.0:0.0981	.	629;875;362	Q59FE5;Q9H324;E9PCI6	.;ATS10_HUMAN;.	K	875;629	ENSP00000270328:R875K	ENSP00000270328:R875K	R	-	2	0	ADAMTS10	8557042	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.313000	0.43735	2.132000	0.65825	0.561000	0.74099	AGG	.		0.662	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
AMPD2	271	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110171048	110171048	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:110171048C>T	ENST00000256578.3	+	11	1860	c.1500C>T	c.(1498-1500)tcC>tcT	p.S500S	AMPD2_ENST00000528454.1_Silent_p.S382S|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000393688.3_Silent_p.S381S|AMPD2_ENST00000342115.4_Silent_p.S419S|AMPD2_ENST00000358729.4_Silent_p.S425S|AMPD2_ENST00000528667.1_Silent_p.S500S	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	500					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		TTGGGGAGTCCGTCCTCCGAG	0.527																																					p.S500S		.											.	AMPD2	292	0			c.C1500T						.						105.0	107.0	106.0					1																	110171048		2203	4300	6503	SO:0001819	synonymous_variant	271	exon11			GGAGTCCGTCCTC	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.1500C>T	1.37:g.110171048C>T		51.0	0.0		40.0	4.0	NM_004037	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Silent	SNP	ENST00000256578.3	37	CCDS805.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.991017	0.35131	.	.	ENSG00000116337	ENST00000369840	.	.	.	4.93	0.0246	0.14142	.	.	.	.	.	T	0.40546	0.1121	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33240	-0.9876	4	.	.	.	-17.8865	8.588	0.33670	0.0:0.4597:0.0:0.5403	.	.	.	.	C	471	.	.	R	+	1	0	AMPD2	109972571	0.944000	0.32072	1.000000	0.80357	0.985000	0.73830	0.074000	0.14662	0.080000	0.16959	-0.367000	0.07326	CGT	.		0.527	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
ANK1	286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	41559138	41559138	+	Silent	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr8:41559138T>C	ENST00000347528.4	-	22	2474	c.2391A>G	c.(2389-2391)ttA>ttG	p.L797L	ANK1_ENST00000379758.2_Silent_p.L797L|ANK1_ENST00000396942.1_Silent_p.L797L|ANK1_ENST00000289734.7_Silent_p.L797L|ANK1_ENST00000352337.4_Silent_p.L797L|ANK1_ENST00000265709.8_Silent_p.L830L|ANK1_ENST00000396945.1_Silent_p.L797L	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	797	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TATCACTGACTAACTAAAACG	0.478											OREG0018740	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L830L		.											.	ANK1	716	0			c.A2490G						.						105.0	98.0	100.0					8																	41559138		2203	4300	6503	SO:0001819	synonymous_variant	286	exon22			ACTGACTAACTAA	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.2391A>G	8.37:g.41559138T>C		148.0	0.0	902	85.0	31.0	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	37	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	T	12.85	2.060377	0.36373	.	.	ENSG00000029534	ENST00000520299	.	.	.	5.97	2.28	0.28536	.	.	.	.	.	T	0.57695	0.2071	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48969	-0.8987	4	.	.	.	.	8.8554	0.35225	0.0:0.2289:0.0:0.7711	.	.	.	.	G	111	.	.	S	-	1	0	ANK1	41678295	0.443000	0.25641	0.994000	0.49952	0.842000	0.47809	-0.045000	0.12003	0.152000	0.19188	0.533000	0.62120	AGT	.		0.478	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
ANKRD7	56311	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	117865018	117865018	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:117865018T>C	ENST00000265224.4	+	1	289	c.134T>C	c.(133-135)cTt>cCt	p.L45P	ANKRD7_ENST00000477532.1_Intron|ANKRD7_ENST00000357099.4_Missense_Mutation_p.L45P|ANKRD7_ENST00000417525.1_5'UTR|ANKRD7_ENST00000433239.1_5'UTR	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	45					male gonad development (GO:0008584)	nucleus (GO:0005634)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						AAGGAATACCTTCAGATCAAG	0.478																																					p.L45P		.											.	ANKRD7	90	0			c.T134C						.						77.0	78.0	78.0					7																	117865018		1845	4086	5931	SO:0001583	missense	56311	exon1			AATACCTTCAGAT	D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.134T>C	7.37:g.117865018T>C	ENSP00000265224:p.Leu45Pro	177.0	0.0		187.0	8.0	NM_019644	B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	ENST00000265224.4	37	CCDS43638.1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.322376	0.41096	.	.	ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000486422	T;T;T	0.72725	-0.68;-0.68;-0.68	4.01	4.01	0.46588	Ankyrin repeat-containing domain (4);	0.000000	0.28482	U	0.015187	D	0.88040	0.6330	H	0.97682	4.055	0.20489	N	0.999895	D	0.89917	1.0	D	0.77557	0.99	T	0.80743	-0.1246	10	0.87932	D	0	-5.6919	9.5654	0.39396	0.0:0.0:0.0:1.0	.	45	Q92527	ANKR7_HUMAN	P	45	ENSP00000349612:L45P;ENSP00000265224:L45P;ENSP00000417353:L45P	ENSP00000265224:L45P	L	+	2	0	ANKRD7	117652254	0.045000	0.20229	0.009000	0.14445	0.002000	0.02628	2.949000	0.49074	1.834000	0.53371	0.444000	0.29173	CTT	.		0.478	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708	
APMAP	57136	broad.mit.edu;bcgsc.ca	37	20	24952125	24952125	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr20:24952125T>C	ENST00000217456.2	-	5	799	c.509A>G	c.(508-510)aAg>aGg	p.K170R	RNU6-1257P_ENST00000384625.1_RNA|APMAP_ENST00000447138.1_Missense_Mutation_p.K170R	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	170					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										AAATAGTCCCTTGTATGCATC	0.423																																					p.K170R		.											.	.	.	0			c.A509G						.						70.0	70.0	70.0					20																	24952125		2203	4300	6503	SO:0001583	missense	57136	exon5			AGTCCCTTGTATG	AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.509A>G	20.37:g.24952125T>C	ENSP00000217456:p.Lys170Arg	108.0	0.0		83.0	4.0	NM_020531	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	ENST00000217456.2	37	CCDS13166.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.12|13.12	2.143313|2.143313	0.37825|0.37825	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000217456;ENST00000447138|ENST00000451442	T;T|.	0.28069|.	1.63;1.63|.	5.47|5.47	5.47|5.47	0.80525|0.80525	Six-bladed beta-propeller, TolB-like (1);|.	0.234553|.	0.43919|.	D|.	0.000514|.	T|T	0.40448|0.40448	0.1117|0.1117	L|L	0.35793|0.35793	1.09|1.09	0.29182|0.29182	N|N	0.876441|0.876441	B;B;B|.	0.25486|.	0.127;0.064;0.038|.	B;B;B|.	0.27076|.	0.076;0.023;0.035|.	T|T	0.35001|0.35001	-0.9806|-0.9806	10|5	0.22109|.	T|.	0.4|.	-29.3377|-29.3377	11.9408|11.9408	0.52899|0.52899	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	170;154;170|.	Q9HDC9-2;A2A2F9;Q9HDC9|.	.;.;APMAP_HUMAN|.	R|G	170|155	ENSP00000217456:K170R;ENSP00000415373:K170R|.	ENSP00000217456:K170R|.	K|R	-|-	2|1	0|2	C20orf3|C20orf3	24900125|24900125	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.389000|4.389000	0.59639|0.59639	2.072000|2.072000	0.62099|0.62099	0.459000|0.459000	0.35465|0.35465	AAG|AGG	.		0.423	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078380.2	NM_020531	
ATP2B4	493	broad.mit.edu;bcgsc.ca	37	1	203667458	203667481	+	Splice_Site	DEL	CGCCCTGCTGGTGAAGAAAATGAA	CGCCCTGCTGGTGAAGAAAATGAA	-	rs114358697|rs372768311	byFrequency	TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	CGCCCTGCTGGTGAAGAAAATGAA	CGCCCTGCTGGTGAAGAAAATGAA	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:203667458_203667481delCGCCCTGCTGGTGAAGAAAATGAA	ENST00000357681.5	+	3	1490_1513	c.367_390delCGCCCTGCTGGTGAAGAAAATGAA	c.(367-390)cgccctgctggtgaagaaaatgaadel	p.RPAGEENE123del	ATP2B4_ENST00000391954.2_Splice_Site_p.RPAGEENE123del|ATP2B4_ENST00000341360.2_Splice_Site_p.RPAGEENE123del|ATP2B4_ENST00000367218.3_Splice_Site_p.RPAGEENE123del|ATP2B4_ENST00000367219.3_Splice_Site_p.RPAGEENE123del	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	123					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.E127E(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GTCCTTTTATCGCCCTGCTGGTGAAGAAAATGAACGTGAGTGTC	0.473																																					p.123_130del		.											.	ATP2B4	517	2	Substitution - coding silent(2)	urinary_tract(2)	c.367_390del						.																																			SO:0001630	splice_region_variant	493	exon3			TTTTATCGCCCTG	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.391+1CGCCCTGCTGGTGAAGAAAATGAA>-	1.37:g.203667458_203667481delCGCCCTGCTGGTGAAGAAAATGAA		278.0	0.0		254.0	12.0	NM_001001396	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	In_Frame_Del	DEL	ENST00000357681.5	37	CCDS1440.1																																																																																			.		0.473	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087462.1	NM_001001396	In_Frame_Del
ATP7A	538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	77243771	77243771	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:77243771T>A	ENST00000341514.6	+	3	309	c.154T>A	c.(154-156)Tat>Aat	p.Y52N	ATP7A_ENST00000343533.5_Missense_Mutation_p.Y52N|ATP7A_ENST00000350425.4_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	52	HMA 1. {ECO:0000255|PROSITE- ProRule:PRU00280}.				blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AACTATTATTTATGACCCTAA	0.348																																					p.Y52N		.											.	ATP7A	130	0			c.T154A						.						179.0	170.0	173.0					X																	77243771		2203	4296	6499	SO:0001583	missense	538	exon3			ATTATTTATGACC	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.154T>A	X.37:g.77243771T>A	ENSP00000345728:p.Tyr52Asn	292.0	0.0		232.0	66.0	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	37	CCDS35339.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.37|18.37	3.609328|3.609328	0.66558|0.66558	.|.	.|.	ENSG00000165240|ENSG00000165240	ENST00000343912|ENST00000343533;ENST00000341514;ENST00000400860;ENST00000355691	.|D;D	.|0.86497	.|-2.13;-2.13	5.59|5.59	5.59|5.59	0.84812|0.84812	.|Heavy metal-associated domain, HMA (3);Heavy metal-associated domain, copper ion-binding (1);	.|0.072596	.|0.56097	.|D	.|0.000023	.|D	.|0.94653	.|0.8276	M|M	0.91196|0.91196	3.185|3.185	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|0.997;1.0	.|D;D	.|0.79784	.|0.987;0.993	.|D	.|0.95666	.|0.8719	.|10	.|0.87932	.|D	.|0	.|-10.4763	14.835|14.835	0.70175|0.70175	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|52;62	.|Q04656;Q59HD1	.|ATP7A_HUMAN;.	.|N	-1|52;52;52;62	.|ENSP00000343026:Y52N;ENSP00000345728:Y52N	.|ENSP00000345728:Y52N	.|Y	+|+	.|1	.|0	ATP7A|ATP7A	77130427|77130427	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.499000|7.499000	0.81566|0.81566	1.885000|1.885000	0.54596|0.54596	0.430000|0.430000	0.28490|0.28490	.|TAT	.		0.348	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
BMPER	168667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	34097695	34097695	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:34097695A>T	ENST00000297161.2	+	11	1326	c.952A>T	c.(952-954)Aat>Tat	p.N318Y	BMPER_ENST00000426693.1_Missense_Mutation_p.N318Y	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	318	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.N318H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GTCCTCTATCAATTGTACCAT	0.507																																					p.N318Y		.											.	BMPER	92	1	Substitution - Missense(1)	breast(1)	c.A952T						.						272.0	203.0	227.0					7																	34097695		2203	4300	6503	SO:0001583	missense	168667	exon11			TCTATCAATTGTA		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.952A>T	7.37:g.34097695A>T	ENSP00000297161:p.Asn318Tyr	346.0	0.0		422.0	125.0	NM_133468	A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	37	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395377	0.83011	.	.	ENSG00000164619	ENST00000297161;ENST00000426693	T;T	0.64991	-0.13;-0.13	5.63	5.63	0.86233	von Willebrand factor, type C (3);	0.085057	0.85682	D	0.000000	T	0.73666	0.3616	L	0.45698	1.435	0.58432	D	0.999999	D	0.71674	0.998	D	0.71184	0.972	T	0.76033	-0.3107	10	0.72032	D	0.01	.	16.1307	0.81436	1.0:0.0:0.0:0.0	.	318	Q8N8U9	BMPER_HUMAN	Y	318	ENSP00000297161:N318Y;ENSP00000393950:N318Y	ENSP00000297161:N318Y	N	+	1	0	BMPER	34064220	1.000000	0.71417	0.966000	0.40874	0.992000	0.81027	8.268000	0.89876	2.263000	0.75096	0.533000	0.62120	AAT	.		0.507	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
BRD1	23774	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50169282	50169282	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr22:50169282C>G	ENST00000216267.8	-	11	3436	c.2950G>C	c.(2950-2952)Gag>Cag	p.E984Q	BRD1_ENST00000542442.1_Missense_Mutation_p.E672Q|BRD1_ENST00000404760.1_Missense_Mutation_p.E1115Q|BRD1_ENST00000457780.2_3'UTR|BRD1_ENST00000342989.5_Missense_Mutation_p.E710Q|BRD1_ENST00000404034.1_Missense_Mutation_p.E984Q	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	984	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AACAGCTTCTCATCAGACTTG	0.592																																					p.E984Q		.											.	BRD1	91	0			c.G2950C						.						135.0	147.0	143.0					22																	50169282		2203	4300	6503	SO:0001583	missense	23774	exon11			GCTTCTCATCAGA	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.2950G>C	22.37:g.50169282C>G	ENSP00000216267:p.Glu984Gln	124.0	1.0		105.0	28.0	NM_014577	A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	37	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959580	0.74016	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000542442;ENST00000342989;ENST00000419212	T;T;T;T;T	0.24350	1.86;1.86;1.86;1.86;1.86	4.84	4.84	0.62591	PWWP (3);	0.000000	0.85682	D	0.000000	T	0.49932	0.1586	L	0.61387	1.9	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.997;0.999	D;D;D;D	0.83275	0.994;0.996;0.991;0.989	T	0.49093	-0.8975	10	0.51188	T	0.08	.	18.2764	0.90085	0.0:1.0:0.0:0.0	.	1115;710;984;1115	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	Q	984;984;1115;672;710;575	ENSP00000216267:E984Q;ENSP00000384076:E984Q;ENSP00000385858:E1115Q;ENSP00000437514:E672Q;ENSP00000345886:E710Q	ENSP00000216267:E984Q	E	-	1	0	BRD1	48555286	1.000000	0.71417	0.938000	0.37757	0.974000	0.67602	7.595000	0.82710	2.407000	0.81776	0.591000	0.81541	GAG	.		0.592	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	
C11orf16	56673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	8947426	8947426	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:8947426A>G	ENST00000326053.5	-	5	894	c.788T>C	c.(787-789)tTc>tCc	p.F263S	C11orf16_ENST00000528998.1_5'Flank|C11orf16_ENST00000525780.1_Missense_Mutation_p.F263S	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	263										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		AGGGCACAGGAATGGAGCATC	0.632																																					p.F263S		.											.	C11orf16	92	0			c.T788C						.						75.0	74.0	74.0					11																	8947426		2201	4296	6497	SO:0001583	missense	56673	exon5			CACAGGAATGGAG	AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.788T>C	11.37:g.8947426A>G	ENSP00000318999:p.Phe263Ser	66.0	0.0		49.0	19.0	NM_020643	Q53FB2|Q8N6Y9	Missense_Mutation	SNP	ENST00000326053.5	37	CCDS7794.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.831224	0.32329	.	.	ENSG00000176029	ENST00000525780;ENST00000326053	T;T	0.38401	1.2;1.14	6.07	3.75	0.43078	.	0.630079	0.16603	N	0.207279	T	0.31009	0.0783	M	0.61703	1.905	0.09310	N	1	B;P	0.43287	0.383;0.802	B;B	0.36719	0.095;0.231	T	0.27905	-1.0060	10	0.59425	D	0.04	-33.0708	6.0536	0.19799	0.7227:0.1369:0.1404:0.0	.	263;263	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	S	263	ENSP00000436818:F263S;ENSP00000318999:F263S	ENSP00000318999:F263S	F	-	2	0	C11orf16	8904002	0.922000	0.31269	0.002000	0.10522	0.005000	0.04900	1.693000	0.37742	0.530000	0.28619	-0.290000	0.09829	TTC	.		0.632	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385626.1	NM_020643	
C16orf82	162083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27078698	27078698	+	lincRNA	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:27078698G>T	ENST00000505035.1	+	0	671				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		CAGCCAGCTGGGCTCCATAGA	0.642																																					p.G128C		.											.	.	.	0			c.G382T						.						8.0	12.0	11.0					16																	27078698		2033	4168	6201			162083	exon1			CAGCTGGGCTCCA	BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27078698G>T		36.0	0.0		35.0	14.0	NM_001145545	B9EGC2|Q8NEF0	Missense_Mutation	SNP	ENST00000505035.1	37																																																																																				.		0.642	C16orf82-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000366634.1	NM_001145545	
TSPEAR	54084	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	45937720	45937720	+	Intron	SNP	T	T	A	rs183543214		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr21:45937720T>A	ENST00000323084.4	-	9	1632				TSPEAR_ENST00000397916.1_Intron|C21orf90_ENST00000465978.1_Splice_Site|TSPEAR-AS1_ENST00000430181.1_RNA|TSPEAR-AS1_ENST00000451035.1_RNA|C21orf90_ENST00000354333.5_Splice_Site|C21orf90_ENST00000330490.3_Splice_Site	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats						sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GCTTTGAAGGTAACTTTCCTT	0.547													T|||	1	0.000199681	0.0	0.0014	5008	,	,		19853	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			c.621+2T>A						.																																			SO:0001627	intron_variant	114043	exon1			TGAAGGTAACTTT	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1566+4045A>T	21.37:g.45937720T>A		203.0	0.0		124.0	45.0	NR_026548		RNA	SNP	ENST00000323084.4	37	CCDS13712.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	T	4.166	0.029254	0.08054	.	.	ENSG00000182912	ENST00000330490;ENST00000354333	.	.	.	0.815	-0.599	0.11645	.	.	.	.	.	.	.	.	.	.	.	0.22858	N	0.998645	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0082	0.06035	0.0:0.4837:0.0:0.5163	.	.	.	.	.	-1	.	.	.	+	.	.	C21orf90	44762148	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.602000	0.05680	-0.229000	0.09854	0.383000	0.25322	.	T|0.999;A|0.000		0.547	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991	
C2orf74	339804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61389694	61389694	+	Silent	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:61389694A>G	ENST00000432605.1	+	1	66	c.66A>G	c.(64-66)ctA>ctG	p.L22L	C2orf74_ENST00000426997.1_Intron|RP11-493E12.1_ENST00000605902.1_lincRNA	NM_001143959.1	NP_001137431.1	A8MZ97	CB074_HUMAN	chromosome 2 open reading frame 74	22						integral component of membrane (GO:0016021)				endometrium(1)	1						TCATCCTTCTAATTTGCCTCA	0.358																																					p.L22L		.											.	.	.	0			c.A66G						.						374.0	293.0	318.0					2																	61389694		692	1591	2283	SO:0001819	synonymous_variant	339804	exon1			CCTTCTAATTTGC			2p15	2012-08-06			ENSG00000237651	ENSG00000237651			34439	protein-coding gene	gene with protein product							Standard	NM_001143959		Approved	LOC339804	uc010ypm.1	A8MZ97		ENST00000432605.1:c.66A>G	2.37:g.61389694A>G		421.0	0.0		420.0	196.0	NM_001143959	C9JP62	Silent	SNP	ENST00000432605.1	37																																																																																				.		0.358	C2orf74-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001143959	
CACNA1B	774	broad.mit.edu;bcgsc.ca	37	9	140991060	140991060	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr9:140991060C>A	ENST00000371372.1	+	37	5364	c.5219C>A	c.(5218-5220)gCg>gAg	p.A1740E	CACNA1B_ENST00000371363.1_Missense_Mutation_p.A1738E|CACNA1B_ENST00000371365.2_Missense_Mutation_p.A104E|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A1740E|CACNA1B_ENST00000277549.5_Missense_Mutation_p.A934E|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A1739E|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A1741E	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1740	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GACCCGGCTGCGTGGTAAGTG	0.557																																					p.A1740E		.											.	CACNA1B	138	0			c.C5219A						.						80.0	78.0	79.0					9																	140991060		2078	4230	6308	SO:0001583	missense	774	exon36			CGGCTGCGTGGTA	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5219C>A	9.37:g.140991060C>A	ENSP00000360423:p.Ala1740Glu	81.0	0.0		75.0	6.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.8|24.8	4.575620|4.575620	0.86645|0.86645	.|.	.|.	ENSG00000148408|ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355;ENST00000371365|ENST00000413253	D;D;D;D;D;D;D|.	0.97850|.	-4.36;-4.38;-4.57;-4.35;-4.34;-4.35;-4.46|.	4.44|4.44	4.44|4.44	0.53790|0.53790	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.86276|.	0.5894|.	M|M	0.93150|0.93150	3.385|3.385	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	D|.	0.90609|.	0.4550|.	10|.	0.87932|.	D|.	0|.	.|.	17.4531|17.4531	0.87597|0.87597	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1739;1738|.	B1AQK7;B1AQK6|.	.;.|.	E|X	1740;1740;934;1738;1739;1741;104|104	ENSP00000360423:A1740E;ENSP00000277551:A1740E;ENSP00000277549:A934E;ENSP00000360414:A1738E;ENSP00000360408:A1739E;ENSP00000360406:A1741E;ENSP00000360416:A104E|.	ENSP00000277549:A934E|.	A|C	+|+	2|3	0|2	CACNA1B|CACNA1B	140110881|140110881	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.725000|0.725000	0.41563|0.41563	7.698000|7.698000	0.84413|0.84413	2.193000|2.193000	0.70182|0.70182	0.557000|0.557000	0.71058|0.71058	GCG|TGC	.		0.557	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CASZ1	54897	ucsc.edu;bcgsc.ca	37	1	10699837	10699837	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:10699837T>C	ENST00000377022.3	-	21	4759	c.4442A>G	c.(4441-4443)cAc>cGc	p.H1481R	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1481					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CACGCGGTCGTGGTGCTGCGC	0.627																																					p.H1481R		.											.	CASZ1	113	0			c.A4442G						.						42.0	58.0	52.0					1																	10699837		2179	4275	6454	SO:0001583	missense	54897	exon21			CGGTCGTGGTGCT	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4442A>G	1.37:g.10699837T>C	ENSP00000366221:p.His1481Arg	100.0	1.0		43.0	4.0	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.656652	0.88154	.	.	ENSG00000130940	ENST00000377022	.	.	.	4.84	4.84	0.62591	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.48767	U	0.000164	T	0.76608	0.4011	M	0.66939	2.045	0.80722	D	1	D	0.61697	0.99	D	0.74348	0.983	T	0.79780	-0.1659	9	0.87932	D	0	-18.7207	14.4083	0.67099	0.0:0.0:0.0:1.0	.	1481	Q86V15	CASZ1_HUMAN	R	1481	.	ENSP00000366221:H1481R	H	-	2	0	CASZ1	10622424	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.947000	0.87758	1.814000	0.52955	0.377000	0.23210	CAC	.		0.627	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
CELF1	10658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	47504291	47504291	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:47504291C>A	ENST00000358597.3	-	6	642	c.643G>T	c.(643-645)Gga>Tga	p.G215*	CELF1_ENST00000310513.5_Nonsense_Mutation_p.G215*|CELF1_ENST00000361904.3_Nonsense_Mutation_p.G215*|CELF1_ENST00000395292.2_Nonsense_Mutation_p.G215*|CELF1_ENST00000395290.2_Nonsense_Mutation_p.G214*|CELF1_ENST00000532048.1_Nonsense_Mutation_p.G241*|CELF1_ENST00000531165.1_Nonsense_Mutation_p.G242*			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	215					embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						GCAAGGTTTCCCCACACAGAT	0.488																																					p.G241X	Pancreas(163;1949 1966 9906 43218 43785)	.											.	CELF1	92	0			c.G721T						.						129.0	116.0	120.0					11																	47504291		2201	4298	6499	SO:0001587	stop_gained	10658	exon9			GGTTTCCCCACAC	U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.643G>T	11.37:g.47504291C>A	ENSP00000351409:p.Gly215*	274.0	0.0		206.0	89.0	NM_001172639	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Nonsense_Mutation	SNP	ENST00000358597.3	37	CCDS31482.1	.	.	.	.	.	.	.	.	.	.	c	33	5.290516	0.95546	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-7.4391	19.7714	0.96367	0.0:1.0:0.0:0.0	.	.	.	.	X	214;215;215;215;215;242;241	.	ENSP00000308386:G215X	G	-	1	0	CELF1	47460867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.728000	0.84847	2.661000	0.90470	0.651000	0.88453	GGA	.		0.488	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398352.1	NM_006560	
CD248	57124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66082959	66082959	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:66082959G>C	ENST00000311330.3	-	1	1556	c.1540C>G	c.(1540-1542)Ccc>Gcc	p.P514A	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	514	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						ATCATAGGGGGCTGGTGGGCA	0.577																																					p.P514A		.											.	CD248	154	0			c.C1540G						.						78.0	82.0	80.0					11																	66082959		2200	4295	6495	SO:0001583	missense	57124	exon1			TAGGGGGCTGGTG	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1540C>G	11.37:g.66082959G>C	ENSP00000308117:p.Pro514Ala	189.0	0.0		160.0	68.0	NM_020404	Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002839	0.35320	.	.	ENSG00000174807	ENST00000311330	D	0.92752	-3.1	4.44	2.46	0.29980	.	.	.	.	.	D	0.84897	0.5574	L	0.27053	0.805	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.69684	-0.5079	9	0.22706	T	0.39	-10.6789	10.0404	0.42155	0.0:0.0:0.4632:0.5368	.	514	Q9HCU0	CD248_HUMAN	A	514	ENSP00000308117:P514A	ENSP00000308117:P514A	P	-	1	0	CD248	65839535	0.994000	0.37717	0.870000	0.34147	0.420000	0.31355	3.687000	0.54692	0.446000	0.26666	-0.535000	0.04281	CCC	.		0.577	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404	
CHIA	27159	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	111861754	111861754	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:111861754C>T	ENST00000369740.1	+	10	1031	c.928C>T	c.(928-930)Ctg>Ttg	p.L310L	CHIA_ENST00000483391.1_Silent_p.L149L|CHIA_ENST00000430615.1_Silent_p.L202L|CHIA_ENST00000343320.6_Silent_p.L310L|CHIA_ENST00000451398.2_Silent_p.L149L|CHIA_ENST00000353665.6_Silent_p.L149L|RP5-1125M8.2_ENST00000426321.1_RNA	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	310					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		CTGTACCTTCCTGAAAAATGG	0.403																																					p.L310L		.											.	CHIA	91	0			c.C928T						.						72.0	73.0	73.0					1																	111861754		2203	4300	6503	SO:0001819	synonymous_variant	27159	exon10			ACCTTCCTGAAAA	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.928C>T	1.37:g.111861754C>T		273.0	2.0		219.0	69.0	NM_201653	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Silent	SNP	ENST00000369740.1	37	CCDS41368.1																																																																																			.		0.403	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		
CHN2	1124	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	29519792	29519792	+	Intron	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:29519792G>A	ENST00000222792.6	+	7	1106				CHN2_ENST00000546235.1_Intron|CHN2_ENST00000424025.2_Silent_p.Q22Q|CHN2_ENST00000539389.1_Intron|CHN2_ENST00000435288.2_Intron|CHN2_ENST00000421775.2_Silent_p.Q22Q|CHN2_ENST00000495789.2_Intron|CHN2_ENST00000439711.2_Silent_p.Q22Q|CHN2_ENST00000539406.1_Intron|CHN2_ENST00000409041.4_Silent_p.Q22Q	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2						positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						AGTCTAAGCAGGGCAGGAAAC	0.527																																					p.Q22Q	Ovarian(1;44 48 13232 18918 31480)	.											.	CHN2	229	0			c.G66A						.						109.0	123.0	118.0					7																	29519792		1327	2309	3636	SO:0001627	intron_variant	1124	exon1			TAAGCAGGGCAGG	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.577-103G>A	7.37:g.29519792G>A		212.0	1.0		257.0	70.0	NM_001039936	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Silent	SNP	ENST00000222792.6	37	CCDS5420.1																																																																																			.		0.527	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
CKMT2	1160	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	80548514	80548514	+	Splice_Site	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:80548514C>A	ENST00000424301.2	+	4	391	c.153C>A	c.(151-153)agC>agA	p.S51R	CKMT2-AS1_ENST00000501927.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2_ENST00000254035.4_Splice_Site_p.S51R|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2_ENST00000437669.1_Splice_Site_p.S51R|CKMT2-AS1_ENST00000503483.2_RNA	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	51	Cardiolipin-binding. {ECO:0000250}.|Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.S51S(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	CCCCACACAGCGCAGACTACC	0.602																																					p.S51R		.											.	CKMT2	90	1	Substitution - coding silent(1)	endometrium(1)	c.C153A						.						67.0	61.0	63.0					5																	80548514		2203	4300	6503	SO:0001630	splice_region_variant	1160	exon4			ACACAGCGCAGAC		CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.153-1C>A	5.37:g.80548514C>A		42.0	0.0		51.0	36.0	NM_001825	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	ENST00000424301.2	37	CCDS4053.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.895581	0.91962	.	.	ENSG00000131730	ENST00000254035;ENST00000511719;ENST00000437669;ENST00000424301;ENST00000505060	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	6.04	-8.5	0.00927	ATP:guanido phosphotransferase, N-terminal (3);	0.125812	0.64402	D	0.000001	T	0.73737	0.3625	M	0.80422	2.495	0.51767	D	0.999938	D	0.89917	1.0	D	0.72982	0.979	T	0.83162	-0.0098	9	.	.	.	.	17.4362	0.87553	0.0:0.5501:0.0:0.4499	.	51	P17540	KCRS_HUMAN	R	51	ENSP00000254035:S51R;ENSP00000423264:S51R;ENSP00000410289:S51R;ENSP00000404203:S51R;ENSP00000427635:S51R	.	S	+	3	2	CKMT2	80584270	0.000000	0.05858	0.019000	0.16419	0.872000	0.50106	-3.327000	0.00511	-1.967000	0.01008	-0.224000	0.12420	AGC	.		0.602	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369600.1	NM_001825	Missense_Mutation
CLPS	1208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	35762977	35762977	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:35762977G>A	ENST00000259938.2	-	3	307	c.285C>T	c.(283-285)tcC>tcT	p.S95S		NM_001832.3	NP_001823.1	P04118	COL_HUMAN	colipase, pancreatic	95					lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	enzyme activator activity (GO:0008047)			large_intestine(2)|lung(2)|prostate(1)	5						TGTTGGTGATGGAGCCCACGA	0.572																																					p.S95S	Melanoma(167;2962 3494 37796)	.											.	CLPS	90	0			c.C285T						.						287.0	187.0	221.0					6																	35762977		2203	4300	6503	SO:0001819	synonymous_variant	1208	exon3			GGTGATGGAGCCC		CCDS4811.1, CCDS75437.1, CCDS75438.1	6p21.31	2012-02-06			ENSG00000137392	ENSG00000137392			2085	protein-coding gene	gene with protein product		120105				2045105	Standard	NM_001832		Approved		uc003ole.2	P04118	OTTHUMG00000014578	ENST00000259938.2:c.285C>T	6.37:g.35762977G>A		248.0	0.0		192.0	49.0	NM_001832	Q5T9G7|Q5U809	Silent	SNP	ENST00000259938.2	37	CCDS4811.1																																																																																			.		0.572	CLPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040312.1	NM_001832	
CLSTN2	64084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	140178531	140178531	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:140178531T>C	ENST00000458420.3	+	7	1332	c.1142T>C	c.(1141-1143)aTc>aCc	p.I381T	RP11-68L1.1_ENST00000483759.2_RNA|RP11-68L1.2_ENST00000503357.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	381					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CAGTTCACCATCACCATGTGG	0.562										HNSCC(16;0.037)																											p.I381T	GBM(45;858 913 3709 36904 37282)	.											.	CLSTN2	157	0			c.T1142C						.						91.0	76.0	81.0					3																	140178531		2203	4300	6503	SO:0001583	missense	64084	exon7			TCACCATCACCAT	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.1142T>C	3.37:g.140178531T>C	ENSP00000402460:p.Ile381Thr	84.0	0.0		90.0	39.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.368726	0.82463	.	.	ENSG00000158258	ENST00000458420	T	0.77620	-1.11	5.41	5.41	0.78517	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.057864	0.64402	D	0.000003	D	0.86389	0.5921	M	0.79693	2.465	0.80722	D	1	D	0.56968	0.978	P	0.60236	0.871	D	0.88363	0.2989	10	0.87932	D	0	-30.4199	13.4033	0.60896	0.0:0.0:0.0:1.0	.	381	Q9H4D0	CSTN2_HUMAN	T	381	ENSP00000402460:I381T	ENSP00000402460:I381T	I	+	2	0	CLSTN2	141661221	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	2.064000	0.61679	0.533000	0.62120	ATC	.		0.562	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
CMPK1	51727	broad.mit.edu;bcgsc.ca	37	1	47834285	47834285	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:47834285A>G	ENST00000371873.5	+	2	465	c.316A>G	c.(316-318)Agg>Ggg	p.R106G	CMPK1_ENST00000450808.2_Intron	NM_001136140.1|NM_016308.2	NP_001129612.1|NP_057392.1			cytidine monophosphate (UMP-CMP) kinase 1, cytosolic											endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|stomach(2)	8						TTTATTAAAGAGGGTAAGGAG	0.398																																					p.R106G		.											.	CMPK1	116	0			c.A316G						.						99.0	88.0	92.0					1																	47834285		2203	4300	6503	SO:0001583	missense	51727	exon2			TTAAAGAGGGTAA	AF070416	CCDS549.1, CCDS44135.1	1p34.1-p33	2008-02-05	2008-01-25	2008-01-25	ENSG00000162368	ENSG00000162368	2.7.4.14		18170	protein-coding gene	gene with protein product	"""UMP-CMP kinase"", ""Cytidine monophosphate kinase"""	191710	"""cytidylate kinase"""	CMPK		10462544	Standard	NM_016308		Approved	UMP-CMPK	uc001cri.3	P30085	OTTHUMG00000007849	ENST00000371873.5:c.316A>G	1.37:g.47834285A>G	ENSP00000360939:p.Arg106Gly	128.0	0.0		110.0	7.0	NM_016308		Missense_Mutation	SNP	ENST00000371873.5	37	CCDS549.1	.	.	.	.	.	.	.	.	.	.	A	19.11	3.764106	0.69878	.	.	ENSG00000162368	ENST00000371873	T	0.76448	-1.02	5.27	4.12	0.48240	.	0.041459	0.85682	D	0.000000	T	0.67183	0.2866	L	0.28608	0.87	0.80722	D	1	P	0.41947	0.766	B	0.39840	0.311	T	0.65713	-0.6101	10	0.44086	T	0.13	-17.3219	12.4003	0.55410	0.8595:0.1405:0.0:0.0	.	106	B2R6S5	.	G	106	ENSP00000360939:R106G	ENSP00000360937:R106G	R	+	1	2	CMPK1	47606872	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.766000	0.68843	0.798000	0.33994	0.455000	0.32223	AGG	.		0.398	CMPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021646.2	NM_016308	
CMTM2	146225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	66613710	66613710	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:66613710G>T	ENST00000268595.2	+	1	351	c.200G>T	c.(199-201)gGg>gTg	p.G67V	RP11-403P17.2_ENST00000568430.1_RNA|CMTM2_ENST00000379486.2_Missense_Mutation_p.G67V	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2	67					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		ACGAGGAGGGGGTGTCGCCGC	0.547																																					p.G67V		.											.	CMTM2	91	0			c.G200T						.						55.0	56.0	56.0					16																	66613710		2201	4300	6501	SO:0001583	missense	146225	exon1			GGAGGGGGTGTCG	BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.200G>T	16.37:g.66613710G>T	ENSP00000268595:p.Gly67Val	111.0	0.0		95.0	41.0	NM_001199317	Q5I2A4|Q8N7E5	Missense_Mutation	SNP	ENST00000268595.2	37	CCDS10814.1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538351	0.45176	.	.	ENSG00000140932	ENST00000379486;ENST00000268595	T;T	0.74526	-0.85;-0.02	4.14	3.15	0.36227	.	0.595626	0.15482	N	0.260037	T	0.79358	0.4432	L	0.54323	1.7	0.19775	N	0.999952	D;D	0.67145	0.996;0.992	D;D	0.67548	0.952;0.914	T	0.66650	-0.5870	10	0.87932	D	0	.	6.2226	0.20689	0.1483:0.0:0.8517:0.0	.	67;67	Q5I2A4;Q8TAZ6	.;CKLF2_HUMAN	V	67	ENSP00000368800:G67V;ENSP00000268595:G67V	ENSP00000268595:G67V	G	+	2	0	CMTM2	65171211	0.721000	0.28007	0.006000	0.13384	0.683000	0.39861	2.248000	0.43160	1.238000	0.43771	0.561000	0.74099	GGG	.		0.547	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268808.1		
COL18A1	80781	ucsc.edu;bcgsc.ca	37	21	46917553	46917553	+	Silent	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr21:46917553A>G	ENST00000359759.4	+	31	3927	c.3906A>G	c.(3904-3906)gaA>gaG	p.E1302E	COL18A1_ENST00000459895.1_3'UTR|COL18A1_ENST00000400337.2_Silent_p.E887E|COL18A1_ENST00000355480.5_Silent_p.E1067E			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1302	Triple-helical region 7 (COL7).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCAAAGGAGAAGTGGGCCCCC	0.642																																					p.E1067E		.											.	COL18A1	90	0			c.A3201G						.						19.0	23.0	21.0					21																	46917553		1990	4129	6119	SO:0001819	synonymous_variant	80781	exon31			AGGAGAAGTGGGC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3906A>G	21.37:g.46917553A>G		48.0	0.0		38.0	4.0	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	ENST00000359759.4	37																																																																																				.		0.642	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
COL4A4	1286	broad.mit.edu;mdanderson.org	37	2	227892673	227892673	+	Silent	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:227892673A>T	ENST00000396625.3	-	42	4233	c.4026T>A	c.(4024-4026)ccT>ccA	p.P1342P	COL4A4_ENST00000329662.7_Silent_p.P1342P	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1342	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCTTCTCTCCAGGTGGCCCAG	0.483																																					p.P1342P		.											.	COL4A4	142	0			c.T4026A						.						41.0	46.0	45.0					2																	227892673		1855	4090	5945	SO:0001819	synonymous_variant	1286	exon42			CTCTCCAGGTGGC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4026T>A	2.37:g.227892673A>T		72.0	0.0		68.0	34.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	37	CCDS42828.1																																																																																			.		0.483	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	3565967	3565967	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr8:3565967delG	ENST00000520002.1	-	7	1533	c.978delC	c.(976-978)cccfs	p.P326fs	CSMD1_ENST00000602723.1_Frame_Shift_Del_p.P326fs|CSMD1_ENST00000400186.3_Frame_Shift_Del_p.P326fs|CSMD1_ENST00000602557.1_Frame_Shift_Del_p.P326fs|CSMD1_ENST00000537824.1_Frame_Shift_Del_p.P326fs|CSMD1_ENST00000542608.1_Frame_Shift_Del_p.P326fs|CSMD1_ENST00000539096.1_Frame_Shift_Del_p.P326fs			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	326						integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CATCCTTGCTGGGCAGCATCT	0.443																																					p.P326fs		.											.	CSMD1	86	0			c.978delC						.						100.0	100.0	100.0					8																	3565967		1987	4178	6165	SO:0001589	frameshift_variant	64478	exon7			CTTGCTGGGCAGC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.978delC	8.37:g.3565967delG	ENSP00000430733:p.Pro326fs	171.0	0.0		158.0	56.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Frame_Shift_Del	DEL	ENST00000520002.1	37																																																																																				.		0.443	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T41A	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0	CTNNB1	24361	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	c.A121G						.						89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCCACTACCACAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	3.37:g.41266124A>G	ENSP00000344456:p.Thr41Ala	239.0	1.0		200.0	13.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	CTNNB1	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	.		0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CYP2W1	54905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	1026794	1026794	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:1026794C>A	ENST00000308919.7	+	6	884	c.871C>A	c.(871-873)Ctg>Atg	p.L291M	CYP2W1_ENST00000340150.6_Missense_Mutation_p.L235M	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	291					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GGCCTGCACCCTGGACATGGT	0.706																																					p.L291M		.											.	CYP2W1	90	0			c.C871A						.						17.0	18.0	18.0					7																	1026794		2171	4276	6447	SO:0001583	missense	54905	exon6			TGCACCCTGGACA	AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.871C>A	7.37:g.1026794C>A	ENSP00000310149:p.Leu291Met	86.0	0.0		80.0	34.0	NM_017781		Missense_Mutation	SNP	ENST00000308919.7	37	CCDS5319.2	.	.	.	.	.	.	.	.	.	.	C	12.27	1.889001	0.33348	.	.	ENSG00000073067	ENST00000308919;ENST00000340150;ENST00000415893	T;T;T	0.80566	-1.39;-1.39;-1.39	5.32	3.52	0.40303	.	0.505958	0.21484	N	0.073782	T	0.79064	0.4383	L	0.39514	1.22	0.27182	N	0.960644	B;P	0.47253	0.236;0.892	B;P	0.52031	0.262;0.688	T	0.69213	-0.5204	10	0.33940	T	0.23	.	10.6798	0.45809	0.0:0.8457:0.0:0.1543	.	235;291	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	M	291;235;65	ENSP00000310149:L291M;ENSP00000344178:L235M;ENSP00000392581:L65M	ENSP00000310149:L291M	L	+	1	2	CYP2W1	993320	0.384000	0.25164	0.460000	0.27093	0.709000	0.40893	1.311000	0.33562	0.638000	0.30545	0.561000	0.74099	CTG	.		0.706	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157249.1	NM_017781	
DACT1	51339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	59112430	59112430	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr14:59112430C>G	ENST00000335867.4	+	4	1113	c.1089C>G	c.(1087-1089)aaC>aaG	p.N363K	DACT1_ENST00000541264.2_Missense_Mutation_p.N82K|DACT1_ENST00000556859.1_Missense_Mutation_p.N82K|DACT1_ENST00000395153.3_Missense_Mutation_p.N326K			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	363					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CCAGCGTGAACGCTGACCCCA	0.522																																					p.N363K		.											.	DACT1	291	0			c.C1089G						.						60.0	61.0	60.0					14																	59112430		2203	4300	6503	SO:0001583	missense	51339	exon4			CGTGAACGCTGAC	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1089C>G	14.37:g.59112430C>G	ENSP00000337439:p.Asn363Lys	72.0	0.0		75.0	29.0	NM_016651	A8MYJ2|Q86TY0	Missense_Mutation	SNP	ENST00000335867.4	37	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787717	0.49997	.	.	ENSG00000165617	ENST00000556859;ENST00000421793;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.46	-6.63	0.01807	.	0.240791	0.47852	N	0.000220	T	0.44456	0.1294	M	0.67953	2.075	0.38146	D	0.938598	P;P	0.45396	0.857;0.857	P;P	0.52109	0.669;0.69	T	0.56007	-0.8050	10	0.45353	T	0.12	-9.4124	10.926	0.47191	0.0:0.3207:0.0901:0.5893	.	326;363	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	K	82;82;82;326;363;82	ENSP00000451598:N82K;ENSP00000404297:N82K;ENSP00000378581:N82K;ENSP00000378582:N326K;ENSP00000337439:N363K;ENSP00000442850:N82K	ENSP00000337439:N363K	N	+	3	2	DACT1	58182183	0.130000	0.22417	0.042000	0.18584	0.857000	0.48899	-0.488000	0.06497	-1.382000	0.02109	-0.471000	0.05019	AAC	.		0.522	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651	
ACKR1	2532	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159175494	159175494	+	Missense_Mutation	SNP	C	C	A	rs34599082	byFrequency	TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:159175494C>A	ENST00000368122.2	+	2	944	c.265C>A	c.(265-267)Cgc>Agc	p.R89S	CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000368121.2_Missense_Mutation_p.R91S|DARC_ENST00000537147.1_Missense_Mutation_p.R89S	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		89			R -> C (antigen Fy(x); dbSNP:rs34599082). {ECO:0000269|PubMed:9731074, ECO:0000269|PubMed:9746760, ECO:0000269|PubMed:9886340}.		chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					ACCTCTCTTCCGCTGGCAGCT	0.602																																					p.R91S		.											.	DARC	659	0			c.C271A	GRCh37	CM983823	DARC	M	rs34599082	.						129.0	122.0	124.0					1																	159175494		2203	4300	6503	SO:0001583	missense	2532	exon1			CTCTTCCGCTGGC																												ENST00000368122.2:c.265C>A	1.37:g.159175494C>A	ENSP00000357104:p.Arg89Ser	239.0	1.0		285.0	91.0	NM_001122951	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	37	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370594	0.24771	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000435307;ENST00000368121	T;T;T;T	0.38240	1.15;1.15;1.9;1.15	4.96	2.98	0.34508	.	1.239470	0.06256	U	0.693066	T	0.07638	0.0192	N	0.19112	0.55	0.18873	N	0.999985	P;B	0.37636	0.603;0.296	B;B	0.30716	0.119;0.119	T	0.13656	-1.0501	10	0.19590	T	0.45	-3.2297	7.1239	0.25461	0.0:0.7227:0.1782:0.0991	.	91;89	Q5Y7A1;Q16570	.;DUFFY_HUMAN	S	89;89;89;91;91	ENSP00000357104:R89S;ENSP00000441985:R89S;ENSP00000398406:R91S;ENSP00000357103:R91S	ENSP00000352341:R89S	R	+	1	0	DARC	157442118	0.007000	0.16637	0.952000	0.39060	0.273000	0.26683	0.541000	0.23207	1.149000	0.42402	0.462000	0.41574	CGC	C|0.991;T|0.009		0.602	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155156800	155156800	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr4:155156800A>C	ENST00000357232.4	-	25	7638	c.7639T>G	c.(7639-7641)Ttt>Gtt	p.F2547V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2547					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AACACTAAAAAGGAGACCACC	0.383																																					p.F2547V		.											.	DCHS2	94	0			c.T7639G						.						59.0	61.0	60.0					4																	155156800		2202	4300	6502	SO:0001583	missense	54798	exon25			CTAAAAAGGAGAC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7639T>G	4.37:g.155156800A>C	ENSP00000349768:p.Phe2547Val	192.0	0.0		157.0	61.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	A	0.184	-1.059221	0.01950	.	.	ENSG00000197410	ENST00000357232	T	0.54866	0.55	5.53	0.931	0.19460	.	0.552403	0.18120	N	0.151079	T	0.28830	0.0715	L	0.29908	0.895	0.09310	N	0.999998	B	0.14805	0.011	B	0.08055	0.003	T	0.12656	-1.0539	10	0.08599	T	0.76	.	2.4251	0.04457	0.5111:0.2142:0.0775:0.1971	.	2547	Q6V1P9	PCD23_HUMAN	V	2547	ENSP00000349768:F2547V	ENSP00000349768:F2547V	F	-	1	0	DCHS2	155376250	0.126000	0.22350	0.534000	0.28014	0.286000	0.27126	1.187000	0.32090	0.343000	0.23821	0.383000	0.25322	TTT	.		0.383	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DHTKD1	55526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	12131171	12131171	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr10:12131171C>T	ENST00000263035.4	+	5	966	c.904C>T	c.(904-906)Cgc>Tgc	p.R302C	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	302					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GGGCAAAACTCGCGGCAGGCA	0.602																																					p.R302C		.											.	DHTKD1	515	0			c.C904T						.						76.0	69.0	71.0					10																	12131171		2203	4300	6503	SO:0001583	missense	55526	exon5			AAAACTCGCGGCA	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.904C>T	10.37:g.12131171C>T	ENSP00000263035:p.Arg302Cys	57.0	0.0		49.0	12.0	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532131	0.45073	.	.	ENSG00000181192	ENST00000263035;ENST00000437298	T;T	0.16196	2.36;2.36	5.43	5.43	0.79202	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	H	0.98388	4.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75961	-0.3133	10	0.87932	D	0	-9.1937	14.8998	0.70670	0.1439:0.8561:0.0:0.0	.	302	Q96HY7	DHTK1_HUMAN	C	302;237	ENSP00000263035:R302C;ENSP00000388163:R237C	ENSP00000263035:R302C	R	+	1	0	DHTKD1	12171177	0.977000	0.34250	0.031000	0.17742	0.008000	0.06430	2.402000	0.44521	2.543000	0.85770	0.563000	0.77884	CGC	.		0.602	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
DIS3	22894	ucsc.edu;bcgsc.ca	37	13	73355910	73355910	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr13:73355910G>A	ENST00000377767.4	-	1	161	c.61C>T	c.(61-63)Cgc>Tgc	p.R21C	DIS3_ENST00000545453.1_5'UTR|DIS3_ENST00000377780.4_Missense_Mutation_p.R21C|PIBF1_ENST00000326291.6_5'Flank|DIS3_ENST00000475871.1_5'UTR	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	21					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TAGTGCTCGCGCACGATCTTC	0.672										Multiple Myeloma(4;0.011)																											p.R21C		.											.	DIS3	90	0			c.C61T						.						11.0	13.0	12.0					13																	73355910		2198	4286	6484	SO:0001583	missense	22894	exon1			GCTCGCGCACGAT	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.61C>T	13.37:g.73355910G>A	ENSP00000366997:p.Arg21Cys	59.0	0.0		40.0	4.0	NM_001128226	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969751	0.92855	.	.	ENSG00000083520	ENST00000377767;ENST00000377780	T;T	0.38401	1.51;1.14	5.44	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.65502	0.2697	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.973	T	0.71431	-0.4595	10	0.87932	D	0	.	9.1218	0.36791	0.0735:0.0:0.781:0.1455	.	21;21	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	C	21	ENSP00000366997:R21C;ENSP00000367011:R21C	ENSP00000366997:R21C	R	-	1	0	DIS3	72253911	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.024000	0.70857	1.317000	0.45149	-0.136000	0.14681	CGC	.		0.672	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52394057	52394057	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:52394057delG	ENST00000420323.2	+	27	4794	c.4533delG	c.(4531-4533)gtgfs	p.V1512fs		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1512	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGGAGAACGTGGTCAGCGTGA	0.612																																					p.V1511fs		.											.	DNAH1	67	0			c.4533delG						.						134.0	137.0	136.0					3																	52394057		2148	4259	6407	SO:0001589	frameshift_variant	25981	exon27			GAACGTGGTCAGC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.4533delG	3.37:g.52394057delG	ENSP00000401514:p.Val1512fs	99.0	0.0		93.0	20.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Frame_Shift_Del	DEL	ENST00000420323.2	37	CCDS46842.1																																																																																			.		0.612	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
DNAH8	1769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38738285	38738285	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:38738285G>A	ENST00000359357.3	+	10	1317	c.1063G>A	c.(1063-1065)Gaa>Aaa	p.E355K	DNAH8_ENST00000449981.2_Missense_Mutation_p.E572K|DNAH8_ENST00000441566.1_Missense_Mutation_p.E355K			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	355					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TGAGGTTTCAGAAATGTATAT	0.363																																					p.E572K		.											.	DNAH8	615	0			c.G1714A						.						39.0	40.0	40.0					6																	38738285		2203	4299	6502	SO:0001583	missense	1769	exon12			GTTTCAGAAATGT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1063G>A	6.37:g.38738285G>A	ENSP00000352312:p.Glu355Lys	102.0	0.0		112.0	11.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	G	29.3	4.992739	0.93167	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.56275	0.47;0.47;0.47	5.45	5.45	0.79879	Dynein heavy chain, domain-1 (1);	0.000000	0.85682	D	0.000000	T	0.68842	0.3045	M	0.87097	2.86	0.80722	D	1	P	0.46578	0.88	P	0.59546	0.859	T	0.68625	-0.5359	10	0.39692	T	0.17	.	17.4237	0.87521	0.0:0.0:1.0:0.0	.	355	Q96JB1	DYH8_HUMAN	K	560;560;355;355	ENSP00000333363:E560K;ENSP00000352312:E355K;ENSP00000402294:E355K	ENSP00000333363:E560K	E	+	1	0	DNAH8	38846263	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.481000	0.81124	2.726000	0.93360	0.643000	0.83706	GAA	.		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DOCK10	55619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	225721666	225721666	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:225721666G>C	ENST00000258390.7	-	15	1786	c.1719C>G	c.(1717-1719)gaC>gaG	p.D573E	DOCK10_ENST00000409592.3_Missense_Mutation_p.D567E	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	573					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TTGAGTCTCTGTCCACATTTC	0.318																																					p.D573E		.											.	DOCK10	92	0			c.C1719G						.						101.0	96.0	97.0					2																	225721666		1826	4082	5908	SO:0001583	missense	55619	exon15			GTCTCTGTCCACA	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.1719C>G	2.37:g.225721666G>C	ENSP00000258390:p.Asp573Glu	230.0	0.0		161.0	61.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	37	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780652	0.70222	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.04194	3.68;3.68	5.53	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.15089	0.0364	L	0.60455	1.87	0.34539	D	0.710089	D;D	0.89917	1.0;0.997	D;D	0.83275	0.996;0.937	T	0.08638	-1.0712	10	0.87932	D	0	.	8.837	0.35117	0.2865:0.0:0.7135:0.0	.	573;567	Q96BY6;B3FL70	DOC10_HUMAN;.	E	567;573	ENSP00000386694:D567E;ENSP00000258390:D573E	ENSP00000258390:D573E	D	-	3	2	DOCK10	225429910	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.912000	0.56386	1.334000	0.45468	-0.245000	0.11935	GAC	.		0.318	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	41725559	41725559	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr21:41725559T>C	ENST00000400454.1	-	5	1244	c.767A>G	c.(766-768)tAc>tGc	p.Y256C		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	256	Ig-like C2-type 3.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CAGCCAGCGGTAATCTGGCTC	0.597																																					p.Y256C	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.A767G						.						43.0	42.0	42.0					21																	41725559		1926	4127	6053	SO:0001583	missense	1826	exon5			CAGCGGTAATCTG	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.767A>G	21.37:g.41725559T>C	ENSP00000383303:p.Tyr256Cys	74.0	0.0		56.0	24.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.850741	0.71719	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.66638	-0.22;-0.22	5.31	4.16	0.48862	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75443	0.3850	L	0.52126	1.63	0.52501	D	0.999958	D	0.76494	0.999	D	0.81914	0.995	T	0.76077	-0.3091	10	0.66056	D	0.02	.	11.2924	0.49258	0.0:0.0722:0.0:0.9278	.	256	O60469	DSCAM_HUMAN	C	256;8	ENSP00000383303:Y256C;ENSP00000385342:Y8C	ENSP00000383303:Y256C	Y	-	2	0	DSCAM	40647429	1.000000	0.71417	0.987000	0.45799	0.999000	0.98932	7.560000	0.82277	0.954000	0.37851	0.528000	0.53228	TAC	.		0.597	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
DUS3L	56931	ucsc.edu;bcgsc.ca	37	19	5789643	5789643	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:5789643C>T	ENST00000309061.7	-	3	571	c.475G>A	c.(475-477)Ggc>Agc	p.G159S	DUS3L_ENST00000590681.1_5'UTR|DUS3L_ENST00000320699.8_Intron	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	159							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CAGCGGGGGCCCAGGTCGGCC	0.672																																					p.G159S		.											.	DUS3L	90	0			c.G475A						.						10.0	16.0	14.0					19																	5789643		2127	4242	6369	SO:0001583	missense	56931	exon3			GGGGGCCCAGGTC		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.475G>A	19.37:g.5789643C>T	ENSP00000311977:p.Gly159Ser	39.0	0.0		48.0	4.0	NM_020175	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	37	CCDS32880.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882702	0.51908	.	.	ENSG00000141994	ENST00000309061	T	0.19394	2.15	4.72	4.72	0.59763	.	0.061205	0.64402	D	0.000004	T	0.21387	0.0515	L	0.52759	1.655	0.50632	D	0.999884	B	0.30114	0.269	B	0.32149	0.141	T	0.03773	-1.1005	10	0.52906	T	0.07	-25.4976	11.1313	0.48349	0.0:0.8124:0.1876:0.0	.	159	Q96G46	DUS3L_HUMAN	S	159	ENSP00000311977:G159S	ENSP00000311977:G159S	G	-	1	0	DUS3L	5740643	1.000000	0.71417	1.000000	0.80357	0.322000	0.28314	5.508000	0.67006	2.169000	0.68431	0.491000	0.48974	GGC	.		0.672	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175	
DUSP22	56940	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	348816	348816	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:348816T>A	ENST00000344450.5	+	7	926	c.483T>A	c.(481-483)gaT>gaA	p.D161E	DUSP22_ENST00000605315.1_Missense_Mutation_p.D58E|DUSP22_ENST00000604971.1_Missense_Mutation_p.D58E|DUSP22_ENST00000419235.2_Missense_Mutation_p.D161E|DUSP22_ENST00000605035.1_3'UTR|DUSP22_ENST00000603453.1_Missense_Mutation_p.D58E	NM_020185.3	NP_064570.1	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	161					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(2)	26	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CTTTGCAGGATGCAGAAGAAG	0.547																																					p.D161E		.											.	DUSP22	252	0			c.T483A						.						136.0	124.0	128.0					6																	348816		2203	4300	6503	SO:0001583	missense	56940	exon7			GCAGGATGCAGAA	AF165519	CCDS4468.1, CCDS69035.1	6p25.3	2013-09-19			ENSG00000112679	ENSG00000112679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16077	protein-coding gene	gene with protein product						9205128, 11717427	Standard	NM_001286555		Approved	MKPX, JSP1, JKAP, VHX	uc003msx.3	Q9NRW4	OTTHUMG00000014113	ENST00000344450.5:c.483T>A	6.37:g.348816T>A	ENSP00000345281:p.Asp161Glu	175.0	1.0		161.0	50.0	NM_020185	B4DK56|Q59GW2|Q5VWR2|Q96AR1	Missense_Mutation	SNP	ENST00000344450.5	37	CCDS4468.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.7|20.7	4.032206|4.032206	0.75504|0.75504	.|.	.|.	ENSG00000112679|ENSG00000112679	ENST00000419235|ENST00000344450	.|T	.|0.04406	.|3.63	4.8|4.8	0.988|0.988	0.19796|0.19796	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.06735|0.06735	0.0172|0.0172	L|L	0.55103|0.55103	1.725|1.725	0.46061|0.46061	D|D	0.998849|0.998849	.|P;D;D	.|0.89917	.|0.778;1.0;1.0	.|P;D;D	.|0.91635	.|0.55;0.999;0.999	T|T	0.17258|0.17258	-1.0375|-1.0375	5|10	.|0.40728	.|T	.|0.16	.|.	8.9554|8.9554	0.35814|0.35814	0.0:0.2941:0.0:0.7059|0.0:0.2941:0.0:0.7059	.|.	.|161;118;161	.|Q9NRW4-2;B3KSA8;Q9NRW4	.|.;.;DUS22_HUMAN	S|E	99|161	.|ENSP00000345281:D161E	.|ENSP00000345281:D161E	C|D	+|+	1|3	0|2	DUSP22|DUSP22	293816|293816	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.952000|0.952000	0.60782|0.60782	0.648000|0.648000	0.24828|0.24828	-0.003000|-0.003000	0.14444|0.14444	-0.261000|-0.261000	0.10672|0.10672	TGC|GAT	.		0.547	DUSP22-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000039621.1	NM_020185	
ECE2	9718	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183976322	183976322	+	Intron	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:183976322G>T	ENST00000402825.3	+	2	480				ECE2_ENST00000324557.4_Missense_Mutation_p.D243Y|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2						brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTTCCTTCAGGACTCAGATCA	0.602																																					p.D243Y		.											.	ECE2	94	0			c.G727T						.						82.0	82.0	82.0					3																	183976322		2203	4300	6503	SO:0001627	intron_variant	9718	exon3			CTTCAGGACTCAG	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.480+778G>T	3.37:g.183976322G>T		113.0	1.0		101.0	35.0	NM_032331	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238753	0.58995	.	.	ENSG00000145194	ENST00000324557	T	0.19806	2.12	5.13	5.13	0.70059	.	.	.	.	.	T	0.47563	0.1452	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	T	0.47086	-0.9144	8	0.66056	D	0.02	.	17.323	0.87241	0.0:0.0:1.0:0.0	.	243	O60344-4	.	Y	243	ENSP00000314295:D243Y	ENSP00000314295:D243Y	D	+	1	0	ECE2	185459016	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.359000	0.52292	2.663000	0.90544	0.655000	0.94253	GAC	.		0.602	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
EDA	1896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	69249366	69249366	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:69249366A>T	ENST00000374552.4	+	5	961	c.719A>T	c.(718-720)aAa>aTa	p.K240I	EDA_ENST00000524573.1_Missense_Mutation_p.K240I|EDA_ENST00000374553.2_Missense_Mutation_p.K240I	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	240					cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						GCTGCTGATAAAGCTGGAACT	0.483											OREG0019846	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K240I		.											.	EDA	195	0			c.A719T						.						166.0	130.0	142.0					X																	69249366		2203	4300	6503	SO:0001583	missense	1896	exon5			CTGATAAAGCTGG	U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.719A>T	X.37:g.69249366A>T	ENSP00000363680:p.Lys240Ile	216.0	0.0	1113	143.0	56.0	NM_001399	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	ENST00000374552.4	37	CCDS14394.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.441193	0.63067	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573;ENST00000503592	D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.02	4.59	4.59	0.56863	.	0.057403	0.64402	D	0.000002	D	0.94548	0.8244	L	0.42245	1.32	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.81914	0.991;0.995;0.991	D	0.94709	0.7890	10	0.62326	D	0.03	-3.7523	12.4982	0.55940	1.0:0.0:0.0:0.0	.	240;240;240	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	I	240;240;240;108	ENSP00000363680:K240I;ENSP00000363681:K240I;ENSP00000432585:K240I;ENSP00000423037:K108I	ENSP00000363680:K240I	K	+	2	0	EDA	69166091	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	6.056000	0.71111	1.811000	0.52892	0.486000	0.48141	AAA	.		0.483	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057048.2	NM_001399	
EFCAB13	124989	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	45479548	45479548	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr17:45479548C>T	ENST00000331493.2	+	18	2407	c.1996C>T	c.(1996-1998)Cgt>Tgt	p.R666C	EFCAB13_ENST00000517484.1_Missense_Mutation_p.R570C	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	666	EF-hand 3.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AAGGAATATGCGTGATGCTGC	0.328																																					p.R666C		.											.	.	.	0			c.C1996T						.						114.0	120.0	118.0					17																	45479548		2203	4300	6503	SO:0001583	missense	124989	exon18			AATATGCGTGATG	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.1996C>T	17.37:g.45479548C>T	ENSP00000332111:p.Arg666Cys	133.0	2.0		98.0	43.0	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	37	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080708	0.36758	.	.	ENSG00000178852	ENST00000331493;ENST00000517484	T;T	0.25414	1.8;1.8	2.74	0.521	0.17046	.	2.305130	0.02169	N	0.059529	T	0.34745	0.0908	L	0.40543	1.245	0.09310	N	1	D;D	0.76494	0.999;0.999	P;P	0.57960	0.83;0.764	T	0.10706	-1.0618	10	0.87932	D	0	0.0084	3.2032	0.06657	0.2577:0.5895:0.0:0.1528	.	666;570	Q8IY85;G3V128	CQ057_HUMAN;.	C	666;570	ENSP00000332111:R666C;ENSP00000430048:R570C	ENSP00000332111:R666C	R	+	1	0	C17orf57	42834547	0.000000	0.05858	0.002000	0.10522	0.069000	0.16628	-0.247000	0.08866	0.027000	0.15297	-0.394000	0.06481	CGT	.		0.328	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
EFCAB13	124989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	45479563	45479563	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr17:45479563delT	ENST00000331493.2	+	18	2422	c.2011delT	c.(2011-2013)ttafs	p.L671fs	EFCAB13_ENST00000517484.1_Frame_Shift_Del_p.L575fs	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	671						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										TGCTGCCAGGTTAGAAGGTAA	0.323																																					p.L671X		.											.	.	.	0			c.2011delT						.						112.0	118.0	116.0					17																	45479563		2203	4300	6503	SO:0001589	frameshift_variant	124989	exon18			GCCAGGTTAGAAG	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.2011delT	17.37:g.45479563delT	ENSP00000332111:p.Leu671fs	120.0	0.0		97.0	39.0	NM_152347	G3V128|Q49AG9	Nonsense_Mutation	DEL	ENST00000331493.2	37	CCDS11512.1																																																																																			.		0.323	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
ERRFI1	54206	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	8074176	8074182	+	Frame_Shift_Del	DEL	GGCTTCA	GGCTTCA	-			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	GGCTTCA	GGCTTCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:8074176_8074182delGGCTTCA	ENST00000377482.5	-	4	700_706	c.477_483delTGAAGCC	c.(475-483)tctgaagccfs	p.SEA159fs	ERRFI1_ENST00000474874.1_Intron|ERRFI1_ENST00000469499.1_3'UTR|ERRFI1_ENST00000467067.1_3'UTR	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	159					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		CCAGAGAGAGGGCTTCAGAGATTGGCA	0.483																																					p.159_161del		.											.	ERRFI1	91	0			c.477_483del						.																																			SO:0001589	frameshift_variant	54206	exon4			AGAGAGGGCTTCA	BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.477_483delTGAAGCC	1.37:g.8074176_8074182delGGCTTCA	ENSP00000366702:p.Ser159fs	138.0	0.0		41.0	18.0	NM_018948	B2RDX9|Q9NTG9|Q9UD05	Frame_Shift_Del	DEL	ENST00000377482.5	37	CCDS94.1																																																																																			.		0.483	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003617.1	NM_018948	
FAM65A	79567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	67572365	67572365	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:67572365G>A	ENST00000379312.3	+	2	137	c.16G>A	c.(16-18)Gtg>Atg	p.V6M	FAM65A_ENST00000422602.2_Missense_Mutation_p.V26M|CTD-2012K14.2_ENST00000567122.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.V26M|FAM65A_ENST00000566522.1_Intron|FAM65A_ENST00000428437.2_Missense_Mutation_p.V20M|FAM65A_ENST00000042381.4_Missense_Mutation_p.V6M	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	6						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GTCCCTGTCGGTGCGGCCGCA	0.716																																					p.V26M		.											.	FAM65A	92	0			c.G76A						.						7.0	9.0	8.0					16																	67572365		2074	4105	6179	SO:0001583	missense	79567	exon2			CTGTCGGTGCGGC	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.16G>A	16.37:g.67572365G>A	ENSP00000368614:p.Val6Met	156.0	0.0		128.0	59.0	NM_001193523	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.364472	0.82463	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	T;T;T	0.20200	2.12;2.11;2.09	5.05	5.05	0.67936	.	0.064495	0.64402	D	0.000010	T	0.41558	0.1164	L	0.56769	1.78	0.50632	D	0.999883	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.71184	0.956;0.956;0.956;0.972	T	0.25537	-1.0129	10	0.72032	D	0.01	-12.4677	13.8889	0.63726	0.0:0.1519:0.8481:0.0	.	20;26;6;26	B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.;.;FA65A_HUMAN;.	M	6;6;26;20	ENSP00000368614:V6M;ENSP00000042381:V6M;ENSP00000400099:V26M	ENSP00000042381:V6M	V	+	1	0	FAM65A	66129866	0.999000	0.42202	1.000000	0.80357	0.596000	0.36781	3.110000	0.50352	2.349000	0.79799	0.491000	0.48974	GTG	.		0.716	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268866.3	NM_024519	
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45665463	45665463	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr14:45665463G>T	ENST00000267430.5	+	21	5514	c.5429G>T	c.(5428-5430)aGa>aTa	p.R1810I	FANCM_ENST00000542564.2_Missense_Mutation_p.R1784I	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1810	Interaction with FAAP24 and EME1.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ACTTCTCTTAGACTTCCGCAG	0.438								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R1810I		.											.	FANCM	569	0			c.G5429T						.						129.0	126.0	127.0					14																	45665463		2203	4300	6503	SO:0001583	missense	57697	exon21	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CTCTTAGACTTCC	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5429G>T	14.37:g.45665463G>T	ENSP00000267430:p.Arg1810Ile	195.0	0.0		134.0	62.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.30|18.30	3.594617|3.594617	0.66219|0.66219	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	T;T;T|.	0.18810|.	2.78;2.78;2.19|.	4.75|4.75	2.88|2.88	0.33553|0.33553	.|.	0.957926|.	0.08693|.	N|.	0.907600|.	T|.	0.38134|.	0.1029|.	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	P;P|.	0.49961|.	0.93;0.855|.	B;B|.	0.41571|.	0.36;0.36|.	T|.	0.26677|.	-1.0096|.	10|.	0.87932|.	D|.	0|.	.|.	4.2487|4.2487	0.10684|0.10684	0.1933:0.0:0.6242:0.1825|0.1933:0.0:0.6242:0.1825	.|.	1784;1810|.	B2RTQ9;Q8IYD8|.	.;FANCM_HUMAN|.	I|Y	1810;1784;1326|777	ENSP00000267430:R1810I;ENSP00000442493:R1784I;ENSP00000452033:R1326I|.	ENSP00000267430:R1810I|.	R|X	+|+	2|3	0|2	FANCM|FANCM	44735213|44735213	0.000000|0.000000	0.05858|0.05858	0.012000|0.012000	0.15200|0.15200	0.497000|0.497000	0.33675|0.33675	-0.014000|-0.014000	0.12656|0.12656	1.228000|1.228000	0.43614|0.43614	0.563000|0.563000	0.77884|0.77884	AGA|TAG	.		0.438	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
FER	2241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	108203627	108203627	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:108203627T>C	ENST00000281092.4	+	6	1025	c.641T>C	c.(640-642)aTg>aCg	p.M214T	FER_ENST00000438717.2_Missense_Mutation_p.M39T|FER_ENST00000536402.1_Missense_Mutation_p.M214T	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	214	Important for interaction with membranes containing phosphoinositides.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		TTACAAAAGATGCAAGAAGAA	0.353																																					p.M214T	Colon(146;1051 1799 9836 27344 47401)	.											.	FER	946	0			c.T641C						.						95.0	87.0	89.0					5																	108203627		2202	4300	6502	SO:0001583	missense	2241	exon6			AAAAGATGCAAGA	J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.641T>C	5.37:g.108203627T>C	ENSP00000281092:p.Met214Thr	237.0	0.0		237.0	126.0	NM_005246	B2RCR4|B4DSQ2|H2FLB8	Missense_Mutation	SNP	ENST00000281092.4	37	CCDS4098.1	.	.	.	.	.	.	.	.	.	.	T	19.98	3.926950	0.73327	.	.	ENSG00000151422	ENST00000281092;ENST00000536402;ENST00000438717	T;T;T	0.44482	0.92;0.92;2.5	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.60353	0.2262	M	0.63428	1.95	0.80722	D	1	D	0.55800	0.973	P	0.61201	0.885	T	0.63323	-0.6663	10	0.87932	D	0	-20.9734	16.3197	0.82945	0.0:0.0:0.0:1.0	.	214	P16591	FER_HUMAN	T	214;214;39	ENSP00000281092:M214T;ENSP00000442627:M214T;ENSP00000394297:M39T	ENSP00000281092:M214T	M	+	2	0	FER	108231526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.525000	0.81892	2.302000	0.77476	0.533000	0.62120	ATG	.		0.353	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250664.1	NM_005246	
FREM1	158326	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	14868953	14868953	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr9:14868953G>T	ENST00000380880.3	-	2	806	c.23C>A	c.(22-24)gCt>gAt	p.A8D	FREM1_ENST00000380881.4_Missense_Mutation_p.A8D|FREM1_ENST00000422223.2_Missense_Mutation_p.A8D			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	8					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GGCATTCGCAGCCCCCCAACT	0.607																																					p.A8D		.											.	FREM1	138	0			c.C23A						.						23.0	28.0	26.0					9																	14868953		2056	4194	6250	SO:0001583	missense	158326	exon3			TTCGCAGCCCCCC	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.23C>A	9.37:g.14868953G>T	ENSP00000370262:p.Ala8Asp	17.0	0.0		10.0	5.0	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	G	3.396	-0.123249	0.06795	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.11277	2.79;2.79;2.79	5.75	0.666	0.17901	.	1.223500	0.05631	N	0.581757	T	0.05364	0.0142	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39683	-0.9602	10	0.49607	T	0.09	0.9644	1.7545	0.02979	0.4167:0.3116:0.1422:0.1295	.	8	Q5H8C1	FREM1_HUMAN	D	8	ENSP00000370263:A8D;ENSP00000412940:A8D;ENSP00000370262:A8D	ENSP00000370257:A8D	A	-	2	0	FREM1	14858953	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.371000	0.07513	0.343000	0.23821	-1.274000	0.01402	GCT	.		0.607	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
FRRS1L	23732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	111899753	111899753	+	Silent	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr9:111899753T>C	ENST00000561981.2	-	5	1016	c.1017A>G	c.(1015-1017)ctA>ctG	p.L339L		NM_014334.2	NP_055149.2	Q9P0K9	FRS1L_HUMAN	ferric-chelate reductase 1-like	339						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)											TTCCCATCAATAGGTAGAAGG	0.368																																					p.L339L		.											.	.	.	0			c.A1017G						.						96.0	95.0	95.0					9																	111899753		2203	4300	6503	SO:0001819	synonymous_variant	23732	exon5			CATCAATAGGTAG	AF155065	CCDS35098.1	9q31.3	2014-07-16	2012-03-06	2012-03-06	ENSG00000260230	ENSG00000260230			1362	protein-coding gene	gene with protein product		604574	"""chromosome 9 open reading frame 4"""	C9orf4		10603000	Standard	NM_014334		Approved	CG-6	uc004bdw.1	Q9P0K9	OTTHUMG00000020468	ENST00000561981.2:c.1017A>G	9.37:g.111899753T>C		141.0	0.0		91.0	34.0	NM_014334	Q5T4G4	Silent	SNP	ENST00000561981.2	37	CCDS35098.1																																																																																			.		0.368	FRRS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053586.2	NM_014334	
GABRA3	2556	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	151424438	151424438	+	Silent	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:151424438T>A	ENST00000370314.4	-	5	601	c.363A>T	c.(361-363)acA>acT	p.T121T	GABRA3_ENST00000535043.1_Silent_p.T121T	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	121					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CATCATGCCATGTCTGCCGAA	0.443																																					p.T121T	NSCLC(142;2578 2613 10251 16743)	.											.	GABRA3	131	0			c.A363T						.						125.0	103.0	110.0					X																	151424438		2203	4300	6503	SO:0001819	synonymous_variant	2556	exon5			ATGCCATGTCTGC		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.363A>T	X.37:g.151424438T>A		191.0	0.0		139.0	10.0	NM_000808	Q8TAF9	Silent	SNP	ENST00000370314.4	37	CCDS14706.1																																																																																			.		0.443	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808	
GAD1	2571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171715379	171715379	+	Silent	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:171715379T>A	ENST00000358196.3	+	16	2137	c.1587T>A	c.(1585-1587)ccT>ccA	p.P529P		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	529					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CAGACAGCCCTCAACGACGGG	0.443																																					p.P529P		.											.	GAD1	91	0			c.T1587A						.						84.0	86.0	85.0					2																	171715379		2203	4300	6503	SO:0001819	synonymous_variant	2571	exon16			CAGCCCTCAACGA		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1587T>A	2.37:g.171715379T>A		217.0	0.0		152.0	61.0	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Silent	SNP	ENST00000358196.3	37	CCDS2239.1																																																																																			.		0.443	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
GGA2	23062	ucsc.edu;bcgsc.ca	37	16	23504772	23504772	+	Missense_Mutation	SNP	T	T	C	rs145830611		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:23504772T>C	ENST00000309859.4	-	4	342	c.260A>G	c.(259-261)gAg>gGg	p.E87G	GGA2_ENST00000567468.1_Missense_Mutation_p.E87G	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	87	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		CATGCACATCTCCAGCACCTG	0.562																																					p.E87G		.											.	GGA2	91	0			c.A260G						.	T	GLY/GLU	0,4394		0,0,2197	111.0	85.0	93.0		260	5.6	1.0	16	dbSNP_134	93	2,8598	2.2+/-6.3	0,2,4298	yes	missense	GGA2	NM_015044.4	98	0,2,6495	CC,CT,TT		0.0233,0.0,0.0154	probably-damaging	87/614	23504772	2,12992	2197	4300	6497	SO:0001583	missense	23062	exon4			CACATCTCCAGCA	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.260A>G	16.37:g.23504772T>C	ENSP00000311962:p.Glu87Gly	79.0	0.0		39.0	4.0	NM_015044	D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	ENST00000309859.4	37	CCDS10611.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.929531	0.92389	0.0	2.33E-4	ENSG00000103365	ENST00000309859	T	0.25250	1.81	5.58	5.58	0.84498	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.051952	0.85682	D	0.000000	T	0.54224	0.1845	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60801	-0.7191	10	0.87932	D	0	-35.1353	13.7087	0.62654	0.0:0.0:0.0:1.0	.	87	Q9UJY4	GGA2_HUMAN	G	87	ENSP00000311962:E87G	ENSP00000311962:E87G	E	-	2	0	GGA2	23412273	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.596000	0.82721	2.132000	0.65825	0.368000	0.22195	GAG	T|1.000;C|0.000		0.562	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		
GLI2	2736	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	121740293	121740293	+	Splice_Site	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:121740293T>C	ENST00000452319.1	+	11	1580	c.1520T>C	c.(1519-1521)tTc>tCc	p.F507S	GLI2_ENST00000435313.2_3'UTR|GLI2_ENST00000361492.4_Splice_Site_p.F507S|GLI2_ENST00000314490.11_Splice_Site_p.F179S					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TCCTTCTAGTTCGAGGGCTGC	0.637																																					p.F507S		.											.	GLI2	954	0			c.T1520C						.						46.0	49.0	48.0					2																	121740293		2203	4300	6503	SO:0001630	splice_region_variant	2736	exon10			TCTAGTTCGAGGG		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.1519-1T>C	2.37:g.121740293T>C		77.0	1.0		68.0	22.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271577	0.80469	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	T;T;T	0.47528	0.84;0.84;0.84	4.39	3.21	0.36854	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	M	0.72479	2.2	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;0.997	D;D;D;D;D	0.87578	0.998;0.961;0.993;0.998;0.946	T	0.66304	-0.5957	10	0.87932	D	0	.	10.5549	0.45112	0.1448:0.0:0.0:0.8552	.	507;490;162;162;179	P10070;Q0VGA0;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.;.	S	507;507;179	ENSP00000390436:F507S;ENSP00000354586:F507S;ENSP00000312694:F179S	ENSP00000312694:F179S	F	+	2	0	GLI2	121456763	1.000000	0.71417	0.960000	0.40013	0.947000	0.59692	7.818000	0.86416	0.797000	0.33971	0.397000	0.26171	TTC	.		0.637	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	Missense_Mutation
GLO1	2739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	38650599	38650599	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:38650599C>G	ENST00000373365.4	-	4	447	c.361G>C	c.(361-363)Gac>Cac	p.D121H	GLO1_ENST00000470973.1_5'UTR	NM_006708.2	NP_006699.2	Q04760	LGUL_HUMAN	glyoxalase I	121					carbohydrate metabolic process (GO:0005975)|glutathione metabolic process (GO:0006749)|methylglyoxal metabolic process (GO:0009438)|negative regulation of apoptotic process (GO:0043066)|osteoclast differentiation (GO:0030316)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lactoylglutathione lyase activity (GO:0004462)|zinc ion binding (GO:0008270)			lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	6					Glutathione(DB00143)|Indomethacin(DB00328)	CCTCGAGGGTCTGAATTGCCA	0.343																																					p.D121H		.											.	GLO1	227	0			c.G361C						.						159.0	132.0	141.0					6																	38650599		2203	4300	6503	SO:0001583	missense	2739	exon4			GAGGGTCTGAATT	L07837	CCDS4837.1	6p21.3-p21.1	2012-10-02			ENSG00000124767	ENSG00000124767	4.4.1.5		4323	protein-coding gene	gene with protein product	"""glyoxalase domain containing 1"""	138750				8449929, 7684374	Standard	NM_006708		Approved	GLOD1	uc003ooc.3	Q04760	OTTHUMG00000014636	ENST00000373365.4:c.361G>C	6.37:g.38650599C>G	ENSP00000362463:p.Asp121His	135.0	0.0		120.0	17.0	NM_006708	B2R6P7|B4DDV0|P78375|Q59EL0|Q5TZW3|Q96FC0|Q96J41	Missense_Mutation	SNP	ENST00000373365.4	37	CCDS4837.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813910	0.90790	.	.	ENSG00000124767	ENST00000373365	T	0.29397	1.57	5.95	5.95	0.96441	Glyoxalase/fosfomycin resistance/dioxygenase (1);Glyoxalase I, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.56140	0.1965	M	0.85630	2.765	0.80722	D	1	D	0.65815	0.995	D	0.67725	0.953	T	0.60850	-0.7181	10	0.87932	D	0	-26.3725	20.0036	0.97427	0.0:1.0:0.0:0.0	.	121	Q04760	LGUL_HUMAN	H	121	ENSP00000362463:D121H	ENSP00000362463:D121H	D	-	1	0	GLO1	38758577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.280000	0.65603	2.824000	0.97209	0.655000	0.94253	GAC	.		0.343	GLO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040438.2	NM_006708	
GLO1	2739	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	38650627	38650627	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:38650627C>T	ENST00000373365.4	-	4	419	c.333G>A	c.(331-333)gaG>gaA	p.E111E	GLO1_ENST00000470973.1_5'UTR	NM_006708.2	NP_006699.2	Q04760	LGUL_HUMAN	glyoxalase I	111			E -> A (in dbSNP:rs4746). {ECO:0000269|PubMed:10564821, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7684374, ECO:0000269|PubMed:8449929}.		carbohydrate metabolic process (GO:0005975)|glutathione metabolic process (GO:0006749)|methylglyoxal metabolic process (GO:0009438)|negative regulation of apoptotic process (GO:0043066)|osteoclast differentiation (GO:0030316)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lactoylglutathione lyase activity (GO:0004462)|zinc ion binding (GO:0008270)			lung(2)|ovary(2)|prostate(1)|urinary_tract(1)	6					Glutathione(DB00143)|Indomethacin(DB00328)	AACTCTGGGTCTCATCATCTT	0.368																																					p.E111E		.											.	GLO1	227	0			c.G333A						.						161.0	132.0	142.0					6																	38650627		2203	4300	6503	SO:0001819	synonymous_variant	2739	exon4			CTGGGTCTCATCA	L07837	CCDS4837.1	6p21.3-p21.1	2012-10-02			ENSG00000124767	ENSG00000124767	4.4.1.5		4323	protein-coding gene	gene with protein product	"""glyoxalase domain containing 1"""	138750				8449929, 7684374	Standard	NM_006708		Approved	GLOD1	uc003ooc.3	Q04760	OTTHUMG00000014636	ENST00000373365.4:c.333G>A	6.37:g.38650627C>T		151.0	0.0		119.0	11.0	NM_006708	B2R6P7|B4DDV0|P78375|Q59EL0|Q5TZW3|Q96FC0|Q96J41	Silent	SNP	ENST00000373365.4	37	CCDS4837.1																																																																																			.		0.368	GLO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040438.2	NM_006708	
GNB1	2782	ucsc.edu;bcgsc.ca	37	1	1721849	1721849	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:1721849G>A	ENST00000378609.4	-	9	1015	c.684C>T	c.(682-684)gaC>gaT	p.D228D		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	228					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		TGGCATTGATGTCAGACTCGT	0.527																																					p.D228D		.											.	GNB1	227	0			c.C684T						.						84.0	75.0	78.0					1																	1721849		2203	4300	6503	SO:0001819	synonymous_variant	2782	exon9			ATTGATGTCAGAC	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.684C>T	1.37:g.1721849G>A		104.0	0.0		66.0	6.0	NM_002074	B1AJZ7|P04697|P04901|Q1RMY8	Silent	SNP	ENST00000378609.4	37	CCDS34.1	.	.	.	.	.	.	.	.	.	.	G	8.848	0.943976	0.18281	.	.	ENSG00000078369	ENST00000424622	.	.	.	5.43	4.52	0.55395	.	.	.	.	.	T	0.69205	0.3085	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68119	-0.5493	4	.	.	.	-0.1355	13.2859	0.60243	0.0761:0.0:0.9239:0.0	.	.	.	.	I	86	.	.	T	-	2	0	GNB1	1711709	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	3.974000	0.56852	1.291000	0.44653	0.655000	0.94253	ACA	.		0.527	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074	
GPATCH2L	55668	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76662254	76662254	+	Silent	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr14:76662254A>G	ENST00000261530.7	+	9	1293	c.1227A>G	c.(1225-1227)tcA>tcG	p.S409S	GPATCH2L_ENST00000553588.1_Missense_Mutation_p.H30R|GPATCH2L_ENST00000556675.1_3'UTR|GPATCH2L_ENST00000312858.5_Silent_p.S404S	NM_017926.2	NP_060396.2	Q9NWQ4	GPT2L_HUMAN	G patch domain containing 2-like	409																	CACCATGTTCACGTGACATCA	0.418																																					p.S409S		.											.	.	.	0			c.A1227G						.						203.0	190.0	194.0					14																	76662254		2203	4300	6503	SO:0001819	synonymous_variant	55668	exon9			ATGTTCACGTGAC	AK000696	CCDS9848.1, CCDS9849.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000089916	ENSG00000089916			20210	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 118"""	C14orf118		10574461	Standard	NM_017926		Approved	FLJ20689, FLJ10033	uc001xsh.3	Q9NWQ4	OTTHUMG00000171490	ENST00000261530.7:c.1227A>G	14.37:g.76662254A>G		81.0	0.0		53.0	17.0	NM_017926	B3KN42|Q6PEJ7|Q9H3M3|Q9NWH0|Q9ULR8	Silent	SNP	ENST00000261530.7	37	CCDS9848.1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.424137	0.43020	.	.	ENSG00000089916	ENST00000336993;ENST00000554799;ENST00000553588	.	.	.	5.87	1.96	0.26148	.	.	.	.	.	T	0.53367	0.1792	.	.	.	0.26453	N	0.975573	.	.	.	.	.	.	T	0.50311	-0.8843	5	0.87932	D	0	-27.5296	12.5426	0.56179	0.5972:0.4028:0.0:0.0	.	.	.	.	R	403;30;30	.	ENSP00000337200:H403R	H	+	2	0	C14orf118	75732007	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	2.249000	0.43169	0.077000	0.16863	0.482000	0.46254	CAC	.		0.418	GPATCH2L-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000413698.2	NM_017926	
GRIA3	2892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	122616686	122616686	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:122616686G>A	ENST00000371251.1	+	15	2528	c.2476G>A	c.(2476-2478)Ggc>Agc	p.G826S	GRIA3_ENST00000371256.5_Missense_Mutation_p.G826S|GRIA3_ENST00000264357.5_Missense_Mutation_p.G826S|GRIA3_ENST00000542149.1_3'UTR			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	826					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	CAATGTGGCAGGCGTTTTCTA	0.448																																					p.G826S		.											.	GRIA3	134	0			c.G2476A						.						110.0	106.0	107.0					X																	122616686		2203	4300	6503	SO:0001583	missense	2892	exon15			GTGGCAGGCGTTT	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2476G>A	X.37:g.122616686G>A	ENSP00000360297:p.Gly826Ser	216.0	0.0		171.0	73.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	37	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828626	0.90955	.	.	ENSG00000125675	ENST00000264357;ENST00000371256;ENST00000371251	T;T;T	0.62364	0.03;0.03;0.03	5.81	5.81	0.92471	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.82577	0.5067	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.85515	0.1200	10	0.87932	D	0	.	17.8613	0.88781	0.0:0.0:1.0:0.0	.	826;826	P42263;P42263-2	GRIA3_HUMAN;.	S	826	ENSP00000264357:G826S;ENSP00000360302:G826S;ENSP00000360297:G826S	ENSP00000264357:G826S	G	+	1	0	GRIA3	122444367	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.436000	0.82500	0.600000	0.82982	GGC	.		0.448	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
GRIK2	2898	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	102516324	102516324	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:102516324G>A	ENST00000421544.1	+	16	3155	c.2665G>A	c.(2665-2667)Gaa>Aaa	p.E889K	GRIK2_ENST00000369137.3_Missense_Mutation_p.E813K|GRIK2_ENST00000369134.4_Missense_Mutation_p.E840K|GRIK2_ENST00000413795.1_3'UTR|GRIK2_ENST00000369138.1_3'UTR	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	889					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GAAAACAGAAGAAGTTATCAA	0.463																																					p.E889K		.											.	GRIK2	157	0			c.G2665A						.						111.0	99.0	103.0					6																	102516324		2203	4300	6503	SO:0001583	missense	2898	exon16			ACAGAAGAAGTTA		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2665G>A	6.37:g.102516324G>A	ENSP00000397026:p.Glu889Lys	161.0	0.0		161.0	14.0	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	37	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007574	0.75046	.	.	ENSG00000164418	ENST00000421544;ENST00000369137;ENST00000369134	T;T;T	0.12039	2.72;2.92;2.73	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.07683	0.0193	L	0.36672	1.1	0.58432	D	0.999997	B	0.22211	0.066	B	0.20184	0.028	T	0.13361	-1.0512	10	0.35671	T	0.21	.	20.0361	0.97558	0.0:0.0:1.0:0.0	.	889	Q13002	GRIK2_HUMAN	K	889;813;840	ENSP00000397026:E889K;ENSP00000358133:E813K;ENSP00000358130:E840K	ENSP00000358130:E840K	E	+	1	0	GRIK2	102623017	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.444000	0.97578	2.745000	0.94114	0.462000	0.41574	GAA	.		0.463	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
GTDC1	79712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	144903285	144903285	+	Silent	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:144903285C>A	ENST00000392869.2	-	4	353	c.201G>T	c.(199-201)gtG>gtT	p.V67V	GTDC1_ENST00000463875.2_5'UTR|GTDC1_ENST00000409214.1_Silent_p.V67V|GTDC1_ENST00000409298.1_Silent_p.V67V|GTDC1_ENST00000542155.1_Silent_p.V67V|GTDC1_ENST00000344850.4_Silent_p.V67V|GTDC1_ENST00000241391.5_Silent_p.V67V|GTDC1_ENST00000392867.3_Silent_p.V67V	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	67					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		TCAGGTTAAGCACTGAACTTG	0.438																																					p.V67V		.											.	GTDC1	91	0			c.G201T						.						100.0	96.0	98.0					2																	144903285		2203	4300	6503	SO:0001819	synonymous_variant	79712	exon5			GTTAAGCACTGAA	AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.201G>T	2.37:g.144903285C>A		103.0	0.0		66.0	19.0	NM_001006636	A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Silent	SNP	ENST00000392869.2	37	CCDS33300.1																																																																																			.		0.438	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254779.2	NM_024659	
HAUS2	55142	ucsc.edu;bcgsc.ca	37	15	42853492	42853492	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr15:42853492G>T	ENST00000260372.3	+	4	344	c.281G>T	c.(280-282)aGc>aTc	p.S94I	HAUS2_ENST00000568876.1_Missense_Mutation_p.S63I|HAUS2_ENST00000568846.2_Missense_Mutation_p.A93S	NM_018097.2	NP_060567.1	Q9NVX0	HAUS2_HUMAN	HAUS augmin-like complex, subunit 2	94					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleus (GO:0005634)				endometrium(1)|large_intestine(1)|lung(1)	3						ACTCTGCAAAGCATGAATAAT	0.353																																					p.S94I		.											.	HAUS2	90	0			c.G281T						.						104.0	100.0	101.0					15																	42853492		2203	4299	6502	SO:0001583	missense	55142	exon4			TGCAAAGCATGAA	AK001322	CCDS10090.1, CCDS45247.1	15q15.1	2014-02-20	2009-04-20	2009-04-20	ENSG00000137814	ENSG00000137814		"""HAUS augmin-like complex subunits"""	25530	protein-coding gene	gene with protein product		613429	"""chromosome 15 open reading frame 25"", ""centrosomal protein 27kDa"""	C15orf25, CEP27		14702039, 14654843, 19427217	Standard	NM_018097		Approved	FLJ10460, HsT17025	uc001zqe.3	Q9NVX0	OTTHUMG00000130678	ENST00000260372.3:c.281G>T	15.37:g.42853492G>T	ENSP00000260372:p.Ser94Ile	63.0	0.0		39.0	4.0	NM_018097	C9JH36|Q9H9B3	Missense_Mutation	SNP	ENST00000260372.3	37	CCDS10090.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956587	0.53293	.	.	ENSG00000137814	ENST00000260372;ENST00000391623	T	0.46451	0.87	5.8	3.92	0.45320	.	0.502847	0.24147	N	0.041114	T	0.37785	0.1016	M	0.65975	2.015	0.25486	N	0.987692	B;B	0.18610	0.013;0.029	B;B	0.15870	0.01;0.014	T	0.38090	-0.9677	10	0.59425	D	0.04	-5.989	6.0017	0.19525	0.2121:0.2443:0.5436:0.0	.	63;94	Q9NVX0-3;Q9NVX0	.;HAUS2_HUMAN	I	94;63	ENSP00000260372:S94I	ENSP00000260372:S94I	S	+	2	0	HAUS2	40640784	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.547000	0.23299	1.452000	0.47756	0.655000	0.94253	AGC	.		0.353	HAUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253173.1	NM_018097	
HEBP2	23593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138734131	138734131	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:138734131C>T	ENST00000607197.1	+	4	811	c.534C>T	c.(532-534)ggC>ggT	p.G178G	HEBP2_ENST00000367697.3_3'UTR|HEBP2_ENST00000448741.1_3'UTR	NM_014320.2	NP_055135.1	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	178					negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of necrotic cell death (GO:0010940)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		ACACTGCAGGCTACAACAGTC	0.348																																					p.G178G		.											.	HEBP2	90	0			c.C534T						.						143.0	147.0	146.0					6																	138734131		2203	4300	6503	SO:0001819	synonymous_variant	23593	exon4			TGCAGGCTACAAC	AF117616	CCDS5191.1	6q24	2008-08-29	2002-09-23	2002-09-27	ENSG00000051620	ENSG00000051620			15716	protein-coding gene	gene with protein product		605825	"""chromosome 6 open reading frame 34"""	C6orf34		10640688, 17098234	Standard	NM_014320		Approved	SOUL	uc003qhw.1	Q9Y5Z4	OTTHUMG00000015671	ENST00000607197.1:c.534C>T	6.37:g.138734131C>T		166.0	0.0		133.0	33.0	NM_014320	Q96P57	Silent	SNP	ENST00000607197.1	37	CCDS5191.1																																																																																			.		0.348	HEBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042426.2		
HIF3A	64344	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46832675	46832675	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:46832675G>T	ENST00000377670.4	+	12	1683	c.1652G>T	c.(1651-1653)tGc>tTc	p.C551F	HIF3A_ENST00000420102.2_Missense_Mutation_p.C500F|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000300862.3_Missense_Mutation_p.C549F|HIF3A_ENST00000244303.6_Missense_Mutation_p.C482F|HIF3A_ENST00000600383.1_Missense_Mutation_p.C482F|HIF3A_ENST00000339613.2_Missense_Mutation_p.C495F|HIF3A_ENST00000472815.1_Intron	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	551	ODD.				cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.C549Y(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		CGGCTGAGCTGCTCCAGCCCT	0.682																																					p.C551F		.											HIF3A,brain,glioma,0	HIF3A	228	1	Substitution - Missense(1)	central_nervous_system(1)	c.G1652T						.						17.0	17.0	17.0					19																	46832675		2202	4296	6498	SO:0001583	missense	64344	exon12			TGAGCTGCTCCAG	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1652G>T	19.37:g.46832675G>T	ENSP00000366898:p.Cys551Phe	59.0	0.0		56.0	25.0	NM_152795	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	CCDS12681.2	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094184	0.36952	.	.	ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	T;T;T;T;T	0.64085	0.66;-0.07;0.54;0.66;-0.08	4.68	4.68	0.58851	.	0.882388	0.09593	N	0.781335	T	0.59059	0.2166	L	0.27053	0.805	0.35029	D	0.758647	D;B;B;B;B;B	0.55605	0.972;0.075;0.047;0.028;0.028;0.028	P;B;B;B;B;B	0.49085	0.6;0.006;0.009;0.004;0.004;0.004	T	0.62854	-0.6766	10	0.44086	T	0.13	.	13.4928	0.61407	0.0:0.0:1.0:0.0	.	500;482;549;495;551;551	F5H884;B4DNA2;Q9Y2N7-2;A8MPQ1;Q9Y2N7;B0M185	.;.;.;.;HIF3A_HUMAN;.	F	551;551;482;495;495;549;500	ENSP00000366898:C551F;ENSP00000244303:C482F;ENSP00000341877:C495F;ENSP00000300862:C549F;ENSP00000407771:C500F	ENSP00000244302:C551F	C	+	2	0	HIF3A	51524515	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.055000	0.30467	2.340000	0.79590	0.655000	0.94253	TGC	.		0.682	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3		
HPR	3250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72110626	72110626	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:72110626C>T	ENST00000540303.2	+	5	725	c.693C>T	c.(691-693)aaC>aaT	p.N231N	HPR_ENST00000356967.5_Silent_p.N231N|HPR_ENST00000561690.1_Intron|HPR_ENST00000228226.8_Silent_p.N268N	NM_020995.3	NP_066275.3	P00739	HPTR_HUMAN	haptoglobin-related protein	231	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|spherical high-density lipoprotein particle (GO:0034366)	hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|stomach(1)|urinary_tract(2)	20		Ovarian(137;0.125)				AAAGTGACAACTTTAAACTTA	0.468																																					p.N231N		.											.	HPR	515	0			c.C693T						.						181.0	135.0	150.0					16																	72110626		2081	4191	6272	SO:0001819	synonymous_variant	3250	exon5			TGACAACTTTAAA	BC160066	CCDS42193.1	16q22.2	2012-10-03			ENSG00000261701	ENSG00000261701			5156	protein-coding gene	gene with protein product		140210				2987228, 16778136	Standard	NM_020995		Approved		uc002fby.3	P00739	OTTHUMG00000173010	ENST00000540303.2:c.693C>T	16.37:g.72110626C>T		229.0	0.0		148.0	70.0	NM_020995	Q7LE20|Q92658|Q92659|Q9ULB0	Silent	SNP	ENST00000540303.2	37	CCDS42193.1																																																																																			.		0.468	HPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421696.1	NM_020995	
HSD17B11	51170	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88293884	88293884	+	Silent	SNP	C	C	A	rs114331860	byFrequency	TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr4:88293884C>A	ENST00000358290.4	-	4	849	c.534G>T	c.(532-534)tcG>tcT	p.S178S	HSD17B11_ENST00000507518.1_5'UTR|HSD17B11_ENST00000507286.1_Silent_p.S134S	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	178					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		AGAAGGGGACCGAGACATGTC	0.418																																					p.S178S		.											.	HSD17B11	92	0			c.G534T						.						158.0	129.0	139.0					4																	88293884		2203	4300	6503	SO:0001819	synonymous_variant	51170	exon4			GGGGACCGAGACA	AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.534G>T	4.37:g.88293884C>A		186.0	0.0		131.0	60.0	NM_016245	Q96HF6|Q9UKU4	Silent	SNP	ENST00000358290.4	37	CCDS3619.1																																																																																			C|0.995;T|0.005		0.418	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253041.1	NM_016245	
HTR2A	3356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	47409332	47409332	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr13:47409332G>A	ENST00000378688.4	-	3	1187	c.1056C>T	c.(1054-1056)tcC>tcT	p.S352S	HTR2A_ENST00000542664.1_Silent_p.S352S|HTR2A_ENST00000543956.1_Silent_p.S268S			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	352					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCTCATTGCAGGACTCTTTGC	0.478																																					p.S352S		.											.	HTR2A	519	0			c.C1056T						.						136.0	118.0	124.0					13																	47409332		2203	4300	6503	SO:0001819	synonymous_variant	3356	exon4			ATTGCAGGACTCT	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1056C>T	13.37:g.47409332G>A		202.0	0.0		154.0	48.0	NM_000621	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Silent	SNP	ENST00000378688.4	37	CCDS9405.1																																																																																			.		0.478	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044835.3	NM_000621	
HTRA2	27429	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	74757336	74757336	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:74757336C>G	ENST00000258080.3	+	1	833	c.203C>G	c.(202-204)cCc>cGc	p.P68R	HTRA2_ENST00000352222.3_Missense_Mutation_p.P68R|HTRA2_ENST00000467961.1_Intron|AUP1_ENST00000377526.3_5'Flank	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	68					adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						GTCACTGAACCCCGAGCATGC	0.662																																					p.P68R		.											.	HTRA2	91	0			c.C203G						.						12.0	14.0	14.0					2																	74757336		2190	4287	6477	SO:0001583	missense	27429	exon1			CTGAACCCCGAGC		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.203C>G	2.37:g.74757336C>G	ENSP00000258080:p.Pro68Arg	73.0	0.0		77.0	31.0	NM_013247	Q9HBZ4|Q9P0Y3|Q9P0Y4	Missense_Mutation	SNP	ENST00000258080.3	37	CCDS1951.1	.	.	.	.	.	.	.	.	.	.	c	0.011	-1.697609	0.00725	.	.	ENSG00000115317	ENST00000258080;ENST00000352222;ENST00000437202	T;T;T	0.15952	2.38;2.38;2.38	5.0	3.21	0.36854	.	1.090900	0.07058	N	0.833151	T	0.12433	0.0302	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.28324	0.132;0.207;0.207;0.132	B;B;B;B	0.30646	0.055;0.118;0.118;0.055	T	0.37079	-0.9721	10	0.38643	T	0.18	0.2023	6.3613	0.21431	0.1799:0.7281:0.0:0.0919	.	68;68;68;68	A8K7G2;O43464-3;O43464-2;O43464	.;.;.;HTRA2_HUMAN	R	68;68;55	ENSP00000258080:P68R;ENSP00000312893:P68R;ENSP00000399166:P55R	ENSP00000258080:P68R	P	+	2	0	HTRA2	74610844	0.004000	0.15560	0.003000	0.11579	0.139000	0.21198	1.101000	0.31037	0.701000	0.31803	-0.379000	0.06801	CCC	.		0.662	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
HTT	3064	hgsc.bcm.edu;bcgsc.ca	37	4	3209019	3209019	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr4:3209019delC	ENST00000355072.5	+	45	6232	c.6087delC	c.(6085-6087)gccfs	p.A2029fs		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2029					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCAGCATGGCCCAGTTGCCAA	0.438																																					p.A2029fs		.											.	HTT	281	0			c.6087delC						.						112.0	105.0	107.0					4																	3209019		1955	4143	6098	SO:0001589	frameshift_variant	3064	exon45			CATGGCCCAGTTG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.6087delC	4.37:g.3209019delC	ENSP00000347184:p.Ala2029fs	93.0	0.0		65.0	0.0	NM_002111	Q9UQB7	Frame_Shift_Del	DEL	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.438	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
HTT	3064	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	3209018	3209019	+	Frame_Shift_Ins	INS	-	-	A	rs540936636	byFrequency	TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr4:3209018_3209019insA	ENST00000355072.5	+	45	6231_6232	c.6086_6087insA	c.(6085-6090)gcccagfs	p.Q2030fs		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2030					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AGCAGCATGGCCCAGTTGCCAA	0.441																																					p.A2029fs		.											.	HTT	281	0			c.6086_6087insA						.																																			SO:0001589	frameshift_variant	3064	exon45			GCATGGCCCAGTT	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	Exception_encountered	4.37:g.3209018_3209019insA	ENSP00000347184:p.Gln2030fs	93.0	0.0		65.0	19.0	NM_002111	Q9UQB7	Frame_Shift_Ins	INS	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.441	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
IFT88	8100	broad.mit.edu;bcgsc.ca	37	13	21264933	21264933	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr13:21264933A>G	ENST00000319980.6	+	27	2686	c.2359A>G	c.(2359-2361)Agt>Ggt	p.S787G	IFT88_ENST00000351808.5_Missense_Mutation_p.S778G|IFT88_ENST00000382778.4_3'UTR|IFT88_ENST00000537103.1_Missense_Mutation_p.S759G	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	787					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		ACCTTATGAAAGTAGCAGTAA	0.463																																					p.S787G		.											.	IFT88	91	0			c.A2359G						.						104.0	99.0	100.0					13																	21264933		2203	4300	6503	SO:0001583	missense	8100	exon27			TATGAAAGTAGCA	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.2359A>G	13.37:g.21264933A>G	ENSP00000323580:p.Ser787Gly	140.0	0.0		86.0	5.0	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.683374	0.68157	.	.	ENSG00000032742	ENST00000351808;ENST00000319980;ENST00000537103	T;T;T	0.75050	-0.9;-0.9;-0.9	6.07	6.07	0.98685	.	0.240623	0.48767	D	0.000163	T	0.65575	0.2704	L	0.50333	1.59	0.33043	D	0.531717	B;B	0.30406	0.002;0.278	B;B	0.22386	0.001;0.039	T	0.71636	-0.4533	10	0.33141	T	0.24	-20.0991	10.6136	0.45436	0.9283:0.0:0.0717:0.0	.	759;787	F5H6C2;Q13099	.;IFT88_HUMAN	G	778;787;759	ENSP00000261632:S778G;ENSP00000323580:S787G;ENSP00000437719:S759G	ENSP00000323580:S787G	S	+	1	0	IFT88	20162933	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.747000	0.47475	2.326000	0.78906	0.533000	0.62120	AGT	.		0.463	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
IL1RAPL1	11141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	29973331	29973331	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:29973331A>T	ENST00000378993.1	+	11	2158	c.1485A>T	c.(1483-1485)agA>agT	p.R495S	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.R495S	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	495	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TGGAAACCAGACTTCGAAATA	0.438																																					p.R495S		.											.	IL1RAPL1	134	0			c.A1485T						.						98.0	89.0	92.0					X																	29973331		2202	4300	6502	SO:0001583	missense	11141	exon11			AACCAGACTTCGA	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1485A>T	X.37:g.29973331A>T	ENSP00000368278:p.Arg495Ser	340.0	0.0		243.0	91.0	NM_014271	A0AVG4|Q9UJ53	Missense_Mutation	SNP	ENST00000378993.1	37	CCDS14218.1	.	.	.	.	.	.	.	.	.	.	A	13.02	2.112983	0.37242	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.07216	3.21;3.21	5.87	2.02	0.26589	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.85682	D	0.000000	T	0.16300	0.0392	M	0.70595	2.14	0.50467	D	0.999878	D	0.55385	0.971	P	0.59546	0.859	T	0.05305	-1.0893	9	.	.	.	.	1.2665	0.02012	0.4731:0.1407:0.2472:0.1389	.	495	Q9NZN1	IRPL1_HUMAN	S	495	ENSP00000368278:R495S;ENSP00000305200:R495S	.	R	+	3	2	IL1RAPL1	29883252	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	0.401000	0.20948	0.333000	0.23563	-0.314000	0.08810	AGA	.		0.438	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056155.1	NM_014271	
IL20RA	53832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	137323493	137323493	+	Splice_Site	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:137323493C>G	ENST00000316649.5	-	7	1100		c.e7-1		IL20RA_ENST00000541547.1_Splice_Site|IL20RA_ENST00000468393.1_5'Flank|IL20RA_ENST00000367748.1_Splice_Site|RP11-204P2.3_ENST00000458017.1_RNA	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha						cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		AAATCAAAATCTATAAAGAGA	0.313																																					.		.											.	IL20RA	94	0			c.865-1G>C						.						20.0	23.0	22.0					6																	137323493		2119	4168	6287	SO:0001630	splice_region_variant	53832	exon8			CAAAATCTATAAA	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.865-1G>C	6.37:g.137323493C>G		61.0	0.0		49.0	7.0	NM_014432	B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Splice_Site	SNP	ENST00000316649.5	37	CCDS5181.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353316	0.24512	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7927	0.85593	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IL20RA	137365186	1.000000	0.71417	0.977000	0.42913	0.018000	0.09664	4.394000	0.59671	2.745000	0.94114	0.655000	0.94253	.	.		0.313	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432	Intron
INTS1	26173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	1539152	1539152	+	Silent	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:1539152C>A	ENST00000404767.3	-	6	886	c.801G>T	c.(799-801)ctG>ctT	p.L267L	INTS1_ENST00000389470.4_Silent_p.L395L|INTS1_ENST00000493531.1_5'Flank	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	267					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCCCCTGCAGCAGCACGCTCC	0.682																																					p.L267L		.											.	.	.	0			c.G801T						.						33.0	40.0	38.0					7																	1539152		1967	4154	6121	SO:0001819	synonymous_variant	26173	exon6			CTGCAGCAGCACG	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.801G>T	7.37:g.1539152C>A		51.0	0.0		55.0	38.0	NM_001080453	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Silent	SNP	ENST00000404767.3	37	CCDS47526.1																																																																																			.		0.682	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
IRS4	8471	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107977031	107977031	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:107977031G>T	ENST00000372129.2	-	1	2620	c.2544C>A	c.(2542-2544)aaC>aaA	p.N848K	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	848					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TGGGGTCCCAGTTATAGGAGA	0.507																																					p.N848K		.											.	IRS4	623	0			c.C2544A						.						178.0	182.0	181.0					X																	107977031		2203	4300	6503	SO:0001583	missense	8471	exon1			GTCCCAGTTATAG	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2544C>A	X.37:g.107977031G>T	ENSP00000361202:p.Asn848Lys	301.0	1.0		230.0	72.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	G	4.661	0.122899	0.08931	.	.	ENSG00000133124	ENST00000372129	T	0.19394	2.15	4.32	0.368	0.16146	.	0.747332	0.13057	N	0.417239	T	0.12135	0.0295	N	0.25647	0.755	0.09310	N	1	B	0.30068	0.267	B	0.22601	0.04	T	0.18209	-1.0344	10	0.62326	D	0.03	-1.8982	6.3471	0.21355	0.1537:0.4563:0.39:0.0	.	848	O14654	IRS4_HUMAN	K	848	ENSP00000361202:N848K	ENSP00000361202:N848K	N	-	3	2	IRS4	107863687	0.000000	0.05858	0.000000	0.03702	0.289000	0.27227	0.702000	0.25631	-0.066000	0.12998	0.600000	0.82982	AAC	.		0.507	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
ISX	91464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	35463259	35463259	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr22:35463259C>T	ENST00000308700.6	+	1	1131	c.179C>T	c.(178-180)gCt>gTt	p.A60V	ISX_ENST00000404699.2_Missense_Mutation_p.A60V|RP1-272J12.1_ENST00000448318.4_RNA	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	60					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						CCCGGAGAAGCTGCGGCCTCA	0.567																																					p.A60V		.											.	ISX	95	0			c.C179T						.						31.0	34.0	33.0					22																	35463259		2199	4296	6495	SO:0001583	missense	91464	exon1			GAGAAGCTGCGGC	AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.179C>T	22.37:g.35463259C>T	ENSP00000311492:p.Ala60Val	83.0	0.0		101.0	37.0	NM_001008494	Q68DJ5	Missense_Mutation	SNP	ENST00000308700.6	37	CCDS33640.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.870421	0.33069	.	.	ENSG00000175329	ENST00000308700;ENST00000404699	D;D	0.90732	-2.72;-2.72	4.9	-0.435	0.12279	.	0.487974	0.17243	N	0.181460	T	0.80325	0.4602	L	0.32530	0.975	0.09310	N	1	B	0.14805	0.011	B	0.14023	0.01	T	0.64214	-0.6460	10	0.30078	T	0.28	.	2.7101	0.05173	0.1391:0.5209:0.1536:0.1865	.	60	Q2M1V0	ISX_HUMAN	V	60	ENSP00000311492:A60V;ENSP00000386037:A60V	ENSP00000311492:A60V	A	+	2	0	ISX	33793259	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.660000	0.25009	0.124000	0.18369	-0.742000	0.03525	GCT	.		0.567	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320662.1	NM_001008494	
KIAA0368	23392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	114213731	114213731	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr9:114213731T>C	ENST00000338205.5	-	2	346	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	KIAA0368_ENST00000259335.4_Missense_Mutation_p.S221G			Q5VYK3	ECM29_HUMAN	KIAA0368	49					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TCTTGGGTGCTAGAGAGTTTG	0.373																																					p.S221G		.											.	KIAA0368	68	0			c.A661G						.						65.0	59.0	61.0					9																	114213731		1849	4105	5954	SO:0001583	missense	23392	exon4			GGGTGCTAGAGAG	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.127A>G	9.37:g.114213731T>C	ENSP00000339889:p.Ser43Gly	243.0	0.0		165.0	66.0	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	T	25.0	4.593025	0.86953	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.70986	-0.53	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83764	0.5325	M	0.78456	2.415	0.80722	D	1	D	0.53885	0.963	D	0.67231	0.95	D	0.86020	0.1506	10	0.87932	D	0	.	15.6977	0.77512	0.0:0.0:0.0:1.0	.	49	Q5VYK3	ECM29_HUMAN	G	43;221	ENSP00000259335:S221G	ENSP00000259335:S221G	S	-	1	0	KIAA0368	113253552	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.665000	0.83852	2.107000	0.64212	0.482000	0.46254	AGC	.		0.373	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
KIF13A	63971	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	17828535	17828535	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:17828535G>C	ENST00000259711.6	-	14	1573	c.1468C>G	c.(1468-1470)Cag>Gag	p.Q490E	KIF13A_ENST00000378814.5_Missense_Mutation_p.Q490E|KIF13A_ENST00000378826.2_Missense_Mutation_p.Q490E|KIF13A_ENST00000378843.2_Missense_Mutation_p.Q490E|KIF13A_ENST00000378816.5_Missense_Mutation_p.Q490E	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	490	FHA.				ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TCACAGTGCTGAGGCTGAATT	0.423																																					p.Q490E		.											.	KIF13A	137	0			c.C1468G						.						70.0	66.0	67.0					6																	17828535		1915	4131	6046	SO:0001583	missense	63971	exon14			AGTGCTGAGGCTG	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1468C>G	6.37:g.17828535G>C	ENSP00000259711:p.Gln490Glu	268.0	0.0		192.0	54.0	NM_001105567	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	37	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	G	6.051	0.377705	0.11466	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	D;D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19;-2.19	6.04	5.18	0.71444	Forkhead-associated (FHA) domain (3);SMAD/FHA domain (1);	0.107001	0.64402	N	0.000007	T	0.41259	0.1151	N	0.00453	-1.485	0.31583	N	0.654868	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.0;0.001;0.0	T	0.19289	-1.0310	10	0.02654	T	1	.	17.6519	0.88167	0.0:0.8768:0.1232:0.0	.	461;490;490;490;490	E7ER65;Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;.;KI13A_HUMAN;.	E	490	ENSP00000368091:Q490E;ENSP00000259711:Q490E;ENSP00000368103:Q490E;ENSP00000368120:Q490E;ENSP00000368093:Q490E	ENSP00000259711:Q490E	Q	-	1	0	KIF13A	17936514	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	4.022000	0.57203	1.579000	0.49836	-0.226000	0.12346	CAG	.		0.423	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	55598063	55598063	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr4:55598063C>T	ENST00000288135.5	+	16	2357	c.2260C>T	c.(2260-2262)Ccc>Tcc	p.P754S		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	754	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGATGTGACTCCCGCCATCAT	0.468		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.P754S		.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	20166	0			c.C2260T						.						111.0	98.0	102.0					4																	55598063		2203	4299	6502	SO:0001583	missense	3815	exon16	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GTGACTCCCGCCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2260C>T	4.37:g.55598063C>T	ENSP00000288135:p.Pro754Ser	182.0	0.0		138.0	50.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.920177	0.00498	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.88586	-2.4;-2.4	5.96	3.12	0.35913	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.323928	0.27064	N	0.021105	T	0.71745	0.3376	N	0.11131	0.1	0.09310	N	1	B;B	0.24483	0.003;0.104	B;B	0.26864	0.004;0.074	T	0.58758	-0.7580	10	0.06099	T	0.92	.	5.5127	0.16890	0.1751:0.5564:0.1958:0.0726	.	750;754	P10721-2;P10721	.;KIT_HUMAN	S	754;750	ENSP00000288135:P754S;ENSP00000390987:P750S	ENSP00000288135:P754S	P	+	1	0	KIT	55292820	0.013000	0.17824	0.253000	0.24343	0.001000	0.01503	1.001000	0.29783	1.538000	0.49270	-0.140000	0.14226	CCC	.		0.468	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
LCN15	389812	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139651621	139651621	+	IGR	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr9:139651621C>A	ENST00000316144.5	-	0	762				LCN8_ENST00000371688.3_Splice_Site|LCN8_ENST00000482893.1_5'UTR|LCN15_ENST00000482511.1_5'Flank	NM_203347.1	NP_976222.1	Q6UWW0	LCN15_HUMAN	lipocalin 15						lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)|transporter activity (GO:0005215)			endometrium(1)|lung(1)	2						ATCCTCCAATCTAGAGAGATA	0.642																																					.		.											.	LCN8	91	0			c.25-1G>T						.						39.0	37.0	38.0					9																	139651621		2203	4300	6503	SO:0001628	intergenic_variant	138307	exon3			TCCAATCTAGAGA		CCDS7006.1	9q34.3	2011-10-24			ENSG00000177984	ENSG00000177984		"""Lipocalins"""	33777	protein-coding gene	gene with protein product							Standard	NM_203347		Approved	UNQ2541, PRO6093	uc004cjd.3	Q6UWW0	OTTHUMG00000020943		9.37:g.139651621C>A		79.0	0.0		52.0	21.0	NM_178469		Splice_Site	SNP	ENST00000316144.5	37	CCDS7006.1	.	.	.	.	.	.	.	.	.	.	C	6.568	0.473124	0.12461	.	.	ENSG00000204001	ENST00000371688	.	.	.	3.47	3.47	0.39725	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7394	0.46145	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LCN8	138771442	0.634000	0.27190	0.883000	0.34634	0.032000	0.12392	2.823000	0.48081	2.257000	0.74773	0.561000	0.74099	.	.		0.642	LCN15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055114.2	NM_203347	
LRRC8D	55144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	90399468	90399468	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:90399468G>A	ENST00000337338.5	+	3	1248	c.841G>A	c.(841-843)Gga>Aga	p.G281R	LRRC8D_ENST00000394593.3_Missense_Mutation_p.G281R	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	281					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		TAAAAAGGATGGAGAGCAGGC	0.428																																					p.G281R		.											.	LRRC8D	92	0			c.G841A						.						40.0	40.0	40.0					1																	90399468		2203	4300	6503	SO:0001583	missense	55144	exon3			AAGGATGGAGAGC	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.841G>A	1.37:g.90399468G>A	ENSP00000338887:p.Gly281Arg	75.0	0.0		52.0	17.0	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	ENST00000337338.5	37	CCDS726.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.782792	0.70222	.	.	ENSG00000171492	ENST00000337338;ENST00000394593	T;T	0.39406	1.08;1.08	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	L	0.49778	1.585	0.80722	D	1	D	0.54772	0.968	P	0.58013	0.831	T	0.19418	-1.0306	9	.	.	.	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	281	Q7L1W4	LRC8D_HUMAN	R	281	ENSP00000338887:G281R;ENSP00000378093:G281R	.	G	+	1	0	LRRC8D	90172056	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.869000	0.99810	2.782000	0.95742	0.655000	0.94253	GGA	.		0.428	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
LZTS3	9762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3146846	3146846	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr20:3146846G>A	ENST00000329152.3	-	2	2017	c.620C>T	c.(619-621)aCt>aTt	p.T207I	LZTS3_ENST00000360342.3_Missense_Mutation_p.T207I|LZTS3_ENST00000337576.5_Missense_Mutation_p.T207I			O60299	LZTS3_HUMAN		207						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)											ACCCGCTGGAGTCATGGTCCG	0.642																																					p.T207I		.											.	.	.	0			c.C620T						.						58.0	49.0	52.0					20																	3146846		2203	4300	6503	SO:0001583	missense	0	exon2			GCTGGAGTCATGG																												ENST00000329152.3:c.620C>T	20.37:g.3146846G>A	ENSP00000332123:p.Thr207Ile	131.0	0.0		108.0	41.0	NM_014731	A2A2Q7|D3DVX6|Q8IXX8	Missense_Mutation	SNP	ENST00000329152.3	37	CCDS13049.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124702	0.56613	.	.	ENSG00000088899	ENST00000329152;ENST00000360342;ENST00000337576	T;T;T	0.32515	1.45;1.48;1.48	5.26	4.25	0.50352	.	0.564326	0.19422	N	0.114671	T	0.28366	0.0701	N	0.22421	0.69	0.32461	N	0.544154	P;P	0.52061	0.95;0.917	P;B	0.50708	0.648;0.445	T	0.10314	-1.0635	10	0.22109	T	0.4	-22.6717	13.1811	0.59655	0.0:0.0:0.7598:0.2402	.	207;207	O60299-2;O60299	.;PRIP1_HUMAN	I	207	ENSP00000332123:T207I;ENSP00000353496:T207I;ENSP00000338166:T207I	ENSP00000332123:T207I	T	-	2	0	RP5-1187M17.10	3094846	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	2.377000	0.44300	2.450000	0.82876	0.561000	0.74099	ACT	.		0.642	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077715.2		
LZTS3	9762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3147349	3147349	+	Splice_Site	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr20:3147349A>G	ENST00000329152.3	-	1	1857		c.e1+1		LZTS3_ENST00000360342.3_Splice_Site|LZTS3_ENST00000337576.5_Splice_Site			O60299	LZTS3_HUMAN								cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)											CTGCGGACTGACCTGGTCTAG	0.632																																					.		.											.	.	.	0			c.459+2T>C						.						64.0	65.0	65.0					20																	3147349		2203	4300	6503	SO:0001630	splice_region_variant	0	exon2			GGACTGACCTGGT																												ENST00000329152.3:c.459+1T>C	20.37:g.3147349A>G		95.0	0.0		70.0	23.0	NM_014731	A2A2Q7|D3DVX6|Q8IXX8	Splice_Site	SNP	ENST00000329152.3	37	CCDS13049.1	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667640	0.67814	.	.	ENSG00000088899	ENST00000329152;ENST00000360342;ENST00000337576	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5784	0.68268	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RP5-1187M17.10	3095349	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.623000	0.54224	1.915000	0.55452	0.459000	0.35465	.	.		0.632	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077715.2		Intron
MACC1	346389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20199316	20199316	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:20199316C>A	ENST00000400331.5	-	5	976	c.668G>T	c.(667-669)gGg>gTg	p.G223V	MACC1_ENST00000589011.1_Missense_Mutation_p.G223V|MACC1_ENST00000332878.4_Missense_Mutation_p.G223V	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	223					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TTGTACTGACCCTCCTTGATG	0.488																																					p.G223V		.											.	MACC1	93	0			c.G668T						.						108.0	96.0	100.0					7																	20199316		2203	4300	6503	SO:0001583	missense	346389	exon5			ACTGACCCTCCTT		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.668G>T	7.37:g.20199316C>A	ENSP00000383185:p.Gly223Val	225.0	0.0		257.0	74.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.198378	0.58126	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.39592	1.07;1.07	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.68384	0.2995	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70930	-0.4738	10	0.87932	D	0	-11.593	19.8516	0.96743	0.0:1.0:0.0:0.0	.	223	Q6ZN28	MACC1_HUMAN	V	223	ENSP00000383185:G223V;ENSP00000328410:G223V	ENSP00000328410:G223V	G	-	2	0	MACC1	20165841	1.000000	0.71417	0.988000	0.46212	0.438000	0.31896	7.818000	0.86416	2.685000	0.91497	0.585000	0.79938	GGG	.		0.488	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
MAGEC1	9947	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	140993822	140993822	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:140993822T>C	ENST00000285879.4	+	4	918	c.632T>C	c.(631-633)tTg>tCg	p.L211S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	211										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCACTTTATTGAGTATTTTC	0.502										HNSCC(15;0.026)																											p.L211S		.											.	MAGEC1	133	0			c.T632C						.						128.0	136.0	133.0					X																	140993822		2203	4299	6502	SO:0001583	missense	9947	exon4			CTTTATTGAGTAT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.632T>C	X.37:g.140993822T>C	ENSP00000285879:p.Leu211Ser	998.0	0.0		780.0	108.0	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	-	5.768	0.326142	0.10900	.	.	ENSG00000155495	ENST00000285879	T	0.03035	4.07	.	.	.	.	.	.	.	.	T	0.02767	0.0083	N	0.08118	0	0.31656	N	0.646166	P	0.44006	0.824	P	0.48704	0.587	T	0.47674	-0.9099	8	0.28530	T	0.3	.	4.4859	0.11790	0.0:7.0E-4:0.0:0.9993	.	211	O60732	MAGC1_HUMAN	S	211	ENSP00000285879:L211S	ENSP00000285879:L211S	L	+	2	0	MAGEC1	140821488	0.996000	0.38824	0.201000	0.23476	0.201000	0.24016	0.766000	0.26560	0.046000	0.15833	0.046000	0.15203	TTG	.		0.502	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MAGOHB	55110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10766087	10766087	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr12:10766087G>A	ENST00000320756.2	-	1	135	c.45C>T	c.(43-45)caC>caT	p.H15H	MAGOHB_ENST00000381881.2_Silent_p.H15H|MAGOHB_ENST00000539554.1_Intron	NM_018048.3	NP_060518.1	Q96A72	MGN2_HUMAN	mago-nashi homolog B (Drosophila)	15					mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|large_intestine(2)	4						ACTTGCCCTTGTGCCCTACGT	0.617																																					p.H15H		.											.	MAGOHB	153	0			c.C45T						.						110.0	105.0	107.0					12																	10766087		2203	4300	6503	SO:0001819	synonymous_variant	55110	exon1			GCCCTTGTGCCCT		CCDS8628.1	12p13.2	2014-02-12	2008-01-24		ENSG00000111196	ENSG00000111196			25504	protein-coding gene	gene with protein product							Standard	NM_018048		Approved	FLJ10292, MGN2	uc001qyq.2	Q96A72	OTTHUMG00000168407	ENST00000320756.2:c.45C>T	12.37:g.10766087G>A		88.0	0.0		74.0	32.0	NM_018048		Silent	SNP	ENST00000320756.2	37	CCDS8628.1																																																																																			.		0.617	MAGOHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399616.1	NM_018048	
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71491564	71491564	+	Silent	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:71491564T>A	ENST00000296755.7	+	5	2680	c.2382T>A	c.(2380-2382)gcT>gcA	p.A794A		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	794					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CCGCAGAGGCTGTCGCTGCAG	0.537																																					p.A794A	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B	155	0			c.T2382A						.						43.0	46.0	45.0					5																	71491564		2203	4299	6502	SO:0001819	synonymous_variant	4131	exon5			AGAGGCTGTCGCT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.2382T>A	5.37:g.71491564T>A		66.0	0.0		77.0	42.0	NM_005909	A2BDK5	Silent	SNP	ENST00000296755.7	37	CCDS4012.1																																																																																			.		0.537	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MAP1B	4131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	71494133	71494133	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:71494133C>A	ENST00000296755.7	+	5	5249	c.4951C>A	c.(4951-4953)Caa>Aaa	p.Q1651K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1651					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGAATTTGGCCAAGAATCTCC	0.483																																					p.Q1651K	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B	155	0			c.C4951A						.						115.0	119.0	118.0					5																	71494133		2203	4300	6503	SO:0001583	missense	4131	exon5			TTTGGCCAAGAAT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4951C>A	5.37:g.71494133C>A	ENSP00000296755:p.Gln1651Lys	128.0	0.0		138.0	33.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.011916	0.54468	.	.	ENSG00000131711	ENST00000296755	T	0.04015	3.73	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000015	T	0.03477	0.0100	N	0.08118	0	0.58432	D	0.999997	P;P	0.42456	0.78;0.78	B;B	0.34931	0.192;0.192	T	0.55655	-0.8107	10	0.62326	D	0.03	-17.1043	18.7095	0.91651	0.0:1.0:0.0:0.0	.	1525;1651	A2BDK6;P46821	.;MAP1B_HUMAN	K	1651	ENSP00000296755:Q1651K	ENSP00000296755:Q1651K	Q	+	1	0	MAP1B	71529889	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.435000	0.82474	0.313000	0.20887	CAA	.		0.483	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MAP3K10	4294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40704415	40704415	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:40704415G>A	ENST00000253055.3	+	2	1104	c.816G>A	c.(814-816)ccG>ccA	p.P272P	MAP3K10_ENST00000593906.1_3'UTR	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	272	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GGATGGCGCCGGAGGTTATCC	0.632																																					p.P272P		.											.	MAP3K10	981	0			c.G816A						.						72.0	64.0	67.0					19																	40704415		2203	4300	6503	SO:0001819	synonymous_variant	4294	exon2			GGCGCCGGAGGTT	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.816G>A	19.37:g.40704415G>A		111.0	0.0		63.0	20.0	NM_002446	Q12761|Q14871	Silent	SNP	ENST00000253055.3	37	CCDS12549.1																																																																																			.		0.632	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
MBOAT1	154141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	20151445	20151445	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:20151445C>A	ENST00000324607.7	-	3	458	c.294G>T	c.(292-294)atG>atT	p.M98I	MBOAT1_ENST00000541730.1_5'UTR|MBOAT1_ENST00000536798.1_Missense_Mutation_p.M98I	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	98					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			TAGCAGTGACCATGATTGCAT	0.343																																					p.M98I		.											.	MBOAT1	68	0			c.G294T						.						149.0	130.0	137.0					6																	20151445		2203	4300	6503	SO:0001583	missense	154141	exon3			AGTGACCATGATT	AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.294G>T	6.37:g.20151445C>A	ENSP00000324944:p.Met98Ile	128.0	0.0		75.0	32.0	NM_001080480	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	ENST00000324607.7	37	CCDS34346.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.020038	0.35606	.	.	ENSG00000172197	ENST00000324607;ENST00000536798	T;T	0.24151	2.74;1.87	5.69	4.79	0.61399	.	0.214010	0.53938	D	0.000055	T	0.14270	0.0345	L	0.58428	1.81	0.50313	D	0.999868	B	0.16396	0.017	B	0.17098	0.017	T	0.03384	-1.1042	10	0.17832	T	0.49	-14.4912	15.6825	0.77381	0.0:0.8632:0.1368:0.0	.	98	Q6ZNC8	MBOA1_HUMAN	I	98	ENSP00000324944:M98I;ENSP00000439814:M98I	ENSP00000324944:M98I	M	-	3	0	MBOAT1	20259424	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	1.794000	0.38774	2.661000	0.90470	0.650000	0.86243	ATG	.		0.343	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039980.1		
MON1B	22879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	77228415	77228415	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:77228415G>A	ENST00000248248.3	+	4	1009	c.659G>A	c.(658-660)cGc>cAc	p.R220H	MON1B_ENST00000545553.1_Missense_Mutation_p.R74H|MON1B_ENST00000320859.6_Intron|MON1B_ENST00000439557.2_Missense_Mutation_p.R111H	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	220										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						GACCTCCGCCGCCTGCTGGCT	0.627																																					p.R220H		.											.	MON1B	90	0			c.G659A						.						76.0	71.0	72.0					16																	77228415		2198	4300	6498	SO:0001583	missense	22879	exon4			TCCGCCGCCTGCT	BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.659G>A	16.37:g.77228415G>A	ENSP00000248248:p.Arg220His	111.0	0.0		94.0	34.0	NM_014940	B4DDZ0|O94949	Missense_Mutation	SNP	ENST00000248248.3	37	CCDS10925.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059274	0.93846	.	.	ENSG00000103111	ENST00000248248;ENST00000439557;ENST00000545553	.	.	.	4.49	4.49	0.54785	.	0.054301	0.64402	D	0.000001	D	0.83982	0.5372	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.95;1.0;1.0;0.999	D	0.87256	0.2276	9	0.72032	D	0.01	.	15.4783	0.75504	0.0:0.0:1.0:0.0	.	74;111;100;220	B4DDZ0;E7EW32;Q6ZR87;Q7L1V2	.;.;.;MON1B_HUMAN	H	220;111;74	.	ENSP00000248248:R220H	R	+	2	0	MON1B	75785916	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.428000	0.82296	0.561000	0.74099	CGC	.		0.627	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269036.2	NM_014940	
MBTPS1	8720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	84124541	84124541	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:84124541C>T	ENST00000343411.3	-	8	1465	c.970G>A	c.(970-972)Gaa>Aaa	p.E324K	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	324	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GCTGTTAATTCCCACACCTAC	0.363																																					p.E324K		.											.	MBTPS1	92	0			c.G970A						.						120.0	111.0	114.0					16																	84124541		2200	4300	6500	SO:0001583	missense	8720	exon8			TTAATTCCCACAC	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.970G>A	16.37:g.84124541C>T	ENSP00000344223:p.Glu324Lys	189.0	0.0		151.0	66.0	NM_003791	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	ENST00000343411.3	37	CCDS10941.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892897	0.91889	.	.	ENSG00000140943	ENST00000343411	T	0.44083	0.93	5.91	5.91	0.95273	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.60353	0.2262	L	0.46670	1.46	0.80722	D	1	D	0.55800	0.973	D	0.69479	0.964	T	0.55464	-0.8137	10	0.49607	T	0.09	-28.6816	20.3053	0.98627	0.0:1.0:0.0:0.0	.	324	Q14703	MBTP1_HUMAN	K	324	ENSP00000344223:E324K	ENSP00000344223:E324K	E	-	1	0	MBTPS1	82682042	1.000000	0.71417	0.999000	0.59377	0.608000	0.37181	7.610000	0.82949	2.808000	0.96608	0.655000	0.94253	GAA	.		0.363	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
MYOC	4653	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	171621608	171621608	+	Missense_Mutation	SNP	C	C	A	rs74315339	byFrequency	TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:171621608C>A	ENST00000037502.6	-	1	215	c.144G>T	c.(142-144)caG>caT	p.Q48H		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	48			Q -> H (in GLC1A and GLC3A; the GLC3A patient also carries mutation H-368 in CYP1B1 suggesting digenic inheritance). {ECO:0000269|PubMed:15025728, ECO:0000269|PubMed:15733270}.		bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TGAAGGTATACTGGCATCGGC	0.587													c|||	13	0.00259585	0.0	0.0	5008	,	,		18225	0.0		0.0	False		,,,				2504	0.0133				p.Q48H		.											.	MYOC	226	0			c.G144T	GRCh37	CM023962	MYOC	M	rs74315339	.						101.0	78.0	86.0					1																	171621608		2203	4300	6503	SO:0001583	missense	4653	exon1			GGTATACTGGCAT	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.144G>T	1.37:g.171621608C>A	ENSP00000037502:p.Gln48His	246.0	1.0		239.0	81.0	NM_000261	B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	37	CCDS1297.1	.	.	.	.	.	.	.	.	.	.	c	11.07	1.529561	0.27387	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000537133	T	0.59083	0.29	5.72	0.193	0.15139	.	0.610353	0.18226	N	0.147735	T	0.27241	0.0668	M	0.62723	1.935	0.31416	A	0.325049	B;B	0.19817	0.011;0.039	B;B	0.11329	0.005;0.006	T	0.05886	-1.0858	9	0.62326	D	0.03	.	2.4656	0.04552	0.1292:0.3654:0.3353:0.1701	.	48;48	B4DV44;Q99972	.;MYOC_HUMAN	H	48	ENSP00000037502:Q48H	ENSP00000037502:Q48H	Q	-	3	2	MYOC	169888231	0.972000	0.33761	0.998000	0.56505	0.510000	0.34073	-0.087000	0.11215	0.060000	0.16281	-0.121000	0.15023	CAG	.		0.587	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261	
NFYA	4800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41051832	41051832	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:41051832C>G	ENST00000341376.6	+	4	411	c.210C>G	c.(208-210)atC>atG	p.I70M	OARD1_ENST00000480585.1_Intron|NFYA_ENST00000353205.5_Missense_Mutation_p.I41M	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	70	Gln-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCCAGCTAATCACATCAACTG	0.453																																					p.I70M		.											.	NFYA	226	0			c.C210G						.						105.0	80.0	88.0					6																	41051832		2203	4300	6503	SO:0001583	missense	4800	exon4			GCTAATCACATCA		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.210C>G	6.37:g.41051832C>G	ENSP00000345702:p.Ile70Met	143.0	0.0		126.0	49.0	NM_002505	Q8IXU0	Missense_Mutation	SNP	ENST00000341376.6	37	CCDS4849.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239746	0.58995	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.76	3.61	0.41365	.	0.000000	0.85682	D	0.000000	T	0.55210	0.1906	L	0.56769	1.78	0.49798	D	0.999824	D;P	0.54397	0.966;0.943	P;P	0.58721	0.844;0.703	T	0.60110	-0.7327	9	0.72032	D	0.01	-9.5961	9.9989	0.41916	0.0:0.8072:0.0:0.1928	.	41;70	P23511-2;P23511	.;NFYA_HUMAN	M	70;41	.	ENSP00000345702:I70M	I	+	3	3	NFYA	41159810	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.206000	0.51098	0.641000	0.30601	0.650000	0.86243	ATC	.		0.453	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
NLRC4	58484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32475575	32475575	+	Missense_Mutation	SNP	C	C	T	rs200929188		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:32475575C>T	ENST00000404025.2	-	5	1846	c.1358G>A	c.(1357-1359)cGa>cAa	p.R453Q	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000402280.1_Missense_Mutation_p.R453Q|NLRC4_ENST00000360906.5_Missense_Mutation_p.R453Q			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	453	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.|Winged-helix domain (WHD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.R453Q(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GCTGAGTCTTCGTCCTGCTGT	0.448													C|||	1	0.000199681	0.0008	0.0	5008	,	,		23359	0.0		0.0	False		,,,				2504	0.0				p.R453Q		.											NLRC4,NS,carcinoma,-1	NLRC4	276	1	Substitution - Missense(1)	skin(1)	c.G1358A						.						81.0	82.0	81.0					2																	32475575		2203	4300	6503	SO:0001583	missense	58484	exon4			AGTCTTCGTCCTG	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1358G>A	2.37:g.32475575C>T	ENSP00000385090:p.Arg453Gln	188.0	0.0		158.0	60.0	NM_001199138	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	ENST00000404025.2	37	CCDS33174.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	16.89	3.248662	0.59103	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.11821	2.74;2.74;2.74	2.93	2.03	0.26663	.	0.000000	0.39615	N	0.001319	T	0.25568	0.0622	L	0.51422	1.61	0.32289	N	0.566616	D	0.89917	1.0	D	0.74023	0.982	T	0.25012	-1.0144	9	0.44086	T	0.13	.	9.3386	0.38065	0.0:0.8767:0.0:0.1233	.	453	Q9NPP4	NLRC4_HUMAN	Q	453	ENSP00000354159:R453Q;ENSP00000385428:R453Q;ENSP00000385090:R453Q	ENSP00000354159:R453Q	R	-	2	0	NLRC4	32329079	0.079000	0.21365	0.971000	0.41717	0.986000	0.74619	1.869000	0.39519	1.667000	0.50832	0.430000	0.28490	CGA	C|0.999;T|0.000		0.448	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
NLRP3	114548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247588697	247588697	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:247588697C>A	ENST00000336119.3	+	3	2698	c.1952C>A	c.(1951-1953)cCc>cAc	p.P651H	NLRP3_ENST00000366497.2_Missense_Mutation_p.P651H|NLRP3_ENST00000391827.2_Missense_Mutation_p.P651H|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000348069.2_Missense_Mutation_p.P651H|NLRP3_ENST00000366496.2_Missense_Mutation_p.P651H|NLRP3_ENST00000391828.3_Missense_Mutation_p.P651H	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	651					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GACTATTTCCCCAAGATTGAG	0.498																																					p.P651H		.											.	NLRP3	674	0			c.C1952A						.						94.0	80.0	85.0					1																	247588697		2203	4300	6503	SO:0001583	missense	114548	exon3			ATTTCCCCAAGAT	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1952C>A	1.37:g.247588697C>A	ENSP00000337383:p.Pro651His	243.0	0.0		261.0	85.0	NM_183395	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	C	16.44	3.125165	0.56721	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53;-2.53	3.96	3.96	0.45880	.	0.000000	0.48767	D	0.000163	D	0.88887	0.6559	L	0.27053	0.805	0.44843	D	0.997853	B;B;D;B;B	0.69078	0.167;0.278;0.997;0.198;0.23	B;B;D;B;B	0.66716	0.099;0.201;0.946;0.257;0.131	D	0.87909	0.2696	10	0.44086	T	0.13	.	11.8199	0.52232	0.0:1.0:0.0:0.0	.	651;651;651;651;651	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	H	651	ENSP00000375704:P651H;ENSP00000355453:P651H;ENSP00000337383:P651H;ENSP00000294752:P651H;ENSP00000355452:P651H;ENSP00000375703:P651H	ENSP00000337383:P651H	P	+	2	0	NLRP3	245655320	0.035000	0.19736	0.999000	0.59377	0.888000	0.51559	0.459000	0.21908	2.502000	0.84385	0.655000	0.94253	CCC	.		0.498	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
NTRK2	4915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	87570246	87570246	+	Silent	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr9:87570246G>T	ENST00000323115.4	+	15	2291	c.1938G>T	c.(1936-1938)acG>acT	p.T646T	NTRK2_ENST00000376213.1_Silent_p.T646T|NTRK2_ENST00000277120.3_Silent_p.T662T|NTRK2_ENST00000376214.1_Silent_p.T662T			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	646	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	ACCCGCCCACGGAACTGACGC	0.627										TSP Lung(25;0.17)																											p.T662T		.											.	NTRK2	1404	0			c.G1986T						.						31.0	26.0	28.0					9																	87570246		2203	4300	6503	SO:0001819	synonymous_variant	4915	exon19			GCCCACGGAACTG	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1938G>T	9.37:g.87570246G>T		41.0	0.0		38.0	14.0	NM_006180	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Silent	SNP	ENST00000323115.4	37	CCDS35050.1																																																																																			.		0.627	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
OGFRL1	79627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	72003250	72003250	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:72003250C>G	ENST00000370435.4	+	3	470	c.336C>G	c.(334-336)atC>atG	p.I112M	RP11-154D6.1_ENST00000412751.1_RNA|OGFRL1_ENST00000467503.1_3'UTR|RP11-154D6.1_ENST00000586030.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	112						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						TCAAAGATATCCGATATCAAA	0.333																																					p.I112M		.											.	OGFRL1	68	0			c.C336G						.						57.0	58.0	57.0					6																	72003250		2202	4298	6500	SO:0001583	missense	79627	exon3			AGATATCCGATAT		CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.336C>G	6.37:g.72003250C>G	ENSP00000359464:p.Ile112Met	232.0	0.0		216.0	16.0	NM_024576	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	ENST00000370435.4	37	CCDS34482.1	.	.	.	.	.	.	.	.	.	.	C	14.20	2.464741	0.43736	.	.	ENSG00000119900	ENST00000370435	T	0.44482	0.92	5.96	4.11	0.48088	Opioid growth factor receptor (OGFr) conserved domain (1);	0.190794	0.47093	D	0.000259	T	0.14700	0.0355	N	0.08118	0	0.30283	N	0.791097	P	0.45634	0.863	P	0.50405	0.64	T	0.03863	-1.0997	10	0.45353	T	0.12	-6.8875	5.2802	0.15670	0.0:0.5576:0.1449:0.2976	.	112	Q5TC84	OGRL1_HUMAN	M	112	ENSP00000359464:I112M	ENSP00000359464:I112M	I	+	3	3	OGFRL1	72059971	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	0.244000	0.18124	1.444000	0.47605	0.655000	0.94253	ATC	.		0.333	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
OR2L8	391190	ucsc.edu;bcgsc.ca	37	1	248112750	248112750	+	Silent	SNP	A	A	T	rs369417034		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:248112750A>T	ENST00000357191.3	+	1	591	c.591A>T	c.(589-591)acA>acT	p.T197T	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ATGAGGGCACAGTGTTTTTGA	0.473																																					p.T197T		.											.	OR2L8	70	0			c.A591T						.						142.0	46.0	78.0					1																	248112750		2203	4295	6498	SO:0001819	synonymous_variant	391190	exon1			GGGCACAGTGTTT	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.591A>T	1.37:g.248112750A>T		315.0	0.0		324.0	60.0	NM_001001963	Q6IF03	Silent	SNP	ENST00000357191.3	37	CCDS31101.1																																																																																			.		0.473	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
OR2L3	391192	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	248224574	248224574	+	Silent	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:248224574A>T	ENST00000359959.3	+	1	591	c.591A>T	c.(589-591)acA>acT	p.T197T	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ATGAGGGCACAGTGTTTTTGA	0.478																																					p.T197T		.											.	OR2L3	68	0			c.A591T						.						172.0	191.0	185.0					1																	248224574		2196	4300	6496	SO:0001819	synonymous_variant	391192	exon1			GGGCACAGTGTTT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.591A>T	1.37:g.248224574A>T		1021.0	0.0		1251.0	67.0	NM_001004687	B9EH44	Silent	SNP	ENST00000359959.3	37	CCDS31104.1																																																																																			.		0.478	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
OR51T1	401665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4903945	4903945	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:4903945G>T	ENST00000322049.1	+	1	816	c.816G>T	c.(814-816)agG>agT	p.R272S	MMP26_ENST00000380390.1_Intron|OR51T1_ENST00000380378.1_Missense_Mutation_p.R299S|MMP26_ENST00000477339.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCACCCCAAGGGTGCTCTGTA	0.493																																					p.R299S		.											.	OR51T1	115	0			c.G897T						.						118.0	105.0	109.0					11																	4903945		2201	4298	6499	SO:0001583	missense	401665	exon1			CCCAAGGGTGCTC	BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.816G>T	11.37:g.4903945G>T	ENSP00000322679:p.Arg272Ser	238.0	0.0		178.0	69.0	NM_001004759	Q6IFH9	Missense_Mutation	SNP	ENST00000322049.1	37		.	.	.	.	.	.	.	.	.	.	G	10.44	1.351761	0.24512	.	.	ENSG00000176900	ENST00000380378;ENST00000322049	T;T	0.35421	1.31;1.31	4.97	-5.93	0.02254	GPCR, rhodopsin-like superfamily (1);	0.509628	0.16622	N	0.206431	T	0.16128	0.0388	N	0.20986	0.625	0.09310	N	1	B	0.21071	0.051	B	0.17433	0.018	T	0.06197	-1.0840	10	0.52906	T	0.07	.	3.03	0.06103	0.5324:0.0951:0.1682:0.2043	.	272	Q8NGJ9	O51T1_HUMAN	S	299;272	ENSP00000369738:R299S;ENSP00000322679:R272S	ENSP00000322679:R272S	R	+	3	2	OR51T1	4860521	0.000000	0.05858	0.075000	0.20258	0.932000	0.56968	-2.939000	0.00684	-1.095000	0.03050	0.491000	0.48974	AGG	.		0.493	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759	
OR5P3	120066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7846818	7846818	+	Silent	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:7846818G>T	ENST00000328375.1	-	1	701	c.702C>A	c.(700-702)cgC>cgA	p.R234R	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153445.1	NP_703146.1	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P, member 3	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	15				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGGCCTTGTGGCGGCCCTTGG	0.498																																					p.R234R		.											.	OR5P3	69	0			c.C702A						.						118.0	99.0	106.0					11																	7846818		2188	4296	6484	SO:0001819	synonymous_variant	120066	exon1			CTTGTGGCGGCCC	AF158377	CCDS7783.1	11p15.4	2012-08-09			ENSG00000182334	ENSG00000182334		"""GPCR / Class A : Olfactory receptors"""	14784	protein-coding gene	gene with protein product							Standard	NM_153445		Approved	JCG1	uc010rbg.2	Q8WZ94	OTTHUMG00000165669	ENST00000328375.1:c.702C>A	11.37:g.7846818G>T		179.0	0.0		144.0	63.0	NM_153445	Q6IFE1|Q8NGM2	Silent	SNP	ENST00000328375.1	37	CCDS7783.1																																																																																			.		0.498	OR5P3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385697.1	NM_153445	
OR8J1	219477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56127796	56127796	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:56127796T>C	ENST00000303039.3	+	1	106	c.74T>C	c.(73-75)aTt>aCt	p.I25T		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					GAGCTCCAGATTCCCCTCTTC	0.498																																					p.I25T		.											.	OR8J1	70	0			c.T74C						.						109.0	108.0	108.0					11																	56127796		2201	4296	6497	SO:0001583	missense	219477	exon1			TCCAGATTCCCCT	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.74T>C	11.37:g.56127796T>C	ENSP00000304060:p.Ile25Thr	167.0	0.0		173.0	71.0	NM_001005205	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	37	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	T	4.133	0.022923	0.08006	.	.	ENSG00000172487	ENST00000303039	T	0.00587	6.38	4.57	3.34	0.38264	.	1.064010	0.07249	N	0.865549	T	0.00666	0.0022	L	0.38953	1.18	0.09310	N	1	B	0.20988	0.05	B	0.25405	0.06	T	0.46735	-0.9170	10	0.40728	T	0.16	.	5.648	0.17600	0.0:0.0946:0.1744:0.731	.	25	Q8NGP2	OR8J1_HUMAN	T	25	ENSP00000304060:I25T	ENSP00000304060:I25T	I	+	2	0	OR8J1	55884372	0.000000	0.05858	0.059000	0.19551	0.366000	0.29705	0.641000	0.24720	1.828000	0.53243	0.523000	0.50628	ATT	.		0.498	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205	
OR8U1	219417	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	11	56143382	56143382	+	Missense_Mutation	SNP	G	G	T	rs77605314		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:56143382G>T	ENST00000302270.1	+	1	283	c.283G>T	c.(283-285)Gat>Tat	p.D95Y		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					TATATCCTTTGATGCATGTGC	0.403																																					p.D95Y		.											.	OR8U1	72	0			c.G283T						.						206.0	192.0	197.0					11																	56143382		2034	4211	6245	SO:0001583	missense	219417	exon1			TCCTTTGATGCAT	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.283G>T	11.37:g.56143382G>T	ENSP00000304188:p.Asp95Tyr	118.0	0.0		66.0	33.0	NM_001005204		Missense_Mutation	SNP	ENST00000302270.1	37	CCDS41647.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.598806	0.00125	.	.	ENSG00000172199	ENST00000302270	T	0.00348	8.0	5.78	-3.03	0.05429	GPCR, rhodopsin-like superfamily (1);	0.538501	0.16919	N	0.194162	T	0.00144	0.0004	L	0.43554	1.36	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42292	-0.9460	10	0.14656	T	0.56	.	1.3132	0.02102	0.3741:0.2301:0.2699:0.1259	.	95	Q8NH10	OR8U1_HUMAN	Y	95	ENSP00000304188:D95Y	ENSP00000304188:D95Y	D	+	1	0	OR8U1	55899958	0.000000	0.05858	0.959000	0.39883	0.008000	0.06430	-3.973000	0.00322	-0.144000	0.11314	-1.515000	0.00940	GAT	G|0.500;A|0.500		0.403	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391607.1	NM_001005204	
OVCH1	341350	broad.mit.edu;bcgsc.ca	37	12	29649135	29649142	+	Frame_Shift_Del	DEL	TGTGCTGC	TGTGCTGC	-	rs376740689		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	TGTGCTGC	TGTGCTGC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr12:29649135_29649142delTGTGCTGC	ENST00000318184.5	-	3	252_259	c.253_260delGCAGCACA	c.(253-261)gcagcacacfs	p.AAH85fs		NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	85	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.A85V(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					GTCCAGGCAGTGTGCTGCTGTAACAACC	0.462																																					p.85_87del		.											.	OVCH1	210	1	Substitution - Missense(1)	cervix(1)	c.253_260del						.																																			SO:0001589	frameshift_variant	341350	exon3			AGGCAGTGTGCTG	BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.253_260delGCAGCACA	12.37:g.29649135_29649142delTGTGCTGC	ENSP00000326708:p.Ala85fs	80.0	0.0		64.0	8.0	NM_183378		Frame_Shift_Del	DEL	ENST00000318184.5	37																																																																																				.		0.462	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
PAK6	56924	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	40565801	40565801	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr15:40565801C>A	ENST00000542403.2	+	7	1778	c.1667C>A	c.(1666-1668)cCt>cAt	p.P556H	PAK6_ENST00000453867.1_Missense_Mutation_p.P556H|PAK6_ENST00000441369.1_Missense_Mutation_p.P556H|PAK6_ENST00000560346.1_Missense_Mutation_p.P556H|PAK6_ENST00000455577.2_Missense_Mutation_p.P556H|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000260404.4_Missense_Mutation_p.P556H	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	556	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		AAAGACGTCCCTAAGAGGAAG	0.567																																					p.W556X		.											.	PAK6	996	0			c.G1667A						.						87.0	80.0	83.0					15																	40565801		2203	4300	6503	SO:0001583	missense	56924	exon9			ACGTCCCTAAGAG	AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1667C>A	15.37:g.40565801C>A	ENSP00000439597:p.Pro556His	243.0	0.0		198.0	56.0	NM_020168	A8K2G2|B3KYB0|G5E9R2	Nonsense_Mutation	SNP	ENST00000542403.2	37	CCDS10054.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114770	0.77210	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.16	3.23	0.37069	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70684	0.3252	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71262	-0.4645	10	0.87932	D	0	.	11.9326	0.52855	0.1378:0.7298:0.1324:0.0	.	556;556	Q9NQU5;G5E9R2	PAK6_HUMAN;.	H	556	ENSP00000406873:P556H;ENSP00000401153:P556H;ENSP00000409465:P556H;ENSP00000260404:P556H;ENSP00000439597:P556H	ENSP00000260404:P556H	P	+	2	0	PAK6	38353093	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	6.030000	0.70903	0.538000	0.28769	0.462000	0.41574	CCT	.		0.567	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000418355.1		
PASD1	139135	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	150840760	150840760	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:150840760A>T	ENST00000370357.4	+	14	1788	c.1543A>T	c.(1543-1545)Atg>Ttg	p.M515L		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	515	Lys-rich.					nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					gcagaagaagatgcaggagaa	0.537																																					p.M515L		.											.	PASD1	133	0			c.A1543T						.						34.0	35.0	35.0					X																	150840760		2105	4098	6203	SO:0001583	missense	139135	exon14			AAGAAGATGCAGG	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1543A>T	X.37:g.150840760A>T	ENSP00000359382:p.Met515Leu	308.0	0.0		253.0	74.0	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	37	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	A	8.418	0.845805	0.16963	.	.	ENSG00000166049	ENST00000370357	T	0.17213	2.29	1.01	-2.01	0.07410	.	.	.	.	.	T	0.05731	0.0150	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.40289	-0.9571	9	0.06494	T	0.89	.	4.836	0.13466	0.4634:0.5366:0.0:0.0	.	515	Q8IV76	PASD1_HUMAN	L	515	ENSP00000359382:M515L	ENSP00000359382:M515L	M	+	1	0	PASD1	150591416	0.000000	0.05858	0.002000	0.10522	0.300000	0.27592	-0.617000	0.05584	-1.035000	0.03291	0.235000	0.17854	ATG	.		0.537	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
PAX1	5075	ucsc.edu;mdanderson.org	37	20	21695194	21695194	+	Missense_Mutation	SNP	C	C	G	rs17861059	byFrequency	TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr20:21695194C>G	ENST00000398485.2	+	5	1412	c.1358C>G	c.(1357-1359)cCt>cGt	p.P453R	PAX1_ENST00000444366.2_Silent_p.T432T	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	453			P -> L (in dbSNP:rs17861059). {ECO:0000269|Ref.2}.		bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CGGCCTCGACCTCCTAGGGGC	0.731																																					p.P453R		.											.	PAX1	227	0			c.C1358G						.						9.0	10.0	10.0					20																	21695194		2192	4285	6477	SO:0001583	missense	5075	exon5			CTCGACCTCCTAG		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.1358C>G	20.37:g.21695194C>G	ENSP00000381499:p.Pro453Arg	18.0	0.0		26.0	10.0	NM_006192	B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646841	0.67358	.	.	ENSG00000125813	ENST00000398485	D	0.97232	-4.3	5.27	-0.953	0.10362	.	.	.	.	.	D	0.91616	0.7351	N	0.24115	0.695	0.80722	D	1	B	0.20550	0.046	B	0.17098	0.017	T	0.82993	-0.0181	9	0.72032	D	0.01	.	6.5309	0.22326	0.0:0.4638:0.2271:0.3091	.	453	P15863	PAX1_HUMAN	R	453	ENSP00000381499:P453R	ENSP00000381499:P453R	P	+	2	0	PAX1	21643194	0.709000	0.27886	0.980000	0.43619	0.980000	0.70556	-0.588000	0.05774	-0.025000	0.13918	-0.266000	0.10368	CCT	C|0.993;T|0.007		0.731	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3		
PCDH7	5099	broad.mit.edu;mdanderson.org	37	4	30723824	30723824	+	Silent	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr4:30723824G>T	ENST00000361762.2	+	1	1788	c.780G>T	c.(778-780)ctG>ctT	p.L260L	PCDH7_ENST00000543491.1_Silent_p.L260L	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	260	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AGCCGCAGCTGATCGTGAAGG	0.736																																					p.L260L		.											.	PCDH7	229	0			c.G780T						.						4.0	7.0	6.0					4																	30723824		2005	4049	6054	SO:0001819	synonymous_variant	5099	exon1			GCAGCTGATCGTG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.780G>T	4.37:g.30723824G>T		14.0	0.0		11.0	7.0	NM_032457	O60246|O60247|Q4W5C4	Silent	SNP	ENST00000361762.2	37	CCDS33971.1																																																																																			.		0.736	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
PCDHA1	56147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140167846	140167846	+	Silent	SNP	G	G	A	rs376407441		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:140167846G>A	ENST00000504120.2	+	1	1971	c.1971G>A	c.(1969-1971)ccG>ccA	p.P657P	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Silent_p.P657P	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	657	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGGTGAGCCGGCGCTGACAG	0.662													.|||	1	0.000199681	0.0008	0.0	5008	,	,		15980	0.0		0.0	False		,,,				2504	0.0				p.P657P		.											.	PCDHA1	23	0			c.G1971A						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	45.0	51.0	49.0		1971,1971,	-4.9	0.5	5		49	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,intron	PCDHA1	NM_018900.2,NM_031410.1,NM_031411.1	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	657/951,657/808,	140167846	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56147	exon1			TGAGCCGGCGCTG	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1971G>A	5.37:g.140167846G>A		163.0	0.0		175.0	102.0	NM_031410	O75288|Q9NRT7	Silent	SNP	ENST00000504120.2	37	CCDS54913.1																																																																																			.		0.662	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140209428	140209428	+	Silent	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:140209428A>T	ENST00000529310.1	+	1	1866	c.1752A>T	c.(1750-1752)tcA>tcT	p.S584S	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	584	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCGCGGTCACTGGGTGCAG	0.672																																					p.S584S		.											.	PCDHA6	92	0			c.A1752T						.						86.0	86.0	86.0					5																	140209428		2203	4299	6502	SO:0001819	synonymous_variant	56142	exon1			GCGGTCACTGGGT	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1752A>T	5.37:g.140209428A>T		284.0	0.0		376.0	19.0	NM_018909	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	37	CCDS47281.1																																																																																			.		0.672	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PDHX	8050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	35016491	35016491	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:35016491C>T	ENST00000227868.4	+	11	1362	c.1278C>T	c.(1276-1278)gaC>gaT	p.D426D	PDHX_ENST00000430469.2_Silent_p.D199D|PDHX_ENST00000448838.3_Silent_p.D411D|PDHX_ENST00000477173.3_Intron			O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	426					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	16	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			TTGGCATCGACGAATTTACTG	0.488																																					p.D426D		.											.	PDHX	226	0			c.C1278T						.						117.0	117.0	117.0					11																	35016491		2202	4298	6500	SO:0001819	synonymous_variant	8050	exon11			CATCGACGAATTT	U82328	CCDS7896.1, CCDS44569.1, CCDS53616.1	11p13	2008-02-05			ENSG00000110435	ENSG00000110435			21350	protein-coding gene	gene with protein product		608769				9467010, 12372595	Standard	NM_003477		Approved	E3BP, proX, PDX1, OPDX, DLDBP	uc001mvt.3	O00330	OTTHUMG00000166491	ENST00000227868.4:c.1278C>T	11.37:g.35016491C>T		182.0	0.0		143.0	9.0	NM_003477	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Silent	SNP	ENST00000227868.4	37	CCDS7896.1	.	.	.	.	.	.	.	.	.	.	C	5.116	0.206948	0.09704	.	.	ENSG00000110435	ENST00000526309	.	.	.	6.04	-1.72	0.08107	.	.	.	.	.	T	0.58104	0.2099	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55842	-0.8077	4	.	.	.	-25.8974	11.9285	0.52833	0.0:0.5073:0.0:0.4927	.	.	.	.	M	114	.	.	T	+	2	0	PDHX	34973067	0.611000	0.26992	0.959000	0.39883	0.626000	0.37791	-0.211000	0.09332	-0.273000	0.09246	-1.012000	0.02466	ACG	.		0.488	PDHX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390017.1	NM_003477	
PDXDC1	23042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	15103555	15103555	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:15103555G>A	ENST00000396410.4	+	8	763	c.666G>A	c.(664-666)gaG>gaA	p.E222E	PDXDC1_ENST00000569715.1_Silent_p.E195E|MIR1972-1_ENST00000459337.1_RNA|PDXDC1_ENST00000563679.1_Silent_p.E240E|PDXDC1_ENST00000447912.2_Silent_p.E131E|PDXDC1_ENST00000535621.2_Silent_p.E222E|PDXDC1_ENST00000455313.2_Silent_p.E199E|PDXDC1_ENST00000325823.7_Silent_p.E207E|PDXDC1_ENST00000450288.2_Silent_p.E194E	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	222					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTTCCTGGAGAAACTGATTA	0.368																																					p.E222E		.											.	PDXDC1	91	0			c.G666A						.						61.0	73.0	69.0					16																	15103555		2197	4297	6494	SO:0001819	synonymous_variant	23042	exon8			CCTGGAGAAACTG	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.666G>A	16.37:g.15103555G>A		582.0	0.0		410.0	85.0	NM_015027	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	CCDS32393.1																																																																																			.		0.368	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
PECR	55825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	216930060	216930060	+	Silent	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:216930060C>G	ENST00000265322.7	-	3	473	c.399G>C	c.(397-399)acG>acC	p.T133T	PECR_ENST00000497889.1_5'UTR	NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	133					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)	p.T133T(1)		endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	AGAAGGTACCCGTCAGGTTGG	0.458																																					p.T133T		.											.	PECR	90	1	Substitution - coding silent(1)	lung(1)	c.G399C						.						139.0	132.0	134.0					2																	216930060		2203	4300	6503	SO:0001819	synonymous_variant	55825	exon3			GGTACCCGTCAGG	AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.399G>C	2.37:g.216930060C>G		157.0	0.0		126.0	55.0	NM_018441	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Silent	SNP	ENST00000265322.7	37	CCDS33375.1																																																																																			.		0.458	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1	NM_018441	
PGR	5241	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	100998683	100998683	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:100998683C>T	ENST00000325455.5	-	1	2572	c.1119G>A	c.(1117-1119)gcG>gcA	p.A373A	PGR_ENST00000534013.1_Intron|PGR_ENST00000263463.5_Silent_p.A373A	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	373	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	AGAGAGGGTACGCGTCGTCCT	0.687																																					p.A373A	Pancreas(124;2271 2354 21954 22882)	.											.	PGR	652	0			c.G1119A						.						19.0	23.0	22.0					11																	100998683		2094	4150	6244	SO:0001819	synonymous_variant	5241	exon1			AGGGTACGCGTCG	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.1119G>A	11.37:g.100998683C>T		148.0	0.0		111.0	42.0	NM_000926	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Silent	SNP	ENST00000325455.5	37	CCDS8310.1																																																																																			.		0.687	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
PHKA1	5255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	71855112	71855112	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:71855112T>C	ENST00000373542.4	-	16	1766	c.1607A>G	c.(1606-1608)aAc>aGc	p.N536S	PHKA1_ENST00000373545.3_Missense_Mutation_p.N536S|PHKA1_ENST00000339490.3_Missense_Mutation_p.N536S|PHKA1_ENST00000373539.3_Missense_Mutation_p.N536S|PHKA1_ENST00000541944.1_Missense_Mutation_p.N536S	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	536					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					TATCATCTTGTTGTCCAGAGC	0.418																																					p.N536S		.											.	PHKA1	134	0			c.A1607G						.						117.0	91.0	100.0					X																	71855112		2203	4300	6503	SO:0001583	missense	5255	exon16			ATCTTGTTGTCCA		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.1607A>G	X.37:g.71855112T>C	ENSP00000362643:p.Asn536Ser	189.0	0.0		160.0	70.0	NM_001172436	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	ENST00000373542.4	37	CCDS14421.1	.	.	.	.	.	.	.	.	.	.	T	10.69	1.422106	0.25639	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.90844	-2.72;-2.74;-2.71;-2.73;-2.73	4.47	4.47	0.54385	Glycoside hydrolase 15-related (1);	0.050069	0.85682	D	0.000000	D	0.86912	0.6047	L	0.51422	1.61	0.54753	D	0.999989	B;B;B	0.25521	0.128;0.032;0.08	B;B;B	0.30716	0.078;0.034;0.119	T	0.81858	-0.0739	10	0.20519	T	0.43	-11.7535	11.0389	0.47818	0.0:0.0:0.0:1.0	.	536;536;536	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	S	536	ENSP00000362646:N536S;ENSP00000362643:N536S;ENSP00000441251:N536S;ENSP00000342469:N536S;ENSP00000362640:N536S	ENSP00000342469:N536S	N	-	2	0	PHKA1	71771837	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.136000	0.58004	1.572000	0.49736	0.339000	0.21740	AAC	.		0.418	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
PIWIL1	9271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130842075	130842075	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr12:130842075A>G	ENST00000245255.3	+	14	1914	c.1642A>G	c.(1642-1644)Aag>Gag	p.K548E		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	548	RNA-binding. {ECO:0000250}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTTACAGCAAAAGGTCACAGC	0.408																																					p.K548E		.											.	PIWIL1	92	0			c.A1642G						.						146.0	128.0	134.0					12																	130842075		2203	4300	6503	SO:0001583	missense	9271	exon14			CAGCAAAAGGTCA	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1642A>G	12.37:g.130842075A>G	ENSP00000245255:p.Lys548Glu	225.0	0.0		185.0	25.0	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	A	15.45	2.838127	0.50951	.	.	ENSG00000125207	ENST00000245255	T	0.13196	2.61	5.59	4.43	0.53597	Ribonuclease H-like (1);	0.177411	0.64402	D	0.000012	T	0.11793	0.0287	L	0.41236	1.265	0.40541	D	0.981025	B;B	0.14438	0.01;0.001	B;B	0.11329	0.004;0.006	T	0.09684	-1.0663	10	0.18710	T	0.47	-1.6065	12.1143	0.53856	0.8564:0.1436:0.0:0.0	.	548;548	Q96J94;Q96J94-2	PIWL1_HUMAN;.	E	548	ENSP00000245255:K548E	ENSP00000245255:K548E	K	+	1	0	PIWIL1	129408028	1.000000	0.71417	0.742000	0.31022	0.986000	0.74619	5.912000	0.69948	0.924000	0.37069	0.533000	0.62120	AAG	.		0.408	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110454292	110454292	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr8:110454292A>G	ENST00000378402.5	+	35	4365	c.4261A>G	c.(4261-4263)Aca>Gca	p.T1421A		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1421	IPT/TIG 7.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGTGGGGGACACAGTGGCATG	0.418										HNSCC(38;0.096)																											p.T1421A		.											.	PKHD1L1	145	0			c.A4261G						.						115.0	117.0	116.0					8																	110454292		1866	4108	5974	SO:0001583	missense	93035	exon35			GGGGACACAGTGG	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4261A>G	8.37:g.110454292A>G	ENSP00000367655:p.Thr1421Ala	245.0	0.0		200.0	76.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	11.70	1.718217	0.30503	.	.	ENSG00000205038	ENST00000378402	D	0.85411	-1.98	5.82	4.6	0.57074	Cupredoxin (1);	0.202657	0.42053	D	0.000771	T	0.81074	0.4747	M	0.63428	1.95	0.23673	N	0.99715	B	0.27117	0.168	B	0.20577	0.03	T	0.71269	-0.4643	10	0.37606	T	0.19	.	10.8656	0.46853	0.8422:0.1577:0.0:0.0	.	1421	Q86WI1	PKHL1_HUMAN	A	1421	ENSP00000367655:T1421A	ENSP00000367655:T1421A	T	+	1	0	PKHD1L1	110523468	1.000000	0.71417	0.995000	0.50966	0.421000	0.31385	3.696000	0.54757	2.218000	0.71995	0.482000	0.46254	ACA	.		0.418	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLXNB1	5364	broad.mit.edu;bcgsc.ca	37	3	48465123	48465123	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:48465123delC	ENST00000358536.4	-	3	1167	c.898delG	c.(898-900)gctfs	p.A301fs	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000456774.1_Frame_Shift_Del_p.A301fs|PLXNB1_ENST00000296440.6_Frame_Shift_Del_p.A301fs|PLXNB1_ENST00000358459.4_Frame_Shift_Del_p.A301fs	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	301	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGGGTGCAGCCGAGGAGAAA	0.697																																					p.A300fs		.											.	PLXNB1	293	0			c.898delG						.						20.0	24.0	23.0					3																	48465123		2196	4290	6486	SO:0001589	frameshift_variant	5364	exon3			GTGCAGCCGAGGA	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.898delG	3.37:g.48465123delC	ENSP00000351338:p.Ala301fs	44.0	0.0		28.0	8.0	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Frame_Shift_Del	DEL	ENST00000358536.4	37	CCDS2765.1																																																																																			.		0.697	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
PLXNA1	5361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126708420	126708420	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:126708420G>A	ENST00000393409.2	+	1	984	c.984G>A	c.(982-984)ctG>ctA	p.L328L	PLXNA1_ENST00000251772.4_Silent_p.L305L	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	328	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CCCACCAGCTGGGCCTGGCTG	0.657																																					p.L328L		.											.	PLXNA1	93	0			c.G984A						.						74.0	81.0	79.0					3																	126708420		2203	4300	6503	SO:0001819	synonymous_variant	5361	exon1			CCAGCTGGGCCTG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.984G>A	3.37:g.126708420G>A		83.0	0.0		66.0	24.0	NM_032242		Silent	SNP	ENST00000393409.2	37	CCDS33847.2																																																																																			.		0.657	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
PNKD	25953	ucsc.edu;bcgsc.ca	37	2	219204528	219204528	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:219204528T>C	ENST00000273077.4	+	3	310	c.259T>C	c.(259-261)Tgg>Cgg	p.W87R	PNKD_ENST00000258362.3_Missense_Mutation_p.W63R|AC021016.8_ENST00000411433.1_RNA|PNKD_ENST00000436005.2_Missense_Mutation_p.W27R	NM_015488.4	NP_056303.3	Q8N490	PNKD_HUMAN	paroxysmal nonkinesigenic dyskinesia	87					glutathione biosynthetic process (GO:0006750)|neuromuscular process controlling posture (GO:0050884)|regulation of dopamine metabolic process (GO:0042053)|regulation of synaptic transmission, dopaminergic (GO:0032225)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACCCGCACCTGGCTCGGGTA	0.602																																					p.W87R		.											.	PNKD	90	0			c.T259C						.						52.0	53.0	53.0					2																	219204528		2203	4300	6503	SO:0001583	missense	25953	exon3			CGCACCTGGCTCG		CCDS2411.1, CCDS2413.1, CCDS42816.1	2q35	2011-01-21	2007-07-12		ENSG00000127838	ENSG00000127838			9153	protein-coding gene	gene with protein product	"""myofibrillogenesis regulator 1"""	609023	"""paroxysmal nonkinesiogenic dyskinesia"""			8659518	Standard	NM_015488		Approved	DYT8, PDC, DKFZp564N1362, FPD1, MR-1, BRP17, FKSG19, TAHCCP2, KIAA1184, KIPP1184, MGC31943, PKND1	uc002vhn.3	Q8N490	OTTHUMG00000133110	ENST00000273077.4:c.259T>C	2.37:g.219204528T>C	ENSP00000273077:p.Trp87Arg	82.0	0.0		61.0	6.0	NM_015488	A8K1F2|Q96A48|Q9BU26|Q9NSX4|Q9ULN6|Q9Y4T1	Missense_Mutation	SNP	ENST00000273077.4	37	CCDS2411.1	.	.	.	.	.	.	.	.	.	.	T	4.135	0.023400	0.08006	.	.	ENSG00000127838	ENST00000273077;ENST00000258362;ENST00000436005	D;D;D	0.96200	-3.94;-3.61;-3.61	5.33	4.17	0.49024	.	0.304797	0.33346	N	0.005018	D	0.86539	0.5957	N	0.19112	0.55	0.27806	N	0.942321	B;B	0.12013	0.0;0.005	B;B	0.08055	0.002;0.003	T	0.71889	-0.4456	10	0.06625	T	0.88	-8.5017	3.4138	0.07368	0.1634:0.2131:0.0:0.6235	.	63;87	Q8N490-3;Q8N490	.;PNKD_HUMAN	R	87;63;27	ENSP00000273077:W87R;ENSP00000258362:W63R;ENSP00000414400:W27R	ENSP00000258362:W63R	W	+	1	0	PNKD	218912772	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.564000	0.36375	0.855000	0.35359	0.459000	0.35465	TGG	.		0.602	PNKD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256775.2		
POLR2G	5436	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	62532653	62532653	+	Splice_Site	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:62532653G>T	ENST00000301788.7	+	4	387		c.e4-1			NM_002696.2	NP_002687.1	P62487	RPB7_HUMAN	polymerase (RNA) II (DNA directed) polypeptide G						7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, exonucleolytic (GO:0000291)|nucleotide-excision repair (GO:0006289)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translational initiation (GO:0045948)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)|translation initiation factor binding (GO:0031369)			lung(3)	3						TTTTTTTCTAGGTTGGACTCT	0.532																																					.		.											.	POLR2G	90	0			c.283-1G>T						.						144.0	132.0	136.0					11																	62532653		2202	4299	6501	SO:0001630	splice_region_variant	5436	exon4			TTTCTAGGTTGGA	U20659	CCDS31585.1	11q13.1	2013-01-21			ENSG00000168002	ENSG00000168002		"""RNA polymerase subunits"""	9194	protein-coding gene	gene with protein product		602013				7579693, 9256063	Standard	NM_002696		Approved	hRPB19, hsRPB7, RPB7	uc001nva.3	P62487	OTTHUMG00000167609	ENST00000301788.7:c.283-1G>T	11.37:g.62532653G>T		264.0	0.0		191.0	13.0	NM_002696	B2R5C0|P52433|Q2M1Z4	Splice_Site	SNP	ENST00000301788.7	37	CCDS31585.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793127	0.90453	.	.	ENSG00000168002	ENST00000301788	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0887	0.89466	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	POLR2G	62289229	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	8.440000	0.90311	2.873000	0.98535	0.563000	0.77884	.	.		0.532	POLR2G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395344.1	NM_002696	Intron
POTEJ	653781	bcgsc.ca;mdanderson.org	37	2	131414451	131414451	+	Missense_Mutation	SNP	G	G	A	rs541398584		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:131414451G>A	ENST00000409602.1	+	15	2170	c.2118G>A	c.(2116-2118)atG>atA	p.M706I		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	706	Actin-like.				retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						AGCAGGGCATGATGGGGGGCA	0.617													g|||	1	0.000199681	0.0008	0.0	5008	,	,		18376	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.																																			SO:0001583	missense	653781	.			GGGCATGATGGGG		CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.2118G>A	2.37:g.131414451G>A	ENSP00000387176:p.Met706Ile	253.0	0.0		167.0	99.0	.		Missense_Mutation	SNP	ENST00000409602.1	37	CCDS59432.1	.	.	.	.	.	.	.	.	.	.	.	8.775	0.926806	0.18056	.	.	ENSG00000222038	ENST00000409602	D	0.89270	-2.49	0.736	0.736	0.18307	.	.	.	.	.	T	0.60340	0.2261	N	0.00258	-1.755	0.21386	N	0.99971	.	.	.	.	.	.	T	0.59563	-0.7431	7	0.62326	D	0.03	.	3.2397	0.06777	0.3546:0.0:0.6454:0.0	.	.	.	.	I	706	ENSP00000387176:M706I	ENSP00000387176:M706I	M	+	3	0	POTEJ	131130921	1.000000	0.71417	0.141000	0.22245	0.143000	0.21401	1.504000	0.35726	0.132000	0.18615	0.134000	0.15878	ATG	.		0.617	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333665.1	XM_929706	
POU3F2	5454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	99283990	99283990	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:99283990C>T	ENST00000328345.5	+	1	1411	c.1241C>T	c.(1240-1242)cCt>cTt	p.P414L		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	414					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGGATGACCCCTCCCGGAGGG	0.607																																					p.P414L		.											.	POU3F2	90	0			c.C1241T						.						44.0	55.0	51.0					6																	99283990		2202	4298	6500	SO:0001583	missense	5454	exon1			TGACCCCTCCCGG	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.1241C>T	6.37:g.99283990C>T	ENSP00000329170:p.Pro414Leu	56.0	0.0		35.0	19.0	NM_005604	Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	ENST00000328345.5	37	CCDS5040.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951662	0.73787	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	D	0.87491	-2.26	4.51	4.51	0.55191	Homeobox (1);Homeodomain-like (1);	.	.	.	.	D	0.89938	0.6860	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.65323	0.934	D	0.91226	0.5010	9	0.87932	D	0	.	16.1405	0.81519	0.0:1.0:0.0:0.0	.	414	P20265	PO3F2_HUMAN	L	414;347	ENSP00000329170:P414L	ENSP00000329170:P414L	P	+	2	0	POU3F2	99390711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.555000	0.60767	2.330000	0.79161	0.555000	0.69702	CCT	.		0.607	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
PRDX1	5052	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	45977037	45977037	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:45977037G>A	ENST00000262746.1	-	6	903	c.564C>T	c.(562-564)gtC>gtT	p.V188V	PRDX1_ENST00000372079.1_Silent_p.V86V|PRDX1_ENST00000319248.8_Silent_p.V188V	NM_002574.3|NM_181696.2	NP_002565.1|NP_859047.1	Q06830	PRDX1_HUMAN	peroxiredoxin 1	188					cell proliferation (GO:0008283)|erythrocyte homeostasis (GO:0034101)|hydrogen peroxide catabolic process (GO:0042744)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of NF-kappaB import into nucleus (GO:0042345)|regulation of stress-activated MAPK cascade (GO:0032872)|removal of superoxide radicals (GO:0019430)|retina homeostasis (GO:0001895)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)	heme binding (GO:0020037)|peroxidase activity (GO:0004601)|poly(A) RNA binding (GO:0044822)|thioredoxin peroxidase activity (GO:0008379)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	12	Acute lymphoblastic leukemia(166;0.155)					TGCTCTTTTGGACATCAGGCT	0.483																																					p.V188V		.											.	PRDX1	514	0			c.C564T						.						205.0	212.0	210.0					1																	45977037		2203	4300	6503	SO:0001819	synonymous_variant	5052	exon6			CTTTTGGACATCA	BC021683	CCDS522.1	1p34.1	2008-02-05			ENSG00000117450	ENSG00000117450			9352	protein-coding gene	gene with protein product		176763		PAGA		8496166	Standard	NM_181697		Approved	NKEFA	uc021omw.1	Q06830	OTTHUMG00000007738	ENST00000262746.1:c.564C>T	1.37:g.45977037G>A		126.0	1.0		105.0	43.0	NM_181696	B5BU26|D3DPZ8|P35703|Q2V576|Q5T154|Q5T155	Silent	SNP	ENST00000262746.1	37	CCDS522.1																																																																																			.		0.483	PRDX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020845.1	NM_181697	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	69104677	69104677	+	Silent	SNP	G	G	A	rs138983574	byFrequency	TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr8:69104677G>A	ENST00000288368.4	+	37	4798	c.4521G>A	c.(4519-4521)ggG>ggA	p.G1507G		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1507					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GTGCTTCTGGGGTTGGACTGC	0.572													G|||	3	0.000599042	0.0	0.0	5008	,	,		14159	0.0		0.002	False		,,,				2504	0.001				p.G1507G		.											.	PREX2	390	0			c.G4521A						.	G		0,4406		0,0,2203	76.0	62.0	67.0		4521	-9.8	0.1	8	dbSNP_134	67	10,8590	7.7+/-29.5	0,10,4290	no	coding-synonymous	PREX2	NM_024870.2		0,10,6493	AA,AG,GG		0.1163,0.0,0.0769		1507/1607	69104677	10,12996	2203	4300	6503	SO:0001819	synonymous_variant	80243	exon37			TTCTGGGGTTGGA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4521G>A	8.37:g.69104677G>A		88.0	0.0		79.0	21.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	37	CCDS6201.1																																																																																			G|0.999;A|0.001		0.572	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PTPRQ	374462	ucsc.edu;bcgsc.ca	37	12	81004255	81004255	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr12:81004255C>T	ENST00000266688.5	+	33	4757	c.4757C>T	c.(4756-4758)tCa>tTa	p.S1586L				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1632	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TTCATCAAGTCAAATGAAGAA	0.289																																					p.S1418L		.											.	.	.	0			c.C4253T						.						37.0	30.0	32.0					12																	81004255		691	1580	2271	SO:0001583	missense	374462	exon25			TCAAGTCAAATGA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4757C>T	12.37:g.81004255C>T	ENSP00000266688:p.Ser1586Leu	34.0	0.0		41.0	4.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.03|15.03	2.712579|2.712579	0.48517|0.48517	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722|ENST00000266688	.|T	.|0.59364	.|0.27	5.9|5.9	4.96|4.96	0.65561|0.65561	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	.|T	.|0.41627	.|0.1167	.|.	.|.	.|.	0.22112|0.22112	N|N	0.999356|0.999356	.|B	.|0.15473	.|0.013	.|B	.|0.14578	.|0.011	.|T	.|0.10613	.|-1.0622	.|8	.|0.26408	.|T	.|0.33	.|.	9.3091|9.3091	0.37893|0.37893	0.1455:0.783:0.0:0.0715|0.1455:0.783:0.0:0.0715	.|.	.|1632	.|Q9UMZ3	.|PTPRQ_HUMAN	X|L	1287|1586	.|ENSP00000266688:S1586L	.|ENSP00000266688:S1586L	Q|S	+|+	1|2	0|0	PTPRQ|PTPRQ	79528386|79528386	1.000000|1.000000	0.71417|0.71417	0.861000|0.861000	0.33841|0.33841	0.968000|0.968000	0.65278|0.65278	2.136000|2.136000	0.42121|0.42121	2.808000|2.808000	0.96608|0.96608	0.650000|0.650000	0.86243|0.86243	CAA|TCA	.		0.289	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
PYGM	5837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64520562	64520562	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:64520562C>A	ENST00000164139.3	-	12	1899	c.1501G>T	c.(1501-1503)Gca>Tca	p.A501S	PYGM_ENST00000462303.1_5'Flank|PYGM_ENST00000377432.3_Missense_Mutation_p.A413S	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	501					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATGACCTCTGCCAGCCCGGGG	0.567																																					p.A501S		.											.	PYGM	92	0			c.G1501T						.						195.0	222.0	213.0					11																	64520562		2201	4297	6498	SO:0001583	missense	5837	exon12			CCTCTGCCAGCCC		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1501G>T	11.37:g.64520562C>A	ENSP00000164139:p.Ala501Ser	195.0	0.0		134.0	50.0	NM_005609	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	37	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.015598	0.35511	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.92911	-3.13;-3.13	5.82	5.82	0.92795	.	0.000000	0.56097	D	0.000028	D	0.87071	0.6086	N	0.11064	0.09	0.80722	D	1	B;B	0.17465	0.009;0.022	B;B	0.40038	0.105;0.317	T	0.79262	-0.1876	10	0.05833	T	0.94	-12.0263	17.579	0.87960	0.0:1.0:0.0:0.0	.	413;501	A6NDY6;P11217	.;PYGM_HUMAN	S	413;501;482	ENSP00000366650:A413S;ENSP00000164139:A501S	ENSP00000164139:A501S	A	-	1	0	PYGM	64277138	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.748000	0.85085	2.756000	0.94617	0.561000	0.74099	GCA	.		0.567	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
RABEP1	9135	ucsc.edu;bcgsc.ca	37	17	5235401	5235401	+	Silent	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr17:5235401A>G	ENST00000546142.2	+	3	508	c.321A>G	c.(319-321)aaA>aaG	p.K107K	RABEP1_ENST00000570487.1_3'UTR|RABEP1_ENST00000537505.1_Silent_p.K64K|RABEP1_ENST00000262477.6_Silent_p.K107K|RABEP1_ENST00000341923.6_Silent_p.K107K|RABEP1_ENST00000408982.2_Silent_p.K107K			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	107					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						ATGAAGTGAAAAGACAGTGGA	0.413																																					p.K107K		.											.	RABEP1	659	0			c.A321G						.						104.0	100.0	101.0					17																	5235401		1907	4121	6028	SO:0001819	synonymous_variant	9135	exon3			AGTGAAAAGACAG	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.321A>G	17.37:g.5235401A>G		55.0	0.0		33.0	4.0	NM_004703	B2RAG7|O95369|Q8IVX3	Silent	SNP	ENST00000546142.2	37	CCDS45592.1																																																																																			.		0.413	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439349.1	NM_004703	
RFX5	5993	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	151314816	151314816	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:151314816C>A	ENST00000290524.4	-	11	1875	c.1697G>T	c.(1696-1698)aGt>aTt	p.S566I	RFX5_ENST00000368870.2_Missense_Mutation_p.S566I|RFX5_ENST00000452671.2_Missense_Mutation_p.S566I|RFX5_ENST00000478564.1_5'Flank|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000452513.2_Missense_Mutation_p.S526I	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	566					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTTGATGACACTCACTTTTGA	0.498																																					p.S566I		.											.	RFX5	91	0			c.G1697T						.						135.0	128.0	130.0					1																	151314816		2203	4300	6503	SO:0001583	missense	5993	exon11			ATGACACTCACTT		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1697G>T	1.37:g.151314816C>A	ENSP00000290524:p.Ser566Ile	465.0	0.0		489.0	33.0	NM_000449	B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	ENST00000290524.4	37	CCDS994.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343206	0.61073	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513;ENST00000392746	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	5.15	5.15	0.70609	.	0.147419	0.48767	D	0.000171	T	0.53642	0.1809	M	0.64997	1.995	0.42570	D	0.993179	D;D	0.71674	0.995;0.998	D;D	0.78314	0.986;0.991	T	0.56481	-0.7972	10	0.87932	D	0	-11.928	13.999	0.64421	0.0:1.0:0.0:0.0	.	526;566	B7Z848;P48382	.;RFX5_HUMAN	I	566;566;566;526;566	ENSP00000290524:S566I;ENSP00000357864:S566I;ENSP00000389130:S566I;ENSP00000398388:S526I;ENSP00000376502:S566I	ENSP00000290524:S566I	S	-	2	0	RFX5	149581440	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	3.540000	0.53611	2.689000	0.91719	0.591000	0.81541	AGT	.		0.498	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
RCSD1	92241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167663459	167663459	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr1:167663459T>A	ENST00000367854.3	+	5	725	c.394T>A	c.(394-396)Tct>Act	p.S132T	RCSD1_ENST00000537350.1_Missense_Mutation_p.S102T	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	132					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					TGGTGTGCGATCTAGGCCCAG	0.582																																					p.S132T		.											.	RCSD1	517	0			c.T394A						.						67.0	63.0	65.0					1																	167663459		2203	4300	6503	SO:0001583	missense	92241	exon5			GTGCGATCTAGGC	BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.394T>A	1.37:g.167663459T>A	ENSP00000356828:p.Ser132Thr	102.0	0.0		161.0	47.0	NM_052862	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	ENST00000367854.3	37	CCDS1263.1	.	.	.	.	.	.	.	.	.	.	T	11.95	1.790947	0.31685	.	.	ENSG00000198771	ENST00000367854;ENST00000361496;ENST00000537350	T;T	0.54675	0.61;0.56	5.18	0.256	0.15567	.	0.320614	0.33092	N	0.005294	T	0.33411	0.0862	L	0.40543	1.245	0.23923	N	0.99646	P;D	0.56521	0.89;0.976	B;P	0.50049	0.318;0.629	T	0.28427	-1.0044	9	0.56958	D	0.05	-1.5821	10.6741	0.45776	0.0:0.4197:0.0:0.5803	.	102;132	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	T	132;108;102	ENSP00000356828:S132T;ENSP00000439409:S102T	ENSP00000355291:S108T	S	+	1	0	RCSD1	165930083	0.001000	0.12720	0.000000	0.03702	0.100000	0.18952	-0.044000	0.12023	-0.137000	0.11455	-0.256000	0.11100	TCT	.		0.582	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862	
RGMB	285704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	98115463	98115463	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:98115463C>G	ENST00000513185.1	+	2	752	c.316C>G	c.(316-318)Cat>Gat	p.H106D	RGMB_ENST00000308234.7_Missense_Mutation_p.H147D|RGMB_ENST00000504776.1_3'UTR			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	106					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		CCTGGTATACCATTCTGCCGT	0.542																																					p.H147D		.											.	.	.	0			c.C439G						.						65.0	67.0	66.0					5																	98115463		1976	4162	6138	SO:0001583	missense	285704	exon4			GTATACCATTCTG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.316C>G	5.37:g.98115463C>G	ENSP00000423256:p.His106Asp	94.0	0.0		86.0	50.0	NM_001012761	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		.	.	.	.	.	.	.	.	.	.	C	27.4	4.827997	0.90955	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.97906	-4.6;-4.6	5.4	5.4	0.78164	Repulsive guidance molecule, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98848	0.9611	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99679	1.0998	10	0.72032	D	0.01	-18.147	19.5247	0.95199	0.0:1.0:0.0:0.0	.	106	Q6NW40	RGMB_HUMAN	D	147;106	ENSP00000308219:H147D;ENSP00000423256:H106D	ENSP00000308219:H147D	H	+	1	0	RGMB	98143363	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.445000	0.80570	2.689000	0.91719	0.563000	0.77884	CAT	.		0.542	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
RGMB	285704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	98129453	98129453	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:98129453T>A	ENST00000513185.1	+	3	1746	c.1310T>A	c.(1309-1311)tTg>tAg	p.L437*	RGMB_ENST00000308234.7_Nonsense_Mutation_p.L478*			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	437					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		ATCGTGTTTTTGTAGGGGTTG	0.363																																					p.L478X		.											.	.	.	0			c.T1433A						.						134.0	125.0	128.0					5																	98129453		1857	4088	5945	SO:0001587	stop_gained	285704	exon5			TGTTTTTGTAGGG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.1310T>A	5.37:g.98129453T>A	ENSP00000423256:p.Leu437*	204.0	0.0		247.0	135.0	NM_001012761	D6R9A0|Q8NC92	Nonsense_Mutation	SNP	ENST00000513185.1	37		.	.	.	.	.	.	.	.	.	.	T	38	6.881023	0.97908	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	.	.	.	5.62	3.05	0.35203	.	0.307281	0.27375	N	0.019656	.	.	.	.	.	.	0.34302	D	0.684425	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.6986	0.34312	0.1274:0.0:0.1335:0.7391	.	.	.	.	X	478;437	.	ENSP00000308219:L478X	L	+	2	0	RGMB	98157353	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	3.650000	0.54424	0.937000	0.37394	0.533000	0.62120	TTG	.		0.363	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
RGS9	8787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	63198195	63198195	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr17:63198195A>T	ENST00000262406.9	+	14	1128	c.1061A>T	c.(1060-1062)tAc>tTc	p.Y354F	RGS9_ENST00000449996.3_Missense_Mutation_p.Y351F|RGS9_ENST00000443584.3_Missense_Mutation_p.Y351F	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	354	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						GAGGAGATTTACAAGTGAGCA	0.517																																					p.Y354F		.											.	RGS9	94	0			c.A1061T						.						74.0	75.0	74.0					17																	63198195		1962	4158	6120	SO:0001583	missense	8787	exon14			AGATTTACAAGTG	AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1061A>T	17.37:g.63198195A>T	ENSP00000262406:p.Tyr354Phe	97.0	0.0		85.0	23.0	NM_003835	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.533611	0.45073	.	.	ENSG00000108370	ENST00000262406;ENST00000449996;ENST00000443584	T;T	0.02812	4.15;4.15	5.81	4.72	0.59763	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.184175	0.49916	D	0.000136	T	0.05181	0.0138	L	0.46819	1.47	0.58432	D	0.999998	B;B;B	0.33171	0.4;0.012;0.01	B;B;B	0.39660	0.306;0.033;0.019	T	0.45644	-0.9247	10	0.36615	T	0.2	.	13.2064	0.59798	0.867:0.1329:0.0:0.0	.	354;354;351	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	F	354;351;354	ENSP00000262406:Y354F;ENSP00000396329:Y351F	ENSP00000262406:Y354F	Y	+	2	0	RGS9	60628657	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.219000	0.78000	1.005000	0.39183	0.533000	0.62120	TAC	.		0.517	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1	NM_003835	
RNASET2	8635	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	167366035	167366035	+	Splice_Site	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:167366035C>T	ENST00000508775.1	-	2	607	c.88G>A	c.(88-90)Gac>Aac	p.D30N	RNASET2_ENST00000476238.2_Splice_Site_p.D30N|RNASET2_ENST00000366855.6_5'UTR|RP11-514O12.4_ENST00000507747.1_Splice_Site_p.V10V|RNASET2_ENST00000496851.2_5'Flank	NM_003730.4	NP_003721.2	O00584	RNT2_HUMAN	ribonuclease T2	30					RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	ribonuclease activity (GO:0004540)|ribonuclease T2 activity (GO:0033897)|RNA binding (GO:0003723)			large_intestine(4)|lung(4)	8		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)		TCATGGTTGTCACTGTTAAAA	0.423																																					p.D30N		.											.	RNASET2	90	0			c.G88A						.						97.0	89.0	92.0					6																	167366035		2203	4300	6503	SO:0001630	splice_region_variant	8635	exon2			GGTTGTCACTGTT	AJ419866	CCDS5295.1	6q27	2014-05-20			ENSG00000026297	ENSG00000026297			21686	protein-coding gene	gene with protein product		612944				9192857	Standard	NM_003730		Approved	RNASE6PL, FLJ10907, bA514O12.3	uc003qve.3	O00584	OTTHUMG00000016009	ENST00000508775.1:c.87-1G>A	6.37:g.167366035C>T		265.0	0.0		231.0	27.0	NM_003730	B2RDA7|E1P5C3|Q5T8Q0|Q8TCU2|Q9BZ46|Q9BZ47	Missense_Mutation	SNP	ENST00000508775.1	37	CCDS5295.1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.116263	0.37339	.	.	ENSG00000026297	ENST00000508775;ENST00000428859;ENST00000476238;ENST00000478180;ENST00000310843;ENST00000425007	T;T;T	0.64085	-0.08;-0.08;-0.07	4.35	2.53	0.30540	.	0.863021	0.10121	N	0.713457	T	0.11324	0.0276	N	0.08118	0	0.24296	N	0.995147	B	0.33694	0.421	B	0.26864	0.074	T	0.30060	-0.9991	10	0.05525	T	0.97	-8.9063	5.7466	0.18124	0.0:0.6945:0.1981:0.1074	.	30	O00584	RNT2_HUMAN	N	30	ENSP00000426455:D30N;ENSP00000422846:D30N;ENSP00000426059:D30N	ENSP00000028008:D30N	D	-	1	0	RNASET2	167286025	0.118000	0.22208	0.541000	0.28102	0.336000	0.28762	0.563000	0.23547	0.444000	0.26612	0.655000	0.94253	GAC	.		0.423	RNASET2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043089.2	NM_003730	Missense_Mutation
RNF123	63891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	49738946	49738946	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:49738946G>T	ENST00000327697.6	+	16	1444	c.1300G>T	c.(1300-1302)Gtc>Ttc	p.V434F	RNF123_ENST00000432042.1_Missense_Mutation_p.V288F	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	434					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.V434I(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CCGCTCCGTCGTCTTCTTTTA	0.632											OREG0015570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V434F		.											.	RNF123	584	1	Substitution - Missense(1)	large_intestine(1)	c.G1300T						.						52.0	56.0	54.0					3																	49738946		2203	4300	6503	SO:0001583	missense	63891	exon16			TCCGTCGTCTTCT	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1300G>T	3.37:g.49738946G>T	ENSP00000328287:p.Val434Phe	126.0	0.0	964	101.0	53.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	9.384	1.073650	0.20147	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.75938	-0.69;-0.98	5.71	4.84	0.62591	.	0.063441	0.64402	D	0.000009	T	0.59321	0.2185	N	0.24115	0.695	0.80722	D	1	P;P	0.46656	0.882;0.675	B;B	0.41691	0.364;0.364	T	0.57242	-0.7845	10	0.10111	T	0.7	-33.9587	13.5769	0.61879	0.0741:0.0:0.9259:0.0	.	288;434	C9J266;Q5XPI4	.;RN123_HUMAN	F	434;434;288	ENSP00000328287:V434F;ENSP00000392443:V288F	ENSP00000328287:V434F	V	+	1	0	RNF123	49713950	1.000000	0.71417	0.865000	0.33974	0.367000	0.29736	7.329000	0.79170	1.423000	0.47198	0.561000	0.74099	GTC	.		0.632	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
SAV1	60485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	51107527	51107527	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr14:51107527A>T	ENST00000324679.4	-	4	1254	c.891T>A	c.(889-891)aaT>aaA	p.N297K	RN7SL452P_ENST00000482923.2_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	297					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					TATGATATGGATTTGCAGGTA	0.443																																					p.N297K		.											.	SAV1	658	0			c.T891A						.						199.0	186.0	190.0					14																	51107527		2203	4300	6503	SO:0001583	missense	60485	exon4			ATATGGATTTGCA	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.891T>A	14.37:g.51107527A>T	ENSP00000324729:p.Asn297Lys	333.0	0.0		258.0	84.0	NM_021818	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Missense_Mutation	SNP	ENST00000324679.4	37	CCDS9701.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.469845	0.84533	.	.	ENSG00000151748	ENST00000555720;ENST00000324679;ENST00000535862	T;T	0.50813	0.78;0.73	5.79	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.63850	0.2546	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.65129	-0.6243	10	0.72032	D	0.01	-18.0655	8.7019	0.34332	0.8365:0.0:0.1635:0.0	.	297	Q9H4B6	SAV1_HUMAN	K	229;297;264	ENSP00000451492:N229K;ENSP00000324729:N297K	ENSP00000324729:N297K	N	-	3	2	SAV1	50177277	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.320000	0.43797	0.974000	0.38366	0.533000	0.62120	AAT	.		0.443	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
SCN3B	55800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123516374	123516374	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:123516374G>A	ENST00000392770.2	-	2	942	c.140C>T	c.(139-141)tCc>tTc	p.S47F	SCN3B_ENST00000530277.1_Missense_Mutation_p.S47F|SCN3B_ENST00000299333.3_Missense_Mutation_p.S47F	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	47	Ig-like C2-type.				atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTCATGCAGGAGATGCAGCG	0.577																																					p.S47F		.											.	SCN3B	156	0			c.C140T						.						126.0	121.0	123.0					11																	123516374		2202	4299	6501	SO:0001583	missense	55800	exon2			ATGCAGGAGATGC	AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.140C>T	11.37:g.123516374G>A	ENSP00000376523:p.Ser47Phe	122.0	0.0		105.0	42.0	NM_018400	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	ENST00000392770.2	37	CCDS8442.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.041137	0.93685	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277;ENST00000527836;ENST00000528267	D;D;D;D;T	0.94092	-3.35;-3.35;-3.35;-3.35;-0.03	5.96	5.96	0.96718	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.095583	0.85682	D	0.000000	D	0.92906	0.7743	L	0.31526	0.94	0.58432	D	0.999997	D	0.55385	0.971	P	0.53224	0.721	D	0.91496	0.5215	10	0.33940	T	0.23	-4.9537	20.4182	0.99029	0.0:0.0:1.0:0.0	.	47	Q9NY72	SCN3B_HUMAN	F	47	ENSP00000376523:S47F;ENSP00000299333:S47F;ENSP00000432785:S47F;ENSP00000435554:S47F;ENSP00000434363:S47F	ENSP00000299333:S47F	S	-	2	0	SCN3B	123021584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.258000	0.72487	2.820000	0.97059	0.609000	0.83330	TCC	.		0.577	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387412.1	NM_018400	
SCYL2	55681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	100728028	100728028	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr12:100728028A>G	ENST00000360820.2	+	14	2283	c.1846A>G	c.(1846-1848)Atg>Gtg	p.M616V		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	616					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						ACTTCATATAATGCAAGAACA	0.333																																					p.M616V		.											.	SCYL2	336	0			c.A1846G						.						111.0	106.0	108.0					12																	100728028		2203	4297	6500	SO:0001583	missense	55681	exon14			CATATAATGCAAG	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1846A>G	12.37:g.100728028A>G	ENSP00000354061:p.Met616Val	55.0	0.0		36.0	20.0	NM_017988	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.362435	0.41902	.	.	ENSG00000136021	ENST00000549687;ENST00000360820	T;T	0.29917	1.94;1.55	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	L	0.55481	1.735	0.80722	D	1	B	0.22003	0.063	B	0.24006	0.05	T	0.06041	-1.0849	10	0.28530	T	0.3	.	15.6868	0.77418	1.0:0.0:0.0:0.0	.	616	Q6P3W7	SCYL2_HUMAN	V	616	ENSP00000448366:M616V;ENSP00000354061:M616V	ENSP00000354061:M616V	M	+	1	0	SCYL2	99252159	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.109000	0.77062	2.153000	0.67306	0.477000	0.44152	ATG	.		0.333	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
SEPT2	4735	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242289532	242289532	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:242289532G>A	ENST00000391973.2	+	12	1557	c.1029G>A	c.(1027-1029)atG>atA	p.M343I	SEPT2_ENST00000401990.1_Missense_Mutation_p.M353I|SEPT2_ENST00000391971.2_Missense_Mutation_p.M343I|SEPT2_ENST00000407971.1_Missense_Mutation_p.M303I|SEPT2_ENST00000360051.3_Missense_Mutation_p.M343I|SEPT2_ENST00000402092.2_Missense_Mutation_p.M343I|AC005104.3_ENST00000414896.1_RNA	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	343					cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)			central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		AGGCGCAGATGCAGATGCAGA	0.522																																					p.M343I		.											.	SEPT2	68	0			c.G1029A						.						62.0	57.0	59.0					2																	242289532		2203	4300	6503	SO:0001583	missense	4735	exon13			GCAGATGCAGATG	D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.1029G>A	2.37:g.242289532G>A	ENSP00000375834:p.Met343Ile	386.0	1.0		288.0	60.0	NM_001008491	B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Missense_Mutation	SNP	ENST00000391973.2	37	CCDS2548.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.9|25.9	4.688309|4.688309	0.88639|0.88639	.|.	.|.	ENSG00000168385|ENSG00000168385	ENST00000451310|ENST00000391973;ENST00000360051;ENST00000391971;ENST00000401990;ENST00000407971;ENST00000402092;ENST00000391972;ENST00000421717	.|T;T;T;T;T;T;T	.|0.54675	.|0.56;0.56;0.56;0.56;0.58;0.56;0.88	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71239|0.71239	0.3316|0.3316	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|D;P;P	.|0.53745	.|0.962;0.525;0.525	.|D;P;B	.|0.66716	.|0.946;0.48;0.38	T|T	0.68637|0.68637	-0.5356|-0.5356	5|10	.|0.59425	.|D	.|0.04	.|.	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|378;303;343	.|Q15019-2;B5MCX3;Q15019	.|.;.;SEPT2_HUMAN	T|I	11|343;343;343;353;303;343;378;170	.|ENSP00000375834:M343I;ENSP00000353157:M343I;ENSP00000375832:M343I;ENSP00000385109:M353I;ENSP00000384525:M303I;ENSP00000385172:M343I;ENSP00000408296:M170I	.|ENSP00000353157:M343I	A|M	+|+	1|3	0|0	SEPT2|SEPT2	241938205|241938205	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	9.130000|9.130000	0.94437|0.94437	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCA|ATG	.		0.522	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155	
SLC6A20	54716	broad.mit.edu;bcgsc.ca	37	3	45807036	45807036	+	Silent	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:45807036G>A	ENST00000358525.4	-	8	1411	c.1296C>T	c.(1294-1296)gcC>gcT	p.A432A	SLC6A20_ENST00000456124.2_Silent_p.A432A|SLC6A20_ENST00000493980.1_5'UTR|SLC6A20_ENST00000353278.4_Silent_p.A395A	NM_020208.3	NP_064593.1	Q9NP91	S6A20_HUMAN	solute carrier family 6 (proline IMINO transporter), member 20	432					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|glycine transport (GO:0015816)|ion transport (GO:0006811)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|large_intestine(6)|ovary(2)|skin(2)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		GACCTGAGATGGCCTCCTTGG	0.652																																					p.A432A		.											.	SLC6A20	92	0			c.C1296T						.						47.0	41.0	43.0					3																	45807036		2203	4300	6503	SO:0001819	synonymous_variant	54716	exon8			TGAGATGGCCTCC	AF075260	CCDS2730.1, CCDS43077.1	3p21.6	2013-05-22			ENSG00000163817	ENSG00000163817		"""Solute carriers"""	30927	protein-coding gene	gene with protein product		605616				9932288, 11352561	Standard	NM_022405		Approved	XT3, Xtrp3	uc011bai.2	Q9NP91	OTTHUMG00000133446	ENST00000358525.4:c.1296C>T	3.37:g.45807036G>A		131.0	0.0		88.0	12.0	NM_020208	A1A4F2|O75590|Q8TF10|Q9NPQ2|Q9NQ77	Silent	SNP	ENST00000358525.4	37	CCDS43077.1																																																																																			.		0.652	SLC6A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257318.3	NM_020208	
SLC9A6	10479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135080330	135080330	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chrX:135080330T>A	ENST00000370698.3	+	3	528	c.493T>A	c.(493-495)Tat>Aat	p.Y165N	SLC9A6_ENST00000370701.1_Missense_Mutation_p.Y145N|SLC9A6_ENST00000370695.4_Missense_Mutation_p.Y197N	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	165					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TTATGCAGGTTATAGCCTGAA	0.313																																					p.Y197N		.											.	SLC9A6	131	0			c.T589A						.						67.0	69.0	68.0					X																	135080330		2203	4297	6500	SO:0001583	missense	10479	exon3			GCAGGTTATAGCC	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.493T>A	X.37:g.135080330T>A	ENSP00000359732:p.Tyr165Asn	576.0	0.0		436.0	164.0	NM_001042537	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.445438	0.63178	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.17528	2.27;2.27;2.27	4.77	4.77	0.60923	Cation/H+ exchanger (1);	0.122953	0.64402	D	0.000019	T	0.55000	0.1893	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.79784	0.993;0.988;0.993	T	0.70561	-0.4838	10	0.87932	D	0	.	12.8214	0.57696	0.0:0.0:0.0:1.0	.	145;197;165	B4DU30;Q92581-2;Q92581	.;.;SL9A6_HUMAN	N	145;165;197	ENSP00000359735:Y145N;ENSP00000359732:Y165N;ENSP00000359729:Y197N	ENSP00000359729:Y197N	Y	+	1	0	SLC9A6	134907996	1.000000	0.71417	0.988000	0.46212	0.976000	0.68499	7.608000	0.82898	1.687000	0.51057	0.345000	0.21793	TAT	.		0.313	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
SRRM5	100170229	ucsc.edu;bcgsc.ca	37	19	44116676	44116676	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:44116676T>C	ENST00000607544.1	+	3	725	c.403T>C	c.(403-405)Tca>Cca	p.S135P	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Missense_Mutation_p.S135P|SRRM5_ENST00000526798.1_Missense_Mutation_p.S150P			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	135	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						CTCCAAGAGGTCACCCAGCAG	0.622																																					p.S135P		.											.	.	.	0			c.T403C						.						38.0	51.0	47.0					19																	44116676		692	1591	2283	SO:0001583	missense	100170229	exon1			AAGAGGTCACCCA	AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.403T>C	19.37:g.44116676T>C	ENSP00000476253:p.Ser135Pro	42.0	0.0		38.0	5.0	NM_001145641	B4DNF0	Missense_Mutation	SNP	ENST00000607544.1	37	CCDS46095.1	.	.	.	.	.	.	.	.	.	.	T	19.17	3.776681	0.70107	.	.	ENSG00000226763	ENST00000526798;ENST00000417606	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	T	0.52403	0.1732	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.50882	-0.8775	8	0.40728	T	0.16	.	7.2305	0.26040	0.1973:0.0:0.0:0.8027	.	135	B3KS81	SRRM5_HUMAN	P	150;135	.	ENSP00000414512:S135P	S	+	1	0	SRRM5	48808516	0.993000	0.37304	0.992000	0.48379	0.963000	0.63663	0.379000	0.20585	2.126000	0.65437	0.533000	0.62120	TCA	.		0.622	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000384398.2	NM_001145641	
TBX4	9496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	59560737	59560737	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr17:59560737G>A	ENST00000240335.1	+	8	1543	c.1498G>A	c.(1498-1500)Ggg>Agg	p.G500R	TBX4_ENST00000393853.4_Missense_Mutation_p.G501R	NM_018488.2	NP_060958.2	P57082	TBX4_HUMAN	T-box 4	500					angiogenesis (GO:0001525)|embryonic limb morphogenesis (GO:0030326)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(15)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						CCTCCCCCAAGGGTGTGAGAG	0.552																																					p.G500R		.											.	TBX4	227	0			c.G1498A						.						63.0	64.0	63.0					17																	59560737		2203	4300	6503	SO:0001583	missense	9496	exon8			CCCCAAGGGTGTG	AF188703	CCDS11629.1	17q21-q22	2005-10-11				ENSG00000121075		"""T-boxes"""	11603	protein-coding gene	gene with protein product		601719				10945475	Standard	NM_018488		Approved		uc002izi.3	P57082		ENST00000240335.1:c.1498G>A	17.37:g.59560737G>A	ENSP00000240335:p.Gly500Arg	120.0	0.0		82.0	29.0	NM_018488	A5PKU7|B2RMT1|B7ZLV3	Missense_Mutation	SNP	ENST00000240335.1	37	CCDS11629.1	.	.	.	.	.	.	.	.	.	.	G	4.713	0.132535	0.09032	.	.	ENSG00000121075	ENST00000393853;ENST00000240335	D;D	0.85411	-1.98;-1.98	5.14	1.96	0.26148	.	1.172590	0.06049	N	0.656267	T	0.75162	0.3812	N	0.22421	0.69	0.09310	N	1	B;B	0.28026	0.198;0.01	B;B	0.30251	0.113;0.004	T	0.59705	-0.7404	9	.	.	.	.	5.727	0.18018	0.2362:0.1402:0.6236:0.0	.	501;500	A5PKU7;P57082	.;TBX4_HUMAN	R	501;500	ENSP00000377435:G501R;ENSP00000240335:G500R	.	G	+	1	0	TBX4	56915519	0.997000	0.39634	0.014000	0.15608	0.036000	0.12997	2.447000	0.44917	0.165000	0.19558	0.655000	0.94253	GGG	.		0.552	TBX4-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449649.1	NM_018488	
TFPI2	7980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	93516721	93516721	+	Silent	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:93516721T>C	ENST00000222543.5	-	4	795	c.483A>G	c.(481-483)ccA>ccG	p.P161P	GNGT1_ENST00000455502.1_Intron|TFPI2_ENST00000545378.1_Intron	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	161	BPTI/Kunitz inhibitor 3. {ECO:0000255|PROSITE-ProRule:PRU00031}.				blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CCTCATCTTTTGGACTGTAGC	0.348																																					p.P161P		.											.	TFPI2	515	0			c.A483G						.						64.0	64.0	64.0					7																	93516721		2203	4300	6503	SO:0001819	synonymous_variant	7980	exon4			ATCTTTTGGACTG	L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.483A>G	7.37:g.93516721T>C		102.0	0.0		118.0	70.0	NM_006528	Q66ME8|Q8NAK6|Q9UC86	Silent	SNP	ENST00000222543.5	37	CCDS5632.1																																																																																			.		0.348	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254720.2	NM_006528	
TGFB3	7043	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	76437499	76437499	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr14:76437499C>G	ENST00000238682.3	-	3	913	c.616G>C	c.(616-618)Gac>Cac	p.D206H	RP11-270M14.5_ENST00000553732.1_lincRNA|TGFB3_ENST00000556285.1_Missense_Mutation_p.D206H	NM_003239.2	NP_003230.1	P10600	TGFB3_HUMAN	transforming growth factor, beta 3	206					activation of MAPK activity (GO:0000187)|aging (GO:0007568)|blood coagulation (GO:0007596)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|detection of hypoxia (GO:0070483)|digestive tract development (GO:0048565)|embryonic neurocranium morphogenesis (GO:0048702)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|mammary gland development (GO:0030879)|menstrual cycle phase (GO:0022601)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|odontogenesis (GO:0042476)|ossification involved in bone remodeling (GO:0043932)|palate development (GO:0060021)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell division (GO:0051781)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|salivary gland morphogenesis (GO:0007435)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|T-tubule (GO:0030315)	identical protein binding (GO:0042802)|transforming growth factor beta binding (GO:0050431)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			NS(1)|breast(1)|endometrium(4)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.0169)		CGCACAGTGTCAGTGACATCA	0.532																																					p.D206H		.											.	TGFB3	524	0			c.G616C						.						111.0	96.0	101.0					14																	76437499		2203	4300	6503	SO:0001583	missense	7043	exon3			CAGTGTCAGTGAC		CCDS9846.1	14q24	2014-09-17				ENSG00000119699		"""Endogenous ligands"""	11769	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-3"""	190230	"""arrhythmogenic right ventricular dysplasia 1"""	ARVD1, ARVD		16549496, 15639475	Standard	XM_005268028		Approved		uc001xsc.2	P10600		ENST00000238682.3:c.616G>C	14.37:g.76437499C>G	ENSP00000238682:p.Asp206His	62.0	0.0		42.0	10.0	NM_003239	Q8WV88	Missense_Mutation	SNP	ENST00000238682.3	37	CCDS9846.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245418	0.80024	.	.	ENSG00000119699	ENST00000238682;ENST00000556285	T;T	0.65916	-0.18;-0.18	5.55	5.55	0.83447	Transforming growth factor-beta, N-terminal (1);	0.100619	0.64402	D	0.000002	T	0.67002	0.2847	L	0.48642	1.525	0.50813	D	0.999899	P	0.45531	0.86	P	0.53266	0.722	T	0.68526	-0.5385	10	0.62326	D	0.03	-9.7812	12.8047	0.57607	0.0:0.9252:0.0:0.0748	.	206	P10600	TGFB3_HUMAN	H	206	ENSP00000238682:D206H;ENSP00000451110:D206H	ENSP00000238682:D206H	D	-	1	0	TGFB3	75507252	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.782000	0.68973	2.627000	0.88993	0.561000	0.74099	GAC	.		0.532	TGFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413685.1	NM_003239	
TINAG	27283	ucsc.edu;bcgsc.ca	37	6	54254594	54254594	+	Silent	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:54254594T>C	ENST00000259782.4	+	11	1398	c.1302T>C	c.(1300-1302)gcT>gcC	p.A434A		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	434					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TGCAGATTGCTGCCAATTCCT	0.373																																					p.A434A		.											.	TINAG	93	0			c.T1302C						.						112.0	110.0	111.0					6																	54254594		2203	4300	6503	SO:0001819	synonymous_variant	27283	exon11			GATTGCTGCCAAT	AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1302T>C	6.37:g.54254594T>C		51.0	0.0		46.0	4.0	NM_014464	Q5T467|Q9UJW1|Q9ULZ4	Silent	SNP	ENST00000259782.4	37	CCDS4955.1																																																																																			.		0.373	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
TMEM108	66000	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	133099005	133099005	+	Silent	SNP	C	C	T	rs368132206		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr3:133099005C>T	ENST00000321871.6	+	4	660	c.450C>T	c.(448-450)acC>acT	p.T150T	TMEM108_ENST00000515826.1_Silent_p.T150T|TMEM108_ENST00000393130.3_Silent_p.T150T|TMEM108_ENST00000508711.1_Intron	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	150	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CGGGGGCCACCAGCCGCCCCA	0.701																																					p.T150T		.											.	TMEM108	94	0			c.C450T						.		,	0,4384		0,0,2192	13.0	17.0	16.0		450,450	3.6	1.0	3		16	1,8573		0,1,4286	no	coding-synonymous,coding-synonymous	TMEM108	NM_001136469.1,NM_023943.2	,	0,1,6478	TT,TC,CC		0.0117,0.0,0.0077	,	150/576,150/576	133099005	1,12957	2192	4287	6479	SO:0001819	synonymous_variant	66000	exon4			GGCCACCAGCCGC	AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.450C>T	3.37:g.133099005C>T		41.0	0.0		52.0	24.0	NM_023943	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Silent	SNP	ENST00000321871.6	37	CCDS33858.1																																																																																			.		0.701	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
TRERF1	55809	broad.mit.edu;bcgsc.ca	37	6	42196208	42196208	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:42196208C>T	ENST00000372922.4	-	18	4040	c.3478G>A	c.(3478-3480)Gac>Aac	p.D1160N	TRERF1_ENST00000541110.1_Missense_Mutation_p.D1180N|TRERF1_ENST00000340840.2_Missense_Mutation_p.D1089N|TRERF1_ENST00000372917.4_Missense_Mutation_p.D1089N|TRERF1_ENST00000354325.2_Missense_Mutation_p.D1077N	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1160	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TCGAGGATGTCCACATCCTTG	0.577																																					p.D1160N		.											.	TRERF1	230	0			c.G3478A						.						151.0	150.0	150.0					6																	42196208		2203	4300	6503	SO:0001583	missense	55809	exon18			GGATGTCCACATC	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3478G>A	6.37:g.42196208C>T	ENSP00000362013:p.Asp1160Asn	108.0	0.0		85.0	6.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033650	0.93575	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.15256	2.46;2.44;2.53;2.44;2.45	5.55	5.55	0.83447	.	0.093319	0.46145	D	0.000312	T	0.14270	0.0345	N	0.19112	0.55	0.30293	N	0.79023	D;P;P;D;D	0.60575	0.965;0.941;0.941;0.965;0.988	P;P;P;P;P	0.57911	0.786;0.616;0.616;0.786;0.829	T	0.01899	-1.1251	10	0.59425	D	0.04	-20.4001	16.6673	0.85256	0.0:1.0:0.0:0.0	.	1077;1180;1160;916;928	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	N	1180;1089;1160;1089;1077	ENSP00000439689:D1180N;ENSP00000362008:D1089N;ENSP00000362013:D1160N;ENSP00000339438:D1089N;ENSP00000346285:D1077N	ENSP00000339438:D1089N	D	-	1	0	TRERF1	42304186	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.993000	0.63895	2.620000	0.88729	0.563000	0.77884	GAC	.		0.577	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
TRIML2	205860	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	189026083	189026083	+	Silent	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr4:189026083A>G	ENST00000512729.1	-	2	417	c.43T>C	c.(43-45)Tta>Cta	p.L15L	TRIML2_ENST00000536972.1_Silent_p.L65L|TRIML2_ENST00000326754.3_Silent_p.L15L|TRIML2_ENST00000502707.1_5'Flank	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	15					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)	p.L15I(1)		central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TCCTGGAATAACTTCTATAGA	0.378																																					p.L15L		.											TRIML2,brain,glioma,0	TRIML2	90	1	Substitution - Missense(1)	central_nervous_system(1)	c.T43C						.						143.0	137.0	139.0					4																	189026083		2203	4299	6502	SO:0001819	synonymous_variant	205860	exon2			GGAATAACTTCTA	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.43T>C	4.37:g.189026083A>G		216.0	1.0		164.0	45.0	NM_173553	B7Z6J6	Silent	SNP	ENST00000512729.1	37	CCDS3850.1																																																																																			.		0.378	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553	
TSPAN18	90139	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	44931287	44931287	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:44931287T>C	ENST00000520358.2	+	5	510	c.95T>C	c.(94-96)aTc>aCc	p.I32T	TSPAN18_ENST00000340160.3_Missense_Mutation_p.I32T			Q96SJ8	TSN18_HUMAN	tetraspanin 18	32						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						GCCATCGGCATCTGGGTCATG	0.662																																					p.I32T		.											.	TSPAN18	68	0			c.T95C						.						43.0	47.0	46.0					11																	44931287		2203	4299	6502	SO:0001583	missense	90139	exon4			TCGGCATCTGGGT	AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.95T>C	11.37:g.44931287T>C	ENSP00000429993:p.Ile32Thr	70.0	1.0		60.0	27.0	NM_130783	Q6UY44|Q8NBI9	Missense_Mutation	SNP	ENST00000520358.2	37	CCDS7910.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.622956	0.87460	.	.	ENSG00000157570	ENST00000533786;ENST00000533202;ENST00000520358;ENST00000520999;ENST00000340160;ENST00000520837	D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.0	3.87	0.44632	.	0.172056	0.53938	N	0.000055	D	0.87313	0.6146	M	0.78916	2.43	0.80722	D	1	D;D	0.67145	0.996;0.96	D;P	0.63957	0.92;0.765	D	0.87276	0.2289	10	0.87932	D	0	.	10.4579	0.44561	0.0:0.0769:0.0:0.9231	.	32;32	Q8WUV1;Q96SJ8	.;TSN18_HUMAN	T	32;32;32;42;32;42	ENSP00000433592:I32T;ENSP00000434625:I32T;ENSP00000429993:I32T;ENSP00000427942:I42T;ENSP00000339820:I32T;ENSP00000430343:I42T	ENSP00000339820:I32T	I	+	2	0	TSPAN18	44887863	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.268000	0.72552	0.763000	0.33175	0.459000	0.35465	ATC	.		0.662	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376197.3	NM_130783	
TST	7263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	37414432	37414432	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr22:37414432C>A	ENST00000403892.3	-	1	1076	c.342G>T	c.(340-342)tgG>tgT	p.W114C	MPST_ENST00000429360.2_5'Flank|MPST_ENST00000397129.1_5'Flank|TST_ENST00000249042.3_Missense_Mutation_p.W114C|MPST_ENST00000404393.1_5'Flank|MPST_ENST00000404802.3_5'Flank|MPST_ENST00000341116.3_5'Flank|MPST_ENST00000401419.3_5'Flank	NM_001270483.1	NP_001257412.1	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase (rhodanese)	114	Rhodanese 1. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular nitrogen compound metabolic process (GO:0034641)|cyanate catabolic process (GO:0009440)|epithelial cell differentiation (GO:0030855)|rRNA import into mitochondrion (GO:0035928)|rRNA transport (GO:0051029)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|thiosulfate sulfurtransferase activity (GO:0004792)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	7						CACGGAACATCCACCAGACCC	0.622																																					p.W114C		.											.	TST	90	0			c.G342T						.						86.0	68.0	74.0					22																	37414432		2203	4300	6503	SO:0001583	missense	7263	exon2			GAACATCCACCAG	Z73420	CCDS13938.1	22q13.1	2002-02-05			ENSG00000128311	ENSG00000128311	2.8.1.1		12388	protein-coding gene	gene with protein product		180370				1953758	Standard	NM_003312		Approved	RDS	uc003aqh.4	Q16762	OTTHUMG00000150533	ENST00000403892.3:c.342G>T	22.37:g.37414432C>A	ENSP00000385828:p.Trp114Cys	96.0	0.0		96.0	22.0	NM_003312	B3KRM1|Q6IB06	Missense_Mutation	SNP	ENST00000403892.3	37	CCDS13938.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.431273	0.83776	.	.	ENSG00000128311	ENST00000403892;ENST00000249042;ENST00000413912;ENST00000438203	T;T;T	0.51817	0.69;0.69;0.69	5.09	5.09	0.68999	Rhodanese-like (5);	0.000000	0.85682	D	0.000000	D	0.83788	0.5330	H	0.99726	4.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91807	0.5456	10	0.87932	D	0	-3.0902	18.5155	0.90934	0.0:1.0:0.0:0.0	.	114	Q16762	THTR_HUMAN	C	114	ENSP00000385828:W114C;ENSP00000249042:W114C;ENSP00000400764:W114C	ENSP00000249042:W114C	W	-	3	0	TST	35744378	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.801000	0.85960	2.355000	0.79922	0.561000	0.74099	TGG	.		0.622	TST-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318790.1		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179434262	179434262	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr2:179434262G>T	ENST00000591111.1	-	276	71898	c.71674C>A	c.(71674-71676)Cct>Act	p.P23892T	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P16468T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P25533T|TTN_ENST00000342992.6_Missense_Mutation_p.P22965T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P16660T|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P16593T			Q8WZ42	TITIN_HUMAN	titin	23892	Ig-like 120.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTTTATAGGAACAAATAAC	0.388																																					p.P25533T		.											.	TTN	636	0			c.C76597A						.						88.0	78.0	81.0					2																	179434262		1877	4108	5985	SO:0001583	missense	7273	exon326			TTATAGGAACAAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.71674C>A	2.37:g.179434262G>T	ENSP00000465570:p.Pro23892Thr	270.0	0.0		246.0	90.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	17.90	3.502267	0.64298	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.55	5.55	0.83447	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72045	0.3412	L	0.31420	0.93	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.74970	-0.3482	9	0.87932	D	0	.	19.4973	0.95079	0.0:0.0:1.0:0.0	.	16468;16593;16660;23892	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	22965;16468;16660;16593;16466	ENSP00000343764:P22965T;ENSP00000434586:P16468T;ENSP00000340554:P16660T;ENSP00000352154:P16593T	ENSP00000340554:P16660T	P	-	1	0	TTN	179142508	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	9.869000	0.99810	2.608000	0.88229	0.655000	0.94253	CCT	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBR2	23304	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	42619803	42619803	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr6:42619803G>C	ENST00000372899.1	+	24	2866	c.2608G>C	c.(2608-2610)Gat>Cat	p.D870H	UBR2_ENST00000372901.1_Missense_Mutation_p.D870H|UBR2_ENST00000372883.3_Missense_Mutation_p.D374H	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	870					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			AAATAGAGAAGATACAGGTAT	0.353																																					p.D870H		.											.	UBR2	94	0			c.G2608C						.						129.0	142.0	137.0					6																	42619803		2203	4300	6503	SO:0001583	missense	23304	exon24			AGAGAAGATACAG	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2608G>C	6.37:g.42619803G>C	ENSP00000361990:p.Asp870His	234.0	0.0		174.0	13.0	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419643	0.83559	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.49432	0.78;0.78;0.78	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	L	0.61218	1.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.994;0.94	T	0.60865	-0.7178	10	0.51188	T	0.08	-24.4855	19.4613	0.94918	0.0:0.0:1.0:0.0	.	870;870	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	H	870;870;374	ENSP00000361990:D870H;ENSP00000361992:D870H;ENSP00000361974:D374H	ENSP00000361974:D374H	D	+	1	0	UBR2	42727781	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.581000	0.90788	2.677000	0.91161	0.557000	0.71058	GAT	.		0.353	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
USP6NL	9712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	11532861	11532861	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr10:11532861A>T	ENST00000609104.1	-	9	907	c.513T>A	c.(511-513)caT>caA	p.H171Q	USP6NL_ENST00000379237.2_Missense_Mutation_p.H194Q|USP6NL_ENST00000277575.5_Missense_Mutation_p.H188Q	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	171	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						CAGCAAGCACATGGAATAAGG	0.348																																					p.H188Q		.											.	USP6NL	628	0			c.T564A						.						33.0	32.0	32.0					10																	11532861		1801	4049	5850	SO:0001583	missense	9712	exon8			AAGCACATGGAAT	BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.513T>A	10.37:g.11532861A>T	ENSP00000476462:p.His171Gln	203.0	0.0		152.0	64.0	NM_001080491	A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	ENST00000609104.1	37	CCDS53492.1	.	.	.	.	.	.	.	.	.	.	A	19.25	3.791682	0.70452	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.04083	3.71;3.71	5.58	1.91	0.25777	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.11750	0.0286	L	0.48260	1.515	0.58432	D	0.999994	D;P	0.55172	0.97;0.925	P;P	0.62813	0.907;0.804	T	0.00745	-1.1584	10	0.66056	D	0.02	.	9.6228	0.39732	0.7138:0.0:0.2862:0.0	.	171;188	Q92738;Q92738-2	US6NL_HUMAN;.	Q	171;188;171	ENSP00000277575:H188Q;ENSP00000368539:H171Q	ENSP00000277575:H188Q	H	-	3	2	USP6NL	11572867	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.683000	0.25349	0.133000	0.18654	0.533000	0.62120	CAT	.		0.348	USP6NL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046764.3	NM_014688	
UTP15	84135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	72866457	72866457	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr5:72866457G>T	ENST00000296792.4	+	6	849	c.594G>T	c.(592-594)gaG>gaT	p.E198D	UTP15_ENST00000543251.1_Missense_Mutation_p.E8D|UTP15_ENST00000508491.1_Missense_Mutation_p.E179D	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	198					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		GAACGAGTGAGAGTGTTCTCT	0.398																																					p.E198D		.											.	UTP15	90	0			c.G594T						.						158.0	145.0	150.0					5																	72866457		2203	4300	6503	SO:0001583	missense	84135	exon6			GAGTGAGAGTGTT	AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.594G>T	5.37:g.72866457G>T	ENSP00000296792:p.Glu198Asp	227.0	0.0		246.0	67.0	NM_032175	B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Missense_Mutation	SNP	ENST00000296792.4	37	CCDS34186.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.744|7.744	0.701806|0.701806	0.15172|0.15172	.|.	.|.	ENSG00000164338|ENSG00000164338	ENST00000296792;ENST00000543251;ENST00000508491|ENST00000509005	T;T;T|.	0.45276|.	2.14;0.9;2.14|.	5.85|5.85	0.397|0.397	0.16314|0.16314	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.727609|.	0.14378|.	N|.	0.323303|.	T|T	0.23688|0.23688	0.0573|0.0573	L|L	0.31065|0.31065	0.9|0.9	0.09310|0.09310	N|N	0.999999|0.999999	B;B|.	0.10296|.	0.003;0.001|.	B;B|.	0.11329|.	0.006;0.004|.	T|T	0.24548|0.24548	-1.0157|-1.0157	10|5	0.36615|.	T|.	0.2|.	.|.	3.824|3.824	0.08846|0.08846	0.3754:0.0986:0.4256:0.1003|0.3754:0.0986:0.4256:0.1003	.|.	179;198|.	B4DXK8;Q8TED0|.	.;UTP15_HUMAN|.	D|I	198;8;179|225	ENSP00000296792:E198D;ENSP00000440796:E8D;ENSP00000424609:E179D|.	ENSP00000296792:E198D|.	E|R	+|+	3|2	2|0	UTP15|UTP15	72902213|72902213	0.955000|0.955000	0.32602|0.32602	0.119000|0.119000	0.21687|0.21687	0.554000|0.554000	0.35429|0.35429	0.323000|0.323000	0.19593|0.19593	0.105000|0.105000	0.17753|0.17753	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.		0.398	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368965.1	NM_032175	
VWDE	221806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	12414712	12414712	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:12414712C>A	ENST00000275358.3	-	8	1354	c.1166G>T	c.(1165-1167)aGa>aTa	p.R389I		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	389						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GTTTGAGACTCTATCTCCATC	0.418																																					p.R389I		.											.	VWDE	68	0			c.G1166T						.						142.0	123.0	129.0					7																	12414712		692	1591	2283	SO:0001583	missense	221806	exon8			GAGACTCTATCTC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.1166G>T	7.37:g.12414712C>A	ENSP00000275358:p.Arg389Ile	255.0	0.0		232.0	110.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253588	0.59212	.	.	ENSG00000146530	ENST00000275358	D	0.83506	-1.73	4.2	4.2	0.49525	.	.	.	.	.	D	0.85877	0.5799	M	0.72894	2.215	0.22701	N	0.998837	D	0.61697	0.99	P	0.51999	0.687	T	0.78280	-0.2265	9	0.87932	D	0	.	10.4044	0.44248	0.0:0.9092:0.0:0.0908	.	389	Q8N2E2	VWDE_HUMAN	I	389	ENSP00000275358:R389I	ENSP00000275358:R389I	R	-	2	0	VWDE	12381237	0.980000	0.34600	0.132000	0.22025	0.578000	0.36192	3.063000	0.49978	2.172000	0.68678	0.585000	0.79938	AGA	.		0.418	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
WDR83OS	51398	ucsc.edu;bcgsc.ca	37	19	12779996	12779996	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:12779996C>T	ENST00000596731.1	-	2	2054	c.102G>A	c.(100-102)ccG>ccA	p.P34P	WDR83_ENST00000418543.3_Intron|WDR83OS_ENST00000600694.1_5'Flank|WDR83_ENST00000242796.4_5'Flank|MAN2B1_ENST00000456935.2_5'Flank|WDR83OS_ENST00000222190.5_Silent_p.P34P|CTD-2192J16.24_ENST00000597961.1_Silent_p.P32P|MAN2B1_ENST00000221363.4_5'Flank	NM_016145.3	NP_057229.1	Q9Y284	ASTER_HUMAN	WD repeat domain 83 opposite strand	34						integral component of membrane (GO:0016021)											TCATGTAGTCCGGCGTCGGGT	0.622																																					p.P34P		.											.	.	.	0			c.G102A						.						71.0	68.0	69.0					19																	12779996		2203	4300	6503	SO:0001819	synonymous_variant	51398	exon2			GTAGTCCGGCGTC	AF151898	CCDS12274.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000105583	ENSG00000105583			30203	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 56"""	C19orf56		10810093	Standard	NM_016145		Approved	PTD008	uc002mud.2	Q9Y284		ENST00000596731.1:c.102G>A	19.37:g.12779996C>T		81.0	0.0		41.0	4.0	NM_016145	B2R4T8|Q9BVI3	Silent	SNP	ENST00000596731.1	37	CCDS12274.1																																																																																			.		0.622	WDR83OS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462702.1	NM_016145	
XRRA1	143570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	74617459	74617459	+	Silent	SNP	G	G	T	rs369421169		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:74617459G>T	ENST00000340360.6	-	10	1135	c.804C>A	c.(802-804)atC>atA	p.I268I	RP11-147I3.1_ENST00000533875.1_RNA|XRRA1_ENST00000321448.8_Silent_p.I35I|XRRA1_ENST00000527087.1_Silent_p.I268I	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						GTAGGTATGGGATCCTGATAA	0.423																																					p.I268I		.											.	XRRA1	68	0			c.C804A						.						98.0	95.0	96.0					11																	74617459		1922	4116	6038	SO:0001819	synonymous_variant	143570	exon10			GTATGGGATCCTG	AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.804C>A	11.37:g.74617459G>T		355.0	0.0		251.0	116.0	NM_182969		Silent	SNP	ENST00000340360.6	37	CCDS44680.1																																																																																			.		0.423	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384715.1	NM_182969	
ZBTB4	57659	ucsc.edu;bcgsc.ca	37	17	7369945	7369945	+	Missense_Mutation	SNP	A	A	G	rs373669990		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr17:7369945A>G	ENST00000311403.4	-	3	515	c.176T>C	c.(175-177)cTg>cCg	p.L59P	ZBTB4_ENST00000380599.4_Missense_Mutation_p.L59P	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	59	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		TGAAGTGAGCAGGGCCTCTCT	0.632																																					p.L59P		.											.	ZBTB4	93	0			c.T176C						.	A	PRO/LEU,PRO/LEU	0,4406		0,0,2203	73.0	62.0	66.0		176,176	4.9	1.0	17		66	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZBTB4	NM_001128833.1,NM_020899.3	98,98	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	59/1014,59/1014	7369945	1,13005	2203	4300	6503	SO:0001583	missense	57659	exon3			GTGAGCAGGGCCT	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.176T>C	17.37:g.7369945A>G	ENSP00000307858:p.Leu59Pro	62.0	0.0		46.0	5.0	NM_001128833	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	ENST00000311403.4	37	CCDS11107.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.359378	0.41801	0.0	1.16E-4	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.70869	-0.52;-0.52	4.91	4.91	0.64330	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.331667	0.21698	N	0.070469	T	0.80768	0.4686	M	0.83118	2.625	0.53688	D	0.999976	P	0.52842	0.956	P	0.55824	0.785	T	0.81600	-0.0859	10	0.42905	T	0.14	-8.633	12.1437	0.54012	1.0:0.0:0.0:0.0	.	59	Q9P1Z0	ZBTB4_HUMAN	P	59	ENSP00000307858:L59P;ENSP00000369973:L59P	ENSP00000307858:L59P	L	-	2	0	ZBTB4	7310669	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	4.926000	0.63433	2.060000	0.61445	0.459000	0.35465	CTG	.		0.632	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899	
ZDHHC4	55146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6624765	6624765	+	Silent	SNP	T	T	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr7:6624765T>G	ENST00000396706.2	+	7	1058	c.615T>G	c.(613-615)gcT>gcG	p.A205A	ZDHHC4_ENST00000396713.2_Silent_p.A205A|ZDHHC4_ENST00000396709.1_Silent_p.A205A|ZDHHC4_ENST00000396707.2_Silent_p.A205A|ZDHHC4_ENST00000335965.6_Silent_p.A205A|ZDHHC4_ENST00000405731.3_Silent_p.A205A|AC079742.4_ENST00000434951.1_RNA			Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	205						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		CGGCCTCGGCTGCCACCGTCG	0.527																																					p.A205A		.											.	ZDHHC4	154	0			c.T615G						.						167.0	114.0	132.0					7																	6624765		2203	4300	6503	SO:0001819	synonymous_variant	55146	exon7			CTCGGCTGCCACC	AF201931	CCDS5352.1	7p22.1	2011-01-11			ENSG00000136247	ENSG00000136247		"""Zinc fingers, DHHC-type"""	18471	protein-coding gene	gene with protein product							Standard	NM_018106		Approved	FLJ10479, ZNF374	uc003sqj.3	Q9NPG8	OTTHUMG00000023579	ENST00000396706.2:c.615T>G	7.37:g.6624765T>G		255.0	1.0		349.0	175.0	NM_018106	A4D2N9|Q53EV7|Q6FIB5|Q9H0R9	Silent	SNP	ENST00000396706.2	37	CCDS5352.1																																																																																			.		0.527	ZDHHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207477.3	NM_018106	
ZNF177	7730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9492041	9492041	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:9492041G>A	ENST00000589262.1	+	6	1100	c.1034G>A	c.(1033-1035)tGt>tAt	p.C345Y	ZNF177_ENST00000541595.2_Missense_Mutation_p.C185Y|ZNF177_ENST00000343499.4_Missense_Mutation_p.C185Y|ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000602738.1_Missense_Mutation_p.C185Y|ZNF177_ENST00000434737.2_Missense_Mutation_p.C345Y|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000602856.1_3'UTR	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	345					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						TGTAAGGAATGTGGGAAGGCT	0.448																																					p.C345Y		.											.	ZNF177	91	0			c.G1034A						.						104.0	103.0	103.0					19																	9492041		2203	4300	6503	SO:0001583	missense	7730	exon6			AGGAATGTGGGAA	U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.1034G>A	19.37:g.9492041G>A	ENSP00000468531:p.Cys345Tyr	125.0	0.0		71.0	30.0	NM_001172651	B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	ENST00000589262.1	37	CCDS54214.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311928	0.60414	.	.	ENSG00000188629	ENST00000541595;ENST00000343499;ENST00000434737	D;D;D	0.85861	-2.04;-2.04;-2.04	2.64	2.64	0.31445	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94231	0.8148	H	0.97051	3.93	0.27048	N	0.963847	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96359	0.9264	8	0.87932	D	0	.	11.4554	0.50179	0.0:0.0:1.0:0.0	.	345;185	B4DY57;Q13360	.;ZN177_HUMAN	Y	185;185;345	ENSP00000445323:C185Y;ENSP00000341497:C185Y;ENSP00000415070:C345Y	ENSP00000341497:C185Y	C	+	2	0	ZNF177	9353041	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.905000	0.87416	1.803000	0.52742	0.563000	0.77884	TGT	.		0.448	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449028.1	NM_003451	
ZNF239	8187	hgsc.bcm.edu;bcgsc.ca	37	10	44052345	44052346	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr10:44052345_44052346delTG	ENST00000306006.6	-	2	1834_1835	c.1182_1183delCA	c.(1180-1185)ctcagafs	p.R395fs	ZNF239_ENST00000491188.1_5'Flank|ZNF239_ENST00000535642.1_Frame_Shift_Del_p.R395fs|ZNF239_ENST00000426961.1_Frame_Shift_Del_p.R395fs|ZNF239_ENST00000374446.2_Frame_Shift_Del_p.R395fs	NM_005674.2	NP_005665.2	Q16600	ZN239_HUMAN	zinc finger protein 239	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GTGTGGACTCTGAGATGGATGC	0.515																																					p.394_395del		.											.	ZNF239	90	0			c.1182_1183del						.																																			SO:0001589	frameshift_variant	8187	exon3			GGACTCTGAGATG	X82125	CCDS41502.1	10q11.22-q11.23	2013-01-08			ENSG00000196793	ENSG00000196793		"""Zinc fingers, C2H2-type"""	13031	protein-coding gene	gene with protein product		601069				8903737, 8587123	Standard	NM_005674		Approved	MOK2, HOK-2	uc009xmk.3	Q16600	OTTHUMG00000018033	ENST00000306006.6:c.1182_1183delCA	10.37:g.44052345_44052346delTG	ENSP00000307774:p.Arg395fs	287.0	0.0		224.0	65.0	NM_001099284	Q5T1G9|Q8TAS5	Frame_Shift_Del	DEL	ENST00000306006.6	37	CCDS41502.1																																																																																			.		0.515	ZNF239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047710.1		
ZNF267	10308	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	31926035	31926035	+	Silent	SNP	T	T	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr16:31926035T>G	ENST00000300870.10	+	4	674	c.465T>G	c.(463-465)tcT>tcG	p.S155S	ZNF267_ENST00000394846.3_3'UTR	NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	155					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TACTTTCTTCTTGTGCCAAAA	0.328																																					p.S155S		.											.	ZNF267	138	0			c.T465G						.						68.0	70.0	70.0					16																	31926035		2197	4300	6497	SO:0001819	synonymous_variant	10308	exon4			TTCTTCTTGTGCC	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.465T>G	16.37:g.31926035T>G		215.0	0.0		209.0	76.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Silent	SNP	ENST00000300870.10	37	CCDS32440.1																																																																																			.		0.328	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
ZNF280B	140883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	22842866	22842866	+	Silent	SNP	A	A	G			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr22:22842866A>G	ENST00000406426.1	-	4	1600	c.858T>C	c.(856-858)agT>agC	p.S286S	ZNF280B_ENST00000360412.2_Silent_p.S286S			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	286					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		AGTAAAAGTCACTAAGTAACA	0.383																																					p.S286S		.											.	ZNF280B	70	0			c.T858C						.						121.0	113.0	115.0					22																	22842866		2203	4300	6503	SO:0001819	synonymous_variant	140883	exon4			AAAGTCACTAAGT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.858T>C	22.37:g.22842866A>G		174.0	0.0		180.0	51.0	NM_080764		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																			.		0.383	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
ZNF33A	7581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	38343322	38343322	+	Silent	SNP	C	C	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr10:38343322C>T	ENST00000458705.2	+	5	425	c.267C>T	c.(265-267)caC>caT	p.H89H	ZNF33A_ENST00000469037.2_Silent_p.H90H|ZNF33A_ENST00000374618.3_Silent_p.H90H|ZNF33A_ENST00000432900.2_Silent_p.H96H|ZNF33A_ENST00000307441.9_Silent_p.H89H			Q06730	ZN33A_HUMAN	zinc finger protein 33A	89					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						CAGCTGATCACCTGAAAGAGA	0.358																																					p.H90H		.											.	ZNF33A	93	0			c.C270T						.						76.0	77.0	77.0					10																	38343322		2203	4300	6503	SO:0001819	synonymous_variant	7581	exon5			TGATCACCTGAAA	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.267C>T	10.37:g.38343322C>T		181.0	0.0		110.0	52.0	NM_006954	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Silent	SNP	ENST00000458705.2	37	CCDS31182.1																																																																																			.		0.358	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974	
ZNF408	79797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46726465	46726465	+	Silent	SNP	G	G	T			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr11:46726465G>T	ENST00000311764.2	+	5	1445	c.1215G>T	c.(1213-1215)ggG>ggT	p.G405G		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCACCGTGGGGTGCGGCCCT	0.582																																					p.G405G	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	.											.	ZNF408	90	0			c.G1215T						.						61.0	61.0	61.0					11																	46726465		2201	4299	6500	SO:0001819	synonymous_variant	79797	exon5			CCGTGGGGTGCGG	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1215G>T	11.37:g.46726465G>T		140.0	0.0		91.0	12.0	NM_024741		Silent	SNP	ENST00000311764.2	37	CCDS7923.1																																																																																			.		0.582	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
ZNF536	9745	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	30934910	30934910	+	Silent	SNP	G	G	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:30934910G>C	ENST00000355537.3	+	2	588	c.441G>C	c.(439-441)ctG>ctC	p.L147L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	147					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCCTCTCCCTGCACATGCGCA	0.632																																					p.L147L		.											.	ZNF536	144	0			c.G441C						.						61.0	52.0	55.0					19																	30934910		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon2			CTCCCTGCACATG		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.441G>C	19.37:g.30934910G>C		68.0	1.0		72.0	16.0	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																			.		0.632	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF772	400720	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	57987070	57987075	+	In_Frame_Del	DEL	GGTACA	GGTACA	-	rs374022798		TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	GGTACA	GGTACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:57987070_57987075delGGTACA	ENST00000343280.4	-	3	412_417	c.152_157delTGTACC	c.(151-159)ctgtaccgt>cgt	p.LY51del	AC004076.9_ENST00000596831.1_In_Frame_Del_p.LY51del|ZNF772_ENST00000356584.3_In_Frame_Del_p.LY51del|ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000600175.1_Intron|AC003005.2_ENST00000595422.1_lincRNA|ZNF772_ENST00000427512.2_Intron|ZNF772_ENST00000425074.3_Intron|AC004076.9_ENST00000415705.3_Intron	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		ATCACATCACGGTACAGGAGCCTCTG	0.558																																					p.51_53del	Melanoma(5;289 436 14293 15924 30817)	.											.	ZNF772	90	0			c.152_157del						.																																			SO:0001651	inframe_deletion	400720	exon3			CATCACGGTACAG	BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.152_157delTGTACC	19.37:g.57987070_57987075delGGTACA	ENSP00000341165:p.Leu51_Tyr52del	328.0	0.0		188.0	34.0	NM_001144068	A6NJK9|B4DH56|B4DYS0	In_Frame_Del	DEL	ENST00000343280.4	37	CCDS33133.1																																																																																			.		0.558	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1	NM_001024596	
ZNF831	128611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57829455	57829455	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr20:57829455A>C	ENST00000371030.2	+	5	4691	c.4691A>C	c.(4690-4692)aAa>aCa	p.K1564T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1564							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCAACTGAAAAAACTCATCTT	0.478																																					p.K1564T		.											.	ZNF831	126	0			c.A4691C						.						49.0	50.0	50.0					20																	57829455		1906	4131	6037	SO:0001583	missense	128611	exon5			CTGAAAAAACTCA	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4691A>C	20.37:g.57829455A>C	ENSP00000360069:p.Lys1564Thr	159.0	0.0		128.0	45.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	A	8.170	0.791427	0.16258	.	.	ENSG00000124203	ENST00000371030	T	0.05717	3.4	5.66	4.5	0.54988	.	0.235838	0.29572	N	0.011766	T	0.07773	0.0195	L	0.45581	1.43	0.09310	N	1	D	0.53312	0.959	B	0.43623	0.425	T	0.23119	-1.0197	10	0.72032	D	0.01	-5.8619	9.1128	0.36739	0.8156:0.1844:0.0:0.0	.	1564	Q5JPB2	ZN831_HUMAN	T	1564	ENSP00000360069:K1564T	ENSP00000360069:K1564T	K	+	2	0	ZNF831	57262850	0.007000	0.16637	0.073000	0.20177	0.063000	0.16089	1.997000	0.40786	2.160000	0.67779	0.528000	0.53228	AAA	.		0.478	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
MISP	126353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	758698	758699	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-DD-A11D-01A-11D-A12Z-10	TCGA-DD-A11D-11A-12D-A12Z-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	ef36ae28-ea74-4d7d-9fe3-df3b7ee12a58	6509e096-9af2-4933-9691-7463020c7f8d	g.chr19:758698_758699GA>TG	ENST00000215582.6	+	2	1855_1856	c.1752_1753GA>TG	c.(1750-1755)caGAac>caTGac	p.584_585QN>HD		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	584					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											ACTCTGACCAGAACTCCAGGAG	0.629																																					p.QN584HD		.											.	.	.	0			.						.																																			SO:0001583	missense	126353	.			TGACCAGAACTCC	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	Exception_encountered	19.37:g.758698_758699delinsTG	ENSP00000215582:p.Q584_N585delinsHD	116.0	0.0		100.0	26.0	.		Missense_Mutation	DNP	ENST00000215582.6	37	CCDS12042.1																																																																																			.		0.629	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
