#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AAK1	22848	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	69757151	69757151	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:69757151T>A	ENST00000409085.4	-	8	1236	c.860A>T	c.(859-861)cAc>cTc	p.H287L	AAK1_ENST00000406297.3_Missense_Mutation_p.H287L|AAK1_ENST00000470281.1_5'Flank|AAK1_ENST00000409068.1_Missense_Mutation_p.H287L	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						AATTAGGCAGTGCATGTCTTG	0.333																																					p.H287L		.											.	AAK1	333	0			c.A860T						.						46.0	43.0	44.0					2																	69757151		1827	4086	5913	SO:0001583	missense	22848	exon8			AGGCAGTGCATGT	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.860A>T	2.37:g.69757151T>A	ENSP00000386456:p.His287Leu	215.0	1.0		163.0	61.0	NM_014911	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	ENST00000409085.4	37	CCDS1893.2	.	.	.	.	.	.	.	.	.	.	T	17.64	3.440868	0.63067	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.63417	-0.04;-0.04;-0.04	5.24	5.24	0.73138	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	N	0.05050	-0.12	0.80722	D	1	P;P;D	0.76494	0.771;0.86;0.999	P;P;D	0.83275	0.667;0.655;0.996	T	0.71230	-0.4654	10	0.72032	D	0.01	-22.4282	14.4832	0.67597	0.0:0.0:0.0:1.0	.	287;287;287	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	L	287	ENSP00000386342:H287L;ENSP00000386456:H287L;ENSP00000385181:H287L	ENSP00000385181:H287L	H	-	2	0	AAK1	69610655	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.855000	0.86950	2.204000	0.70986	0.383000	0.25322	CAC	.		0.333	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251847.4	NM_014911	
ACSL1	2180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	185709825	185709825	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr4:185709825A>T	ENST00000515030.1	-	3	581	c.256T>A	c.(256-258)Tat>Aat	p.Y86N	ACSL1_ENST00000281455.2_Missense_Mutation_p.Y86N|ACSL1_ENST00000504900.1_Missense_Mutation_p.Y86N|ACSL1_ENST00000437665.3_5'UTR|ACSL1_ENST00000504342.1_Missense_Mutation_p.Y86N|ACSL1_ENST00000507295.1_Missense_Mutation_p.Y86N|ACSL1_ENST00000454703.2_5'UTR|ACSL1_ENST00000513317.1_Missense_Mutation_p.Y86N			P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	86					adiponectin-activated signaling pathway (GO:0033211)|alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|linoleic acid metabolic process (GO:0043651)|lipid biosynthetic process (GO:0008610)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid metabolic process (GO:0033559)|xenobiotic catabolic process (GO:0042178)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|liver(1)|lung(17)|ovary(2)|prostate(1)|skin(2)	38		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ACATCATCATAGAAATACACC	0.488																																					p.Y86N		.											.	ACSL1	92	0			c.T256A						.						127.0	111.0	117.0					4																	185709825		2203	4300	6503	SO:0001583	missense	2180	exon3			CATCATAGAAATA	BC026290	CCDS3839.1, CCDS68825.1, CCDS68826.1, CCDS75213.1	4q35.1	2014-08-08	2004-02-19	2004-02-20	ENSG00000151726	ENSG00000151726	6.2.1.3	"""Acyl-CoA synthetase family"""	3569	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", ""long-chain fatty-acid-coenzyme A ligase 1"""	152425	"""fatty-acid-Coenzyme A ligase, long-chain 2"""	FACL2		2341402, 1531127	Standard	XM_005262828		Approved	LACS2, LACS, ACS1, LACS1, FACL1	uc003iwu.1	P33121	OTTHUMG00000160547	ENST00000515030.1:c.256T>A	4.37:g.185709825A>T	ENSP00000422607:p.Tyr86Asn	49.0	0.0		40.0	16.0	NM_001995	B7Z452|D3DP57|P41215|Q8N8V7|Q8TA99	Missense_Mutation	SNP	ENST00000515030.1	37	CCDS3839.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.143348	0.77888	.	.	ENSG00000151726	ENST00000515030;ENST00000281455;ENST00000507295;ENST00000504342;ENST00000513317;ENST00000504900	T;T;T;T;T;T	0.10477	2.87;2.87;2.87;2.87;2.87;2.87	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.33498	0.0865	M	0.79011	2.435	0.80722	D	1	B;P;D;P	0.76494	0.209;0.59;0.999;0.59	B;B;D;B	0.74023	0.06;0.087;0.982;0.087	T	0.03202	-1.1061	10	0.33940	T	0.23	-20.0264	15.6928	0.77469	1.0:0.0:0.0:0.0	.	86;86;86;86	E7EPM6;B7Z452;D6RER0;P33121	.;.;.;ACSL1_HUMAN	N	86	ENSP00000422607:Y86N;ENSP00000281455:Y86N;ENSP00000426244:Y86N;ENSP00000425006:Y86N;ENSP00000426150:Y86N;ENSP00000424935:Y86N	ENSP00000281455:Y86N	Y	-	1	0	ACSL1	185946819	1.000000	0.71417	0.778000	0.31720	0.911000	0.54048	5.192000	0.65115	2.247000	0.74100	0.482000	0.46254	TAT	.		0.488	ACSL1-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361112.2	NM_001995	
ACVR1C	130399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	158390474	158390474	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:158390474T>C	ENST00000243349.8	-	9	1798	c.1438A>G	c.(1438-1440)Aag>Gag	p.K480E	ACVR1C_ENST00000409680.3_Missense_Mutation_p.K430E|ACVR1C_ENST00000348328.5_Missense_Mutation_p.K323E|ACVR1C_ENST00000335450.7_Missense_Mutation_p.K400E	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GATATAGTCTTCTTAATACGA	0.398																																					p.K480E		.											.	ACVR1C	1006	0			c.A1438G						.						95.0	105.0	101.0					2																	158390474		2203	4300	6503	SO:0001583	missense	130399	exon9			TAGTCTTCTTAAT	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1438A>G	2.37:g.158390474T>C	ENSP00000243349:p.Lys480Glu	54.0	0.0		64.0	25.0	NM_145259		Missense_Mutation	SNP	ENST00000243349.8	37	CCDS2205.1	.	.	.	.	.	.	.	.	.	.	T	28.4	4.915585	0.92178	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000348328;ENST00000335450	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000042	T	0.80555	0.4645	M	0.82630	2.6	0.80722	D	1	D;D;D	0.89917	0.995;1.0;0.999	D;D;D	0.78314	0.962;0.991;0.985	D	0.83835	0.0254	10	0.87932	D	0	.	15.2629	0.73637	0.0:0.0:0.0:1.0	.	323;400;480	Q8NER5-2;Q8NER5-3;Q8NER5	.;.;ACV1C_HUMAN	E	480;430;323;400	ENSP00000243349:K480E;ENSP00000387168:K430E;ENSP00000335139:K323E;ENSP00000335178:K400E	ENSP00000243349:K480E	K	-	1	0	ACVR1C	158098720	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.955000	0.87856	2.080000	0.62538	0.482000	0.46254	AAG	.		0.398	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259	
ADAM21	8747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	70925176	70925176	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr14:70925176T>G	ENST00000603540.1	+	2	1218	c.960T>G	c.(958-960)atT>atG	p.I320M	ADAM21_ENST00000267499.3_Missense_Mutation_p.I320M|RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	320	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GTCCACCTATTGATTGTGGAG	0.408																																					p.I320M		.											.	ADAM21	92	0			c.T960G						.						126.0	126.0	126.0					14																	70925176		2202	4299	6501	SO:0001583	missense	8747	exon2			ACCTATTGATTGT	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.960T>G	14.37:g.70925176T>G	ENSP00000474385:p.Ile320Met	223.0	0.0		178.0	82.0	NM_003813	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.478808	0.26511	.	.	ENSG00000139985	ENST00000267499	T	0.09630	2.96	3.8	1.35	0.21983	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	2.136600	0.02510	N	0.091443	T	0.06872	0.0175	N	0.14661	0.345	0.22842	N	0.998662	B	0.30211	0.273	B	0.28232	0.087	T	0.27971	-1.0058	10	0.36615	T	0.2	.	2.8367	0.05516	0.1871:0.2133:0.0:0.5996	.	320	Q9UKJ8	ADA21_HUMAN	M	320	ENSP00000267499:I320M	ENSP00000267499:I320M	I	+	3	3	ADAM21	69994929	0.000000	0.05858	0.992000	0.48379	0.954000	0.61252	-0.054000	0.11826	0.286000	0.22352	0.455000	0.32223	ATT	.		0.408	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413008.3		
ADAMTS20	80070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	43792900	43792900	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr12:43792900C>A	ENST00000389420.3	-	29	4420	c.4421G>T	c.(4420-4422)tGc>tTc	p.C1474F		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1474	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CCATGAAGGGCATCTGACAGA	0.313																																					p.C1474F		.											.	ADAMTS20	795	0			c.G4421T						.						129.0	107.0	115.0					12																	43792900		2172	4242	6414	SO:0001583	missense	80070	exon29			GAAGGGCATCTGA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4421G>T	12.37:g.43792900C>A	ENSP00000374071:p.Cys1474Phe	177.0	0.0		147.0	51.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500584	0.64298	.	.	ENSG00000173157	ENST00000389420	D	0.98762	-5.12	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000019	D	0.99527	0.9831	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97777	1.0230	10	0.87932	D	0	.	15.7555	0.78021	0.0:1.0:0.0:0.0	.	1474	P59510	ATS20_HUMAN	F	1474	ENSP00000374071:C1474F	ENSP00000374071:C1474F	C	-	2	0	ADAMTS20	42079167	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	4.809000	0.62591	2.621000	0.88768	0.650000	0.86243	TGC	.		0.313	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
ADAMTS9	56999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	64579956	64579956	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:64579956C>T	ENST00000498707.1	-	28	4676	c.4334G>A	c.(4333-4335)tGg>tAg	p.W1445*	ADAMTS9_ENST00000295903.4_Nonsense_Mutation_p.W1417*	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1445	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GCCAGTACTCCATGCAGCGTC	0.483																																					p.W1445X		.											.	ADAMTS9	230	0			c.G4334A						.						163.0	149.0	154.0					3																	64579956		2203	4300	6503	SO:0001587	stop_gained	56999	exon28			GTACTCCATGCAG	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4334G>A	3.37:g.64579956C>T	ENSP00000418735:p.Trp1445*	148.0	0.0		144.0	55.0	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Nonsense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.352656|6.352656	0.97498|0.97498	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000481060|ENST00000295903;ENST00000498707	.|.	.|.	.|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.134382	.|0.53938	.|D	.|0.000047	T|.	0.47340|.	0.1440|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34054|.	-0.9844|.	4|.	.|0.02654	.|T	.|1	.|.	19.2909|19.2909	0.94098|0.94098	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	R|X	501|1417;1445	.|.	.|ENSP00000295903:W1417X	G|W	-|-	1|2	0|0	ADAMTS9|ADAMTS9	64554996|64554996	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.652000|0.652000	0.38707|0.38707	7.288000|7.288000	0.78691|0.78691	2.797000|2.797000	0.96272|0.96272	0.563000|0.563000	0.77884|0.77884	GGA|TGG	.		0.483	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
ADCY6	112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49170256	49170256	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr12:49170256T>C	ENST00000307885.4	-	6	2184	c.1490A>G	c.(1489-1491)aAt>aGt	p.N497S	ADCY6_ENST00000552090.1_5'UTR|ADCY6_ENST00000550422.1_Missense_Mutation_p.N497S|ADCY6_ENST00000357869.3_Missense_Mutation_p.N497S	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	497					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						GGTCACATCATTGGACCACAC	0.647																																					p.N497S		.											.	ADCY6	90	0			c.A1490G						.						68.0	61.0	63.0					12																	49170256		2203	4299	6502	SO:0001583	missense	112	exon7			ACATCATTGGACC		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.1490A>G	12.37:g.49170256T>C	ENSP00000311405:p.Asn497Ser	131.0	0.0		95.0	36.0	NM_020983	Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	37	CCDS8767.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.127400	0.77549	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	D;D;D	0.84516	-1.86;-1.86;-1.86	4.17	4.17	0.49024	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.91372	0.7278	M	0.79258	2.445	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.983	D	0.91964	0.5581	10	0.59425	D	0.04	.	12.6197	0.56595	0.0:0.0:0.0:1.0	.	497;497	O43306-2;O43306	.;ADCY6_HUMAN	S	497	ENSP00000350536:N497S;ENSP00000446730:N497S;ENSP00000311405:N497S	ENSP00000311405:N497S	N	-	2	0	ADCY6	47456523	1.000000	0.71417	0.991000	0.47740	0.922000	0.55478	7.868000	0.87116	1.881000	0.54492	0.260000	0.18958	AAT	.		0.647	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
ANGPTL1	9068	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	178820448	178820448	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:178820448T>C	ENST00000234816.2	-	6	1739	c.1292A>G	c.(1291-1293)aAc>aGc	p.N431S	RALGPS2_ENST00000367635.3_Intron|ANGPTL1_ENST00000367629.1_Missense_Mutation_p.N431S|RALGPS2_ENST00000367634.2_Intron	NM_004673.3	NP_004664.1	O95841	ANGL1_HUMAN	angiopoietin-like 1	431	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			breast(2)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	14						GTGGGCGCAGTTTCCTTTGAG	0.388																																					p.N431S		.											.	ANGPTL1	90	0			c.A1292G						.						79.0	73.0	75.0					1																	178820448		2203	4299	6502	SO:0001583	missense	9068	exon6			GCGCAGTTTCCTT	AF107253	CCDS1327.1	1q25.2	2013-02-06			ENSG00000116194	ENSG00000116194		"""Fibrinogen C domain containing"""	489	protein-coding gene	gene with protein product	"""angioarrestin"""	603874		ANGPT3		10025962, 9286704	Standard	NM_004673		Approved	ANG3, AngY, ARP1	uc001gma.3	O95841	OTTHUMG00000035075	ENST00000234816.2:c.1292A>G	1.37:g.178820448T>C	ENSP00000234816:p.Asn431Ser	119.0	0.0		175.0	91.0	NM_004673	Q5T5Z5	Missense_Mutation	SNP	ENST00000234816.2	37	CCDS1327.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.496537	0.85069	.	.	ENSG00000116194	ENST00000234816;ENST00000367629	D;D	0.82344	-1.6;-1.6	5.78	5.78	0.91487	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.90393	0.6993	M	0.72576	2.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90808	0.4699	10	0.56958	D	0.05	.	16.0592	0.80826	0.0:0.0:0.0:1.0	.	431	O95841	ANGL1_HUMAN	S	431	ENSP00000234816:N431S;ENSP00000356601:N431S	ENSP00000234816:N431S	N	-	2	0	ANGPTL1	177087071	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.997000	0.88414	2.333000	0.79357	0.533000	0.62120	AAC	.		0.388	ANGPTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084924.1	NM_004673	
ANO9	338440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	432029	432029	+	Missense_Mutation	SNP	C	C	T	rs139380371		TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr11:432029C>T	ENST00000332826.6	-	5	460	c.376G>A	c.(376-378)Gtt>Att	p.V126I		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	126					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)	p.V126I(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						TTCATGACAACGAAGTTCACG	0.622																																					p.V126I		.											.	ANO9	227	1	Substitution - Missense(1)	prostate(1)	c.G376A						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	83.0	70.0	75.0		376	-5.6	0.0	11	dbSNP_134	75	0,8598		0,0,4299	no	missense	ANO9	NM_001012302.2	29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	benign	126/783	432029	1,13003	2203	4299	6502	SO:0001583	missense	338440	exon5			TGACAACGAAGTT	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.376G>A	11.37:g.432029C>T	ENSP00000332788:p.Val126Ile	86.0	0.0		89.0	30.0	NM_001012302	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	37	CCDS31326.1	.	.	.	.	.	.	.	.	.	.	C	0.148	-1.094503	0.01858	2.27E-4	0.0	ENSG00000185101	ENST00000332826	T	0.62105	0.05	3.39	-5.56	0.02529	.	.	.	.	.	T	0.33118	0.0852	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.40664	-0.9551	9	0.02654	T	1	.	8.7427	0.34567	0.0:0.2539:0.1123:0.6338	.	126	A1A5B4	ANO9_HUMAN	I	126	ENSP00000332788:V126I	ENSP00000332788:V126I	V	-	1	0	ANO9	422029	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.468000	0.02350	-1.392000	0.02082	0.484000	0.47621	GTT	C|1.000;T|0.000		0.622	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302	
AOX1	316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	201478589	201478589	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:201478589T>G	ENST00000374700.2	+	15	1752	c.1511T>G	c.(1510-1512)tTg>tGg	p.L504W	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	504					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GTCTCCCTTTTGGGCTCGGCG	0.488																																					p.L504W		.											.	AOX1	96	0			c.T1511G						.						90.0	87.0	88.0					2																	201478589		2203	4300	6503	SO:0001583	missense	316	exon15			CCCTTTTGGGCTC	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1511T>G	2.37:g.201478589T>G	ENSP00000363832:p.Leu504Trp	159.0	0.0		178.0	67.0	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	37	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.112968	0.37242	.	.	ENSG00000138356	ENST00000374700	T	0.24908	1.83	5.33	4.45	0.53987	CO dehydrogenase flavoprotein, C-terminal (3);	0.370054	0.30989	N	0.008478	T	0.34077	0.0885	L	0.29908	0.895	0.09310	N	0.999999	P	0.35433	0.501	P	0.51016	0.656	T	0.32771	-0.9894	10	0.87932	D	0	-10.3192	14.0636	0.64815	0.0:0.9278:0.0:0.0722	.	504	Q06278	ADO_HUMAN	W	504	ENSP00000363832:L504W	ENSP00000363832:L504W	L	+	2	0	AOX1	201186834	0.015000	0.18098	0.091000	0.20842	0.006000	0.05464	2.663000	0.46774	1.488000	0.48433	-0.132000	0.14878	TTG	.		0.488	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
AP3S1	1176	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	115249063	115249063	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr5:115249063G>C	ENST00000316788.7	+	6	1015	c.458G>C	c.(457-459)gGc>gCc	p.G153A	AP3S1_ENST00000505423.1_3'UTR	NM_001284.2	NP_001275.1	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1 subunit	153					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transport (GO:0006886)	AP-3 adaptor complex (GO:0030123)|AP-type membrane coat adaptor complex (GO:0030119)|Golgi apparatus (GO:0005794)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|prostate(1)	12		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		ATACAGGCTGGCTTAGCAGGA	0.363																																					p.G153A		.											.	AP3S1	90	0			c.G458C						.						49.0	51.0	50.0					5																	115249063		2202	4300	6502	SO:0001583	missense	1176	exon6			AGGCTGGCTTAGC	D63643	CCDS4123.1	5q22	2010-06-29			ENSG00000177879	ENSG00000177879			2013	protein-coding gene	gene with protein product		601507		CLAPS3		8697810, 9118953	Standard	NM_001284		Approved		uc003krl.3	Q92572	OTTHUMG00000128887	ENST00000316788.7:c.458G>C	5.37:g.115249063G>C	ENSP00000325369:p.Gly153Ala	110.0	1.0		97.0	22.0	NM_001284	O00647|O00676|O00721|O00727|Q53XL4|Q6ICQ2	Missense_Mutation	SNP	ENST00000316788.7	37	CCDS4123.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031751	0.54790	.	.	ENSG00000177879	ENST00000316788	T	0.44083	0.93	6.05	6.05	0.98169	.	0.099515	0.64402	N	0.000002	T	0.48554	0.1506	M	0.75777	2.31	0.80722	D	1	B;B	0.32071	0.355;0.355	B;B	0.29267	0.1;0.1	T	0.47058	-0.9146	10	0.51188	T	0.08	-18.0388	20.1963	0.98243	0.0:0.0:1.0:0.0	.	153;153	B2R4I8;Q92572	.;AP3S1_HUMAN	A	153	ENSP00000325369:G153A	ENSP00000325369:G153A	G	+	2	0	AP3S1	115276962	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.807000	0.99171	2.878000	0.98634	0.650000	0.86243	GGC	.		0.363	AP3S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250847.2		
APBB2	323	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	41015987	41015987	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr4:41015987T>C	ENST00000295974.8	-	6	1077	c.448A>G	c.(448-450)Att>Gtt	p.I150V	APBB2_ENST00000506352.1_Missense_Mutation_p.I150V|APBB2_ENST00000513140.1_Missense_Mutation_p.I150V|APBB2_ENST00000508593.1_Missense_Mutation_p.I150V	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	150					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						GAGGGTAAAATCTCACAGCTC	0.498																																					p.I150V	Ovarian(3;20 75 16686 49997)	.											.	APBB2	92	0			c.A448G						.						70.0	68.0	69.0					4																	41015987		1861	4095	5956	SO:0001583	missense	323	exon6			GTAAAATCTCACA	U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.448A>G	4.37:g.41015987T>C	ENSP00000295974:p.Ile150Val	184.0	1.0		147.0	60.0	NM_173075	B4DSL4|E9PG87|Q8IUI6	Missense_Mutation	SNP	ENST00000295974.8	37	CCDS54761.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.56|10.56	1.385247|1.385247	0.25031|0.25031	.|.	.|.	ENSG00000163697|ENSG00000163697	ENST00000513611|ENST00000295974;ENST00000316212;ENST00000513140;ENST00000508593;ENST00000506352;ENST00000509446	.|T;T;T;T;T	.|0.26957	.|1.7;1.7;1.7;1.7;1.7	5.84|5.84	4.62|4.62	0.57501|0.57501	.|.	.|0.276238	.|0.40554	.|N	.|0.001076	T|T	0.27967|0.27967	0.0689|0.0689	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	.|P;P;P;P	.|0.44281	.|0.779;0.572;0.831;0.572	.|P;B;B;B	.|0.54026	.|0.74;0.122;0.401;0.122	T|T	0.02339|0.02339	-1.1174|-1.1174	5|10	.|0.18710	.|T	.|0.47	-7.1728|-7.1728	12.9814|12.9814	0.58567|0.58567	0.0:0.0:0.135:0.865|0.0:0.0:0.135:0.865	.|.	.|133;150;150;150	.|B4DJ88;E9PG87;Q92870-2;Q92870	.|.;.;.;APBB2_HUMAN	G|V	139|150;149;150;150;150;133	.|ENSP00000295974:I150V;ENSP00000426018:I150V;ENSP00000427211:I150V;ENSP00000421539:I150V;ENSP00000424414:I133V	.|ENSP00000295974:I150V	D|I	-|-	2|1	0|0	APBB2|APBB2	40710744|40710744	0.998000|0.998000	0.40836|0.40836	0.090000|0.090000	0.20809|0.20809	0.761000|0.761000	0.43186|0.43186	2.311000|2.311000	0.43717|0.43717	0.990000|0.990000	0.38787|0.38787	0.459000|0.459000	0.35465|0.35465	GAT|ATT	.		0.498	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3	NM_173075	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21231070	21231070	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:21231070G>T	ENST00000233242.1	-	26	8797	c.8670C>A	c.(8668-8670)ttC>ttA	p.F2890L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2890					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAATTTGTGGAAGTATTTAG	0.423																																					p.F2890L		.											.	APOB	175	0			c.C8670A						.						180.0	177.0	178.0					2																	21231070		2203	4299	6502	SO:0001583	missense	338	exon26			TTTGTGGAAGTAT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8670C>A	2.37:g.21231070G>T	ENSP00000233242:p.Phe2890Leu	157.0	0.0		141.0	53.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.614336	0.28712	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00686	5.85	5.51	1.68	0.24146	.	0.727572	0.12466	N	0.466471	T	0.01156	0.0038	M	0.72479	2.2	0.80722	D	1	B	0.26318	0.146	B	0.19148	0.024	T	0.52931	-0.8509	10	0.52906	T	0.07	.	5.2808	0.15674	0.4271:0.0:0.4419:0.131	.	2890	P04114	APOB_HUMAN	L	2890	ENSP00000233242:F2890L	ENSP00000233242:F2890L	F	-	3	2	APOB	21084575	0.184000	0.23200	0.953000	0.39169	0.951000	0.60555	-0.299000	0.08254	0.301000	0.22738	-0.266000	0.10368	TTC	.		0.423	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARMCX1	51309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100808329	100808329	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chrX:100808329C>A	ENST00000372829.3	+	4	787	c.416C>A	c.(415-417)gCa>gAa	p.A139E		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	139						integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						AGGACCCTTGCACCGAGTTTA	0.612																																					p.A139E		.											.	ARMCX1	134	0			c.C416A						.						69.0	64.0	66.0					X																	100808329		2203	4300	6503	SO:0001583	missense	51309	exon4			CCCTTGCACCGAG	AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.416C>A	X.37:g.100808329C>A	ENSP00000361917:p.Ala139Glu	92.0	0.0		73.0	35.0	NM_016608	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	ENST00000372829.3	37	CCDS14487.1	.	.	.	.	.	.	.	.	.	.	c	10.96	1.499463	0.26861	.	.	ENSG00000126947	ENST00000372829	T	0.26957	1.7	3.86	2.98	0.34508	.	0.855686	0.09693	N	0.768061	T	0.17109	0.0411	N	0.19112	0.55	0.23809	N	0.996783	B	0.27498	0.18	B	0.26094	0.066	T	0.22382	-1.0218	10	0.46703	T	0.11	-0.7593	8.3508	0.32301	0.0:0.7638:0.2362:0.0	.	139	Q9P291	ARMX1_HUMAN	E	139	ENSP00000361917:A139E	ENSP00000361917:A139E	A	+	2	0	ARMCX1	100694985	0.026000	0.19158	0.908000	0.35775	0.774000	0.43823	0.539000	0.23175	0.957000	0.37930	-0.291000	0.09656	GCA	.		0.612	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
ASCC2	84164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	30218403	30218403	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr22:30218403G>T	ENST00000397771.2	-	6	639	c.462C>A	c.(460-462)ttC>ttA	p.F154L	ASCC2_ENST00000307790.3_Missense_Mutation_p.F154L|ASCC2_ENST00000542393.1_Intron			Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit 2	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					endometrium(3)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			TGTCAAAGAGGAAGTTATTGT	0.448																																					p.F154L		.											.	ASCC2	90	0			c.C462A						.						118.0	113.0	115.0					22																	30218403		2203	4300	6503	SO:0001583	missense	84164	exon5			AAAGAGGAAGTTA	AY013289	CCDS13869.1, CCDS56226.1	22q12.1	2004-07-27			ENSG00000100325	ENSG00000100325			24103	protein-coding gene	gene with protein product	"""ASC 1 complex subunit P100"""	614216				12077347, 9847074	Standard	NM_032204		Approved	ASC1p100, FLJ21588, DKFZp586O0223	uc003agr.3	Q9H1I8	OTTHUMG00000067658	ENST00000397771.2:c.462C>A	22.37:g.30218403G>T	ENSP00000380877:p.Phe154Leu	89.0	0.0		78.0	31.0	NM_032204	B7Z8E0|F5H6J9|Q4TT54|Q8TAZ0|Q9H711|Q9H9D6	Missense_Mutation	SNP	ENST00000397771.2	37	CCDS13869.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718702	0.89205	.	.	ENSG00000100325	ENST00000307790;ENST00000397771;ENST00000431535;ENST00000412689	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.85	5.85	0.93711	.	0.101226	0.64402	D	0.000001	T	0.54711	0.1875	M	0.74258	2.255	0.80722	D	1	D	0.61080	0.989	P	0.51999	0.687	T	0.49934	-0.8886	10	0.12430	T	0.62	-24.2021	18.7369	0.91757	0.0:0.0:1.0:0.0	.	154	Q9H1I8	ASCC2_HUMAN	L	154	ENSP00000305502:F154L;ENSP00000380877:F154L;ENSP00000412382:F154L;ENSP00000417032:F154L	ENSP00000305502:F154L	F	-	3	2	ASCC2	28548403	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.170000	0.64990	2.768000	0.95171	0.655000	0.94253	TTC	.		0.448	ASCC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322127.1	NM_032204	
ATP7B	540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	52548363	52548363	+	Silent	SNP	G	G	A	rs377294197		TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr13:52548363G>A	ENST00000242839.4	-	2	1149	c.993C>T	c.(991-993)gcC>gcT	p.A331A	ATP7B_ENST00000400366.3_Intron|ATP7B_ENST00000542656.1_Silent_p.A299A|ATP7B_ENST00000482841.1_5'UTR|ATP7B_ENST00000448424.2_Silent_p.A331A|ATP7B_ENST00000400370.3_Silent_p.A331A|ATP7B_ENST00000344297.5_Silent_p.A331A|ATP7B_ENST00000418097.2_Silent_p.A331A	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	331					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CACTCCCTTCGGCTCCATCAG	0.532									Wilson disease				G|||	1	0.000199681	0.0008	0.0	5008	,	,		18698	0.0		0.0	False		,,,				2504	0.0				p.A331A		.											.	ATP7B	92	0			c.C993T						.	G	,	0,3804		0,0,1902	79.0	79.0	79.0		993,993	-1.4	0.0	13		79	2,8226		0,2,4112	no	coding-synonymous,coding-synonymous	ATP7B	NM_000053.3,NM_001005918.2	,	0,2,6014	AA,AG,GG		0.0243,0.0,0.0166	,	331/1466,331/1259	52548363	2,12030	1902	4114	6016	SO:0001819	synonymous_variant	540	exon2	Familial Cancer Database		CCCTTCGGCTCCA	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.993C>T	13.37:g.52548363G>A		69.0	0.0		38.0	7.0	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Silent	SNP	ENST00000242839.4	37	CCDS41892.1																																																																																			.		0.532	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32602706	32602706	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:32602706G>T	ENST00000421745.2	+	2	510	c.376G>T	c.(376-378)Gtt>Ttt	p.V126F	BIRC6-AS1_ENST00000455572.1_RNA	NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	126					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGTGGATAAAGTTATATTTGT	0.388																																					p.V126F	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.G376T						.						165.0	155.0	158.0					2																	32602706		2203	4300	6503	SO:0001583	missense	57448	exon2			GATAAAGTTATAT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.376G>T	2.37:g.32602706G>T	ENSP00000393596:p.Val126Phe	167.0	0.0		157.0	37.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	34	5.357197	0.95854	.	.	ENSG00000115760	ENST00000421745	T	0.79141	-1.24	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000001	D	0.85682	0.5753	L	0.53249	1.67	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.87596	0.2494	10	0.87932	D	0	.	17.6933	0.88275	0.0:0.0:1.0:0.0	.	126	Q9NR09	BIRC6_HUMAN	F	126	ENSP00000393596:V126F	ENSP00000393596:V126F	V	+	1	0	BIRC6	32456210	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.731000	0.98807	2.226000	0.72624	0.655000	0.94253	GTT	.		0.388	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BTAF1	9044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	93722349	93722349	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr10:93722349C>G	ENST00000265990.6	+	12	1626	c.1318C>G	c.(1318-1320)Cag>Gag	p.Q440E	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	440					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TGAAGGACTCCAGGATCTTGA	0.313																																					p.Q440E		.											.	BTAF1	92	0			c.C1318G						.						53.0	53.0	53.0					10																	93722349		2203	4300	6503	SO:0001583	missense	9044	exon12			GGACTCCAGGATC	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.1318C>G	10.37:g.93722349C>G	ENSP00000265990:p.Gln440Glu	405.0	0.0		375.0	150.0	NM_003972	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	C	9.298	1.052426	0.19907	.	.	ENSG00000095564	ENST00000265990	T	0.64618	-0.11	6.05	6.05	0.98169	Armadillo-like helical (1);Armadillo-type fold (1);	0.056876	0.64402	D	0.000001	T	0.47173	0.1431	N	0.19112	0.55	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.48293	-0.9048	10	0.02654	T	1	4.064	20.6013	0.99457	0.0:1.0:0.0:0.0	.	440	O14981	BTAF1_HUMAN	E	440	ENSP00000265990:Q440E	ENSP00000265990:Q440E	Q	+	1	0	BTAF1	93712329	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.788000	0.75105	2.878000	0.98634	0.650000	0.86243	CAG	.		0.313	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
C7	730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	40981550	40981550	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr5:40981550A>T	ENST00000313164.9	+	18	2766	c.2407A>T	c.(2407-2409)Agc>Tgc	p.S803C		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	803	Factor I module (FIM) 2.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				AGAAGGGTTTAGCATTTGTGT	0.517																																					p.S803C		.											.	C7	22	0			c.A2407T						.						74.0	76.0	75.0					5																	40981550		2132	4236	6368	SO:0001583	missense	730	exon18			GGGTTTAGCATTT	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2407A>T	5.37:g.40981550A>T	ENSP00000322061:p.Ser803Cys	205.0	0.0		151.0	70.0	NM_000587	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	A	17.51	3.407957	0.62399	.	.	ENSG00000112936	ENST00000313164	T	0.64803	-0.12	5.83	-1.58	0.08479	Factor I / membrane attack complex (1);	1.436230	0.03721	N	0.251895	T	0.55768	0.1941	L	0.46157	1.445	0.09310	N	1	P	0.45176	0.852	P	0.45138	0.471	T	0.47484	-0.9114	10	0.41790	T	0.15	0.8743	3.3023	0.06987	0.3986:0.3284:0.0615:0.2115	.	803	P10643	CO7_HUMAN	C	803	ENSP00000322061:S803C	ENSP00000322061:S803C	S	+	1	0	C7	41017307	0.000000	0.05858	0.000000	0.03702	0.579000	0.36224	0.202000	0.17295	-0.131000	0.11578	0.460000	0.39030	AGC	.		0.517	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317680.1		
CEP120	153241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	122725672	122725672	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr5:122725672C>T	ENST00000306467.5	-	8	1505	c.1201G>A	c.(1201-1203)Gaa>Aaa	p.E401K	CEP120_ENST00000306481.6_Missense_Mutation_p.E375K|CEP120_ENST00000328236.5_Missense_Mutation_p.E401K			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	401					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						ACTTCACTTTCTGTTGCATCA	0.398																																					p.E401K		.											.	CEP120	91	0			c.G1201A						.						184.0	166.0	172.0					5																	122725672		1895	4122	6017	SO:0001583	missense	153241	exon9			CACTTTCTGTTGC	AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.1201G>A	5.37:g.122725672C>T	ENSP00000303058:p.Glu401Lys	339.0	0.0		282.0	100.0	NM_153223	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Missense_Mutation	SNP	ENST00000306467.5	37	CCDS4134.2	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387204	0.61956	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481;ENST00000508442	T;T;T;T	0.51071	2.05;2.05;2.05;0.72	5.28	5.28	0.74379	.	0.063920	0.64402	D	0.000009	T	0.51618	0.1685	M	0.67953	2.075	0.80722	D	1	B	0.28971	0.229	B	0.35114	0.196	T	0.47598	-0.9105	10	0.17832	T	0.49	-7.7679	18.8976	0.92430	0.0:1.0:0.0:0.0	.	401	Q8N960	CE120_HUMAN	K	401;401;375;375	ENSP00000303058:E401K;ENSP00000327504:E401K;ENSP00000307419:E375K;ENSP00000421620:E375K	ENSP00000303058:E401K	E	-	1	0	CEP120	122753571	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	5.658000	0.68003	2.483000	0.83821	0.467000	0.42956	GAA	.		0.398	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250899.2	NM_153223	
CHD4	1108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6692504	6692504	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr12:6692504T>C	ENST00000357008.2	-	26	4083	c.3920A>G	c.(3919-3921)gAa>gGa	p.E1307G	SCARNA11_ENST00000516089.1_RNA|CHD4_ENST00000544040.1_Missense_Mutation_p.E1300G|CHD4_ENST00000309577.6_Missense_Mutation_p.E1307G|CHD4_ENST00000540960.1_5'UTR|CHD4_ENST00000544484.1_Missense_Mutation_p.E1304G|RP5-940J5.6_ENST00000501075.2_RNA	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1307					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						ATCCACACTTTCTTCCTGTTT	0.517																																					p.E1307G	Colon(32;586 792 4568 16848 45314)	.											.	CHD4	228	0			c.A3920G						.						221.0	211.0	214.0					12																	6692504		2203	4300	6503	SO:0001583	missense	1108	exon26			ACACTTTCTTCCT	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3920A>G	12.37:g.6692504T>C	ENSP00000349508:p.Glu1307Gly	180.0	0.0		159.0	55.0	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.762199	0.69763	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.91686	-2.83;-2.89;-2.84;-2.89	5.96	5.96	0.96718	Domain of unknown function DUF1087 (1);	0.000000	0.85682	D	0.000000	D	0.95510	0.8541	M	0.68317	2.08	0.80722	D	1	D;D;P	0.89917	1.0;0.998;0.925	D;D;P	0.85130	0.997;0.987;0.621	D	0.95713	0.8759	10	0.66056	D	0.02	-8.5998	16.4484	0.83959	0.0:0.0:0.0:1.0	.	1307;1307;1300	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	G	1304;1300;1307;1307;1281	ENSP00000440392:E1304G;ENSP00000440542:E1300G;ENSP00000312419:E1307G;ENSP00000349508:E1307G	ENSP00000312419:E1307G	E	-	2	0	CHD4	6562765	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.013000	0.88655	2.285000	0.76669	0.533000	0.62120	GAA	.		0.517	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
CNTNAP3	79937	broad.mit.edu;bcgsc.ca	37	9	39099959	39099959	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr9:39099959C>A	ENST00000297668.6	-	18	3017	c.2944G>T	c.(2944-2946)Gtc>Ttc	p.V982F	CNTNAP3_ENST00000377656.2_Intron|CNTNAP3_ENST00000358144.2_Missense_Mutation_p.V894F	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	982	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TCACAGGTGACCCCCCTGCGT	0.537																																					p.V982F		.											.	CNTNAP3	91	0			c.G2944T						.						33.0	28.0	29.0					9																	39099959		2203	4281	6484	SO:0001583	missense	79937	exon18			AGGTGACCCCCCT	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2944G>T	9.37:g.39099959C>A	ENSP00000297668:p.Val982Phe	285.0	0.0		272.0	117.0	NM_033655	B1AMA0|Q9C0E9	Missense_Mutation	SNP	ENST00000297668.6	37	CCDS6616.1	.	.	.	.	.	.	.	.	.	.	c	5.739	0.320797	0.10845	.	.	ENSG00000106714	ENST00000297668;ENST00000358144	T;T	0.76578	-1.03;-1.03	3.51	-7.02	0.01589	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.31979	0.0814	N	0.00226	-1.805	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.44436	-0.9328	9	0.09338	T	0.73	.	6.5594	0.22478	0.5747:0.2771:0.0:0.1483	.	982;982	Q9BZ76-2;Q9BZ76	.;CNTP3_HUMAN	F	982;894	ENSP00000297668:V982F;ENSP00000350863:V894F	ENSP00000297668:V982F	V	-	1	0	CNTNAP3	39089959	0.001000	0.12720	0.000000	0.03702	0.339000	0.28857	1.172000	0.31908	-1.820000	0.01215	-0.350000	0.07774	GTC	.		0.537	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
COL6A6	131873	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	130286894	130286894	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:130286894G>T	ENST00000358511.6	+	5	1878	c.1847G>T	c.(1846-1848)tGc>tTc	p.C616F	COL6A6_ENST00000453409.2_Missense_Mutation_p.C616F	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	616	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TATGCAGCTTGCAAAGAGATG	0.343																																					p.C616F		.											.	COL6A6	76	0			c.G1847T						.						48.0	46.0	47.0					3																	130286894		1827	4102	5929	SO:0001583	missense	131873	exon5			CAGCTTGCAAAGA	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1847G>T	3.37:g.130286894G>T	ENSP00000351310:p.Cys616Phe	105.0	2.0		78.0	34.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398102	0.62177	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78924	-1.22;-1.22	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000006	D	0.92237	0.7538	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94518	0.7724	10	0.87932	D	0	.	18.5995	0.91242	0.0:0.0:1.0:0.0	.	616	A6NMZ7	CO6A6_HUMAN	F	616	ENSP00000351310:C616F;ENSP00000399236:C616F	ENSP00000351310:C616F	C	+	2	0	COL6A6	131769584	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	6.340000	0.72973	2.506000	0.84524	0.655000	0.94253	TGC	.		0.343	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
DACT1	51339	broad.mit.edu;mdanderson.org	37	14	59112758	59112758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr14:59112758G>T	ENST00000335867.4	+	4	1441	c.1417G>T	c.(1417-1419)Gag>Tag	p.E473*	DACT1_ENST00000541264.2_Nonsense_Mutation_p.E192*|DACT1_ENST00000395153.3_Nonsense_Mutation_p.E436*|DACT1_ENST00000556859.1_Nonsense_Mutation_p.E192*			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	473					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						TGGGACAGGGGAGTCCCCTAA	0.612																																					p.E473X		.											.	DACT1	291	0			c.G1417T						.						53.0	62.0	59.0					14																	59112758		2203	4300	6503	SO:0001587	stop_gained	51339	exon4			ACAGGGGAGTCCC	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1417G>T	14.37:g.59112758G>T	ENSP00000337439:p.Glu473*	29.0	0.0		28.0	8.0	NM_016651	A8MYJ2|Q86TY0	Nonsense_Mutation	SNP	ENST00000335867.4	37	CCDS9736.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451449	0.43531	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	.	.	.	5.35	5.35	0.76521	.	0.268407	0.37053	N	0.002280	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-23.8803	12.417	0.55500	0.0772:0.0:0.9228:0.0	.	.	.	.	X	192;192;436;473;192	.	ENSP00000337439:E473X	E	+	1	0	DACT1	58182511	1.000000	0.71417	0.320000	0.25306	0.035000	0.12851	4.442000	0.59988	2.519000	0.84933	0.563000	0.77884	GAG	.		0.612	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325515.1	NM_016651	
DCAF4L2	138009	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	88885313	88885313	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr8:88885313A>G	ENST00000319675.3	-	1	983	c.887T>C	c.(886-888)cTg>cCg	p.L296P		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	296										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						CAAGTCCCACAGCTTGATAGT	0.488																																					p.L296P		.											.	DCAF4L2	91	0			c.T887C						.						106.0	95.0	99.0					8																	88885313		2203	4300	6503	SO:0001583	missense	138009	exon1			TCCCACAGCTTGA	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.887T>C	8.37:g.88885313A>G	ENSP00000316496:p.Leu296Pro	214.0	0.0		189.0	48.0	NM_152418		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	A	19.99	3.929400	0.73327	.	.	ENSG00000176566	ENST00000319675	T	0.67345	-0.26	1.92	1.92	0.25849	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83871	0.5348	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83456	0.0051	10	0.87932	D	0	.	7.449	0.27227	1.0:0.0:0.0:0.0	.	296	Q8NA75	DC4L2_HUMAN	P	296	ENSP00000316496:L296P	ENSP00000316496:L296P	L	-	2	0	DCAF4L2	88954429	0.998000	0.40836	0.443000	0.26883	0.758000	0.43043	3.314000	0.51943	0.627000	0.30340	0.383000	0.25322	CTG	.		0.488	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84931193	84931193	+	Silent	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:84931193C>T	ENST00000237449.6	+	50	8240	c.8232C>T	c.(8230-8232)gtC>gtT	p.V2744V	DNAH6_ENST00000389394.3_Silent_p.V2744V			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2744	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						ATGGTTAGGTCCGTAACACTG	0.393																																					p.V2744V		.											.	DNAH6	69	0			c.C8232T						.						127.0	103.0	110.0					2																	84931193		692	1591	2283	SO:0001819	synonymous_variant	1768	exon51			TTAGGTCCGTAAC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8232C>T	2.37:g.84931193C>T		73.0	0.0		62.0	29.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.393	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DSCAM	1826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	41719859	41719859	+	Silent	SNP	G	G	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr21:41719859G>T	ENST00000400454.1	-	6	1425	c.948C>A	c.(946-948)gcC>gcA	p.A316A		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	316	Ig-like C2-type 4.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GACTGATGGTGGCTTTCAGTG	0.473																																					p.A316A	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM	101	0			c.C948A						.						50.0	47.0	48.0					21																	41719859		1923	4150	6073	SO:0001819	synonymous_variant	1826	exon6			GATGGTGGCTTTC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.948C>A	21.37:g.41719859G>T		69.0	0.0		56.0	21.0	NM_001271534	O60468	Silent	SNP	ENST00000400454.1	37	CCDS42929.1																																																																																			.		0.473	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
E2F6	1876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	11593707	11593707	+	Splice_Site	SNP	C	C	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:11593707C>G	ENST00000381525.3	-	3	650		c.e3+1		E2F6_ENST00000546212.1_Splice_Site|E2F6_ENST00000307236.4_Splice_Site|E2F6_ENST00000362009.4_Splice_Site|E2F6_ENST00000542100.1_Splice_Site	NM_198256.2	NP_937987.2	O75461	E2F6_HUMAN	E2F transcription factor 6						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|kidney(1)|lung(3)|prostate(1)|skin(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.114)|OV - Ovarian serous cystadenocarcinoma(76;0.168)		AAGCAACTCACATCCATCTAA	0.393																																					.		.											.	E2F6	838	0			c.380+1G>C						.						102.0	98.0	100.0					2																	11593707		1879	4095	5974	SO:0001630	splice_region_variant	1876	exon4			AACTCACATCCAT	AF041381	CCDS1680.2, CCDS62858.1, CCDS62859.1	2p25.1	2008-02-05			ENSG00000169016	ENSG00000169016			3120	protein-coding gene	gene with protein product		602944				9501179	Standard	NM_198256		Approved	E2F-6	uc002rbh.4	O75461	OTTHUMG00000090565	ENST00000381525.3:c.380+1G>C	2.37:g.11593707C>G		186.0	0.0		113.0	38.0	NM_198256	A8K2Z8|G5E936|O60544|Q53QY9|Q6Q9Z6|Q7Z2H6	Splice_Site	SNP	ENST00000381525.3	37	CCDS1680.2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474381	0.84640	.	.	ENSG00000169016	ENST00000381525;ENST00000362009;ENST00000307236;ENST00000542100;ENST00000546212	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5369	0.95256	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	E2F6	11511158	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.723000	0.84788	2.610000	0.88304	0.557000	0.71058	.	.		0.393	E2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207101.2	NM_001952	Intron
EGFR	1956	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	55273125	55273125	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr7:55273125A>T	ENST00000275493.2	+	28	3625	c.3448A>T	c.(3448-3450)Aca>Tca	p.T1150S	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000454757.2_Missense_Mutation_p.T1097S	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	1150					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TGTCAACAGCACATTCGACAG	0.607		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.T1150S		.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR	44910	0			c.A3448T						.						105.0	83.0	91.0					7																	55273125		2203	4300	6503	SO:0001583	missense	1956	exon28	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	AACAGCACATTCG		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.3448A>T	7.37:g.55273125A>T	ENSP00000275493:p.Thr1150Ser	143.0	1.0		129.0	48.0	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	A	2.946	-0.217868	0.06101	.	.	ENSG00000146648	ENST00000395504;ENST00000275493;ENST00000454757	T;T	0.73258	-0.73;-0.73	4.91	-2.06	0.07298	.	2.005160	0.02362	N	0.076992	T	0.54870	0.1885	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45190	-0.9278	10	0.44086	T	0.13	.	9.7672	0.40567	0.462:0.0:0.538:0.0	.	1150	P00533	EGFR_HUMAN	S	1020;1150;1097	ENSP00000275493:T1150S;ENSP00000395243:T1097S	ENSP00000275493:T1150S	T	+	1	0	EGFR	55240619	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.368000	0.20399	-0.629000	0.05575	-1.118000	0.02043	ACA	.		0.607	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
EHHADH	1962	hgsc.bcm.edu;bcgsc.ca	37	3	184910328	184910328	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:184910328G>T	ENST00000231887.3	-	7	1933	c.1858C>A	c.(1858-1860)Ctt>Att	p.L620I	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.L524I	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	620					fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CAGCGTTCAAGGATCTCATCC	0.438																																					p.L620I		.											.	EHHADH	93	0			c.C1858A						.						133.0	125.0	128.0					3																	184910328		2203	4300	6503	SO:0001583	missense	1962	exon7			GTTCAAGGATCTC	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1858C>A	3.37:g.184910328G>T	ENSP00000231887:p.Leu620Ile	123.0	0.0		106.0	7.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742839	0.49151	.	.	ENSG00000113790	ENST00000231887;ENST00000456310	D;D	0.82893	-1.66;-1.66	5.91	5.0	0.66597	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.222293	0.41823	D	0.000801	T	0.78509	0.4294	L	0.39326	1.205	0.80722	D	1	B	0.24043	0.096	B	0.34931	0.192	T	0.73445	-0.3980	10	0.36615	T	0.2	-20.1494	11.4227	0.49991	0.0677:0.1268:0.8056:0.0	.	620	Q08426	ECHP_HUMAN	I	620;524	ENSP00000231887:L620I;ENSP00000387746:L524I	ENSP00000231887:L620I	L	-	1	0	EHHADH	186393022	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	3.613000	0.54152	2.793000	0.96121	0.655000	0.94253	CTT	.		0.438	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	184910910	184910910	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:184910910G>A	ENST00000231887.3	-	7	1351	c.1276C>T	c.(1276-1278)Cac>Tac	p.H426Y	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.H330Y	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	426	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			ATGACCAAGTGAGGACGATCA	0.468																																					p.H426Y		.											.	EHHADH	93	0			c.C1276T						.						133.0	127.0	129.0					3																	184910910		2203	4300	6503	SO:0001583	missense	1962	exon7			CCAAGTGAGGACG	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1276C>T	3.37:g.184910910G>A	ENSP00000231887:p.His426Tyr	194.0	0.0		169.0	15.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.107045	0.56291	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.76448	-1.02;-1.02	6.08	4.19	0.49359	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.501640	0.23067	N	0.052317	T	0.71592	0.3358	L	0.32530	0.975	0.80722	D	1	P	0.43750	0.816	B	0.41691	0.364	T	0.76759	-0.2841	10	0.87932	D	0	-1.1369	16.7901	0.85586	0.0:0.2424:0.7576:0.0	.	426	Q08426	ECHP_HUMAN	Y	426;426;330	ENSP00000231887:H426Y;ENSP00000387746:H330Y	ENSP00000231887:H426Y	H	-	1	0	EHHADH	186393604	1.000000	0.71417	0.988000	0.46212	0.983000	0.72400	2.582000	0.46085	1.545000	0.49373	0.591000	0.81541	CAC	.		0.468	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	184910061	184910061	+	Silent	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:184910061G>A	ENST00000231887.3	-	7	2200	c.2125C>T	c.(2125-2127)Ctg>Ttg	p.L709L	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Silent_p.L613L	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	709					fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CATTCTTTCAGGGGAGGGTTT	0.448																																					p.L709L		.											.	EHHADH	93	0			c.C2125T						.						71.0	78.0	75.0					3																	184910061		2203	4300	6503	SO:0001819	synonymous_variant	1962	exon7			CTTTCAGGGGAGG	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.2125C>T	3.37:g.184910061G>A		146.0	0.0		150.0	12.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Silent	SNP	ENST00000231887.3	37	CCDS33901.1																																																																																			.		0.448	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	184910094	184910094	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:184910094G>C	ENST00000231887.3	-	7	2167	c.2092C>G	c.(2092-2094)Cta>Gta	p.L698V	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.L602V	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	698					fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			AGTTTTTTTAGATAGTCACTT	0.458																																					p.L698V		.											.	EHHADH	93	0			c.C2092G						.						71.0	78.0	76.0					3																	184910094		2202	4300	6502	SO:0001583	missense	1962	exon7			TTTTTAGATAGTC	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.2092C>G	3.37:g.184910094G>C	ENSP00000231887:p.Leu698Val	156.0	0.0		140.0	12.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.323529	0.81580	.	.	ENSG00000113790	ENST00000231887;ENST00000456310	D;D	0.85258	-1.96;-1.96	5.91	5.91	0.95273	3-hydroxyacyl-CoA dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.147361	0.47093	D	0.000252	D	0.94470	0.8220	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94704	0.7886	10	0.72032	D	0.01	-12.2218	20.2985	0.98592	0.0:0.0:1.0:0.0	.	698	Q08426	ECHP_HUMAN	V	698;602	ENSP00000231887:L698V;ENSP00000387746:L602V	ENSP00000231887:L698V	L	-	1	2	EHHADH	186392788	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.533000	0.81994	2.793000	0.96121	0.655000	0.94253	CTA	.		0.458	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	184910834	184910834	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:184910834G>A	ENST00000231887.3	-	7	1427	c.1352C>T	c.(1351-1353)tCt>tTt	p.S451F	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.S355F	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	451	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			AGTGGGGGAAGAGTATTGGCT	0.428																																					p.S451F		.											.	EHHADH	93	0			c.C1352T						.						95.0	98.0	97.0					3																	184910834		2203	4300	6503	SO:0001583	missense	1962	exon7			GGGGAAGAGTATT	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1352C>T	3.37:g.184910834G>A	ENSP00000231887:p.Ser451Phe	184.0	0.0		173.0	11.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193003	0.78902	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.78246	-1.16;-1.16	5.91	5.91	0.95273	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.178330	0.50627	D	0.000105	D	0.88081	0.6341	M	0.72894	2.215	0.80722	D	1	D	0.69078	0.997	D	0.70487	0.969	D	0.88163	0.2859	10	0.87932	D	0	-12.4806	20.2985	0.98592	0.0:0.0:1.0:0.0	.	451	Q08426	ECHP_HUMAN	F	451;451;355	ENSP00000231887:S451F;ENSP00000387746:S355F	ENSP00000231887:S451F	S	-	2	0	EHHADH	186393528	1.000000	0.71417	0.965000	0.40720	0.893000	0.52053	9.280000	0.95786	2.793000	0.96121	0.655000	0.94253	TCT	.		0.428	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	184910913	184910913	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:184910913G>A	ENST00000231887.3	-	7	1348	c.1273C>T	c.(1273-1275)Cct>Tct	p.P425S	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.P329S	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	425	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)	p.P425S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			ACCAAGTGAGGACGATCAGTG	0.473																																					p.P425S		.											.	EHHADH	93	1	Substitution - Missense(1)	skin(1)	c.C1273T						.						137.0	130.0	132.0					3																	184910913		2203	4300	6503	SO:0001583	missense	1962	exon7			AGTGAGGACGATC	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1273C>T	3.37:g.184910913G>A	ENSP00000231887:p.Pro425Ser	193.0	0.0		164.0	13.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624022	0.87560	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.80123	-1.34;-1.34	6.08	6.08	0.98989	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.90123	0.6914	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.89868	0.4021	10	0.87932	D	0	-16.8302	20.6721	0.99693	0.0:0.0:1.0:0.0	.	425	Q08426	ECHP_HUMAN	S	425;425;329	ENSP00000231887:P425S;ENSP00000387746:P329S	ENSP00000231887:P425S	P	-	1	0	EHHADH	186393607	1.000000	0.71417	0.953000	0.39169	0.965000	0.64279	9.224000	0.95209	2.894000	0.99253	0.591000	0.81541	CCT	.		0.473	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	184911086	184911086	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:184911086G>A	ENST00000231887.3	-	7	1175	c.1100C>T	c.(1099-1101)tCa>tTa	p.S367L	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.S271L	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	367	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CTTCACAGATGAAGTTAACCT	0.463																																					p.S367L		.											.	EHHADH	93	0			c.C1100T						.						168.0	165.0	166.0					3																	184911086		2203	4300	6503	SO:0001583	missense	1962	exon7			ACAGATGAAGTTA	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1100C>T	3.37:g.184911086G>A	ENSP00000231887:p.Ser367Leu	176.0	0.0		203.0	14.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	1.388	-0.581509	0.03854	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.77098	-1.07;-1.07	6.08	3.35	0.38373	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.917318	0.09420	N	0.804539	T	0.57227	0.2039	N	0.04355	-0.22	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48692	-0.9013	10	0.46703	T	0.11	-2.2989	8.1777	0.31292	0.3266:0.0:0.6734:0.0	.	367	Q08426	ECHP_HUMAN	L	367;367;271	ENSP00000231887:S367L;ENSP00000387746:S271L	ENSP00000231887:S367L	S	-	2	0	EHHADH	186393780	0.999000	0.42202	0.085000	0.20634	0.925000	0.55904	3.017000	0.49615	0.916000	0.36871	0.591000	0.81541	TCA	.		0.463	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EIF2D	1939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	206772954	206772954	+	Silent	SNP	G	G	A	rs114245341	byFrequency	TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:206772954G>A	ENST00000271764.2	-	10	1273	c.1065C>T	c.(1063-1065)ttC>ttT	p.F355F	EIF2D_ENST00000367114.3_Silent_p.F231F|EIF2D_ENST00000472709.2_5'Flank	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	355					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						CGGGTATGACGAAAGATGTAA	0.532																																					p.F355F		.											.	EIF2D	92	0			c.C1065T						.						65.0	75.0	72.0					1																	206772954		2203	4300	6503	SO:0001819	synonymous_variant	1939	exon10			TATGACGAAAGAT	BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1065C>T	1.37:g.206772954G>A		71.0	0.0		144.0	36.0	NM_006893	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Silent	SNP	ENST00000271764.2	37	CCDS1465.1																																																																																			G|0.999;A|0.001		0.532	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088475.1	NM_006893	
ERF	2077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42753847	42753847	+	Silent	SNP	A	A	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr19:42753847A>C	ENST00000222329.4	-	4	574	c.417T>G	c.(415-417)ggT>ggG	p.G139G	ERF_ENST00000595941.1_5'Flank|ERF_ENST00000440177.2_Silent_p.G64G|AC006486.9_ENST00000594664.1_Intron	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	139					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				GGAAGTGGCTACCACCCGACG	0.657																																					p.G139G		.											.	ERF	658	0			c.T417G						.						39.0	41.0	40.0					19																	42753847		2202	4300	6502	SO:0001819	synonymous_variant	2077	exon4			GTGGCTACCACCC	U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.417T>G	19.37:g.42753847A>C		74.0	0.0		46.0	22.0	NM_006494	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Silent	SNP	ENST00000222329.4	37	CCDS12600.1																																																																																			.		0.657	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463684.1	NM_006494	
FAM205A	259308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34725816	34725816	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr9:34725816A>T	ENST00000378788.3	-	4	1460	c.1421T>A	c.(1420-1422)cTc>cAc	p.L474H		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	474						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GGGGAAGGAGAGCTCATTGAA	0.532																																					p.L474H		.											.	.	.	0			c.T1421A						.						32.0	33.0	33.0					9																	34725816		692	1591	2283	SO:0001583	missense	259308	exon4			AAGGAGAGCTCAT		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.1421T>A	9.37:g.34725816A>T	ENSP00000417711:p.Leu474His	207.0	0.0		296.0	54.0	NM_001141917	A8MVW7	Missense_Mutation	SNP	ENST00000378788.3	37	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	A	8.112	0.779089	0.16120	.	.	ENSG00000205108	ENST00000378788	T	0.08008	3.14	3.53	2.33	0.28932	.	.	.	.	.	T	0.18002	0.0432	L	0.58101	1.795	0.09310	N	1	D	0.76494	0.999	D	0.67548	0.952	T	0.12708	-1.0537	9	0.27082	T	0.32	.	5.7822	0.18312	0.8695:0.0:0.1305:0.0	.	474	Q6ZU69	F205A_HUMAN	H	474	ENSP00000417711:L474H	ENSP00000417711:L474H	L	-	2	0	RP11-195F19.10	34715816	0.789000	0.28775	0.011000	0.14972	0.010000	0.07245	1.675000	0.37555	0.495000	0.27882	0.528000	0.53228	CTC	.		0.532	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
FAM58A	92002	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	152857988	152857988	+	Silent	SNP	G	G	T	rs373107311		TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chrX:152857988G>T	ENST00000406277.2	-	6	729	c.627C>A	c.(625-627)gtC>gtA	p.V209V	FAM58A_ENST00000370175.4_5'UTR	NM_001130997.1|NM_152274.3	NP_001124469.1|NP_689487.2	Q8N1B3	FA58A_HUMAN	family with sequence similarity 58, member A	211					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)					endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCTCAGCCTCGACCTCGGCGG	0.637																																					.		.											.	FAM58A	130	0			.						.						27.0	27.0	27.0					X																	152857988		2203	4298	6501	SO:0001819	synonymous_variant	92002	.			AGCCTCGACCTCG	BC032121	CCDS76054.1	Xq28	2014-08-12	2012-11-30	2012-11-30	ENSG00000147382	ENSG00000262919			28434	protein-coding gene	gene with protein product	"""cyclin M"""	300708				18297069, 24218572	Standard	NM_152274		Approved	MGC29729, FLJ21610	uc011myr.2	Q8N1B3	OTTHUMG00000024206	ENST00000406277.2:c.627C>A	X.37:g.152857988G>T		161.0	0.0		167.0	79.0	.	Q2I380|Q330J9|Q96IU5|Q9BUU1	Silent	SNP	ENST00000406277.2	37																																																																																				.		0.637	FAM58A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152274	
IER3	8870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30709635	30709635	+	IGR	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr6:30709635C>T	ENST00000259874.5	-	0	1244				FLOT1_ENST00000456573.2_Missense_Mutation_p.R18Q|FLOT1_ENST00000470643.1_5'UTR|FLOT1_ENST00000376389.3_Missense_Mutation_p.R18Q|XXbac-BPG252P9.10_ENST00000607333.1_RNA	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3						anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)	1						TGGGGGGCTTCGGCAGAACCC	0.617																																					p.R18Q		.											.	FLOT1	90	0			c.G53A						.						51.0	54.0	53.0					6																	30709635		1509	2708	4217	SO:0001628	intergenic_variant	10211	exon3			GGGCTTCGGCAGA	AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265		6.37:g.30709635C>T		91.0	0.0		80.0	37.0	NM_005803	Q5SU30|Q92691|Q93044	Missense_Mutation	SNP	ENST00000259874.5	37	CCDS4689.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951338	0.53186	.	.	ENSG00000137312	ENST00000376389;ENST00000456573;ENST00000438162;ENST00000445853;ENST00000416018;ENST00000454845	T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29	4.27	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.17152	0.0412	L	0.42632	1.34	0.58432	D	0.999992	B;B	0.26809	0.011;0.16	B;B	0.20184	0.007;0.028	T	0.03344	-1.1046	10	0.29301	T	0.29	-20.1662	14.5746	0.68238	0.0:1.0:0.0:0.0	.	18;18	B4DVY7;O75955	.;FLOT1_HUMAN	Q	18	ENSP00000365569:R18Q;ENSP00000394375:R18Q;ENSP00000400615:R18Q;ENSP00000398834:R18Q;ENSP00000412058:R18Q;ENSP00000391341:R18Q	ENSP00000365569:R18Q	R	-	2	0	FLOT1	30817614	1.000000	0.71417	0.997000	0.53966	0.896000	0.52359	4.946000	0.63576	2.356000	0.79943	0.462000	0.41574	CGA	.		0.617	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076578.2		
FRYL	285527	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	48578067	48578067	+	Missense_Mutation	SNP	C	C	T	rs375943517		TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr4:48578067C>T	ENST00000503238.1	-	21	2700	c.2701G>A	c.(2701-2703)Ggc>Agc	p.G901S	FRYL_ENST00000537810.1_Missense_Mutation_p.G901S|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Missense_Mutation_p.G901S|FRYL_ENST00000507711.1_Missense_Mutation_p.G901S|RNU5E-3P_ENST00000515913.1_RNA			O94915	FRYL_HUMAN	FRY-like	901					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ATGCTATAGCCGCTATCTGGG	0.413																																					p.G901S		.											.	FRYL	69	0			c.G2701A						.	C	SER/GLY	0,3754		0,0,1877	130.0	132.0	131.0		2701	5.3	1.0	4		131	1,8235		0,1,4117	no	missense	FRYL	NM_015030.1	56	0,1,5994	TT,TC,CC		0.0121,0.0,0.0083	benign	901/3014	48578067	1,11989	1877	4118	5995	SO:0001583	missense	285527	exon24			TATAGCCGCTATC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.2701G>A	4.37:g.48578067C>T	ENSP00000426064:p.Gly901Ser	89.0	0.0		71.0	5.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	ENST00000503238.1	37	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	C	6.082	0.383411	0.11524	0.0	1.21E-4	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.26	5.26	0.73747	.	0.000000	0.85682	U	0.000000	T	0.45597	0.1350	N	0.12182	0.205	0.80722	D	1	D;B	0.89917	1.0;0.158	D;B	0.85130	0.997;0.022	T	0.34079	-0.9843	10	0.10902	T	0.67	.	18.8613	0.92273	0.0:1.0:0.0:0.0	.	901;901	F2Z2S2;O94915	.;FRYL_HUMAN	S	901	ENSP00000426064:G901S;ENSP00000351113:G901S;ENSP00000441114:G901S;ENSP00000421584:G901S	ENSP00000351113:G901S	G	-	1	0	FRYL	48272824	1.000000	0.71417	0.984000	0.44739	0.082000	0.17680	5.743000	0.68655	2.430000	0.82344	0.467000	0.42956	GGC	.		0.413	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
GFRAL	389400	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	55198738	55198738	+	Silent	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr6:55198738A>G	ENST00000340465.2	+	3	398	c.312A>G	c.(310-312)aaA>aaG	p.K104K		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	104					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			GTATCAATAAATCAGGTAATA	0.274																																					p.K104K		.											.	GFRAL	154	0			c.A312G						.						73.0	78.0	76.0					6																	55198738		2203	4298	6501	SO:0001819	synonymous_variant	389400	exon3			CAATAAATCAGGT	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.312A>G	6.37:g.55198738A>G		32.0	0.0		20.0	11.0	NM_207410	Q5VTF6	Silent	SNP	ENST00000340465.2	37	CCDS4957.1																																																																																			.		0.274	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	
HEATR5B	54497	broad.mit.edu;bcgsc.ca	37	2	37283748	37283748	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:37283748T>C	ENST00000233099.5	-	16	2329	c.2234A>G	c.(2233-2235)aAc>aGc	p.N745S	HEATR5B_ENST00000354531.2_Missense_Mutation_p.N745S	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	745						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				AGAGGCACTGTTTGGCTGGAG	0.438																																					p.N745S		.											.	HEATR5B	142	0			c.A2234G						.						63.0	68.0	66.0					2																	37283748		2202	4300	6502	SO:0001583	missense	54497	exon16			GCACTGTTTGGCT	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2234A>G	2.37:g.37283748T>C	ENSP00000233099:p.Asn745Ser	149.0	0.0		147.0	6.0	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	T	9.219	1.032875	0.19590	.	.	ENSG00000008869	ENST00000233099;ENST00000354531;ENST00000424416	T;T	0.43688	0.94;0.95	5.59	4.42	0.53409	Armadillo-type fold (1);	0.038431	0.85682	D	0.000000	T	0.30448	0.0765	L	0.47190	1.495	0.58432	D	0.999999	B	0.32338	0.365	B	0.28465	0.09	T	0.06516	-1.0822	10	0.06236	T	0.91	-19.0103	11.9266	0.52823	0.1305:0.0:0.0:0.8694	.	745	Q9P2D3	HTR5B_HUMAN	S	745	ENSP00000233099:N745S;ENSP00000346531:N745S	ENSP00000233099:N745S	N	-	2	0	HEATR5B	37137252	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.996000	0.88334	0.923000	0.37045	0.533000	0.62120	AAC	.		0.438	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
IDUA	3425	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	994398	994398	+	Splice_Site	SNP	A	A	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr4:994398A>T	ENST00000247933.4	+	3	387		c.e3-1		IDUA_ENST00000453894.1_Splice_Site|IDUA_ENST00000514224.1_Splice_Site	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-						carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTCCTTCTGCAGGGGGTCCAC	0.642																																					.		.											.	IDUA	91	0			c.300-2A>T						.						61.0	58.0	59.0					4																	994398		2202	4300	6502	SO:0001630	splice_region_variant	3425	exon3			TTCTGCAGGGGGT	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.300-1A>T	4.37:g.994398A>T		223.0	0.0		212.0	87.0	NM_000203	B3KWK6	Splice_Site	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	a	12.72	2.022489	0.35701	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000502910;ENST00000504568;ENST00000514192;ENST00000509948	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8626	0.46835	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IDUA	984398	0.998000	0.40836	0.035000	0.18076	0.005000	0.04900	4.905000	0.63286	1.811000	0.52892	0.456000	0.33151	.	.		0.642	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	Intron
KIF1A	547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	241712532	241712532	+	Splice_Site	SNP	G	G	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:241712532G>C	ENST00000320389.7	-	13	1337	c.1179C>G	c.(1177-1179)gaC>gaG	p.D393E	KIF1A_ENST00000498729.2_Splice_Site_p.D393E	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	393					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGCACTCACTGTCAGTGATGT	0.617																																					p.D393E		.											.	KIF1A	91	0			c.C1179G						.						41.0	45.0	44.0					2																	241712532		2155	4266	6421	SO:0001630	splice_region_variant	547	exon13			CTCACTGTCAGTG	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.1180+1C>G	2.37:g.241712532G>C		114.0	0.0		87.0	34.0	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.61|10.61	1.398812|1.398812	0.25291|0.25291	.|.	.|.	ENSG00000130294|ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283|ENST00000428768	T;T;T|.	0.71698|.	-0.46;-0.51;-0.59|.	3.83|3.83	2.92|2.92	0.33932|0.33932	.|.	0.112561|.	0.64402|.	U|.	0.000015|.	T|T	0.48132|0.48132	0.1483|0.1483	N|N	0.21373|0.21373	0.66|0.66	0.45366|0.45366	D|D	0.998354|0.998354	B;B;B|.	0.09022|.	0.002;0.002;0.001|.	B;B;B|.	0.12837|.	0.008;0.003;0.004|.	T|T	0.27938|0.27938	-1.0059|-1.0059	10|5	0.06365|.	T|.	0.9|.	.|.	12.3594|12.3594	0.55194|0.55194	0.0:0.0:0.8296:0.1704|0.0:0.0:0.8296:0.1704	.|.	393;393;393|.	F5H045;Q12756-2;Q12756|.	.;.;KIF1A_HUMAN|.	E|D	393|201	ENSP00000322791:D393E;ENSP00000438388:D393E;ENSP00000384231:D393E|.	ENSP00000322791:D393E|.	D|H	-|-	3|1	2|0	KIF1A|KIF1A	241361205|241361205	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.531000|0.531000	0.34715|0.34715	1.234000|1.234000	0.32660|0.32660	0.568000|0.568000	0.29311|0.29311	-0.500000|-0.500000	0.04577|0.04577	GAC|CAC	.		0.617	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	Missense_Mutation
KRT27	342574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38933922	38933922	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr17:38933922C>A	ENST00000301656.3	-	6	1075	c.1035G>T	c.(1033-1035)caG>caT	p.Q345H	KRT27_ENST00000540723.1_5'UTR	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				GAGCCTGGATCTGTGCCAGCT	0.537																																					p.Q345H		.											.	KRT27	90	0			c.G1035T						.						159.0	160.0	159.0					17																	38933922		2203	4300	6503	SO:0001583	missense	342574	exon6			CTGGATCTGTGCC	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.1035G>T	17.37:g.38933922C>A	ENSP00000301656:p.Gln345His	145.0	0.0		133.0	69.0	NM_181537		Missense_Mutation	SNP	ENST00000301656.3	37	CCDS11375.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366662	0.41902	.	.	ENSG00000171446	ENST00000301656	D	0.89196	-2.48	5.7	0.856	0.19019	Filament (1);	0.096934	0.46145	N	0.000316	D	0.87330	0.6150	M	0.78344	2.41	0.32477	N	0.542004	B	0.18863	0.031	B	0.30316	0.114	D	0.84862	0.0820	10	0.62326	D	0.03	.	7.2399	0.26090	0.0:0.5836:0.1231:0.2934	.	345	Q7Z3Y8	K1C27_HUMAN	H	345	ENSP00000301656:Q345H	ENSP00000301656:Q345H	Q	-	3	2	KRT27	36187448	0.989000	0.36119	1.000000	0.80357	0.824000	0.46624	0.527000	0.22987	0.425000	0.26087	0.650000	0.86243	CAG	.		0.537	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
LOXL4	84171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	100017553	100017553	+	Missense_Mutation	SNP	G	G	T	rs11189525	byFrequency	TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr10:100017553G>T	ENST00000260702.3	-	8	1264	c.1114C>A	c.(1114-1116)Ccc>Acc	p.P372T	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	372	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.		P -> T (in dbSNP:rs11189525).			extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		AGGTGGATGGGCCCTAGCCCT	0.592													G|||	13	0.00259585	0.0	0.0	5008	,	,		19283	0.0129		0.0	False		,,,				2504	0.0				p.P372T		.											.	LOXL4	230	0			c.C1114A						.	G	THR/PRO	0,4406		0,0,2203	77.0	66.0	70.0		1114	4.9	1.0	10	dbSNP_120	70	1,8599	1.2+/-3.3	0,1,4299	yes	missense	LOXL4	NM_032211.6	38	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	372/757	100017553	1,13005	2203	4300	6503	SO:0001583	missense	84171	exon8			GGATGGGCCCTAG	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1114C>A	10.37:g.100017553G>T	ENSP00000260702:p.Pro372Thr	144.0	0.0		133.0	59.0	NM_032211	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	ENST00000260702.3	37	CCDS7473.1	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	G	18.89	3.718656	0.68844	0.0	1.16E-4	ENSG00000138131	ENST00000260702	T	0.43688	0.94	4.93	4.93	0.64822	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.154856	0.64402	D	0.000015	T	0.37517	0.1006	L	0.60957	1.885	0.58432	D	0.999998	B	0.14805	0.011	B	0.24701	0.055	T	0.43310	-0.9399	10	0.72032	D	0.01	.	18.1361	0.89619	0.0:0.0:1.0:0.0	rs11189525;rs11189525	372	Q96JB6	LOXL4_HUMAN	T	372	ENSP00000260702:P372T	ENSP00000260702:P372T	P	-	1	0	LOXL4	100007543	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.813000	0.99286	2.278000	0.76064	0.542000	0.68232	CCC	G|0.998;T|0.002		0.592	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049766.1	NM_032211	
LRFN5	145581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	42357103	42357103	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr14:42357103A>T	ENST00000298119.4	+	3	2464	c.1275A>T	c.(1273-1275)gaA>gaT	p.E425D	LRFN5_ENST00000554120.1_Missense_Mutation_p.E425D|LRFN5_ENST00000554171.1_Missense_Mutation_p.E425D	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	425	Fibronectin type-III.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGGTGGCAGAAGCTACATCAT	0.358										HNSCC(30;0.082)																											p.E425D		.											.	LRFN5	97	0			c.A1275T						.						71.0	69.0	69.0					14																	42357103		2203	4300	6503	SO:0001583	missense	145581	exon3			GGCAGAAGCTACA	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1275A>T	14.37:g.42357103A>T	ENSP00000298119:p.Glu425Asp	166.0	0.0		141.0	59.0	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	9.907	1.208354	0.22205	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.68765	-0.35;0.62;0.62	5.4	1.74	0.24563	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000018	T	0.59390	0.2190	M	0.62723	1.935	0.45867	D	0.998723	B;B	0.18013	0.002;0.025	B;B	0.21917	0.015;0.037	T	0.51020	-0.8758	10	0.37606	T	0.19	.	8.3374	0.32224	0.7634:0.0:0.2366:0.0	.	425;425	G3V364;Q96NI6	.;LRFN5_HUMAN	D	425	ENSP00000298119:E425D;ENSP00000451897:E425D;ENSP00000451067:E425D	ENSP00000298119:E425D	E	+	3	2	LRFN5	41426853	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.915000	0.48805	0.108000	0.17862	-0.376000	0.06991	GAA	.		0.358	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
LRRC3	81543	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	45876637	45876638	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr21:45876637_45876638insC	ENST00000291592.4	+	2	427_428	c.110_111insC	c.(109-114)tgccggfs	p.R38fs	LRRC3-AS1_ENST00000426578.1_RNA	NM_030891.3	NP_112153.1	Q9BY71	LRRC3_HUMAN	leucine rich repeat containing 3	38	LRRNT.					integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		CCACAGCCCTGCCGGTGCCCTG	0.693																																					p.C37fs		.											.	LRRC3	90	0			c.110_111insC						.																																			SO:0001589	frameshift_variant	81543	exon2			AGCCCTGCCGGTG	AB058646	CCDS13711.1	21q22.3	2011-12-07	2002-06-20		ENSG00000160233	ENSG00000160233			14965	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 102"""	C21orf102		12036297	Standard	NM_030891		Approved		uc002zfa.3	Q9BY71	OTTHUMG00000040847	ENST00000291592.4:c.112dupC	21.37:g.45876639_45876639dupC	ENSP00000291592:p.Arg38fs	46.0	0.0		33.0	10.0	NM_030891	Q0VDJ2	Frame_Shift_Ins	INS	ENST00000291592.4	37	CCDS13711.1																																																																																			.		0.693	LRRC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098095.3		
MESDC2	23184	broad.mit.edu;mdanderson.org	37	15	81282119	81282119	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr15:81282119C>T	ENST00000261758.4	-	1	100	c.14G>A	c.(13-15)aGg>aAg	p.R5K	RP11-775C24.3_ENST00000563737.1_lincRNA	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	5	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						GCGCGCCCACCTGGAAGCCGC	0.706																																					p.R5K		.											.	MESDC2	90	0			c.G14A						.																																			SO:0001583	missense	23184	exon1			GCCCACCTGGAAG	D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.14G>A	15.37:g.81282119C>T	ENSP00000261758:p.Arg5Lys	23.0	0.0		9.0	3.0	NM_015154	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	ENST00000261758.4	37	CCDS32308.1	.	.	.	.	.	.	.	.	.	.	C	6.974	0.549751	0.13374	.	.	ENSG00000117899	ENST00000422879;ENST00000261758	.	.	.	4.13	0.902	0.19290	.	1.422520	0.04612	N	0.400480	T	0.30135	0.0755	N	0.24115	0.695	0.09310	N	1	B	0.13594	0.008	B	0.10450	0.005	T	0.21999	-1.0229	9	0.27785	T	0.31	-27.4048	8.3165	0.32104	0.1672:0.5089:0.3239:0.0	.	5	Q14696	MESD_HUMAN	K	5	.	ENSP00000261758:R5K	R	-	2	0	MESDC2	79069174	0.048000	0.20356	0.081000	0.20488	0.003000	0.03518	0.182000	0.16900	0.078000	0.16900	-0.463000	0.05309	AGG	.		0.706	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417673.2	NM_015154	
MIR194-2	406970	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	64658908	64658908	+	lincRNA	SNP	A	A	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr11:64658908A>C	ENST00000601517.1	-	0	0				MIR194-2_ENST00000384864.1_lincRNA|MIR192_ENST00000384915.1_RNA																							GGGGGCGGGAACCAATTGGAG	0.647																																					.		.											.	.	.	0			.						.						11.0	13.0	13.0					11																	64658908		1562	3572	5134			406970	.			GCGGGAACCAATT																													11.37:g.64658908A>C		112.0	1.0		102.0	30.0	.		RNA	SNP	ENST00000601517.1	37																																																																																				.		0.647	RP11-665N17.4-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000464673.1		
NT5C3A	51251	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	33054407	33054407	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr7:33054407C>A	ENST00000242210.7	-	9	1022	c.946G>T	c.(946-948)Gat>Tat	p.D316Y	NT5C3A_ENST00000381626.2_Missense_Mutation_p.D265Y|AVL9_ENST00000404479.1_Intron|NT5C3A_ENST00000610140.1_Missense_Mutation_p.D311Y|NT5C3A_ENST00000396152.2_Missense_Mutation_p.D277Y|NT5C3A_ENST00000409467.1_Missense_Mutation_p.D265Y|NT5C3A_ENST00000405342.1_Missense_Mutation_p.D277Y	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	316					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										AAAACAATATCATAAGAGTCC	0.338																																					p.D316Y		.											.	.	.	0			c.G946T						.						92.0	95.0	94.0					7																	33054407		2203	4298	6501	SO:0001583	missense	0	exon9			CAATATCATAAGA	AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.946G>T	7.37:g.33054407C>A	ENSP00000242210:p.Asp316Tyr	46.0	0.0		46.0	8.0	NM_001002010	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Missense_Mutation	SNP	ENST00000242210.7	37	CCDS34616.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891382	0.91889	.	.	ENSG00000122643	ENST00000381626;ENST00000396152;ENST00000242210;ENST00000405342;ENST00000409467	D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54	5.94	5.94	0.96194	HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.96291	0.8790	M	0.94063	3.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.991	D	0.96512	0.9379	10	0.87932	D	0	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	316;277	Q9H0P0;Q9H0P0-1	5NT3_HUMAN;.	Y	265;277;316;277;265	ENSP00000371039:D265Y;ENSP00000379456:D277Y;ENSP00000242210:D316Y;ENSP00000385261:D277Y;ENSP00000387166:D265Y	ENSP00000242210:D316Y	D	-	1	0	NT5C3	33020932	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.818000	0.86416	2.820000	0.97059	0.650000	0.86243	GAT	.		0.338	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328880.1	NM_016489	
MRPS33	51650	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	140710231	140710231	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr7:140710231A>G	ENST00000393008.3	-	2	358	c.203T>C	c.(202-204)cTt>cCt	p.L68P	MRPS33_ENST00000472343.1_5'Flank|MRPS33_ENST00000496958.1_Missense_Mutation_p.L68P|MRPS33_ENST00000467334.1_Missense_Mutation_p.L58P|MRPS33_ENST00000324787.5_Missense_Mutation_p.L68P|MRPS33_ENST00000469351.1_Missense_Mutation_p.L68P	NM_016071.3	NP_057155.1	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	68					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(1)|kidney(1)	4	Melanoma(164;0.00956)					GTAGAGTCCAAGAAATCGGAG	0.408																																					p.L68P		.											.	MRPS33	90	0			c.T203C						.						133.0	129.0	130.0					7																	140710231		2203	4300	6503	SO:0001583	missense	51650	exon2			AGTCCAAGAAATC	AF078858	CCDS5864.1	7q34	2012-09-13			ENSG00000090263	ENSG00000090263		"""Mitochondrial ribosomal proteins / small subunits"""	16634	protein-coding gene	gene with protein product		611993				11279123, 10810093	Standard	NM_016071		Approved	CGI-139	uc003vwe.4	Q9Y291	OTTHUMG00000157456	ENST00000393008.3:c.203T>C	7.37:g.140710231A>G	ENSP00000376732:p.Leu68Pro	179.0	1.0		139.0	58.0	NM_016071		Missense_Mutation	SNP	ENST00000393008.3	37	CCDS5864.1	.	.	.	.	.	.	.	.	.	.	A	11.00	1.509321	0.27036	.	.	ENSG00000090263	ENST00000544013;ENST00000393008;ENST00000324787;ENST00000496958;ENST00000469351;ENST00000467334	.	.	.	5.1	-0.96	0.10340	.	1.159410	0.06200	N	0.683063	T	0.63129	0.2485	M	0.66939	2.045	0.27966	N	0.936607	D	0.69078	0.997	P	0.61658	0.892	T	0.59815	-0.7383	9	0.66056	D	0.02	-17.493	11.8089	0.52171	0.3861:0.0:0.0:0.6139	.	68	Q9Y291	RT33_HUMAN	P	68;68;68;68;68;58	.	ENSP00000320567:L68P	L	-	2	0	MRPS33	140356700	0.232000	0.23762	0.015000	0.15790	0.212000	0.24457	2.618000	0.46393	-0.005000	0.14395	0.383000	0.25322	CTT	.		0.408	MRPS33-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348878.1	NM_053035	
PARD3	56288	ucsc.edu;bcgsc.ca	37	10	34636998	34636998	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr10:34636998T>C	ENST00000374789.3	-	15	2438	c.2113A>G	c.(2113-2115)Aca>Gca	p.T705A	PARD3_ENST00000544292.1_Missense_Mutation_p.T422A|PARD3_ENST00000346874.4_Missense_Mutation_p.T705A|PARD3_ENST00000374773.1_Missense_Mutation_p.T705A|PARD3_ENST00000545693.1_Missense_Mutation_p.T692A|PARD3_ENST00000374794.3_Missense_Mutation_p.T648A|PARD3_ENST00000374788.3_Missense_Mutation_p.T705A|PARD3_ENST00000350537.4_Missense_Mutation_p.T692A|PARD3_ENST00000340077.5_Missense_Mutation_p.T705A|PARD3_ENST00000545260.1_Missense_Mutation_p.T648A|PARD3_ENST00000374768.1_Missense_Mutation_p.T143A|PARD3_ENST00000374790.3_Missense_Mutation_p.T648A|PARD3_ENST00000374776.1_Missense_Mutation_p.T692A	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	705					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				TCCAACGCTGTTTCAATGGGC	0.517																																					p.T705A		.											.	PARD3	92	0			c.A2113G						.						80.0	80.0	80.0					10																	34636998		2203	4300	6503	SO:0001583	missense	56288	exon15			ACGCTGTTTCAAT	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2113A>G	10.37:g.34636998T>C	ENSP00000363921:p.Thr705Ala	43.0	0.0		43.0	4.0	NM_001184792	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	T	13.01	2.109527	0.37242	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292;ENST00000374768	T;T;T;T;T;T;T;T;T;T;T;T;T	0.18174	2.55;2.65;2.63;2.62;2.67;2.62;2.65;2.58;2.32;2.23;2.37;2.26;2.44	5.66	5.66	0.87406	.	0.154150	0.64402	D	0.000010	T	0.23846	0.0577	L	0.50333	1.59	0.40126	D	0.976662	B;P;P;B;P;B;B;B;B;B;B;B;B;B;B	0.39717	0.128;0.644;0.684;0.028;0.684;0.128;0.128;0.007;0.007;0.017;0.079;0.065;0.03;0.013;0.016	B;B;P;B;P;B;B;B;B;B;B;B;B;B;B	0.49332	0.106;0.198;0.607;0.053;0.607;0.106;0.106;0.007;0.024;0.024;0.027;0.03;0.02;0.03;0.013	T	0.04537	-1.0944	10	0.12103	T	0.63	.	11.8776	0.52556	0.1307:0.0:0.0:0.8693	.	648;648;692;692;692;705;705;705;648;692;705;705;692;705;422	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	A	692;648;705;705;705;648;692;648;692;705;705;422;143	ENSP00000443147:T692A;ENSP00000440857:T648A;ENSP00000363921:T705A;ENSP00000363920:T705A;ENSP00000340591:T705A;ENSP00000363926:T648A;ENSP00000311986:T692A;ENSP00000363922:T648A;ENSP00000363908:T692A;ENSP00000341844:T705A;ENSP00000363905:T705A;ENSP00000444429:T422A;ENSP00000363900:T143A	ENSP00000341844:T705A	T	-	1	0	PARD3	34677004	1.000000	0.71417	0.430000	0.26722	0.964000	0.63967	3.823000	0.55715	2.279000	0.76181	0.533000	0.62120	ACA	.		0.517	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140222268	140222268	+	Silent	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr5:140222268G>A	ENST00000531613.1	+	1	1362	c.1362G>A	c.(1360-1362)gcG>gcA	p.A454A	PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.A454A|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	454	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCTCCGGCGTTCGCGCAGC	0.662																																					p.A454A		.											.	PCDHA8	92	0			c.G1362A						.						61.0	62.0	62.0					5																	140222268		2194	4266	6460	SO:0001819	synonymous_variant	56140	exon1			TCCGGCGTTCGCG	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1362G>A	5.37:g.140222268G>A		428.0	0.0		353.0	142.0	NM_031856	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																			.		0.662	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82580517	82580517	+	Silent	SNP	T	T	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr7:82580517T>G	ENST00000333891.9	-	6	9724	c.9387A>C	c.(9385-9387)tcA>tcC	p.S3129S	PCLO_ENST00000423517.2_Silent_p.S3129S|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGGCAGGTAATGAAGTCACTG	0.448																																					p.S3129S		.											.	PCLO	29	0			c.A9387C						.						67.0	69.0	69.0					7																	82580517		2025	4193	6218	SO:0001819	synonymous_variant	27445	exon6			AGGTAATGAAGTC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9387A>C	7.37:g.82580517T>G		184.0	0.0		153.0	57.0	NM_014510		Silent	SNP	ENST00000333891.9	37	CCDS47630.1																																																																																			.		0.448	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PTPN9	5780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75798215	75798215	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr15:75798215G>C	ENST00000306726.2	-	7	1281	c.769C>G	c.(769-771)Cac>Gac	p.H257D	PTPN9_ENST00000564970.1_5'Flank	NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	257					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGATCTGGGTGGCCGTTCACC	0.537																																					p.H257D		.											.	PTPN9	226	0			c.C769G						.						107.0	99.0	102.0					15																	75798215		2197	4294	6491	SO:0001583	missense	5780	exon7			CTGGGTGGCCGTT		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.769C>G	15.37:g.75798215G>C	ENSP00000303554:p.His257Asp	203.0	0.0		207.0	83.0	NM_002833	Q53XR9	Missense_Mutation	SNP	ENST00000306726.2	37	CCDS10280.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852465	0.51270	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	D	0.84516	-1.86	5.92	5.92	0.95590	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.140551	0.64402	D	0.000007	T	0.77772	0.4180	L	0.44542	1.39	0.39792	D	0.972457	P	0.48764	0.915	B	0.36922	0.236	T	0.77253	-0.2656	10	0.23302	T	0.38	.	14.2346	0.65916	0.0:0.0:0.851:0.149	.	257	P43378	PTN9_HUMAN	D	257;247	ENSP00000303554:H257D	ENSP00000303554:H257D	H	-	1	0	PTPN9	73585270	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.006000	0.57083	2.822000	0.97130	0.650000	0.86243	CAC	.		0.537	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		
RAPH1	65059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	204304792	204304792	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:204304792G>A	ENST00000319170.5	-	14	3420	c.3121C>T	c.(3121-3123)Ctc>Ttc	p.L1041F	RAPH1_ENST00000374493.3_Missense_Mutation_p.L1093F|RAPH1_ENST00000457812.1_Intron|ABI2_ENST00000295851.5_3'UTR	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1041					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCTTGTTGGAGAACTCCAGGA	0.537																																					p.L1041F		.											.	RAPH1	1151	0			c.C3121T						.						44.0	51.0	48.0					2																	204304792		2203	4300	6503	SO:0001583	missense	65059	exon14			GTTGGAGAACTCC	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3121C>T	2.37:g.204304792G>A	ENSP00000316543:p.Leu1041Phe	114.0	0.0		64.0	22.0	NM_213589	Q96Q37|Q9C0I2	Missense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.982762	0.34942	.	.	ENSG00000173166	ENST00000319170;ENST00000374493	T;T	0.57436	0.4;0.43	4.38	4.38	0.52667	.	.	.	.	.	T	0.36386	0.0965	N	0.17082	0.46	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.27226	-1.0080	9	0.66056	D	0.02	.	10.9302	0.47213	0.088:0.0:0.912:0.0	.	1041	Q70E73	RAPH1_HUMAN	F	1041;1093	ENSP00000316543:L1041F;ENSP00000363617:L1093F	ENSP00000316543:L1041F	L	-	1	0	RAPH1	204013037	1.000000	0.71417	0.020000	0.16555	0.483000	0.33249	4.034000	0.57289	2.164000	0.68074	0.313000	0.20887	CTC	.		0.537	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
RBM19	9904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	114386746	114386746	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr12:114386746C>T	ENST00000545145.2	-	10	1246	c.1168G>A	c.(1168-1170)Ggg>Agg	p.G390R	RBM19_ENST00000392561.3_Missense_Mutation_p.G390R|RBM19_ENST00000261741.5_Missense_Mutation_p.G390R	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	390					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G390W(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TCGTTCTCCCCGAGTATCCGG	0.577																																					p.G390R		.											.	RBM19	95	2	Substitution - Missense(2)	lung(2)	c.G1168A						.						190.0	184.0	186.0					12																	114386746		2203	4300	6503	SO:0001583	missense	9904	exon10			TCTCCCCGAGTAT	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1168G>A	12.37:g.114386746C>T	ENSP00000442053:p.Gly390Arg	321.0	0.0		260.0	93.0	NM_001146699	A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	37	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	C	8.335	0.827432	0.16749	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.06371	3.31;3.31;3.31	4.33	2.12	0.27331	Nucleotide-binding, alpha-beta plait (1);	0.242933	0.40728	N	0.001039	T	0.04497	0.0123	L	0.38531	1.155	0.29189	N	0.875971	B	0.18461	0.028	B	0.13407	0.009	T	0.32771	-0.9894	10	0.19590	T	0.45	-28.3677	5.452	0.16570	0.0:0.5618:0.0:0.4382	.	390	Q9Y4C8	RBM19_HUMAN	R	390	ENSP00000442053:G390R;ENSP00000376344:G390R;ENSP00000261741:G390R	ENSP00000261741:G390R	G	-	1	0	RBM19	112871129	0.999000	0.42202	0.936000	0.37596	0.387000	0.30353	3.592000	0.53993	0.820000	0.34516	0.561000	0.74099	GGG	.		0.577	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
RNF123	63891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49739578	49739578	+	Splice_Site	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr3:49739578G>A	ENST00000327697.6	+	18	1701		c.e18+1		RNF123_ENST00000432042.1_Splice_Site	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TGACAATGGGGTGAGTGACTC	0.592																																					.		.											.	RNF123	584	0			c.1557+1G>A						.						63.0	63.0	63.0					3																	49739578		2203	4300	6503	SO:0001630	splice_region_variant	63891	exon18			AATGGGGTGAGTG	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1557+1G>A	3.37:g.49739578G>A		176.0	0.0		168.0	63.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Splice_Site	SNP	ENST00000327697.6	37	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639577	0.67244	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8474	0.57837	0.0815:0.0:0.9185:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF123	49714582	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	4.959000	0.63666	2.371000	0.80710	0.561000	0.74099	.	.		0.592	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	Intron
RNF17	56163	ucsc.edu;bcgsc.ca	37	13	25439064	25439064	+	Silent	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr13:25439064A>G	ENST00000255324.5	+	29	4081	c.4029A>G	c.(4027-4029)ggA>ggG	p.G1343G	RNF17_ENST00000381921.1_Intron|RNF17_ENST00000339524.3_Intron	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1343					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ATTTTGATGGAATGTCACTTT	0.289																																					p.G1343G		.											.	RNF17	228	0			c.A4029G						.						92.0	95.0	94.0					13																	25439064		2201	4285	6486	SO:0001819	synonymous_variant	56163	exon29			TGATGGAATGTCA	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.4029A>G	13.37:g.25439064A>G		50.0	0.0		45.0	4.0	NM_031277	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	37	CCDS9308.2																																																																																			.		0.289	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
SELE	6401	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	169696929	169696929	+	Silent	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:169696929A>G	ENST00000333360.7	-	9	1558	c.1419T>C	c.(1417-1419)ctT>ctC	p.L473L	SELE_ENST00000367774.1_Intron|SELE_ENST00000367777.1_Intron|SELE_ENST00000367781.4_Silent_p.L410L|SELE_ENST00000367775.1_Silent_p.L348L|SELE_ENST00000367779.4_Intron|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367776.1_Silent_p.L410L|SELE_ENST00000367782.4_Intron|SELE_ENST00000367780.4_Silent_p.L348L	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	473	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	ATGTGCACTCAAGTTGAGTTG	0.448																																					p.L473L		.											.	SELE	95	0			c.T1419C						.						134.0	128.0	130.0					1																	169696929		2203	4300	6503	SO:0001819	synonymous_variant	6401	exon9			GCACTCAAGTTGA	M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1419T>C	1.37:g.169696929A>G		261.0	0.0		312.0	96.0	NM_000450	A2RRD6|P16111	Silent	SNP	ENST00000333360.7	37	CCDS1283.1																																																																																			.		0.448	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084333.1	NM_000450	
SH2D4A	63898	ucsc.edu;bcgsc.ca	37	8	19218714	19218714	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr8:19218714A>G	ENST00000265807.3	+	6	1006	c.595A>G	c.(595-597)Aag>Gag	p.K199E	SH2D4A_ENST00000518040.1_Splice_Site_p.K154E|SH2D4A_ENST00000519207.1_Splice_Site_p.K199E	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	199					negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		tttTAAACAGAAGAAAGAATC	0.348																																					p.K199E		.											.	SH2D4A	90	0			c.A595G						.						30.0	32.0	31.0					8																	19218714		2203	4300	6503	SO:0001630	splice_region_variant	63898	exon6			AAACAGAAGAAAG	AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.595-1A>G	8.37:g.19218714A>G		50.0	0.0		28.0	4.0	NM_022071	B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Missense_Mutation	SNP	ENST00000265807.3	37	CCDS6009.1	.	.	.	.	.	.	.	.	.	.	A	16.12	3.031907	0.54790	.	.	ENSG00000104611	ENST00000265807;ENST00000518040;ENST00000519207;ENST00000523736	T;T;T;T	0.14144	2.73;2.53;2.73;2.53	5.61	5.61	0.85477	.	0.480463	0.22193	N	0.063343	T	0.07052	0.0179	N	0.08118	0	0.33001	D	0.526228	P;B	0.35077	0.483;0.294	B;B	0.30943	0.122;0.057	T	0.26780	-1.0093	10	0.27785	T	0.31	.	12.1915	0.54275	1.0:0.0:0.0:0.0	.	154;199	B4DDR1;Q9H788	.;SH24A_HUMAN	E	199;154;199;158	ENSP00000265807:K199E;ENSP00000429482:K154E;ENSP00000428684:K199E;ENSP00000428048:K158E	ENSP00000265807:K199E	K	+	1	0	SH2D4A	19262994	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	4.133000	0.57983	2.133000	0.65898	0.533000	0.62120	AAG	.		0.348	SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214094.1	NM_022071	Missense_Mutation
SKP2	6502	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	36152875	36152875	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr5:36152875A>G	ENST00000274255.6	+	2	207	c.11A>G	c.(10-12)aAg>aGg	p.K4R	LMBRD2_ENST00000296603.4_5'Flank|RNU6-1305P_ENST00000364353.1_RNA|SKP2_ENST00000274254.5_Missense_Mutation_p.K4R|SKP2_ENST00000508514.1_Missense_Mutation_p.K4R|SKP2_ENST00000546211.1_5'UTR	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase	4					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTCTGCAGGAAGCACCTCCAG	0.488																																					p.K4R		.											.	SKP2	1084	0			c.A11G						.						71.0	69.0	69.0					5																	36152875		2203	4300	6503	SO:0001583	missense	6502	exon2			GCAGGAAGCACCT	U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.11A>G	5.37:g.36152875A>G	ENSP00000274255:p.Lys4Arg	67.0	0.0		43.0	4.0	NM_032637	A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Missense_Mutation	SNP	ENST00000274255.6	37	CCDS3916.1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.600628	0.66332	.	.	ENSG00000145604	ENST00000274254;ENST00000274255;ENST00000308927;ENST00000508514;ENST00000513151	T;T;T;T	0.36699	2.93;2.97;1.24;1.33	5.88	5.88	0.94601	.	0.092707	0.64402	D	0.000001	T	0.27629	0.0679	L	0.32530	0.975	0.80722	D	1	P;P	0.45474	0.859;0.779	B;B	0.38458	0.274;0.141	T	0.09465	-1.0673	10	0.87932	D	0	-21.7076	11.3421	0.49539	0.9298:0.0:0.0702:0.0	.	4;4	Q13309-2;Q13309	.;SKP2_HUMAN	R	4	ENSP00000274254:K4R;ENSP00000274255:K4R;ENSP00000421941:K4R;ENSP00000423188:K4R	ENSP00000274254:K4R	K	+	2	0	SKP2	36188632	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.275000	0.43399	2.248000	0.74166	0.528000	0.53228	AAG	.		0.488	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253769.2	NM_005983	
SLC25A24	29957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	108735196	108735196	+	Intron	SNP	C	C	A	rs150343087	byFrequency	TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:108735196C>A	ENST00000565488.1	-	2	403				SLC25A24_ENST00000370041.4_Missense_Mutation_p.K16N	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24						ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		AGGTCCCATCCTTGTTATAGT	0.562																																					p.K16N		.											.	SLC25A24	91	0			c.G48T						.						233.0	217.0	223.0					1																	108735196		2182	4133	6315	SO:0001627	intron_variant	29957	exon1			CCCATCCTTGTTA	AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.184-6620G>T	1.37:g.108735196C>A		107.0	0.0		108.0	54.0	NM_213651	B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Missense_Mutation	SNP	ENST00000565488.1	37	CCDS41361.1	.	.	.	.	.	.	.	.	.	.	C	4.066	0.010017	0.07912	.	.	ENSG00000085491	ENST00000370041	T	0.70399	-0.48	3.48	-6.96	0.01622	.	.	.	.	.	T	0.19046	0.0457	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.08106	-1.0738	8	0.18276	T	0.48	.	2.8286	0.05492	0.1357:0.4097:0.2752:0.1793	.	16	Q6NUK1-2	.	N	16	ENSP00000359058:K16N	ENSP00000359058:K16N	K	-	3	2	SLC25A24	108536719	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.700000	0.01905	-1.779000	0.01280	-0.339000	0.08088	AAG	C|0.996;T|0.004		0.562	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030280.2	NM_013386	
SLC2A4RG	56731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	62373481	62373481	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr20:62373481A>G	ENST00000266077.2	+	5	631		c.e5-1		RP4-583P15.10_ENST00000447343.2_RNA|SLC2A4RG_ENST00000493772.1_Splice_Site	NM_020062.3	NP_064446.2	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|lung(2)|prostate(2)|skin(1)	7	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CTGTTGCTGCAGAGCCCGGCC	0.672																																					.		.											.	SLC2A4RG	90	0			c.580-2A>G						.						21.0	29.0	26.0					20																	62373481		2173	4288	6461	SO:0001630	splice_region_variant	56731	exon5			TGCTGCAGAGCCC	AF249267	CCDS13537.1	20q13.33	2010-03-11			ENSG00000125520	ENSG00000125520			15930	protein-coding gene	gene with protein product	"""GLUT4 enhancer factor"", ""Huntington's disease gene regulatory region-binding protein 1"""	609493				10825161	Standard	NM_020062		Approved	GEF, HDBP1, Si-1-2, Si-1-2-19	uc002ygq.3	Q9NR83	OTTHUMG00000032997	ENST00000266077.2:c.580-1A>G	20.37:g.62373481A>G		124.0	0.0		88.0	26.0	NM_020062	Q2PHL5|Q6F6I6|Q6F6I7|Q6GTK5|Q8TAH5|Q8WVW7|Q96QD3|Q9BV85	Splice_Site	SNP	ENST00000266077.2	37	CCDS13537.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.490574	0.26686	.	.	ENSG00000125520	ENST00000266077	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6808	0.45813	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC2A4RG	61843925	1.000000	0.71417	0.144000	0.22314	0.205000	0.24178	3.589000	0.53972	1.416000	0.47057	0.260000	0.18958	.	.		0.672	SLC2A4RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080202.1	NM_020062	Intron
SLC6A17	388662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	110740935	110740935	+	Missense_Mutation	SNP	C	C	T	rs141622274	byFrequency	TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:110740935C>T	ENST00000331565.4	+	12	2538	c.2053C>T	c.(2053-2055)Cct>Tct	p.P685S		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	685					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CAGTGAGGCACCTTCCCCCAT	0.607													C|||	2	0.000399361	0.0	0.0	5008	,	,		21408	0.0		0.002	False		,,,				2504	0.0				p.P685S		.											.	SLC6A17	92	0			c.C2053T						.	C	SER/PRO	0,4406		0,0,2203	121.0	98.0	106.0		2053	4.5	1.0	1	dbSNP_134	106	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SLC6A17	NM_001010898.2	74	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	685/728	110740935	2,13004	2203	4300	6503	SO:0001583	missense	388662	exon12			GAGGCACCTTCCC		CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.2053C>T	1.37:g.110740935C>T	ENSP00000330199:p.Pro685Ser	127.0	0.0		120.0	50.0	NM_001010898	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	ENST00000331565.4	37	CCDS30799.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.82	2.945307	0.53079	0.0	2.33E-4	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.74526	-0.85	4.5	4.5	0.54988	.	0.443923	0.24122	N	0.041357	T	0.56963	0.2021	L	0.47716	1.5	0.58432	D	0.999999	B	0.27910	0.193	B	0.23574	0.047	T	0.59705	-0.7404	10	0.35671	T	0.21	.	17.1784	0.86848	0.0:1.0:0.0:0.0	.	685	Q9H1V8	S6A17_HUMAN	S	685	ENSP00000330199:P685S	ENSP00000330199:P685S	P	+	1	0	SLC6A17	110542458	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.445000	0.80570	2.048000	0.60808	0.305000	0.20034	CCT	C|1.000;T|0.000		0.607	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032550.2	XM_371280	
SRRM2	23524	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2814972	2814972	+	Silent	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr16:2814972T>C	ENST00000301740.8	+	11	4992	c.4443T>C	c.(4441-4443)gaT>gaC	p.D1481D		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1481	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GCGAATGTGATTCTTCCCCAG	0.542																																					p.D1481D		.											.	SRRM2	93	0			c.T4443C						.						102.0	103.0	103.0					16																	2814972		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon11			ATGTGATTCTTCC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4443T>C	16.37:g.2814972T>C		43.0	1.0		25.0	8.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	37	CCDS32373.1																																																																																			.		0.542	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SSMEM1	136263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	129847775	129847775	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr7:129847775T>G	ENST00000297819.3	+	1	76	c.25T>G	c.(25-27)Tgg>Ggg	p.W9G	TMEM209_ENST00000473456.1_5'Flank|TMEM209_ENST00000462753.1_5'Flank|TMEM209_ENST00000397622.2_5'Flank|TMEM209_ENST00000336804.8_5'Flank|RP11-775D22.3_ENST00000483283.1_RNA	NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	9						integral component of membrane (GO:0016021)											TTCCTTATTTTGGGAGGTAGA	0.428																																					p.W9G		.											.	.	.	0			c.T25G						.						178.0	169.0	172.0					7																	129847775		2203	4300	6503	SO:0001583	missense	0	exon1			TTATTTTGGGAGG	AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.25T>G	7.37:g.129847775T>G	ENSP00000297819:p.Trp9Gly	198.0	0.0		164.0	62.0	NM_145268		Missense_Mutation	SNP	ENST00000297819.3	37	CCDS5816.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.304963	0.60305	.	.	ENSG00000165120	ENST00000297819	T	0.51817	0.69	5.54	4.39	0.52855	.	0.000000	0.64402	D	0.000014	T	0.61362	0.2341	M	0.67953	2.075	0.38034	D	0.935266	D	0.76494	0.999	D	0.65443	0.935	T	0.66480	-0.5913	10	0.87932	D	0	-0.5736	8.2812	0.31902	0.0:0.0896:0.0:0.9104	.	9	Q8WWF3	CG045_HUMAN	G	9	ENSP00000297819:W9G	ENSP00000297819:W9G	W	+	1	0	C7orf45	129635011	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.753000	0.38359	1.061000	0.40601	0.533000	0.62120	TGG	.		0.428	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349768.1	NM_145268	
STAU2	27067	broad.mit.edu;bcgsc.ca	37	8	74600947	74600947	+	Silent	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr8:74600947T>C	ENST00000521419.1	-	4	408	c.102A>G	c.(100-102)gaA>gaG	p.E34E	RP11-463D19.1_ENST00000533978.1_lincRNA|STAU2_ENST00000517542.1_Silent_p.E34E|STAU2_ENST00000523558.1_Intron|RP11-463D19.2_ENST00000358757.5_3'UTR|STAU2_ENST00000522509.1_Silent_p.E40E|STAU2_ENST00000522695.1_Silent_p.E40E|STAU2_ENST00000524104.1_Silent_p.E40E|STAU2_ENST00000522962.1_5'UTR|STAU2_ENST00000521210.1_Intron|STAU2_ENST00000524300.1_Silent_p.E72E|STAU2_ENST00000519961.1_Silent_p.E72E|STAU2_ENST00000521727.1_Silent_p.E52E|STAU2_ENST00000521451.1_Intron|STAU2_ENST00000355780.5_Silent_p.E40E			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	72	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GAAGCGTAGATTCAGTCAAAG	0.463																																					p.E72E		.											.	STAU2	90	0			c.A216G						.						241.0	208.0	219.0					8																	74600947		2203	4300	6503	SO:0001819	synonymous_variant	27067	exon5			CGTAGATTCAGTC	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521419.1:c.102A>G	8.37:g.74600947T>C		216.0	1.0		153.0	51.0	NM_001164380	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Silent	SNP	ENST00000521419.1	37																																																																																				.		0.463	STAU2-013	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000379012.2	NM_001164380	
TAF2	6873	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	120807828	120807828	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr8:120807828C>T	ENST00000378164.2	-	9	1433	c.1135G>A	c.(1135-1137)Gga>Aga	p.G379R		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	379					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATCCAAAGTCCATAGATATAG	0.353																																					p.G379R		.											.	TAF2	274	0			c.G1135A						.						136.0	129.0	132.0					8																	120807828		2203	4300	6503	SO:0001583	missense	6873	exon9			AAAGTCCATAGAT	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.1135G>A	8.37:g.120807828C>T	ENSP00000367406:p.Gly379Arg	162.0	1.0		111.0	48.0	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	CCDS34937.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.352041|5.352041	0.95830|0.95830	.|.	.|.	ENSG00000064313|ENSG00000064313	ENST00000378164|ENST00000523904	T|.	0.41400|.	1.0|.	5.97|5.97	5.97|5.97	0.96955|0.96955	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83931|0.83931	0.5361|0.5361	M|M	0.86028|0.86028	2.79|2.79	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.77004|.	0.989|.	D|D	0.84111|0.84111	0.0401|0.0401	10|5	0.62326|.	D|.	0.03|.	-42.5797|-42.5797	20.4324|20.4324	0.99085|0.99085	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	379|.	Q6P1X5|.	TAF2_HUMAN|.	R|I	379|71	ENSP00000367406:G379R|.	ENSP00000367406:G379R|.	G|M	-|-	1|3	0|0	TAF2|TAF2	120877009|120877009	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.535000|7.535000	0.82014|0.82014	2.833000|2.833000	0.97629|0.97629	0.585000|0.585000	0.79938|0.79938	GGA|ATG	.		0.353	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
TCHH	7062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	152083976	152083976	+	Nonsense_Mutation	SNP	C	C	A	rs572401737		TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:152083976C>A	ENST00000368804.1	-	2	1716	c.1717G>T	c.(1717-1719)Gag>Tag	p.E573*		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	573	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCGCGCCTCTCCTCCTGCTCG	0.677																																					p.E573X		.											.	TCHH	72	0			c.G1717T						.						53.0	58.0	57.0					1																	152083976		2002	4164	6166	SO:0001587	stop_gained	7062	exon3			GCCTCTCCTCCTG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1717G>T	1.37:g.152083976C>A	ENSP00000357794:p.Glu573*	242.0	0.0		347.0	72.0	NM_007113	Q5VUI3	Nonsense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	22.0	4.225370	0.79576	.	.	ENSG00000159450	ENST00000368804	.	.	.	2.61	-5.23	0.02798	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	8.3188	0.32117	0.0:0.6084:0.2232:0.1684	.	.	.	.	X	573	.	ENSP00000357794:E573X	E	-	1	0	TCHH	150350600	0.000000	0.05858	0.002000	0.10522	0.291000	0.27294	-1.700000	0.01905	-0.582000	0.05929	0.175000	0.17021	GAG	.		0.677	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TFAP2D	83741	ucsc.edu;bcgsc.ca	37	6	50681772	50681772	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr6:50681772T>C	ENST00000008391.3	+	1	232	c.4T>C	c.(4-6)Tca>Cca	p.S2P		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACCCAACATGTCAACTACCTT	0.428																																					p.S2P		.											.	TFAP2D	159	0			c.T4C						.						71.0	75.0	74.0					6																	50681772		2203	4300	6503	SO:0001583	missense	83741	exon1			AACATGTCAACTA	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.4T>C	6.37:g.50681772T>C	ENSP00000008391:p.Ser2Pro	38.0	0.0		47.0	4.0	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.556252	0.65425	.	.	ENSG00000008197	ENST00000008391	D	0.97710	-4.5	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.94879	0.8345	N	0.08118	0	0.80722	D	1	D	0.54601	0.967	D	0.63033	0.91	D	0.94839	0.8003	10	0.24483	T	0.36	-4.0853	15.5626	0.76262	0.0:0.0:0.0:1.0	.	2	Q7Z6R9	AP2D_HUMAN	P	2	ENSP00000008391:S2P	ENSP00000008391:S2P	S	+	1	0	TFAP2D	50789731	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.570000	0.82390	2.134000	0.65973	0.533000	0.62120	TCA	.		0.428	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
TGFA	7039	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	70742002	70742002	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr2:70742002G>C	ENST00000295400.6	-	2	330	c.83C>G	c.(82-84)tCc>tGc	p.S28C	TGFA_ENST00000460808.1_5'UTR|TGFA_ENST00000444975.1_Missense_Mutation_p.S34C|TGFA_ENST00000418333.2_Missense_Mutation_p.S28C|TGFA_ENST00000445399.1_Missense_Mutation_p.S28C|TGFA_ENST00000450929.1_Missense_Mutation_p.S34C	NM_001099691.2|NM_003236.3	NP_001093161.1|NP_003227.1	P01135	TGFA_HUMAN	transforming growth factor, alpha	28					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|mammary gland alveolus development (GO:0060749)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell division (GO:0051781)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mitosis (GO:0045840)|response to drug (GO:0042493)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|MAP kinase kinase activity (GO:0004708)			haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	4						ACTCAGCGGGGACGTGCTGTT	0.607																																					p.S28C		.											.	TGFA	683	0			c.C83G						.						80.0	66.0	71.0					2																	70742002		2203	4300	6503	SO:0001583	missense	7039	exon2			AGCGGGGACGTGC		CCDS1905.1, CCDS46316.1	2p13	2012-10-02			ENSG00000163235	ENSG00000163235			11765	protein-coding gene	gene with protein product		190170				3459638, 10552925	Standard	NM_003236		Approved		uc002sgs.4	P01135	OTTHUMG00000129669	ENST00000295400.6:c.83C>G	2.37:g.70742002G>C	ENSP00000295400:p.Ser28Cys	96.0	0.0		84.0	24.0	NM_001099691	A8K286|Q15577|Q53SK7|Q9BS56|Q9UEI3|Q9UKM1|Q9UKM2|Q9UKM3	Missense_Mutation	SNP	ENST00000295400.6	37	CCDS1905.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177599	0.57692	.	.	ENSG00000163235	ENST00000295400;ENST00000445399;ENST00000418333;ENST00000450929;ENST00000444975;ENST00000394241	T;T;T;T;T;T	0.19394	2.4;2.17;2.17;2.15;2.16;2.18	5.14	5.14	0.70334	.	0.184997	0.39146	N	0.001450	T	0.42063	0.1186	M	0.64997	1.995	0.09310	N	0.999992	D;D;D;D;D;D;D	0.76494	0.999;0.999;0.994;0.999;0.972;0.979;0.994	D;D;D;D;P;P;D	0.70935	0.971;0.971;0.947;0.958;0.634;0.723;0.923	T	0.16276	-1.0408	10	0.48119	T	0.1	.	14.2994	0.66336	0.0:0.0:1.0:0.0	.	34;34;28;28;28;28;28	E7EPT6;F8VNR3;P01135-5;Q9UKM3;P01135-3;P01135-2;P01135	.;.;.;.;.;.;TGFA_HUMAN	C	28;28;28;34;34;28	ENSP00000295400:S28C;ENSP00000387493:S28C;ENSP00000404099:S28C;ENSP00000414127:S34C;ENSP00000404131:S34C;ENSP00000377787:S28C	ENSP00000295400:S28C	S	-	2	0	TGFA	70595510	0.877000	0.30153	0.108000	0.21378	0.685000	0.39939	3.044000	0.49830	2.837000	0.97791	0.655000	0.94253	TCC	.		0.607	TGFA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251870.2		
TLX3	30012	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	170736448	170736448	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr5:170736448C>A	ENST00000296921.5	+	1	161	c.79C>A	c.(79-81)Ccg>Acg	p.P27T		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	27					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTTAACAGCCCGGACCAGGA	0.761			T	BCL11B	T-ALL																																p.P27T	Esophageal Squamous(33;43 807 3116 3348 30094)	.		Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	.	TLX3	658	0			c.C79A						.						12.0	15.0	14.0					5																	170736448		2184	4269	6453	SO:0001583	missense	30012	exon1			AACAGCCCGGACC	AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.79C>A	5.37:g.170736448C>A	ENSP00000296921:p.Pro27Thr	23.0	0.0		28.0	10.0	NM_021025	Q96AD3	Missense_Mutation	SNP	ENST00000296921.5	37	CCDS34288.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472224	0.26423	.	.	ENSG00000164438	ENST00000296921	D	0.91521	-2.86	4.51	3.64	0.41730	.	0.252179	0.39909	N	0.001227	D	0.82921	0.5142	L	0.28400	0.85	0.28954	N	0.890225	B	0.15930	0.015	B	0.16289	0.015	T	0.75059	-0.3451	10	0.48119	T	0.1	.	7.4648	0.27316	0.0:0.7386:0.1709:0.0905	.	27	O43711	TLX3_HUMAN	T	27	ENSP00000296921:P27T	ENSP00000296921:P27T	P	+	1	0	TLX3	170669053	0.991000	0.36638	1.000000	0.80357	0.962000	0.63368	0.849000	0.27723	1.105000	0.41606	0.455000	0.32223	CCG	.		0.761	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372076.3		
TNNT2	7139	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201328352	201328352	+	Missense_Mutation	SNP	C	C	T	rs147940106		TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:201328352C>T	ENST00000509001.1	-	16	1139	c.853G>A	c.(853-855)Ggg>Agg	p.G285R	TNNT2_ENST00000367317.4_Missense_Mutation_p.G285R|TNNT2_ENST00000367322.1_Missense_Mutation_p.G282R|TNNT2_ENST00000460780.1_5'UTR|TNNT2_ENST00000360372.4_Missense_Mutation_p.G280R|TNNT2_ENST00000367318.5_Missense_Mutation_p.G285R|TNNT2_ENST00000236918.7_Missense_Mutation_p.G290R|TNNT2_ENST00000367315.2_Missense_Mutation_p.G282R|TNNT2_ENST00000367320.2_Missense_Mutation_p.G252R|TNNT2_ENST00000458432.2_Missense_Mutation_p.G294R|TNNT2_ENST00000421663.2_Missense_Mutation_p.G288R	NM_001276347.1	NP_001263276.1	P45379	TNNT2_HUMAN	troponin T type 2 (cardiac)	295					ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|muscle filament sliding (GO:0030049)|negative regulation of ATPase activity (GO:0032780)|positive regulation of ATPase activity (GO:0032781)|regulation of heart contraction (GO:0008016)|regulation of muscle contraction (GO:0006937)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle thin filament (GO:0005865)|troponin complex (GO:0005861)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(9)	20						TTCCAGCGCCCGGTGACTTTA	0.647																																					p.G295R		.											.	TNNT2	90	0			c.G883A						.	C	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	1,4401	2.1+/-5.4	0,1,2200	46.0	45.0	45.0		874,853,844,835	4.0	1.0	1	dbSNP_134	45	0,8598		0,0,4299	no	missense,missense,missense,missense	TNNT2	NM_000364.2,NM_001001430.1,NM_001001431.1,NM_001001432.1	125,125,125,125	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	292/296,285/289,282/286,279/283	201328352	1,12999	2201	4299	6500	SO:0001583	missense	7139	exon17			AGCGCCCGGTGAC	X74819	CCDS30968.1, CCDS30969.1, CCDS60390.1, CCDS73002.1, CCDS73003.1	1q32	2014-09-17	2005-09-12		ENSG00000118194	ENSG00000118194			11949	protein-coding gene	gene with protein product		191045	"""troponin T2, cardiac"", ""cardiomyopathy, hypertrophic 2"", ""cardiomyopathy, dilated 1D (autosomal dominant)"""	CMH2, CMD1D		8088824, 8205619, 9482583	Standard	NM_001001430		Approved	CMPD2	uc001gwf.4	P45379	OTTHUMG00000035733	ENST00000509001.1:c.853G>A	1.37:g.201328352C>T	ENSP00000422031:p.Gly285Arg	142.0	0.0		188.0	50.0	NM_001276345	A2TDB9|A8K3K6|O60214|Q99596|Q99597|Q9BUF6|Q9UM96	Missense_Mutation	SNP	ENST00000509001.1	37	CCDS30969.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024617	0.54683	2.27E-4	0.0	ENSG00000118194	ENST00000367322;ENST00000367318;ENST00000458432;ENST00000421663;ENST00000236918;ENST00000367317;ENST00000367315;ENST00000360372;ENST00000367319;ENST00000367320;ENST00000509001	T;T;T;T;T;T;T;T;T;T	0.25414	1.88;1.8;1.9;1.86;1.8;1.8;1.88;1.93;2.25;1.8	3.98	3.98	0.46160	.	0.000000	0.64402	D	0.000003	T	0.18923	0.0454	L	0.47016	1.485	0.45762	D	0.998656	P;P;P;P;P	0.51653	0.933;0.947;0.912;0.78;0.933	B;B;B;B;B	0.36092	0.166;0.217;0.108;0.08;0.166	T	0.03863	-1.0997	10	0.62326	D	0.03	-46.1155	9.6203	0.39716	0.0:0.7862:0.2138:0.0	.	294;294;295;282;292	F8WAF6;P45379-3;P45379;Q9BUF6;P45379-10	.;.;TNNT2_HUMAN;.;.	R	282;285;294;288;290;285;282;280;223;252;285	ENSP00000356291:G282R;ENSP00000356287:G285R;ENSP00000387874:G294R;ENSP00000404134:G288R;ENSP00000236918:G290R;ENSP00000356286:G285R;ENSP00000356284:G282R;ENSP00000353535:G280R;ENSP00000356289:G252R;ENSP00000422031:G285R	ENSP00000236918:G290R	G	-	1	0	TNNT2	199594975	0.987000	0.35691	1.000000	0.80357	0.979000	0.70002	3.892000	0.56235	2.046000	0.60703	0.591000	0.81541	GGG	C|1.000;T|0.000		0.647	TNNT2-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360358.1	NM_000364	
TRPM4	54795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	49703678	49703678	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr19:49703678G>A	ENST00000252826.5	+	18	2893	c.2767G>A	c.(2767-2769)Gtg>Atg	p.V923M	TRPM4_ENST00000355712.5_Missense_Mutation_p.V569M|TRPM4_ENST00000427978.2_Missense_Mutation_p.V778M	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	923					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GATCGTCATCGTGAGCAAGAT	0.622																																					p.V923M		.											.	TRPM4	91	0			c.G2767A						.						36.0	34.0	34.0					19																	49703678		2203	4300	6503	SO:0001583	missense	54795	exon18			GTCATCGTGAGCA	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.2767G>A	19.37:g.49703678G>A	ENSP00000252826:p.Val923Met	75.0	0.0		68.0	34.0	NM_017636	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	ENST00000252826.5	37	CCDS33073.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478645	0.84747	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	D;T;D	0.98649	-5.05;-0.69;-5.05	4.21	4.21	0.49690	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98416	0.9473	L	0.39147	1.195	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.995	D	0.99187	1.0869	10	0.51188	T	0.08	-25.266	15.7186	0.77688	0.0:0.0:1.0:0.0	.	569;749;778;923	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	M	923;778;569	ENSP00000252826:V923M;ENSP00000407492:V778M;ENSP00000347944:V569M	ENSP00000252826:V923M	V	+	1	0	TRPM4	54395490	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	9.056000	0.93881	2.084000	0.62774	0.491000	0.48974	GTG	.		0.622	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465543.2	NM_017636	
TSC1	7248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	135782757	135782757	+	Splice_Site	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr9:135782757C>A	ENST00000298552.3	-	13	1485	c.1264G>T	c.(1264-1266)Gaa>Taa	p.E422*	TSC1_ENST00000440111.2_Splice_Site_p.E422*|TSC1_ENST00000545250.1_Splice_Site_p.E371*	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	422					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		ATTCTCTCTTCCTGAAAAGAT	0.393			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.E422X		.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	1906	1	Unknown(1)	bone(1)	c.G1264T						.						121.0	106.0	111.0					9																	135782757		2203	4300	6503	SO:0001630	splice_region_variant	7248	exon13	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TCTCTTCCTGAAA	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1264-1G>T	9.37:g.135782757C>A		169.0	0.0		93.0	60.0	NM_000368	B7Z897|Q5VVN5	Nonsense_Mutation	SNP	ENST00000298552.3	37	CCDS6956.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.231403|5.231403	0.95207|0.95207	.|.	.|.	ENSG00000165699|ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250|ENST00000424271	.|.	.|.	.|.	5.54|5.54	4.64|4.64	0.57946|0.57946	.|.	0.315793|.	0.39985|.	N|.	0.001210|.	.|T	.|0.72003	.|0.3407	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74842	.|-0.3527	.|5	0.48119|0.72032	T|D	0.1|0.01	-17.673|-17.673	11.7194|11.7194	0.51672|0.51672	0.0:0.9175:0.0:0.0825|0.0:0.9175:0.0:0.0825	.|.	.|.	.|.	.|.	X|S	422;422;371|300	.|.	ENSP00000298552:E422X|ENSP00000393473:R300S	E|R	-|-	1|3	0|2	TSC1|TSC1	134772578|134772578	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.074000|0.074000	0.17049|0.17049	2.584000|2.584000	0.46102|0.46102	1.352000|1.352000	0.45808|0.45808	-0.203000|-0.203000	0.12734|0.12734	GAA|AGG	.		0.393	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		Nonsense_Mutation
UBR2	23304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42585071	42585071	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr6:42585071A>G	ENST00000372899.1	+	11	1534	c.1276A>G	c.(1276-1278)Act>Gct	p.T426A	UBR2_ENST00000372901.1_Intron|UBR2_ENST00000372903.2_Intron|UBR2_ENST00000372883.3_Intron	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	426					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			CACCGCACCTACTCTGGTGAG	0.448																																					p.T426A		.											.	UBR2	94	0			c.A1276G						.						124.0	109.0	114.0					6																	42585071		2203	4300	6503	SO:0001583	missense	23304	exon11			GCACCTACTCTGG	BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.1276A>G	6.37:g.42585071A>G	ENSP00000361990:p.Thr426Ala	157.0	0.0		147.0	62.0	NM_015255	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	ENST00000372899.1	37	CCDS4870.1	.	.	.	.	.	.	.	.	.	.	A	18.18	3.566220	0.65651	.	.	ENSG00000024048	ENST00000372899	T	0.56776	0.44	4.95	4.95	0.65309	.	.	.	.	.	T	0.44201	0.1282	M	0.70595	2.14	0.80722	D	1	B	0.28026	0.198	B	0.35039	0.194	T	0.50101	-0.8867	9	0.42905	T	0.14	.	14.9141	0.70781	1.0:0.0:0.0:0.0	.	426	Q8IWV8	UBR2_HUMAN	A	426	ENSP00000361990:T426A	ENSP00000361990:T426A	T	+	1	0	UBR2	42693049	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.910000	0.92685	1.995000	0.58328	0.533000	0.62120	ACT	.		0.448	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040558.2	NM_015255	
UNC5A	90249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176305056	176305056	+	Silent	SNP	G	G	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr5:176305056G>A	ENST00000329542.4	+	11	2071	c.1797G>A	c.(1795-1797)gcG>gcA	p.A599A	UNC5A_ENST00000261961.3_Silent_p.A559A	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	599					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTGTTTGCGCCGGTGGCCT	0.662																																					p.A599A		.											.	UNC5A	91	0			c.G1797A						.						44.0	42.0	42.0					5																	176305056		2203	4296	6499	SO:0001819	synonymous_variant	90249	exon11			GTTTGCGCCGGTG	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.1797G>A	5.37:g.176305056G>A		94.0	0.0		87.0	47.0	NM_133369	B2RXE6|Q8TF26|Q96GP4	Silent	SNP	ENST00000329542.4	37	CCDS34299.1																																																																																			.		0.662	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372166.1	XM_030300	
UTS2R	2837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80332626	80332626	+	Silent	SNP	C	C	A			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr17:80332626C>A	ENST00000313135.2	+	1	474	c.426C>A	c.(424-426)acC>acA	p.T142T		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	142					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			TCACGCTGACCGTCATGAGCA	0.682																																					p.T142T		.											.	UTS2R	153	0			c.C426A						.						40.0	32.0	35.0					17																	80332626		2203	4300	6503	SO:0001819	synonymous_variant	2837	exon1			GCTGACCGTCATG	AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.426C>A	17.37:g.80332626C>A		71.0	0.0		56.0	24.0	NM_018949	B2RMV8	Silent	SNP	ENST00000313135.2	37	CCDS11810.1																																																																																			.		0.682	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443506.1	NM_018949	
ZBTB7B	51043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154987976	154987976	+	Silent	SNP	G	G	A	rs199671742	byFrequency	TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr1:154987976G>A	ENST00000368426.3	+	3	977	c.840G>A	c.(838-840)gaG>gaA	p.E280E	ZBTB7B_ENST00000535420.1_Silent_p.E280E|ZBTB7B_ENST00000417934.2_Silent_p.E314E|ZBTB7B_ENST00000292176.2_Silent_p.E280E	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	280					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AAGAAGAAGAGGAGCTGGTAT	0.652													G|||	2	0.000399361	0.0	0.0	5008	,	,		17260	0.002		0.0	False		,,,				2504	0.0				p.E314E		.											.	ZBTB7B	90	0			c.G942A						.						38.0	39.0	39.0					1																	154987976		2202	4300	6502	SO:0001819	synonymous_variant	51043	exon4			AGAAGAGGAGCTG	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.840G>A	1.37:g.154987976G>A		140.0	0.0		171.0	43.0	NM_001252406	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Silent	SNP	ENST00000368426.3	37	CCDS1081.1																																																																																			G|0.999;A|0.001		0.652	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872	
ZNF20	7568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12243520	12243520	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EK-01A-11D-A20W-10	TCGA-DD-A1EK-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	cf72fbdc-f5e1-4545-976f-36570cea82ee	5c357792-6f7d-4e11-9e4c-7fbbedc56de1	g.chr19:12243520C>T	ENST00000334213.5	-	4	1705	c.1481G>A	c.(1480-1482)cGa>cAa	p.R494Q	ZNF20_ENST00000600335.1_Intron|ZNF20_ENST00000485451.1_5'Flank|ZNF625-ZNF20_ENST00000430024.1_3'UTR	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						TTCATGATATCGAATGTAATT	0.413																																					p.R494Q		.											.	ZNF20	22	0			c.G1481A						.						171.0	181.0	177.0					19																	12243520		2202	4297	6499	SO:0001583	missense	7568	exon4			TGATATCGAATGT	X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1481G>A	19.37:g.12243520C>T	ENSP00000335437:p.Arg494Gln	102.0	0.0		70.0	25.0	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	C	2.914	-0.224731	0.06022	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	T	0.20598	2.06	0.94	-1.88	0.07713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06600	0.0169	N	0.12569	0.235	0.09310	N	1	B	0.30709	0.291	B	0.15870	0.014	T	0.34254	-0.9836	9	0.07644	T	0.81	.	2.7371	0.05243	0.0:0.2394:0.2619:0.4987	.	494	P17024	ZNF20_HUMAN	Q	494	ENSP00000335437:R494Q	ENSP00000292241:R494Q	R	-	2	0	ZNF20	12104520	0.000000	0.05858	0.000000	0.03702	0.958000	0.62258	-2.754000	0.00790	-0.861000	0.04094	0.313000	0.20887	CGA	.		0.413	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
