#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCB7	22	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	74295254	74295254	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chrX:74295254A>G	ENST00000373394.3	-	6	805	c.798T>C	c.(796-798)gcT>gcC	p.A266A	ABCB7_ENST00000534570.1_5'Flank|ABCB7_ENST00000339447.4_Silent_p.A226A|ABCB7_ENST00000253577.3_Silent_p.A267A			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	266	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						TAAATACCAAAGCACTCAGGA	0.388																																					p.A267A		.											.	ABCB7	131	0			c.T801C						.						110.0	93.0	99.0					X																	74295254		2203	4300	6503	SO:0001819	synonymous_variant	22	exon6			TACCAAAGCACTC	AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.798T>C	X.37:g.74295254A>G		157.0	0.0		137.0	6.0	NM_004299	G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Silent	SNP	ENST00000373394.3	37																																																																																				.		0.388	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000057274.1	NM_004299	
ACOT13	55856	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	24698153	24698153	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:24698153A>G	ENST00000230048.4	+	2	317	c.124A>G	c.(124-126)Atg>Gtg	p.M42V	ACOT13_ENST00000537591.1_Missense_Mutation_p.M19V|ACOT13_ENST00000476436.1_3'UTR|RP1-30M3.5_ENST00000607014.1_RNA	NM_018473.3	NP_060943.1	Q9NPJ3	ACO13_HUMAN	acyl-CoA thioesterase 13	42					metabolic process (GO:0008152)|protein homotetramerization (GO:0051289)	cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA hydrolase activity (GO:0047617)			large_intestine(1)	1						GATTTGTGAAATGAAAGTAGA	0.388																																					p.M42V		.											.	ACOT13	90	0			c.A124G						.						106.0	98.0	100.0					6																	24698153		2203	4300	6503	SO:0001583	missense	55856	exon2			TGTGAAATGAAAG	AF220186	CCDS4558.1, CCDS54972.1	6p22.1	2009-11-20	2009-05-05	2009-05-05	ENSG00000112304	ENSG00000112304		"""Acyl CoA thioesterases"""	20999	protein-coding gene	gene with protein product		615652	"""thioesterase superfamily member 2"""	THEM2		16934754, 19405909	Standard	NM_018473		Approved	HT012	uc003nek.3	Q9NPJ3	OTTHUMG00000014359	ENST00000230048.4:c.124A>G	6.37:g.24698153A>G	ENSP00000230048:p.Met42Val	103.0	0.0		90.0	34.0	NM_018473	F5H2L4|O95549	Missense_Mutation	SNP	ENST00000230048.4	37	CCDS4558.1	.	.	.	.	.	.	.	.	.	.	A	13.59	2.281601	0.40394	.	.	ENSG00000112304	ENST00000537591;ENST00000230048	.	.	.	5.03	1.13	0.20643	Phenylacetic acid degradation-related protein (1);	0.185780	0.56097	D	0.000027	T	0.28267	0.0698	M	0.62016	1.91	0.40470	D	0.980332	B;B	0.31241	0.315;0.15	B;B	0.28638	0.092;0.018	T	0.06023	-1.0850	9	0.35671	T	0.21	-19.9186	4.2242	0.10572	0.4079:0.4044:0.0701:0.1175	.	19;42	F5H2L4;Q9NPJ3	.;ACO13_HUMAN	V	19;42	.	ENSP00000230048:M42V	M	+	1	0	ACOT13	24806132	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	2.010000	0.40913	0.036000	0.15547	0.533000	0.62120	ATG	.		0.388	ACOT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040010.2	NM_018473	
AEBP1	165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	44150363	44150363	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr7:44150363T>A	ENST00000223357.3	+	12	1745	c.1440T>A	c.(1438-1440)aaT>aaA	p.N480K	AEBP1_ENST00000450684.2_5'UTR|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	480	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for DNA-binding and interaction with NFKBIA. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GCTTCAGCAATGACAGCCAGA	0.592																																					p.N480K		.											.	AEBP1	90	0			c.T1440A						.						168.0	159.0	162.0					7																	44150363		2203	4300	6503	SO:0001583	missense	165	exon12			CAGCAATGACAGC	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1440T>A	7.37:g.44150363T>A	ENSP00000223357:p.Asn480Lys	119.0	0.0		92.0	27.0	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.895451	0.72639	.	.	ENSG00000106624	ENST00000223357	D	0.98280	-4.84	5.4	-9.63	0.00544	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.97860	0.9297	M	0.73372	2.23	0.80722	D	1	P	0.42908	0.793	P	0.55615	0.78	D	0.96321	0.9236	10	0.87932	D	0	-34.1631	19.0228	0.92921	0.0:0.607:0.0:0.393	.	480	Q8IUX7	AEBP1_HUMAN	K	480	ENSP00000223357:N480K	ENSP00000223357:N480K	N	+	3	2	AEBP1	44116888	0.035000	0.19736	0.657000	0.29651	0.928000	0.56348	-0.887000	0.04152	-2.067000	0.00885	-1.621000	0.00791	AAT	.		0.592	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
AHNAK2	113146	hgsc.bcm.edu;bcgsc.ca	37	14	105407781	105407781	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr14:105407781T>C	ENST00000333244.5	-	7	14126	c.14007A>G	c.(14005-14007)gaA>gaG	p.E4669E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4669						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAACAACAGATTCCACAATGG	0.418																																					p.E4669E		.											.	AHNAK2	47	0			c.A14007G						.						46.0	48.0	47.0					14																	105407781		1910	4116	6026	SO:0001819	synonymous_variant	113146	exon7			AACAGATTCCACA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.14007A>G	14.37:g.105407781T>C		124.0	0.0		74.0	4.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	37	CCDS45177.1																																																																																			.		0.418	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
ALB	213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	74283258	74283259	+	Frame_Shift_Del	DEL	CG	CG	-	rs78575701		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:74283258_74283259delCG	ENST00000503124.1	+	9	1057_1058	c.850_851delCG	c.(850-852)cgtfs	p.R284fs	ALB_ENST00000505649.1_Intron|ALB_ENST00000401494.3_Frame_Shift_Del_p.R319fs|ALB_ENST00000509063.1_Frame_Shift_Del_p.R434fs|ALB_ENST00000415165.2_Frame_Shift_Del_p.R242fs|ALB_ENST00000295897.4_Frame_Shift_Del_p.R434fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCTATTAGTTCGTTACACCAAG	0.401																																					p.434_434del		.											.	ALB	96	0			c.1300_1301del	GRCh37	CM984718	ALB	M	rs78575701	.																																			SO:0001589	frameshift_variant	213	exon11			TTAGTTCGTTACA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.850_851delCG	4.37:g.74283258_74283259delCG	ENSP00000421027:p.Arg284fs	105.0	0.0		97.0	15.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	37																																																																																				.		0.401	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ALKBH8	91801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	107403057	107403057	+	Missense_Mutation	SNP	T	T	C	rs202093339		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:107403057T>C	ENST00000428149.2	-	8	998	c.847A>G	c.(847-849)Aca>Gca	p.T283A	ALKBH8_ENST00000429370.1_Intron|ALKBH8_ENST00000417449.2_Missense_Mutation_p.T286A|ALKBH8_ENST00000389568.3_Missense_Mutation_p.T283A	NM_138775.2	NP_620130.2	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8 (E. coli)	283	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cellular response to DNA damage stimulus (GO:0006974)|tRNA methylation (GO:0030488)	cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|RNA binding (GO:0003723)|tRNA (uracil) methyltransferase activity (GO:0016300)			breast(2)|large_intestine(2)|lung(5)	9		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		GATTCTCCTGTCATCACCAGC	0.408																																					p.T283A		.											.	ALKBH8	68	0			c.A847G						.						113.0	96.0	101.0					11																	107403057		692	1591	2283	SO:0001583	missense	91801	exon8			CTCCTGTCATCAC	AF086489	CCDS8337.2, CCDS73376.1	11q22.3	2013-10-04			ENSG00000137760	ENSG00000137760	2.1.1.229	"""Alkylation repair homologs"", ""RNA binding motif (RRM) containing"""	25189	protein-coding gene	gene with protein product		613306				20123966	Standard	NM_138775		Approved	MGC10235	uc009yxp.3	Q96BT7	OTTHUMG00000157008	ENST00000428149.2:c.847A>G	11.37:g.107403057T>C	ENSP00000415885:p.Thr283Ala	188.0	0.0		174.0	7.0	NM_138775	B1Q2M0|B4DEF6|Q8N989	Missense_Mutation	SNP	ENST00000428149.2	37	CCDS8337.2	.	.	.	.	.	.	.	.	.	.	T	17.18	3.324084	0.60634	.	.	ENSG00000137760	ENST00000428149;ENST00000389568;ENST00000417449	T;T;T	0.29397	1.57;1.57;1.57	5.01	5.01	0.66863	Oxoglutarate/iron-dependent oxygenase (2);	0.351918	0.30920	N	0.008611	T	0.31263	0.0791	L	0.42632	1.34	0.47065	D	0.9993	P;B	0.36483	0.555;0.313	B;B	0.40982	0.345;0.165	T	0.05852	-1.0860	10	0.35671	T	0.21	-16.0709	13.8922	0.63747	0.0:0.0:0.0:1.0	.	283;286	Q96BT7;Q96BT7-4	ALKB8_HUMAN;.	A	283;283;286	ENSP00000415885:T283A;ENSP00000374219:T283A;ENSP00000397673:T286A	ENSP00000374219:T283A	T	-	1	0	ALKBH8	106908267	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.448000	0.35112	1.883000	0.54544	0.533000	0.62120	ACA	T|0.999;A|0.000		0.408	ALKBH8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347071.2	NM_138775	
ALX3	257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	110607343	110607343	+	Missense_Mutation	SNP	G	G	T	rs535409677		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:110607343G>T	ENST00000369792.4	-	2	547	c.460C>A	c.(460-462)Cgt>Agt	p.R154S	RP4-773N10.4_ENST00000554749.1_RNA	NM_006492.2	NP_006483.2	O95076	ALX3_HUMAN	ALX homeobox 3	154					embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|pattern specification process (GO:0007389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.015)|all cancers(265;0.0706)|Epithelial(280;0.0758)|Colorectal(144;0.113)|LUSC - Lung squamous cell carcinoma(189;0.135)		CGGTTACGACGCTTCTTGCTC	0.592																																					p.R154S		.											.	ALX3	90	0			c.C460A						.						110.0	109.0	109.0					1																	110607343		2203	4300	6503	SO:0001583	missense	257	exon2			TACGACGCTTCTT	AF008203	CCDS819.1	1p13.3	2014-02-04	2008-11-04		ENSG00000156150	ENSG00000156150		"""Homeoboxes / PRD class"""	449	protein-coding gene	gene with protein product		606014	"""aristaless-like homeobox 3"", ""frontonasal dysplasia"""	FND		15226305, 11807986, 19409524	Standard	NM_006492		Approved		uc001dzb.3	O95076	OTTHUMG00000011650	ENST00000369792.4:c.460C>A	1.37:g.110607343G>T	ENSP00000358807:p.Arg154Ser	344.0	0.0		220.0	118.0	NM_006492	O95075|Q5T8M4	Missense_Mutation	SNP	ENST00000369792.4	37	CCDS819.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.368747	0.61624	.	.	ENSG00000156150	ENST00000369792	D	0.97186	-4.28	4.04	4.04	0.47022	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000003	D	0.98966	0.9648	H	0.99325	4.515	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.98737	1.0715	10	0.87932	D	0	.	9.4814	0.38902	0.0:0.0:0.7884:0.2116	.	154	O95076	ALX3_HUMAN	S	154	ENSP00000358807:R154S	ENSP00000358807:R154S	R	-	1	0	ALX3	110408866	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.231000	0.32624	1.940000	0.56252	0.462000	0.41574	CGT	.		0.592	ALX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032232.2	NM_006492	
ANKMY2	57037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	16640522	16640522	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr7:16640522T>A	ENST00000306999.2	-	10	1433	c.1190A>T	c.(1189-1191)gAg>gTg	p.E397V		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	397						cilium (GO:0005929)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TACTTCAGCCTCTGGTTGCTC	0.403																																					p.E397V		.											.	ANKMY2	514	0			c.A1190T						.						100.0	95.0	97.0					7																	16640522		2203	4300	6503	SO:0001583	missense	57037	exon10			TCAGCCTCTGGTT	AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.1190A>T	7.37:g.16640522T>A	ENSP00000303570:p.Glu397Val	63.0	0.0		65.0	21.0	NM_020319	A4D124|Q659G1|Q96BL3	Missense_Mutation	SNP	ENST00000306999.2	37	CCDS5361.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.284409	0.23392	.	.	ENSG00000106524	ENST00000306999	T	0.71579	-0.58	5.4	0.0896	0.14460	.	1.061010	0.07184	N	0.854515	T	0.52533	0.1740	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43196	-0.9406	10	0.66056	D	0.02	0.8445	1.0465	0.01571	0.1526:0.1712:0.1587:0.5175	.	397	Q8IV38	ANKY2_HUMAN	V	397	ENSP00000303570:E397V	ENSP00000303570:E397V	E	-	2	0	ANKMY2	16607047	0.000000	0.05858	0.044000	0.18714	0.617000	0.37484	0.416000	0.21198	-0.144000	0.11314	0.533000	0.62120	GAG	.		0.403	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2	NM_020319	
ANKRD12	23253	hgsc.bcm.edu;bcgsc.ca	37	18	9254527	9254527	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr18:9254527T>C	ENST00000262126.4	+	9	1502	c.1262T>C	c.(1261-1263)gTc>gCc	p.V421A	ANKRD12_ENST00000383440.2_Missense_Mutation_p.V398A|ANKRD12_ENST00000400020.3_Missense_Mutation_p.V398A	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	421						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CCATCTAGGGTCTTATATTCA	0.323																																					p.V421A		.											.	ANKRD12	92	0			c.T1262C						.						70.0	81.0	77.0					18																	9254527		2203	4291	6494	SO:0001583	missense	23253	exon9			CTAGGGTCTTATA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1262T>C	18.37:g.9254527T>C	ENSP00000262126:p.Val421Ala	80.0	0.0		76.0	4.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.219622	0.39201	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158	T;T	0.04970	3.53;3.52	5.86	5.86	0.93980	.	0.064020	0.64402	D	0.000008	T	0.22126	0.0533	L	0.60455	1.87	0.44754	D	0.997754	D;D;D	0.69078	0.997;0.995;0.997	P;P;D	0.72625	0.826;0.648;0.978	T	0.00112	-1.2043	10	0.54805	T	0.06	-11.1792	16.2507	0.82485	0.0:0.0:0.0:1.0	.	48;398;421	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	A	398;421;128	ENSP00000372932:V398A;ENSP00000262126:V421A	ENSP00000262126:V421A	V	+	2	0	ANKRD12	9244527	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.396000	0.79891	2.237000	0.73441	0.528000	0.53228	GTC	.		0.323	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANO3	63982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	26664762	26664762	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:26664762C>T	ENST00000256737.3	+	23	3161	c.2309C>T	c.(2308-2310)gCg>gTg	p.A770V	ANO3_ENST00000525139.1_Missense_Mutation_p.A754V|ANO3_ENST00000531568.1_Missense_Mutation_p.A624V|ANO3_ENST00000537978.1_Missense_Mutation_p.A754V	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	770					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						ATCTTTGTTGCGGCTTTTCCT	0.378																																					p.A770V		.											.	ANO3	93	0			c.C2309T						.						122.0	110.0	114.0					11																	26664762		2203	4299	6502	SO:0001583	missense	63982	exon23			TTGTTGCGGCTTT	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2309C>T	11.37:g.26664762C>T	ENSP00000256737:p.Ala770Val	171.0	0.0		137.0	41.0	NM_031418	B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	37	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	C	34	5.400902	0.96030	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.81451	0.4825	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.81035	-0.1115	10	0.52906	T	0.07	.	19.7537	0.96281	0.0:1.0:0.0:0.0	.	672;770	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	V	754;754;770;672;624	ENSP00000440737:A754V;ENSP00000432576:A754V;ENSP00000256737:A770V;ENSP00000432394:A624V	ENSP00000256737:A770V	A	+	2	0	ANO3	26621338	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.764000	0.85297	2.676000	0.91093	0.655000	0.94253	GCG	.		0.378	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418	
ARHGAP10	79658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	148778702	148778702	+	Splice_Site	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:148778702A>G	ENST00000336498.3	+	5	623		c.e5-1			NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10						establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TTTTATTTGTAGGAAGAAAAA	0.254																																					.		.											.	ARHGAP10	229	0			c.385-2A>G						.						16.0	17.0	16.0					4																	148778702		2074	4159	6233	SO:0001630	splice_region_variant	79658	exon5			ATTTGTAGGAAGA	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.385-1A>G	4.37:g.148778702A>G		43.0	0.0		38.0	17.0	NM_024605	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Splice_Site	SNP	ENST00000336498.3	37	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.619763	0.66787	.	.	ENSG00000071205	ENST00000336498	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8857	0.70567	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP10	148998152	1.000000	0.71417	0.949000	0.38748	0.745000	0.42441	8.319000	0.89992	2.206000	0.71126	0.528000	0.53228	.	.		0.254	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605	Intron
ATAD1	84896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	89550120	89550120	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:89550120G>A	ENST00000308448.7	-	4	707	c.329C>T	c.(328-330)cCt>cTt	p.P110L	ATAD1_ENST00000495903.1_5'UTR|ATAD1_ENST00000541004.1_Missense_Mutation_p.P110L|ATAD1_ENST00000400215.3_Missense_Mutation_p.P52L|ATAD1_ENST00000328142.3_Missense_Mutation_p.P110L	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	110					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CTTTTTGATAGGTAAGATGAC	0.358																																					p.P110L		.											.	ATAD1	578	0			c.C329T						.						120.0	113.0	115.0					10																	89550120		2203	4300	6503	SO:0001583	missense	84896	exon4			TTGATAGGTAAGA	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.329C>T	10.37:g.89550120G>A	ENSP00000339017:p.Pro110Leu	80.0	0.0		79.0	25.0	NM_032810	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	37	CCDS7386.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529721	0.85706	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.97688	-4.02;-4.02;-4.49;-4.23	5.4	4.5	0.54988	.	0.047500	0.85682	D	0.000000	D	0.99013	0.9663	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	D	0.99410	1.0930	9	.	.	.	-10.6677	14.1714	0.65512	0.0725:0.0:0.9275:0.0	.	52;110	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	L	110;110;52;110	ENSP00000339017:P110L;ENSP00000339016:P110L;ENSP00000412968:P52L;ENSP00000445500:P110L	.	P	-	2	0	ATAD1	89540100	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	1.404000	0.46819	0.563000	0.77884	CCT	.		0.358	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049235.1	NM_032810	
ATG4D	84971	hgsc.bcm.edu;bcgsc.ca	37	19	10659671	10659671	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:10659671T>C	ENST00000309469.4	+	6	1100	c.927T>C	c.(925-927)ggT>ggC	p.G309G	RNU7-140P_ENST00000459546.1_RNA|ATG4D_ENST00000540862.1_Intron	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	309					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TGCGACTGGGTGGCGAGACTC	0.602																																					p.G309G		.											.	ATG4D	90	0			c.T927C						.						126.0	94.0	105.0					19																	10659671		2203	4300	6503	SO:0001819	synonymous_variant	84971	exon6			ACTGGGTGGCGAG	AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.927T>C	19.37:g.10659671T>C		138.0	0.0		117.0	5.0	NM_032885	Q969K0	Silent	SNP	ENST00000309469.4	37	CCDS12241.1																																																																																			.		0.602	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452022.1	NM_032885	
ATN1	1822	hgsc.bcm.edu;bcgsc.ca	37	12	7050122	7050122	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr12:7050122T>C	ENST00000356654.4	+	8	3531	c.3294T>C	c.(3292-3294)acT>acC	p.T1098T	ATN1_ENST00000396684.2_Silent_p.T1098T|C12orf57_ENST00000537087.1_5'Flank|U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000544681.1_5'Flank|RNU7-1_ENST00000458811.1_RNA	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	1098					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CAGCTGGAACTCTCCCTAACC	0.587																																					p.T1098T		.											.	ATN1	139	0			c.T3294C						.						144.0	114.0	124.0					12																	7050122		2203	4300	6503	SO:0001819	synonymous_variant	1822	exon8			TGGAACTCTCCCT	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.3294T>C	12.37:g.7050122T>C		103.0	0.0		65.0	5.0	NM_001007026	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			.		0.587	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
AVL9	23080	hgsc.bcm.edu;bcgsc.ca	37	7	32590989	32590989	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr7:32590989A>G	ENST00000318709.4	+	5	637	c.416A>G	c.(415-417)cAt>cGt	p.H139R	AVL9_ENST00000409301.1_Missense_Mutation_p.H139R|AVL9_ENST00000404479.1_Missense_Mutation_p.H139R	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	139					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CTCATTACACATGCATATTTT	0.303																																					p.H139R		.											.	AVL9	90	0			c.A416G						.						107.0	110.0	109.0					7																	32590989		2203	4294	6497	SO:0001583	missense	23080	exon5			TTACACATGCATA	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.416A>G	7.37:g.32590989A>G	ENSP00000315568:p.His139Arg	85.0	0.0		68.0	4.0	NM_015060	Q92573	Missense_Mutation	SNP	ENST00000318709.4	37	CCDS34613.1	.	.	.	.	.	.	.	.	.	.	A	18.22	3.575568	0.65878	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479;ENST00000446718	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.52208	0.1720	L	0.39326	1.205	0.80722	D	1	D;D	0.63880	0.979;0.993	D;D	0.65233	0.933;0.909	T	0.41378	-0.9512	10	0.19590	T	0.45	-15.3642	15.785	0.78294	1.0:0.0:0.0:0.0	.	139;139	Q8N6Z3;Q8NBF6	.;AVL9_HUMAN	R	139;139;139;139;70	ENSP00000315568:H139R;ENSP00000387011:H139R;ENSP00000385242:H139R;ENSP00000395134:H70R	ENSP00000315568:H139R	H	+	2	0	AVL9	32557514	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.339000	0.96797	2.136000	0.66102	0.383000	0.25322	CAT	.		0.303	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
BHLHB9	80823	hgsc.bcm.edu;bcgsc.ca	37	X	102004756	102004756	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chrX:102004756T>C	ENST00000372735.1	+	4	1418	c.833T>C	c.(832-834)aTc>aCc	p.I278T	BHLHB9_ENST00000448867.1_Missense_Mutation_p.I278T|BHLHB9_ENST00000361229.4_Missense_Mutation_p.I278T|BHLHB9_ENST00000457056.1_Missense_Mutation_p.I278T|BHLHB9_ENST00000447531.1_Missense_Mutation_p.I278T			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	278					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TCACAGCCTATCCCTGAGTGT	0.483																																					p.I278T		.											.	BHLHB9	132	0			c.T833C						.						74.0	67.0	69.0					X																	102004756		2203	4300	6503	SO:0001583	missense	80823	exon2			AGCCTATCCCTGA	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.833T>C	X.37:g.102004756T>C	ENSP00000361820:p.Ile278Thr	122.0	0.0		87.0	4.0	NM_001142530	Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	CCDS14502.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.731761	0.00687	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77	4.47	2.02	0.26589	.	0.848237	0.10046	N	0.722893	T	0.08802	0.0218	L	0.44542	1.39	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.40831	-0.9542	9	.	.	.	-2.8756	3.9496	0.09363	0.0:0.1123:0.2117:0.6759	.	278	Q6PI77	BHLH9_HUMAN	T	278	ENSP00000403226:I278T;ENSP00000354675:I278T;ENSP00000405893:I278T;ENSP00000391722:I278T;ENSP00000361820:I278T	.	I	+	2	0	BHLHB9	101891412	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.886000	0.28241	0.289000	0.22422	-0.360000	0.07572	ATC	.		0.483	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639	
C9orf72	203228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	27548315	27548315	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:27548315A>C	ENST00000380003.3	-	11	1428	c.1365T>G	c.(1363-1365)atT>atG	p.I455M	C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	455					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		GGCCTGGTTTAATTTTCTCAG	0.378																																					p.I455M		.											.	C9orf72	517	0			c.T1365G						.						110.0	111.0	111.0					9																	27548315		2203	4300	6503	SO:0001583	missense	203228	exon11			TGGTTTAATTTTC	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.1365T>G	9.37:g.27548315A>C	ENSP00000369339:p.Ile455Met	64.0	0.0		61.0	15.0	NM_018325	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.929733	0.34096	.	.	ENSG00000147894	ENST00000380003	T	0.47528	0.84	5.75	2.13	0.27403	.	0.158723	0.56097	D	0.000023	T	0.21186	0.0510	N	0.08118	0	0.80722	D	1	P	0.39157	0.662	B	0.34180	0.177	T	0.03296	-1.1051	9	.	.	.	.	7.9488	0.30001	0.5824:0.0:0.4176:0.0	.	455	Q96LT7	CI072_HUMAN	M	455	ENSP00000369339:I455M	.	I	-	3	3	C9orf72	27538315	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.279000	0.33191	0.465000	0.27167	0.374000	0.22700	ATT	.		0.378	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
C5	727	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	123738976	123738976	+	Splice_Site	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:123738976A>G	ENST00000223642.1	-	29	3894		c.e29+1			NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5						activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	AAGAAATGTTACCTGGGTTGA	0.423																																					.		.											.	C5	92	0			c.3864+2T>C						.						117.0	117.0	117.0					9																	123738976		2203	4300	6503	SO:0001630	splice_region_variant	727	exon30			AATGTTACCTGGG	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3864+1T>C	9.37:g.123738976A>G		95.0	0.0		80.0	4.0	NM_001735	Q14CJ0|Q27I61	Splice_Site	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	A	19.60	3.858801	0.71834	.	.	ENSG00000106804	ENST00000223642	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5733	0.68226	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C5	122778797	1.000000	0.71417	0.980000	0.43619	0.818000	0.46254	6.503000	0.73699	2.024000	0.59613	0.460000	0.39030	.	.		0.423	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	Intron
CBS	875	hgsc.bcm.edu;bcgsc.ca	37	21	44480560	44480560	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr21:44480560C>T	ENST00000398165.3	-	12	1395	c.1136G>A	c.(1135-1137)cGg>cAg	p.R379Q	CBS_ENST00000352178.5_Missense_Mutation_p.R379Q|CBS_ENST00000359624.3_Missense_Mutation_p.R379Q|CBS_ENST00000544202.1_Missense_Mutation_p.R291Q|CBS_ENST00000398168.1_Missense_Mutation_p.R379Q|CBS_ENST00000398158.1_Missense_Mutation_p.R379Q	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	379			R -> Q (in CBSD; exhibits an activity lower than 4% of the wild-type enzyme; absent capacity to form multimeric quaternary structure). {ECO:0000269|PubMed:12815602}.|R -> W (in CBSD). {ECO:0000269|PubMed:15365998}.		cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	CATGTAGTTCCGCACTGAGTC	0.662																																					p.R379Q		.											.	CBS	90	0			c.G1136A	GRCh37	CM031652	CBS	M		.						95.0	67.0	76.0					21																	44480560		2203	4300	6503	SO:0001583	missense	875	exon12			TAGTTCCGCACTG	L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.1136G>A	21.37:g.44480560C>T	ENSP00000381231:p.Arg379Gln	58.0	0.0		54.0	4.0	NM_000071	B2R993|D3DSK4|Q99425|Q9BWC5	Missense_Mutation	SNP	ENST00000398165.3	37	CCDS13693.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.005806|4.005806	0.74932|0.74932	.|.	.|.	ENSG00000160200|ENSG00000160200	ENST00000430013|ENST00000398158;ENST00000398165;ENST00000359624;ENST00000352178;ENST00000398168;ENST00000539520;ENST00000544202	.|D;D;D;D;D;D	.|0.99207	.|-5.56;-5.56;-5.56;-5.56;-5.56;-5.56	4.9|4.9	4.01|4.01	0.46588|0.46588	.|Pyridoxal phosphate-dependent enzyme, beta subunit (1);	.|0.123875	.|0.53938	.|D	.|0.000051	D|D	0.99048|0.99048	0.9674|0.9674	M|M	0.84846|0.84846	2.72|2.72	0.58432|0.58432	D|D	0.999996|0.999996	.|P;D	.|0.63046	.|0.708;0.992	.|B;P	.|0.53649	.|0.238;0.731	D|D	0.98701|0.98701	1.0700|1.0700	5|10	.|0.72032	.|D	.|0.01	-33.6255|-33.6255	12.2822|12.2822	0.54771|0.54771	0.0:0.9166:0.0:0.0834|0.0:0.9166:0.0:0.0834	.|.	.|379;336	.|P35520;B7Z2D6	.|CBS_HUMAN;.	R|Q	33|379;379;379;379;379;336;291	.|ENSP00000381225:R379Q;ENSP00000381231:R379Q;ENSP00000352643:R379Q;ENSP00000344460:R379Q;ENSP00000381234:R379Q;ENSP00000439332:R291Q	.|ENSP00000344460:R379Q	G|R	-|-	1|2	0|0	CBS|CBS	43353629|43353629	1.000000|1.000000	0.71417|0.71417	0.541000|0.541000	0.28102|0.28102	0.718000|0.718000	0.41266|0.41266	5.609000|5.609000	0.67661|0.67661	2.262000|2.262000	0.75019|0.75019	0.591000|0.591000	0.81541|0.81541	GGA|CGG	.		0.662	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195525.1	NM_000071	
CCDC132	55610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92952972	92952972	+	Silent	SNP	T	T	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr7:92952972T>A	ENST00000305866.5	+	21	2033	c.1905T>A	c.(1903-1905)gtT>gtA	p.V635V	CCDC132_ENST00000544910.1_Silent_p.V605V|CCDC132_ENST00000541136.1_Silent_p.V446V|CCDC132_ENST00000535481.1_Silent_p.V355V	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	635						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CCTTTGATGTTATTCATTTCA	0.279																																					p.V635V		.											.	CCDC132	90	0			c.T1905A						.						79.0	74.0	75.0					7																	92952972		1802	4062	5864	SO:0001819	synonymous_variant	55610	exon21			TGATGTTATTCAT	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1905T>A	7.37:g.92952972T>A		59.0	0.0		39.0	9.0	NM_017667	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Silent	SNP	ENST00000305866.5	37	CCDS43617.1																																																																																			.		0.279	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
CCER1	196477	hgsc.bcm.edu;broad.mit.edu	37	12	91348442	91348442	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr12:91348442C>T	ENST00000358859.2	-	1	511	c.78G>A	c.(76-78)tgG>tgA	p.W26*	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	26																	CCGAGTGTGCCCAgccacagc	0.652																																					p.W26X		.											.	.	.	0			c.G78A						.						9.0	8.0	8.0					12																	91348442		2147	4220	6367	SO:0001587	stop_gained	196477	exon1			GTGTGCCCAGCCA	BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.78G>A	12.37:g.91348442C>T	ENSP00000351727:p.Trp26*	86.0	0.0		54.0	10.0	NM_152638	Q8TC47	Nonsense_Mutation	SNP	ENST00000358859.2	37	CCDS9036.1	.	.	.	.	.	.	.	.	.	.	C	38	6.668357	0.97747	.	.	ENSG00000197651	ENST00000358859	.	.	.	5.08	4.2	0.49525	.	0.000000	0.32328	N	0.006251	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4946	9.5742	0.39447	0.0:0.9051:0.0:0.0949	.	.	.	.	X	26	.	ENSP00000351727:W26X	W	-	3	0	C12orf12	89872573	0.880000	0.30214	0.790000	0.31976	0.054000	0.15201	1.208000	0.32345	1.381000	0.46364	-0.448000	0.05591	TGG	.		0.652	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
CCNH	902	hgsc.bcm.edu;bcgsc.ca	37	5	86703825	86703825	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:86703825T>C	ENST00000256897.4	-	4	717	c.493A>G	c.(493-495)Aga>Gga	p.R165G	CCNH_ENST00000513499.1_Splice_Site|CCNH_ENST00000508855.1_Missense_Mutation_p.R91G|CCNH_ENST00000504878.1_Missense_Mutation_p.R91G	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	165					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		TCAAATGGTCTGTAAGGATTG	0.358								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																													p.R165G		.											.	CCNH	441	0			c.A493G						.						126.0	121.0	123.0					5																	86703825		2203	4300	6503	SO:0001583	missense	902	exon4			ATGGTCTGTAAGG	U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.493A>G	5.37:g.86703825T>C	ENSP00000256897:p.Arg165Gly	96.0	0.0		82.0	4.0	NM_001239	Q53X72|Q8TBL9	Missense_Mutation	SNP	ENST00000256897.4	37	CCDS4064.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.692857	0.48202	.	.	ENSG00000134480	ENST00000508855;ENST00000256897;ENST00000504878	T;T;T	0.64991	-0.13;-0.13;-0.13	5.29	4.07	0.47477	Cyclin-like (2);	0.000000	0.85682	D	0.000000	T	0.81494	0.4834	M	0.90369	3.11	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.77004	0.989;0.983	D	0.85764	0.1351	10	0.87932	D	0	-17.7492	13.4681	0.61268	0.0:0.0:0.1393:0.8607	.	165;112	P51946;E9PDB6	CCNH_HUMAN;.	G	91;165;91	ENSP00000426454:R91G;ENSP00000256897:R165G;ENSP00000426075:R91G	ENSP00000256897:R165G	R	-	1	2	CCNH	86739581	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	3.028000	0.49705	2.005000	0.58758	0.533000	0.62120	AGA	.		0.358	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239291.3	NM_001239	
CD1E	913	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	158325665	158325665	+	Missense_Mutation	SNP	G	G	A	rs202212296	byFrequency	TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:158325665G>A	ENST00000368167.3	+	4	913	c.674G>A	c.(673-675)cGt>cAt	p.R225H	CD1E_ENST00000444681.2_Missense_Mutation_p.R126H|CD1E_ENST00000368163.3_Missense_Mutation_p.R225H|CD1E_ENST00000368165.3_Missense_Mutation_p.R135H|CD1E_ENST00000368161.3_Missense_Mutation_p.R225H|CD1E_ENST00000368154.1_Missense_Mutation_p.R36H|CD1E_ENST00000368160.3_Missense_Mutation_p.R225H|CD1E_ENST00000368166.3_Missense_Mutation_p.R36H|CD1E_ENST00000368164.3_Missense_Mutation_p.R36H|CD1E_ENST00000368155.3_Missense_Mutation_p.R135H|CD1E_ENST00000368156.1_Missense_Mutation_p.R135H|CD1E_ENST00000434258.1_Missense_Mutation_p.R223H|CD1E_ENST00000452291.2_Missense_Mutation_p.R36H|CD1E_ENST00000368157.1_Missense_Mutation_p.R36H	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	225	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GGCCCTGGCCGTCTGCAGCTT	0.592													g|||	3	0.000599042	0.0008	0.0	5008	,	,		16365	0.001		0.0	False		,,,				2504	0.001				p.R225H		.											.	CD1E	93	0			c.G674A						.	A	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	13,4393	21.2+/-45.6	0,13,2190	51.0	52.0	51.0		674,674,674,107,107,404,404,107,107,107,377,404,674	-1.7	1.0	1		51	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	CD1E	NM_001042583.2,NM_001042584.2,NM_001042585.2,NM_001042586.2,NM_001042587.2,NM_001185107.1,NM_001185108.1,NM_001185110.1,NM_001185112.1,NM_001185113.1,NM_001185114.1,NM_001185115.1,NM_030893.3	29,29,29,29,29,29,29,29,29,29,29,29,29	0,13,6490	AA,AG,GG		0.0,0.2951,0.1	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	225/377,225/291,225/322,36/188,36/102,135/299,135/232,36/133,36/200,36/145,126/290,135/287,225/389	158325665	13,12993	2203	4300	6503	SO:0001583	missense	913	exon4			CTGGCCGTCTGCA	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.674G>A	1.37:g.158325665G>A	ENSP00000357149:p.Arg225His	284.0	0.0		503.0	38.0	NM_001042584	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	10.84	1.462948	0.26248	0.002951	0.0	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368164;ENST00000368157;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155;ENST00000368154	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46819	2.55;2.55;2.55;2.55;2.55;2.55;2.55;0.86;2.55;2.55;3.94;2.55;3.52;0.95	4.51	-1.71	0.08133	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (1);	0.429971	0.20186	N	0.097401	T	0.06645	0.0170	N	0.10972	0.075	0.21064	N	0.999796	B;B;B;B;B;P;B;B;B;B;B;B;B;B;B	0.37141	0.003;0.081;0.165;0.02;0.0;0.584;0.003;0.042;0.026;0.004;0.126;0.0;0.078;0.029;0.031	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.24541	0.008;0.014;0.014;0.003;0.002;0.054;0.001;0.018;0.012;0.002;0.017;0.001;0.029;0.006;0.008	T	0.38802	-0.9644	10	0.22706	T	0.39	-9.7394	8.3668	0.32391	0.5969:0.0:0.4031:0.0	.	36;126;223;126;135;135;36;36;225;225;225;36;36;135;225	B4E057;B4E042;E7ET31;E7EP01;P15812-5;P15812-7;P15812-9;P15812-10;P15812-2;P15812;P15812-3;P15812-8;P15812-11;P15812-6;P15812-4	.;.;.;.;.;.;.;.;.;CD1E_HUMAN;.;.;.;.;.	H	223;126;225;36;135;36;225;36;36;225;225;135;135;36	ENSP00000401957:R223H;ENSP00000402906:R126H;ENSP00000357149:R225H;ENSP00000416228:R36H;ENSP00000357147:R135H;ENSP00000357148:R36H;ENSP00000357145:R225H;ENSP00000357146:R36H;ENSP00000357139:R36H;ENSP00000357142:R225H;ENSP00000357143:R225H;ENSP00000357138:R135H;ENSP00000357137:R135H;ENSP00000357136:R36H	ENSP00000357136:R36H	R	+	2	0	CD1E	156592289	0.000000	0.05858	0.971000	0.41717	0.724000	0.41520	-1.243000	0.02905	-0.182000	0.10602	-0.213000	0.12676	CGT	G|0.999;A|0.000		0.592	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
CDH8	1006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	61687550	61687550	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr16:61687550C>T	ENST00000577390.1	-	12	3316	c.2362G>A	c.(2362-2364)Gaa>Aaa	p.E788K	CDH8_ENST00000577730.1_Intron|CDH8_ENST00000299345.6_Intron	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	788					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)	p.E788K(1)		biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GAGTAGAGTTCGCCCAGTCTC	0.473																																					p.E788K		.											.	CDH8	161	1	Substitution - Missense(1)	skin(1)	c.G2362A						.						56.0	59.0	58.0					16																	61687550		2202	4300	6502	SO:0001583	missense	1006	exon12			AGAGTTCGCCCAG	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.2362G>A	16.37:g.61687550C>T	ENSP00000462701:p.Glu788Lys	179.0	0.0		138.0	30.0	NM_001796	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032742	0.75504	.	.	ENSG00000150394	ENST00000299345	.	.	.	5.7	5.7	0.88788	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.72137	0.3423	L	0.48877	1.53	0.80722	D	1	D	0.61697	0.99	P	0.59012	0.85	T	0.73401	-0.3994	9	0.66056	D	0.02	.	18.8311	0.92139	0.0:1.0:0.0:0.0	.	788	P55286	CADH8_HUMAN	K	788	.	ENSP00000299345:E788K	E	-	1	0	CDH8	60245051	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	7.770000	0.85390	2.679000	0.91253	0.655000	0.94253	GAA	.		0.473	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
CEBPZ	10153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	37455988	37455988	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr2:37455988T>C	ENST00000234170.5	-	2	493	c.348A>G	c.(346-348)aaA>aaG	p.K116K	NDUFAF7_ENST00000336237.6_5'Flank|NDUFAF7_ENST00000002125.4_5'Flank	NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	116					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				TTTTTACTTCTTTTTTGCTGG	0.299																																					p.K116K		.											.	CEBPZ	91	0			c.A348G						.						46.0	47.0	47.0					2																	37455988		2191	4297	6488	SO:0001819	synonymous_variant	10153	exon2			TACTTCTTTTTTG	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.348A>G	2.37:g.37455988T>C		36.0	0.0		41.0	5.0	NM_005760	Q8NE75	Silent	SNP	ENST00000234170.5	37	CCDS1787.1																																																																																			.		0.299	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109793709	109793709	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:109793709C>T	ENST00000271332.3	+	1	1069	c.1008C>T	c.(1006-1008)ccC>ccT	p.P336P		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	336	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GGGGCAGCCCCTCTGAAGTCT	0.602																																					p.P336P	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.C1008T						.						72.0	77.0	75.0					1																	109793709		2203	4300	6503	SO:0001819	synonymous_variant	1952	exon1			CAGCCCCTCTGAA	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1008C>T	1.37:g.109793709C>T		65.0	0.0		56.0	25.0	NM_001408	Q5T2Y7|Q92566	Silent	SNP	ENST00000271332.3	37	CCDS796.1																																																																																			.		0.602	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CEP152	22995	hgsc.bcm.edu;bcgsc.ca	37	15	49083508	49083508	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr15:49083508T>C	ENST00000380950.2	-	8	1085	c.898A>G	c.(898-900)Aga>Gga	p.R300G	CEP152_ENST00000325747.5_Missense_Mutation_p.R207G|CEP152_ENST00000399334.3_Missense_Mutation_p.R300G	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	300					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TGTATCTCTCTTTCTTTTCCA	0.333																																					p.R300G		.											.	CEP152	70	0			c.A898G						.						133.0	119.0	124.0					15																	49083508		1822	4078	5900	SO:0001583	missense	22995	exon8			TCTCTCTTTCTTT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.898A>G	15.37:g.49083508T>C	ENSP00000370337:p.Arg300Gly	101.0	0.0		72.0	4.0	NM_014985	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.992539	0.74703	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334;ENST00000541880	T;T;T	0.80214	-1.35;-1.35;-1.35	5.56	5.56	0.83823	.	0.090108	0.85682	D	0.000000	D	0.87111	0.6096	M	0.72894	2.215	0.37710	D	0.924546	P;D;D	0.76494	0.952;0.997;0.999	P;P;D	0.63283	0.461;0.866;0.913	D	0.89686	0.3894	10	0.59425	D	0.04	-21.5976	12.4834	0.55856	0.0:0.0:0.1489:0.8511	.	207;300;300	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	G	300;207;300;300	ENSP00000370337:R300G;ENSP00000321000:R207G;ENSP00000382271:R300G	ENSP00000321000:R207G	R	-	1	2	CEP152	46870800	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.816000	0.55658	2.112000	0.64535	0.533000	0.62120	AGA	.		0.333	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
CERS5	91012	hgsc.bcm.edu;broad.mit.edu	37	12	50529757	50529757	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr12:50529757C>T	ENST00000317551.6	-	7	856	c.732G>A	c.(730-732)atG>atA	p.M244I	CERS5_ENST00000422340.2_Missense_Mutation_p.M186I	NM_147190.2	NP_671723.1	Q8N5B7	CERS5_HUMAN	ceramide synthase 5	244	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CATGTAGACACATGATCAGAG	0.428																																					p.M244I		.											.	.	.	0			c.G732A						.						132.0	122.0	125.0					12																	50529757		2203	4300	6503	SO:0001583	missense	91012	exon7			TAGACACATGATC		CCDS8801.1, CCDS61120.1	12q13.12	2014-09-04	2011-07-08	2011-07-08	ENSG00000139624			"""Homeoboxes / CERS class"""	23749	protein-coding gene	gene with protein product		615335	"""LAG1 longevity assurance homolog 5 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 5"""	LASS5			Standard	NM_147190		Approved	Trh4, MGC45411, FLJ25304	uc001rwd.4	Q8N5B7	OTTHUMG00000169819	ENST00000317551.6:c.732G>A	12.37:g.50529757C>T	ENSP00000325485:p.Met244Ile	107.0	0.0		77.0	4.0	NM_147190	B4DV54	Missense_Mutation	SNP	ENST00000317551.6	37	CCDS8801.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.75|15.75|15.75	2.925636|2.925636|2.925636	0.52759|0.52759|0.52759	.|.|.	.|.|.	ENSG00000139624|ENSG00000139624|ENSG00000139624	ENST00000550547;ENST00000547800|ENST00000551005;ENST00000317551;ENST00000422340|ENST00000550919	.|D;D;D|.	.|0.85773|.	.|-2.03;-2.03;-2.03|.	4.35|4.35|4.35	2.43|2.43|2.43	0.29744|0.29744|0.29744	.|TRAM/LAG1/CLN8 homology domain (3);|.	.|0.234996|.	.|0.47455|.	.|D|.	.|0.000232|.	T|T|T	0.67915|0.67915|0.67915	0.2944|0.2944|0.2944	M|M|M	0.69248|0.69248|0.69248	2.105|2.105|2.105	0.42608|0.42608|0.42608	D|D|D	0.993304|0.993304|0.993304	.|B;B;B|.	.|0.27192|.	.|0.013;0.171;0.036|.	.|B;B;B|.	.|0.25759|.	.|0.038;0.063;0.036|.	T|T|T	0.65651|0.65651|0.65651	-0.6116|-0.6116|-0.6116	5|10|5	.|0.54805|.	.|T|.	.|0.06|.	-2.1121|-2.1121|-2.1121	11.1144|11.1144|11.1144	0.48252|0.48252|0.48252	0.1437:0.7178:0.1385:0.0|0.1437:0.7178:0.1385:0.0|0.1437:0.7178:0.1385:0.0	.|.|.	.|186;244;163|.	.|B4DV54;Q8N5B7;F8W0U5|.	.|.;CERS5_HUMAN;.|.	Y|I|M	46;148|163;244;186|14	.|ENSP00000447556:M163I;ENSP00000325485:M244I;ENSP00000389050:M186I|.	.|ENSP00000325485:M244I|.	C|M|V	-|-|-	2|3|1	0|0|0	CERS5|CERS5|CERS5	48816024|48816024|48816024	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.990000|0.990000|0.990000	0.78478|0.78478|0.78478	2.590000|2.590000|2.590000	0.46154|0.46154|0.46154	0.526000|0.526000|0.526000	0.28541|0.28541|0.28541	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	TGT|ATG|GTG	.		0.428	CERS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406069.3	NM_147190	
CNNM2	54805	hgsc.bcm.edu;bcgsc.ca	37	10	104679481	104679481	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:104679481T>C	ENST00000369878.4	+	1	1432	c.1244T>C	c.(1243-1245)cTg>cCg	p.L415P	CNNM2_ENST00000369875.3_Missense_Mutation_p.L415P|CNNM2_ENST00000433628.2_Missense_Mutation_p.L415P	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	415	DUF21.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GAAAAACTGCTGGAGATGCTC	0.587																																					p.L415P		.											.	CNNM2	515	0			c.T1244C						.						83.0	83.0	83.0					10																	104679481		2203	4300	6503	SO:0001583	missense	54805	exon1			AACTGCTGGAGAT	AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1244T>C	10.37:g.104679481T>C	ENSP00000358894:p.Leu415Pro	38.0	0.0		61.0	4.0	NM_199076	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	ENST00000369878.4	37	CCDS44474.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.132250	0.56828	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	D;D;D	0.88431	-2.38;-2.38;-2.38	4.44	4.44	0.53790	Domain of unknown function DUF21 (1);	0.000000	0.64402	D	0.000001	D	0.93831	0.8027	M	0.80183	2.485	0.80722	D	1	D;D;D	0.69078	0.958;0.966;0.997	P;P;D	0.72075	0.759;0.884;0.976	D	0.93853	0.7147	10	0.48119	T	0.1	.	13.7183	0.62712	0.0:0.0:0.0:1.0	.	415;415;415	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	P	415	ENSP00000392875:L415P;ENSP00000358891:L415P;ENSP00000358894:L415P	ENSP00000286899:L415P	L	+	2	0	CNNM2	104669471	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.027000	0.88791	1.620000	0.50308	0.459000	0.35465	CTG	.		0.587	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
CNTNAP4	85445	hgsc.bcm.edu;bcgsc.ca	37	16	76523688	76523688	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr16:76523688T>C	ENST00000476707.1	+	12	2136	c.1997T>C	c.(1996-1998)aTg>aCg	p.M666T	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.M614T|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.M590T|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.M662T			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	663	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						GTGGCCAGCATGGAGCAACTT	0.453																																					p.M590T		.											.	CNTNAP4	70	0			c.T1769C						.						55.0	43.0	47.0					16																	76523688		2198	4300	6498	SO:0001583	missense	85445	exon12			CCAGCATGGAGCA	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1997T>C	16.37:g.76523688T>C	ENSP00000417628:p.Met666Thr	145.0	0.0		109.0	5.0	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	T	4.787	0.146293	0.09134	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	4.55	1.13	0.20643	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	.	.	.	.	T	0.08268	0.0206	.	.	.	0.32735	N	0.508424	B;B;B;B	0.09022	0.0;0.002;0.001;0.0	B;B;B;B	0.09377	0.002;0.002;0.004;0.001	T	0.29792	-1.0000	8	0.19590	T	0.45	.	8.8403	0.35137	0.0:0.2388:0.0:0.7612	.	590;666;638;663	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	T	662;614;590;666	ENSP00000306893:M662T;ENSP00000439733:M614T;ENSP00000418741:M590T;ENSP00000417628:M666T	ENSP00000306893:M662T	M	+	2	0	CNTNAP4	75081189	0.079000	0.21365	0.999000	0.59377	0.997000	0.91878	0.377000	0.20552	0.360000	0.24265	0.455000	0.32223	ATG	.		0.453	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
COL4A3BP	10087	hgsc.bcm.edu;bcgsc.ca	37	5	74685511	74685511	+	Splice_Site	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:74685511A>G	ENST00000405807.4	-	12	1611	c.1190T>C	c.(1189-1191)gTt>gCt	p.V397A	COL4A3BP_ENST00000380494.5_Splice_Site_p.V525A|COL4A3BP_ENST00000261415.7_Splice_Site_p.V371A	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	397	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		CATCTCTTCAACCTTGAGAAG	0.408																																					p.V525A		.											.	COL4A3BP	226	0			c.T1574C						.						108.0	96.0	100.0					5																	74685511		2203	4300	6503	SO:0001630	splice_region_variant	10087	exon13			TCTTCAACCTTGA	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.1189-1T>C	5.37:g.74685511A>G		93.0	0.0		77.0	4.0	NM_001130105	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Missense_Mutation	SNP	ENST00000405807.4	37	CCDS4028.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.627862	0.87560	.	.	ENSG00000113163	ENST00000357457;ENST00000405807;ENST00000380494;ENST00000261415	D;D;D	0.83673	-1.75;-1.75;-1.75	5.14	5.14	0.70334	START-like domain (1);	0.000000	0.85682	D	0.000000	D	0.87164	0.6109	L	0.47716	1.5	0.58432	D	0.999994	D;D;D	0.64830	0.98;0.994;0.989	P;D;D	0.66084	0.874;0.941;0.921	D	0.86563	0.1842	10	0.39692	T	0.17	-3.1345	15.2562	0.73588	1.0:0.0:0.0:0.0	.	397;525;371	Q9Y5P4;Q9Y5P4-3;Q9Y5P4-2	C43BP_HUMAN;.;.	A	2;397;525;371	ENSP00000383996:V397A;ENSP00000369862:V525A;ENSP00000261415:V371A	ENSP00000261415:V371A	V	-	2	0	COL4A3BP	74721267	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.158000	0.94723	2.071000	0.62044	0.460000	0.39030	GTT	.		0.408	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219875.2	NM_005713	Missense_Mutation
CUL9	23113	hgsc.bcm.edu;bcgsc.ca	37	6	43153709	43153709	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:43153709T>C	ENST00000252050.4	+	4	851	c.767T>C	c.(766-768)cTt>cCt	p.L256P	CUL9_ENST00000354495.3_Missense_Mutation_p.L256P|CUL9_ENST00000372647.2_Missense_Mutation_p.L256P	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	256					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GGAAAGCTGCTTTTCTCCTTG	0.527																																					p.L256P		.											.	CUL9	529	0			c.T767C						.						60.0	58.0	59.0					6																	43153709		2203	4300	6503	SO:0001583	missense	23113	exon4			AGCTGCTTTTCTC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.767T>C	6.37:g.43153709T>C	ENSP00000252050:p.Leu256Pro	96.0	0.0		111.0	6.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.946699	0.34377	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.44482	0.92;0.92;0.92	4.59	4.59	0.56863	.	0.149506	0.46442	D	0.000285	T	0.55242	0.1908	M	0.71036	2.16	0.47123	D	0.999327	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.942;0.942;0.999	T	0.62263	-0.6891	10	0.87932	D	0	-20.1468	14.1283	0.65235	0.0:0.0:0.0:1.0	.	256;256;256	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	P	256	ENSP00000252050:L256P;ENSP00000346490:L256P;ENSP00000361730:L256P	ENSP00000252050:L256P	L	+	2	0	CUL9	43261687	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	4.730000	0.62015	1.938000	0.56188	0.379000	0.24179	CTT	.		0.527	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
CUZD1	50624	hgsc.bcm.edu;bcgsc.ca	37	10	124595749	124595749	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:124595749A>G	ENST00000368904.1	-	8	1884	c.935T>C	c.(934-936)tTa>tCa	p.L312S	CUZD1_ENST00000545804.1_Missense_Mutation_p.L312S|CUZD1_ENST00000392790.1_Missense_Mutation_p.L312S					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		AACATTTGATAATTTTGGTCT	0.368																																					p.L312S		.											.	CUZD1	92	0			c.T935C						.						149.0	149.0	149.0					10																	124595749		2203	4300	6503	SO:0001583	missense	50624	exon6			TTTGATAATTTTG	AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.935T>C	10.37:g.124595749A>G	ENSP00000357900:p.Leu312Ser	129.0	0.0		94.0	4.0	NM_022034		Missense_Mutation	SNP	ENST00000368904.1	37	CCDS7631.1	.	.	.	.	.	.	.	.	.	.	A	6.746	0.506385	0.12883	.	.	ENSG00000138161	ENST00000368904;ENST00000368901;ENST00000368900;ENST00000368899;ENST00000545804;ENST00000392790	T;T;T	0.80994	-1.44;-1.44;-1.44	5.07	5.07	0.68467	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.440893	0.24332	N	0.039454	T	0.54727	0.1876	N	0.04260	-0.245	0.09310	N	1	B	0.18610	0.029	B	0.13407	0.009	T	0.41251	-0.9519	10	0.10636	T	0.68	-4.5698	5.8441	0.18652	0.78:0.0:0.22:0.0	.	312	Q86UP6	CUZD1_HUMAN	S	312;31;31;31;312;312	ENSP00000357900:L312S;ENSP00000441590:L312S;ENSP00000376540:L312S	ENSP00000357895:L31S	L	-	2	0	CUZD1	124585739	0.017000	0.18338	0.105000	0.21289	0.707000	0.40811	2.525000	0.45598	1.902000	0.55061	0.533000	0.62120	TTA	.		0.368	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050829.2	NM_022034	
CWC27	10283	hgsc.bcm.edu;bcgsc.ca	37	5	64079686	64079686	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:64079686T>C	ENST00000381070.3	+	4	493	c.276T>C	c.(274-276)cgT>cgC	p.R92R	CWC27_ENST00000508024.1_Silent_p.R92R	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	92	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						CACGGTTGCGTTTTAATCGGA	0.403																																					p.R92R		.											.	CWC27	90	0			c.T276C						.						202.0	195.0	197.0					5																	64079686		2203	4300	6503	SO:0001819	synonymous_variant	10283	exon4			GTTGCGTTTTAAT	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.276T>C	5.37:g.64079686T>C		62.0	0.0		91.0	4.0	NM_005869	O60529|O60530|Q96EM3	Silent	SNP	ENST00000381070.3	37	CCDS3982.2																																																																																			.		0.403	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869	
CYP2C18	1562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	96447910	96447910	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:96447910G>A	ENST00000285979.6	+	3	559	c.360G>A	c.(358-360)tgG>tgA	p.W120*	CYP2C18_ENST00000339022.5_Nonsense_Mutation_p.W120*	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	120					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GAAAGAGATGGAAGGAGATCC	0.522																																					p.W120X		.											.	CYP2C18	95	0			c.G360A						.						107.0	97.0	101.0					10																	96447910		2203	4300	6503	SO:0001587	stop_gained	1562	exon3			GAGATGGAAGGAG	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.360G>A	10.37:g.96447910G>A	ENSP00000285979:p.Trp120*	240.0	0.0		187.0	57.0	NM_000772	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Nonsense_Mutation	SNP	ENST00000285979.6	37	CCDS7435.1	.	.	.	.	.	.	.	.	.	.	g	41	8.602818	0.98881	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	.	.	.	4.63	3.72	0.42706	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5565	0.45121	0.0964:0.0:0.9035:0.0	.	.	.	.	X	120	.	ENSP00000285979:W120X	W	+	3	0	CYP2C18	96437900	1.000000	0.71417	0.618000	0.29105	0.786000	0.44442	6.855000	0.75445	0.934000	0.37316	0.306000	0.20318	TGG	.		0.522	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772	
DAAM1	23002	hgsc.bcm.edu;bcgsc.ca	37	14	59793328	59793328	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr14:59793328A>G	ENST00000395125.1	+	10	1298	c.1275A>G	c.(1273-1275)acA>acG	p.T425T	DAAM1_ENST00000351081.1_Silent_p.T425T|DAAM1_ENST00000360909.3_Silent_p.T425T	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	425					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		CTGACTCCACACCTTTGGAAA	0.368																																					p.T425T		.											.	DAAM1	227	0			c.A1275G						.						83.0	84.0	84.0					14																	59793328		2203	4300	6503	SO:0001819	synonymous_variant	23002	exon11			CTCCACACCTTTG	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1275A>G	14.37:g.59793328A>G		210.0	0.0		145.0	6.0	NM_001270520	Q86U34|Q8N1Z8|Q8TB39	Silent	SNP	ENST00000395125.1	37	CCDS9737.1																																																																																			.		0.368	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
DCTN5	84516	hgsc.bcm.edu;bcgsc.ca	37	16	23654296	23654296	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr16:23654296T>C	ENST00000300087.2	+	2	220	c.69T>C	c.(67-69)agT>agC	p.S23S	PALB2_ENST00000261584.4_5'Flank|DCTN5_ENST00000568272.1_Silent_p.S23S|DCTN5_ENST00000563998.1_Silent_p.S23S|DCTN5_ENST00000568589.1_Silent_p.S23S	NM_001199743.1|NM_032486.3	NP_001186672.1|NP_115875.1	Q9BTE1	DCTN5_HUMAN	dynactin 5 (p25)	23					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)				endometrium(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(48;0.0156)		ACAAAGTCAGTCGCCAGTCAG	0.473																																					p.S23S		.											.	DCTN5	226	0			c.T69C						.						120.0	113.0	116.0					16																	23654296		2197	4300	6497	SO:0001819	synonymous_variant	84516	exon2			AGTCAGTCGCCAG		CCDS10615.1, CCDS58435.1, CCDS58436.1	16p12.1	2008-02-05			ENSG00000166847	ENSG00000166847			24594	protein-coding gene	gene with protein product		612962				10525537, 15043994	Standard	NM_032486		Approved	MGC3248, p25	uc002dly.2	Q9BTE1	OTTHUMG00000131610	ENST00000300087.2:c.69T>C	16.37:g.23654296T>C		73.0	0.0		64.0	4.0	NM_001199011	A8K9X8|H3BN51|H3BQA4	Silent	SNP	ENST00000300087.2	37	CCDS10615.1																																																																																			.		0.473	DCTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254497.1	NM_032486	
DEFB126	81623	hgsc.bcm.edu;bcgsc.ca	37	20	126206	126206	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr20:126206T>C	ENST00000382398.3	+	2	469	c.209T>C	c.(208-210)gTt>gCt	p.V70A	DEFB126_ENST00000542572.1_Intron	NM_030931.3	NP_112193.1	Q9BYW3	DB126_HUMAN	defensin, beta 126	70					defense response to bacterium (GO:0042742)	cell surface (GO:0009986)|extracellular region (GO:0005576)|glycocalyx (GO:0030112)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			AATTATCCTGTTTTCTGTGTC	0.433																																					p.V70A		.											.	DEFB126	90	0			c.T209C						.						169.0	142.0	151.0					20																	126206		2203	4300	6503	SO:0001583	missense	81623	exon2			ATCCTGTTTTCTG		CCDS12990.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125788	ENSG00000125788		"""Defensins, beta"""	15900	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 8"""	C20orf8		11854508	Standard	NM_030931		Approved	bA530N10.1, DEFB-26	uc002wcx.3	Q9BYW3	OTTHUMG00000031616	ENST00000382398.3:c.209T>C	20.37:g.126206T>C	ENSP00000371835:p.Val70Ala	109.0	0.0		134.0	6.0	NM_030931	Q562G3|Q9H1M5	Missense_Mutation	SNP	ENST00000382398.3	37	CCDS12990.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.739998	0.00675	.	.	ENSG00000125788	ENST00000382398	T	0.38077	1.16	3.02	-6.04	0.02178	.	17.788600	0.00166	N	0.000000	T	0.12689	0.0308	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23476	-1.0187	10	0.07990	T	0.79	.	2.9649	0.05905	0.2486:0.1201:0.0933:0.5379	.	70	Q9BYW3	DB126_HUMAN	A	70	ENSP00000371835:V70A	ENSP00000371835:V70A	V	+	2	0	DEFB126	74206	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.305000	0.01133	-3.271000	0.00199	-1.329000	0.01275	GTT	.		0.433	DEFB126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077428.2	NM_030931	
DFNA5	1687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	24749890	24749890	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr7:24749890G>C	ENST00000342947.3	-	6	1240	c.815C>G	c.(814-816)gCg>gGg	p.A272G	DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000409970.1_Missense_Mutation_p.A108G|DFNA5_ENST00000409775.3_Missense_Mutation_p.A272G|DFNA5_ENST00000419307.1_Missense_Mutation_p.A108G|DFNA5_ENST00000545231.1_Missense_Mutation_p.A108G	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	272					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TATCCCATGCGCAGCATCTGG	0.512																																					p.A272G	GBM(78;184 1250 20134 20900 23600)	.											.	DFNA5	91	0			c.C815G						.						140.0	132.0	135.0					7																	24749890		2203	4300	6503	SO:0001583	missense	1687	exon6			CCATGCGCAGCAT	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.815C>G	7.37:g.24749890G>C	ENSP00000339587:p.Ala272Gly	59.0	0.0		67.0	13.0	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	37	CCDS5389.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.121|6.121	0.390527|0.390527	0.11581|0.11581	.|.	.|.	ENSG00000105928|ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775|ENST00000415480;ENST00000446822	T;T;T;T;T|.	0.20738|.	2.05;2.05;2.05;2.05;2.05|.	5.47|5.47	-0.583|-0.583	0.11706|0.11706	.|.	1.340530|.	0.04814|.	N|.	0.435804|.	T|T	0.04048|0.04048	0.0113|0.0113	N|N	0.00162|0.00162	-1.95|-1.95	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.40572|0.40572	-0.9556|-0.9556	10|5	0.24483|.	T|.	0.36|.	-0.396|-0.396	3.1868|3.1868	0.06603|0.06603	0.2317:0.312:0.3638:0.0924|0.2317:0.312:0.3638:0.0924	.|.	272|.	O60443|.	DFNA5_HUMAN|.	G|G	272;108;108;108;272|61;97	ENSP00000339587:A272G;ENSP00000401332:A108G;ENSP00000442661:A108G;ENSP00000387119:A108G;ENSP00000386670:A272G|.	ENSP00000339587:A272G|.	A|R	-|-	2|1	0|0	DFNA5|DFNA5	24716415|24716415	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.133000|0.133000	0.20885|0.20885	-0.249000|-0.249000	0.08842|0.08842	-0.019000|-0.019000	0.14055|0.14055	-0.256000|-0.256000	0.11100|0.11100	GCG|CGC	.		0.512	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
DHX29	54505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	54570765	54570765	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:54570765T>C	ENST00000251636.5	-	15	2649	c.2501A>G	c.(2500-2502)cAg>cGg	p.Q834R	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	834						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				AATAGCATGCTGAGTGCGGCT	0.388																																					p.Q834R		.											.	DHX29	229	0			c.A2501G						.						104.0	108.0	107.0					5																	54570765		2203	4300	6503	SO:0001583	missense	54505	exon15			GCATGCTGAGTGC	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.2501A>G	5.37:g.54570765T>C	ENSP00000251636:p.Gln834Arg	109.0	0.0		79.0	16.0	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	T	10.75	1.437022	0.25900	.	.	ENSG00000067248	ENST00000251636	T	0.13420	2.59	5.1	5.1	0.69264	.	0.059769	0.64402	D	0.000002	T	0.04407	0.0121	N	0.02802	-0.49	0.43390	D	0.995508	B	0.02656	0.0	B	0.04013	0.001	T	0.26916	-1.0089	10	0.02654	T	1	.	7.8895	0.29669	0.0:0.1558:0.0:0.8442	.	834	Q7Z478	DHX29_HUMAN	R	834	ENSP00000251636:Q834R	ENSP00000251636:Q834R	Q	-	2	0	DHX29	54606522	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.460000	0.60108	2.054000	0.61138	0.460000	0.39030	CAG	.		0.388	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
DLD	1738	hgsc.bcm.edu;bcgsc.ca	37	7	107533711	107533711	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr7:107533711G>A	ENST00000205402.5	+	2	387	c.106G>A	c.(106-108)Gca>Aca	p.A36T	DLD_ENST00000440410.1_Missense_Mutation_p.A36T|DLD_ENST00000437604.2_Missense_Mutation_p.A36T|DLD_ENST00000537148.1_5'UTR|DLD_ENST00000494441.1_3'UTR	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	36					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	GAGAACTTACGCAGATCAGCC	0.358																																					p.A36T		.											.	DLD	226	0			c.G106A						.						102.0	99.0	100.0					7																	107533711		2203	4300	6503	SO:0001583	missense	1738	exon2			ACTTACGCAGATC	AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.106G>A	7.37:g.107533711G>A	ENSP00000205402:p.Ala36Thr	78.0	0.0		65.0	4.0	NM_000108	B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	ENST00000205402.5	37	CCDS5749.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059091	0.36373	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000440410;ENST00000437604	T;T;T;T	0.70045	-0.4;-0.4;-0.41;-0.45	5.03	2.23	0.28157	.	0.240755	0.41294	N	0.000910	T	0.40094	0.1103	N	0.08118	0	0.80722	D	1	B;B;B	0.15141	0.012;0.012;0.012	B;B;B	0.08055	0.003;0.002;0.003	T	0.09840	-1.0656	10	0.44086	T	0.13	-16.0112	5.0545	0.14525	0.1588:0.0:0.5504:0.2907	.	36;36;36	E9PEX6;B4DT69;P09622	.;.;DLDH_HUMAN	T	36	ENSP00000205402:A36T;ENSP00000390667:A36T;ENSP00000417016:A36T;ENSP00000387542:A36T	ENSP00000205402:A36T	A	+	1	0	DLD	107320947	0.970000	0.33590	0.589000	0.28718	0.410000	0.31052	1.287000	0.33284	0.289000	0.22422	0.467000	0.42956	GCA	.		0.358	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337194.3	NM_000108	
DNAH9	1770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11757692	11757692	+	Missense_Mutation	SNP	G	G	A	rs368607572		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:11757692G>A	ENST00000262442.4	+	50	9948	c.9880G>A	c.(9880-9882)Gcg>Acg	p.A3294T	DNAH9_ENST00000454412.2_Missense_Mutation_p.A3294T	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3294	Stalk. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAAAGCCACCGCGGACCTCAC	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16213	0.0		0.0	False		,,,				2504	0.0				p.A3294T		.											.	DNAH9	168	0			c.G9880A						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	53.0	55.0	54.0		9880	-5.5	0.0	17		54	0,8600		0,0,4300	no	missense	DNAH9	NM_001372.3	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	3294/4487	11757692	1,13005	2203	4300	6503	SO:0001583	missense	1770	exon50			GCCACCGCGGACC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9880G>A	17.37:g.11757692G>A	ENSP00000262442:p.Ala3294Thr	113.0	0.0		115.0	44.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	6.821	0.520661	0.13005	2.27E-4	0.0	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.76578	-1.03;-1.03	5.44	-5.49	0.02584	Dynein heavy chain, coiled coil stalk (1);	1.599710	0.03137	N	0.166106	T	0.79753	0.4500	M	0.73753	2.245	0.09310	N	1	B	0.21753	0.06	B	0.28991	0.097	T	0.62891	-0.6758	10	0.19147	T	0.46	.	19.8505	0.96738	0.0774:0.0:0.7888:0.1339	.	3294	Q9NYC9	DYH9_HUMAN	T	3294;3294;1876	ENSP00000262442:A3294T;ENSP00000414874:A3294T	ENSP00000262442:A3294T	A	+	1	0	DNAH9	11698417	0.000000	0.05858	0.005000	0.12908	0.231000	0.25187	0.225000	0.17757	-1.336000	0.02238	-0.274000	0.10170	GCG	.		0.572	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
EPG5	57724	hgsc.bcm.edu;bcgsc.ca	37	18	43496028	43496028	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr18:43496028A>G	ENST00000282041.5	-	19	3562	c.3528T>C	c.(3526-3528)gcT>gcC	p.A1176A	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1176					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TCAGCTGAAAAGCTGCTTTAC	0.423																																					p.A1176A		.											.	EPG5	580	0			c.T3528C						.						63.0	60.0	61.0					18																	43496028		1914	4128	6042	SO:0001819	synonymous_variant	57724	exon19			CTGAAAAGCTGCT	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.3528T>C	18.37:g.43496028A>G		82.0	0.0		55.0	4.0	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	37	CCDS11926.2																																																																																			.		0.423	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
ERCC6	2074	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	50690818	50690818	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:50690818C>A	ENST00000355832.5	-	10	2162	c.2084G>T	c.(2083-2085)gGa>gTa	p.G695V	ERCC6_ENST00000542458.1_Missense_Mutation_p.G65V	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	695	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GCCTAACTTTCCCGGGAAGAT	0.488								Direct reversal of damage;Nucleotide excision repair (NER)																													p.C695F		.											.	ERCC6	1153	0			c.G2084T						.						104.0	96.0	99.0					10																	50690818		2203	4300	6503	SO:0001583	missense	2074	exon10			AACTTTCCCGGGA	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2084G>T	10.37:g.50690818C>A	ENSP00000348089:p.Gly695Val	95.0	0.0		77.0	6.0	NM_000124	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	37	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	C	30	5.052049	0.93793	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	D;D	0.94576	-3.46;-3.46	5.68	5.68	0.88126	DEAD-like helicase (2);SNF2-related (1);	.	.	.	.	D	0.98201	0.9405	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.99069	1.0833	9	0.72032	D	0.01	-25.5945	17.9728	0.89118	0.0:1.0:0.0:0.0	.	695;104	Q03468;Q59FF6	ERCC6_HUMAN;.	V	695;104;65	ENSP00000348089:G695V;ENSP00000445134:G65V	ENSP00000348089:G695V	G	-	2	0	ERCC6	50360824	1.000000	0.71417	0.655000	0.29622	0.991000	0.79684	7.796000	0.85898	2.693000	0.91896	0.655000	0.94253	GGA	.		0.488	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
EZR	7430	hgsc.bcm.edu;bcgsc.ca	37	6	159190397	159190397	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:159190397C>T	ENST00000367075.3	-	12	1473	c.1305G>A	c.(1303-1305)cgG>cgA	p.R435R	EZR_ENST00000337147.7_Silent_p.R435R|EZR_ENST00000392177.4_Silent_p.R403R	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	435	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		CCTTGCGCCTCCGCGCCTCTT	0.592			T	ROS1	NSCLC																																p.R435R		.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR	70	0			c.G1305A						.						82.0	70.0	74.0					6																	159190397		2203	4300	6503	SO:0001819	synonymous_variant	7430	exon11			GCGCCTCCGCGCC	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1305G>A	6.37:g.159190397C>T		45.0	0.0		34.0	4.0	NM_003379	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	ENST00000367075.3	37	CCDS5258.1																																																																																			.		0.592	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	126238284	126238284	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:126238284G>T	ENST00000394329.3	+	1	731	c.718G>T	c.(718-720)Gtg>Ttg	p.V240L		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	240	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AAACGTGACTGTGCAAGACAT	0.607											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V240L		.											.	FAT4	108	0			c.G718T						.						29.0	33.0	32.0					4																	126238284		2030	4181	6211	SO:0001583	missense	79633	exon1			GTGACTGTGCAAG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.718G>T	4.37:g.126238284G>T	ENSP00000377862:p.Val240Leu	138.0	0.0	1548	98.0	8.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	10.07	1.250437	0.22880	.	.	ENSG00000196159	ENST00000394329	T	0.63913	-0.07	5.13	5.13	0.70059	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.31233	U	0.008019	T	0.64853	0.2636	M	0.73319	2.225	0.80722	D	1	B	0.29212	0.237	B	0.35278	0.199	T	0.66221	-0.5978	10	0.49607	T	0.09	.	13.8954	0.63768	0.0754:0.0:0.9246:0.0	.	240	Q6V0I7	FAT4_HUMAN	L	240	ENSP00000377862:V240L	ENSP00000377862:V240L	V	+	1	0	FAT4	126457734	1.000000	0.71417	0.997000	0.53966	0.018000	0.09664	5.185000	0.65076	2.364000	0.80123	0.655000	0.94253	GTG	.		0.607	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FBXO3	26273	hgsc.bcm.edu;bcgsc.ca	37	11	33790501	33790501	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:33790501T>C	ENST00000265651.3	-	3	272	c.254A>G	c.(253-255)gAt>gGt	p.D85G	FBXO3_ENST00000534136.1_Missense_Mutation_p.D85G|FBXO3_ENST00000526785.1_5'UTR|FBXO3_ENST00000530401.1_Missense_Mutation_p.D80G|FBXO3_ENST00000448981.2_Missense_Mutation_p.D85G|FBXO3_ENST00000533103.1_5'UTR	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	85					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		TCTTCCTACATCAGAGTAAGT	0.353																																					p.D85G		.											.	FBXO3	227	0			c.A254G						.						192.0	186.0	188.0					11																	33790501		2202	4298	6500	SO:0001583	missense	26273	exon3			CCTACATCAGAGT	AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.254A>G	11.37:g.33790501T>C	ENSP00000265651:p.Asp85Gly	110.0	0.0		64.0	4.0	NM_012175	B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Missense_Mutation	SNP	ENST00000265651.3	37	CCDS7887.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.225980	0.58668	.	.	ENSG00000110429	ENST00000265651;ENST00000321458;ENST00000530401;ENST00000534136;ENST00000448981	T;T;T;T	0.47177	0.85;0.86;0.88;0.89	5.99	5.99	0.97316	F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.63908	0.2551	M	0.62723	1.935	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.985	D;P;P	0.62955	0.909;0.794;0.643	T	0.66131	-0.6000	10	0.62326	D	0.03	-26.0063	14.7241	0.69329	0.0:0.0:0.0:1.0	.	80;85;85	Q9UK99-3;Q9UK99-2;Q9UK99	.;.;FBX3_HUMAN	G	85;82;80;85;85	ENSP00000265651:D85G;ENSP00000433781:D80G;ENSP00000431745:D85G;ENSP00000408836:D85G	ENSP00000265651:D85G	D	-	2	0	FBXO3	33747077	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.919000	0.70005	2.291000	0.77112	0.533000	0.62120	GAT	.		0.353	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388665.1	NM_012175	
FCGBP	8857	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	40368846	40368846	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:40368846A>C	ENST00000221347.6	-	28	12509	c.12502T>G	c.(12502-12504)Tcc>Gcc	p.S4168A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4168	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCGGCCACGGAGACAGGCAAG	0.627																																					p.S4168A		.											.	FCGBP	98	0			c.T12502G						.						167.0	165.0	166.0					19																	40368846		2203	4300	6503	SO:0001583	missense	8857	exon28			CCACGGAGACAGG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12502T>G	19.37:g.40368846A>C	ENSP00000221347:p.Ser4168Ala	139.0	0.0		120.0	11.0	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	A	3.692	-0.063412	0.07273	.	.	ENSG00000090920	ENST00000221347	T	0.60040	0.22	3.92	1.74	0.24563	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.36690	0.0976	L	0.37697	1.125	0.09310	N	1	B	0.18166	0.026	B	0.16289	0.015	T	0.21621	-1.0240	9	0.08599	T	0.76	.	1.8257	0.03120	0.565:0.1704:0.0994:0.1653	.	4168	Q9Y6R7	FCGBP_HUMAN	A	4168	ENSP00000221347:S4168A	ENSP00000221347:S4168A	S	-	1	0	FCGBP	45060686	0.000000	0.05858	0.025000	0.17156	0.035000	0.12851	-0.277000	0.08502	0.630000	0.30394	0.254000	0.18369	TCC	.		0.627	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FERMT1	55612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	6057869	6057869	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr20:6057869T>A	ENST00000217289.4	-	15	2773	c.1985A>T	c.(1984-1986)gAa>gTa	p.E662V	FERMT1_ENST00000536936.1_Missense_Mutation_p.E405V|FERMT1_ENST00000478194.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	662					cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						ATCGAGTGTTTCATTCTGGTC	0.527											OREG0025763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E662V		.											.	FERMT1	495	0			c.A1985T						.						103.0	93.0	97.0					20																	6057869		2203	4300	6503	SO:0001583	missense	55612	exon15			AGTGTTTCATTCT	AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.1985A>T	20.37:g.6057869T>A	ENSP00000217289:p.Glu662Val	167.0	0.0	631	137.0	23.0	NM_017671	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	ENST00000217289.4	37	CCDS13098.1	.	.	.	.	.	.	.	.	.	.	T	33	5.218220	0.95104	.	.	ENSG00000101311	ENST00000217289;ENST00000536936	T;T	0.38077	1.16;1.16	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.60470	0.2271	M	0.73598	2.24	0.80722	D	1	D	0.71674	0.998	D	0.68765	0.96	T	0.64219	-0.6459	10	0.66056	D	0.02	-5.3488	16.1008	0.81169	0.0:0.0:0.0:1.0	.	662	Q9BQL6	FERM1_HUMAN	V	662;405	ENSP00000217289:E662V;ENSP00000441063:E405V	ENSP00000217289:E662V	E	-	2	0	FERMT1	6005869	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	7.930000	0.87610	2.206000	0.71126	0.533000	0.62120	GAA	.		0.527	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077908.2	NM_017671	
FLG2	388698	broad.mit.edu;bcgsc.ca	37	1	152327807	152327807	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:152327807C>T	ENST00000388718.5	-	3	2527	c.2455G>A	c.(2455-2457)Ggc>Agc	p.G819S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	819	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCAAAGCCAGCGGACTGA	0.522																																					p.G819S		.											.	FLG2	151	0			c.G2455A						.						290.0	285.0	287.0					1																	152327807		2203	4300	6503	SO:0001583	missense	388698	exon3			CAAAGCCAGCGGA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2455G>A	1.37:g.152327807C>T	ENSP00000373370:p.Gly819Ser	120.0	1.0		319.0	15.0	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.502905	0.26949	.	.	ENSG00000143520	ENST00000388718	T	0.04360	3.64	5.05	-2.77	0.05877	.	.	.	.	.	T	0.00906	0.0030	L	0.31065	0.9	0.09310	N	1	B	0.29162	0.235	B	0.22386	0.039	T	0.44128	-0.9348	9	0.08381	T	0.77	-0.0644	10.8851	0.46962	0.0:0.4623:0.0:0.5377	.	819	Q5D862	FILA2_HUMAN	S	819	ENSP00000373370:G819S	ENSP00000373370:G819S	G	-	1	0	FLG2	150594431	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-2.284000	0.01154	-0.305000	0.08831	0.650000	0.86243	GGC	.		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
FTCD	10841	hgsc.bcm.edu;broad.mit.edu	37	21	47575400	47575401	+	In_Frame_Ins	INS	-	-	CCATAA			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr21:47575400_47575401insCCATAA	ENST00000291670.5	-	1	80_81	c.37_38insTTATGG	c.(37-39)gag>gTTATGGag	p.12_13insVM	FTCD_ENST00000397748.1_In_Frame_Ins_p.12_13insVM|FTCD_ENST00000397743.1_In_Frame_Ins_p.12_13insVM|FTCD_ENST00000359679.2_In_Frame_Ins_p.12_13insVM|FTCD_ENST00000498355.2_De_novo_Start_OutOfFrame|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000355384.2_In_Frame_Ins_p.12_13insVM|FTCD_ENST00000397746.3_In_Frame_Ins_p.12_13insVM	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	12	Formiminotransferase N-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	GTTCTTCCCCTCCGAAAAGTTG	0.619																																					p.E13delinsVME		.											.	FTCD	92	0			c.38_39insTTATGG						.																																			SO:0001652	inframe_insertion	10841	exon1			TTCCCCTCCGAAA	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.37_38insTTATGG	21.37:g.47575400_47575401insCCATAA	ENSP00000291670:p.Ser12_Glu13insValMet	100.0	0.0		82.0	11.0	NM_206965	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	In_Frame_Ins	INS	ENST00000291670.5	37	CCDS13731.1																																																																																			.		0.619	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1	NM_006657	
GAL	51083	hgsc.bcm.edu;bcgsc.ca	37	11	68453108	68453108	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:68453108T>C	ENST00000265643.3	+	3	386	c.128T>C	c.(127-129)cTg>cCg	p.L43P		NM_015973.3	NP_057057.2	P22466	GALA_HUMAN	galanin/GMAP prepropeptide	43					cAMP-mediated signaling (GO:0019933)|feeding behavior (GO:0007631)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of root hair elongation (GO:1902891)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catagen (GO:0051795)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein kinase A signaling (GO:0010737)|regulation of glucocorticoid metabolic process (GO:0031943)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to insulin (GO:0032868)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|secretory granule (GO:0030141)	neuropeptide hormone activity (GO:0005184)|type 1 galanin receptor binding (GO:0031764)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			lung(4)	4	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		GGCTACCTGCTGGGCCCACGT	0.642																																					p.L43P		.											.	GAL	90	0			c.T128C						.						74.0	60.0	65.0					11																	68453108		2200	4294	6494	SO:0001583	missense	51083	exon3			ACCTGCTGGGCCC	L11144	CCDS8183.1	11q13.2	2013-02-26	2012-10-23		ENSG00000069482	ENSG00000069482		"""Endogenous ligands"""	4114	protein-coding gene	gene with protein product	"""galanin-message-associated peptide"", ""galanin/GMAP prepropeptide"""	137035	"""galanin"", ""galanin prepropeptide"""	GALN		7508413	Standard	XM_006718580		Approved	GMAP, GAL-GMAP, GLNN	uc001oob.3	P22466	OTTHUMG00000167890	ENST00000265643.3:c.128T>C	11.37:g.68453108T>C	ENSP00000265643:p.Leu43Pro	65.0	0.0		60.0	4.0	NM_015973	Q14413	Missense_Mutation	SNP	ENST00000265643.3	37	CCDS8183.1	.	.	.	.	.	.	.	.	.	.	T	14.27	2.486515	0.44249	.	.	ENSG00000069482	ENST00000265643	T	0.60672	0.17	3.36	3.36	0.38483	Galanin (4);	0.000000	0.64402	D	0.000010	T	0.72137	0.3423	M	0.78801	2.425	0.26695	N	0.971273	D	0.89917	1.0	D	0.91635	0.999	T	0.63005	-0.6733	10	0.87932	D	0	-22.3649	8.0973	0.30835	0.0:0.0:0.0:1.0	.	43	P22466	GALA_HUMAN	P	43	ENSP00000265643:L43P	ENSP00000265643:L43P	L	+	2	0	GAL	68209684	0.778000	0.28640	0.386000	0.26170	0.841000	0.47740	4.018000	0.57174	1.397000	0.46682	0.459000	0.35465	CTG	.		0.642	GAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396843.2	NM_001479	
GLCE	26035	hgsc.bcm.edu;bcgsc.ca	37	15	69553621	69553621	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr15:69553621T>C	ENST00000261858.2	+	4	1010	c.782T>C	c.(781-783)gTg>gCg	p.V261A	GLCE_ENST00000559500.1_3'UTR|GLCE_ENST00000559420.2_Missense_Mutation_p.V197A	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	261					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						ATGGCGAATGTGGCTGATAAG	0.403																																					p.V261A		.											.	GLCE	92	0			c.T782C						.						158.0	154.0	155.0					15																	69553621		2200	4298	6498	SO:0001583	missense	26035	exon4			CGAATGTGGCTGA	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.782T>C	15.37:g.69553621T>C	ENSP00000261858:p.Val261Ala	125.0	0.0		90.0	4.0	NM_015554	Q6GUQ2	Missense_Mutation	SNP	ENST00000261858.2	37	CCDS32277.1	.	.	.	.	.	.	.	.	.	.	T	15.33	2.802042	0.50315	.	.	ENSG00000138604	ENST00000261858	T	0.32515	1.45	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.31888	0.0811	L	0.50333	1.59	0.80722	D	1	P	0.36027	0.533	B	0.36959	0.237	T	0.06023	-1.0850	10	0.40728	T	0.16	-22.1109	14.8343	0.70172	0.0:0.0:0.0:1.0	.	261	O94923	GLCE_HUMAN	A	261	ENSP00000261858:V261A	ENSP00000261858:V261A	V	+	2	0	GLCE	67340675	1.000000	0.71417	0.997000	0.53966	0.767000	0.43475	6.141000	0.71744	2.174000	0.68829	0.482000	0.46254	GTG	.		0.403	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
GNB1	2782	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	1720616	1720617	+	Frame_Shift_Ins	INS	-	-	T	rs201256388		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:1720616_1720617insT	ENST00000378609.4	-	10	1122_1123	c.791_792insA	c.(790-792)tacfs	p.Y264fs		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	264					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		TGTCATGGGAGTAAGTCATGAG	0.55											OREG0012998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y264_S265delinsX		.											.	GNB1	227	0			c.792_793insA						.																																			SO:0001589	frameshift_variant	2782	exon10			ATGGGAGTAAGTC	BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.792dupA	1.37:g.1720617_1720617dupT	ENSP00000367872:p.Tyr264fs	196.0	0.0	598	151.0	61.0	NM_002074	B1AJZ7|P04697|P04901|Q1RMY8	Nonsense_Mutation	INS	ENST00000378609.4	37	CCDS34.1																																																																																			.		0.550	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002762.3	NM_002074	
GPR179	440435	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	36499312	36499312	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:36499312A>G	ENST00000342292.4	-	1	381	c.361T>C	c.(361-363)Tcc>Ccc	p.S121P		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	121					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TCCACACTGGACTCACGGATG	0.622																																					p.S121P		.											.	GPR179	93	0			c.T361C						.						44.0	45.0	44.0					17																	36499312		2135	4249	6384	SO:0001583	missense	440435	exon1			CACTGGACTCACG		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.361T>C	17.37:g.36499312A>G	ENSP00000345060:p.Ser121Pro	170.0	1.0		136.0	15.0	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	37	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781943	0.70222	.	.	ENSG00000188888	ENST00000342292	T	0.78707	-1.2	5.67	4.58	0.56647	.	0.255135	0.34959	N	0.003548	D	0.83138	0.5189	M	0.62723	1.935	0.31042	N	0.716163	D	0.71674	0.998	P	0.58721	0.844	D	0.84072	0.0380	10	0.87932	D	0	-15.2544	12.4502	0.55673	0.86:0.14:0.0:0.0	.	121	Q6PRD1	GP179_HUMAN	P	121	ENSP00000345060:S121P	ENSP00000345060:S121P	S	-	1	0	GPR179	33752838	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.110000	0.31147	1.050000	0.40346	0.533000	0.62120	TCC	.		0.622	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
GPSM1	26086	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	139244074	139244074	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:139244074G>A	ENST00000440944.1	+	11	1534	c.1314G>A	c.(1312-1314)tgG>tgA	p.W438*		NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	438	Interaction with STK11/LKB1. {ECO:0000250}.|Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CAGGGGACTGGCGGGGGCCCA	0.672																																					p.W438X		.											.	GPSM1	90	0			c.G1314A						.						10.0	8.0	9.0					9																	139244074		1799	3685	5484	SO:0001587	stop_gained	26086	exon11			GGACTGGCGGGGG	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1314G>A	9.37:g.139244074G>A	ENSP00000392828:p.Trp438*	115.0	0.0		86.0	30.0	NM_001145638	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Nonsense_Mutation	SNP	ENST00000440944.1	37	CCDS48055.1	.	.	.	.	.	.	.	.	.	.	G	39	7.514064	0.98332	.	.	ENSG00000160360	ENST00000440944;ENST00000354753	.	.	.	4.62	3.71	0.42584	.	1.552250	0.03955	N	0.289137	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-21.9443	10.0713	0.42335	0.1004:0.0:0.8996:0.0	.	.	.	.	X	438;415	.	ENSP00000346797:W415X	W	+	3	0	GPSM1	138363895	0.894000	0.30519	1.000000	0.80357	0.994000	0.84299	2.672000	0.46850	2.268000	0.75426	0.655000	0.94253	TGG	.		0.672	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
GRIN2C	2905	bcgsc.ca;mdanderson.org	37	17	72848172	72848172	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:72848172A>G	ENST00000293190.5	-	3	1124	c.978T>C	c.(976-978)ccT>ccC	p.P326P	GRIN2C_ENST00000347612.4_Silent_p.P326P|GRIN2C_ENST00000578159.1_5'Flank	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	326					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCTCCCGGGCAGGGCTGACGG	0.716																																					p.P326P		.											.	GRIN2C	228	0			c.T978C						.						7.0	9.0	8.0					17																	72848172		2027	4020	6047	SO:0001819	synonymous_variant	2905	exon3			CCGGGCAGGGCTG		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.978T>C	17.37:g.72848172A>G		37.0	0.0		17.0	3.0	NM_000835	B2RTT1	Silent	SNP	ENST00000293190.5	37	CCDS32724.1																																																																																			.		0.716	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1		
GRSF1	2926	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	71691022	71691022	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:71691022A>G	ENST00000254799.6	-	8	1501	c.1384T>C	c.(1384-1386)Tcc>Ccc	p.S462P	GRSF1_ENST00000545193.1_Missense_Mutation_p.S344P|GRSF1_ENST00000502323.1_Missense_Mutation_p.S300P|GRSF1_ENST00000508091.1_Intron|GRSF1_ENST00000439371.1_Missense_Mutation_p.S300P	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	462	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			CGAACGTGGGACCGATCCTTG	0.448																																					p.S462P		.											.	.	.	0			c.T1384C						.						69.0	69.0	69.0					4																	71691022		2017	4196	6213	SO:0001583	missense	2926	exon8			CGTGGGACCGATC	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.1384T>C	4.37:g.71691022A>G	ENSP00000254799:p.Ser462Pro	154.0	0.0		81.0	5.0	NM_002092	B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	37	CCDS47069.1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.260216	0.39995	.	.	ENSG00000132463	ENST00000254799;ENST00000439371;ENST00000540657;ENST00000499044;ENST00000502323;ENST00000545193	T;T;T;T;T	0.07567	3.18;3.18;3.18;3.18;3.18	5.97	4.79	0.61399	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.660495	0.16615	N	0.206721	T	0.12646	0.0307	M	0.64404	1.975	0.27494	N	0.952197	B;B	0.30793	0.295;0.153	B;B	0.37267	0.245;0.162	T	0.13415	-1.0510	10	0.56958	D	0.05	-2.8195	7.8339	0.29360	0.68:0.2525:0.0675:0.0	.	375;462	B7Z5F9;Q12849	.;GRSF1_HUMAN	P	462;300;394;435;300;344	ENSP00000254799:S462P;ENSP00000389219:S300P;ENSP00000427354:S435P;ENSP00000425430:S300P;ENSP00000443380:S344P	ENSP00000254799:S462P	S	-	1	0	GRSF1	71909886	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	1.412000	0.34714	1.076000	0.40961	0.533000	0.62120	TCC	.		0.448	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092	
GTF3C3	9330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	197634689	197634689	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr2:197634689G>A	ENST00000263956.3	-	16	2424	c.2335C>T	c.(2335-2337)Cat>Tat	p.H779Y		NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	779					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GATGCCATATGAATAAAGGTT	0.388																																					p.H779Y		.											.	GTF3C3	97	0			c.C2335T						.						100.0	96.0	97.0					2																	197634689		2203	4300	6503	SO:0001583	missense	9330	exon16			CCATATGAATAAA	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.2335C>T	2.37:g.197634689G>A	ENSP00000263956:p.His779Tyr	99.0	0.0		90.0	17.0	NM_012086	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	37	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069214	0.76301	.	.	ENSG00000119041	ENST00000263956	T	0.28666	1.6	5.27	4.4	0.53042	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.57169	0.2035	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	T	0.63337	-0.6660	10	0.48119	T	0.1	-23.271	14.0128	0.64507	0.0725:0.0:0.9275:0.0	.	779	Q9Y5Q9	TF3C3_HUMAN	Y	779	ENSP00000263956:H779Y	ENSP00000263956:H779Y	H	-	1	0	GTF3C3	197342934	1.000000	0.71417	0.707000	0.30419	0.644000	0.38419	9.081000	0.94049	1.451000	0.47736	0.563000	0.77884	CAT	.		0.388	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
HCFC1	3054	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	153220034	153220034	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chrX:153220034C>T	ENST00000310441.7	-	17	4782	c.3816G>A	c.(3814-3816)gtG>gtA	p.V1272V	HCFC1_ENST00000369984.4_Silent_p.V1272V|HCFC1_ENST00000354233.3_Silent_p.V1203V	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1272					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCAGGGCTGTCACAGTCACTG	0.672																																					p.V1272V		.											.	HCFC1	132	0			c.G3816A						.						51.0	56.0	54.0					X																	153220034		2137	4214	6351	SO:0001819	synonymous_variant	3054	exon17			GGCTGTCACAGTC		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.3816G>A	X.37:g.153220034C>T		165.0	1.0		104.0	40.0	NM_005334	Q6P4G5	Silent	SNP	ENST00000310441.7	37	CCDS44020.1																																																																																			.		0.672	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
HHIPL2	79802	hgsc.bcm.edu;bcgsc.ca	37	1	222712068	222712068	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:222712068A>G	ENST00000343410.6	-	5	1557	c.1499T>C	c.(1498-1500)gTc>gCc	p.V500A		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	500					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		ACCTCCAGTGACTGACTTCCC	0.468																																					p.V500A		.											.	HHIPL2	69	0			c.T1499C						.						136.0	111.0	119.0					1																	222712068		2203	4300	6503	SO:0001583	missense	79802	exon5			CCAGTGACTGACT	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1499T>C	1.37:g.222712068A>G	ENSP00000342118:p.Val500Ala	150.0	0.0		117.0	5.0	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157870	0.78114	.	.	ENSG00000143512	ENST00000343410	T	0.15372	2.43	5.35	5.35	0.76521	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Glucose/Sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.060724	0.64402	D	0.000005	T	0.43144	0.1234	M	0.74546	2.27	0.54753	D	0.999981	D	0.89917	1.0	D	0.85130	0.997	T	0.42137	-0.9469	10	0.87932	D	0	-29.4619	14.9878	0.71362	1.0:0.0:0.0:0.0	.	500	Q6UWX4	HIPL2_HUMAN	A	500	ENSP00000342118:V500A	ENSP00000342118:V500A	V	-	2	0	HHIPL2	220778691	1.000000	0.71417	1.000000	0.80357	0.497000	0.33675	8.704000	0.91351	2.001000	0.58596	0.482000	0.46254	GTC	.		0.468	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
HMGN5	79366	hgsc.bcm.edu;bcgsc.ca	37	X	80371833	80371833	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chrX:80371833T>C	ENST00000358130.2	-	6	465	c.137A>G	c.(136-138)aAg>aGg	p.K46R	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	46					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						ACTTTTTGTCTTCATTTTCTG	0.318																																					p.K46R		.											.	HMGN5	130	0			c.A137G						.						106.0	81.0	89.0					X																	80371833		2202	4298	6500	SO:0001583	missense	79366	exon6			TTTGTCTTCATTT	AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.137A>G	X.37:g.80371833T>C	ENSP00000350848:p.Lys46Arg	102.0	0.0		81.0	4.0	NM_030763	Q5JSL1	Missense_Mutation	SNP	ENST00000358130.2	37	CCDS14448.1	.	.	.	.	.	.	.	.	.	.	T	12.17	1.857822	0.32791	.	.	ENSG00000198157	ENST00000358130;ENST00000447319;ENST00000373250;ENST00000430960;ENST00000436386;ENST00000451455	.	.	.	4.64	3.43	0.39272	.	0.000000	0.34291	U	0.004091	T	0.63558	0.2521	M	0.73598	2.24	0.09310	N	1	D	0.89917	1.0	D	0.75020	0.985	T	0.55147	-0.8186	9	0.87932	D	0	.	7.9301	0.29897	0.1855:0.0:0.0:0.8145	.	46	P82970	HMGN5_HUMAN	R	46;26;36;46;46;46	.	ENSP00000350848:K46R	K	-	2	0	HMGN5	80258489	1.000000	0.71417	0.109000	0.21407	0.014000	0.08584	2.414000	0.44627	0.672000	0.31204	0.441000	0.28932	AAG	.		0.318	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057354.1	NM_030763	
HNRNPC	3183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	21699222	21699222	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr14:21699222A>C	ENST00000320084.7	-	3	490	c.251T>G	c.(250-252)cTg>cGg	p.L84R	HNRNPC_ENST00000555883.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000554455.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000556142.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000553753.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000420743.2_Missense_Mutation_p.L84R|HNRNPC_ENST00000556897.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000336053.6_Missense_Mutation_p.L84R|HNRNPC_ENST00000555914.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000555309.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000556513.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000556628.1_Intron|HNRNPC_ENST00000554969.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000553300.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000449098.1_Missense_Mutation_p.L84R|HNRNPC_ENST00000430246.2_Missense_Mutation_p.L84R|HNRNPC_ENST00000557201.1_Missense_Mutation_p.L84R	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	84	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		CTCTGCAGCCAGGTTAATATC	0.388																																					p.L84R	NSCLC(108;607 2244 12726 38757)	.											.	HNRNPC	90	0			c.T251G						.						73.0	75.0	74.0					14																	21699222		2199	4293	6492	SO:0001583	missense	3183	exon3			GCAGCCAGGTTAA		CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.251T>G	14.37:g.21699222A>C	ENSP00000319690:p.Leu84Arg	64.0	0.0		60.0	14.0	NM_001077443	D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Missense_Mutation	SNP	ENST00000320084.7	37	CCDS41915.1	.	.	.	.	.	.	.	.	.	.	A	16.98	3.272549	0.59649	.	.	ENSG00000092199	ENST00000336053;ENST00000320084;ENST00000449098;ENST00000554969;ENST00000556142;ENST00000554455;ENST00000430246;ENST00000553753;ENST00000555914;ENST00000555309;ENST00000452166;ENST00000555883;ENST00000556513;ENST00000557201;ENST00000553300;ENST00000556897;ENST00000420743;ENST00000557157;ENST00000445284;ENST00000554383;ENST00000555215;ENST00000555137;ENST00000554891;ENST00000556226;ENST00000555176	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89;2.13;0.89;0.89;0.89;0.89;0.89;0.89	5.88	5.88	0.94601	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.275952	0.22837	U	0.055036	T	0.35941	0.0949	L	0.31294	0.92	0.80722	D	1	B;B;B;B;B	0.27316	0.175;0.012;0.152;0.103;0.1	B;B;B;B;B	0.28139	0.052;0.016;0.086;0.036;0.049	T	0.20472	-1.0274	10	0.87932	D	0	.	15.2723	0.73712	1.0:0.0:0.0:0.0	.	84;84;84;84;84	B4DY08;P07910-4;G3V4C1;P07910;P07910-2	.;.;.;HNRPC_HUMAN;.	R	84;84;84;84;84;84;84;84;84;84;84;84;84;84;84;84;84;5;84;84;84;84;84;84;84	ENSP00000338095:L84R;ENSP00000319690:L84R;ENSP00000404559:L84R;ENSP00000450725:L84R;ENSP00000451187:L84R;ENSP00000451291:L84R;ENSP00000442816:L84R;ENSP00000450548:L84R;ENSP00000451708:L84R;ENSP00000450790:L84R;ENSP00000450629:L84R;ENSP00000452214:L84R;ENSP00000452276:L84R;ENSP00000450544:L84R;ENSP00000451176:L84R;ENSP00000404848:L84R;ENSP00000450601:L5R;ENSP00000452021:L84R;ENSP00000452213:L84R;ENSP00000452185:L84R;ENSP00000450467:L84R;ENSP00000451292:L84R;ENSP00000452573:L84R	ENSP00000319690:L84R	L	-	2	0	HNRNPC	20769062	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.865000	0.87049	2.250000	0.74265	0.482000	0.46254	CTG	.		0.388	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1		
HS3ST6	64711	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1961778	1961778	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr16:1961778T>C	ENST00000293937.3	-	2	841	c.842A>G	c.(841-843)aAc>aGc	p.N281S	HS3ST6_ENST00000443547.1_Missense_Mutation_p.N250S|HS3ST6_ENST00000454677.2_Missense_Mutation_p.N298S			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	281					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						CTTGGTGGCGTTGAAGTAGAA	0.697																																					p.N250S		.											.	.	.	0			c.A749G						.						58.0	66.0	63.0					16																	1961778		2198	4300	6498	SO:0001583	missense	64711	exon2			GTGGCGTTGAAGT			16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.842A>G	16.37:g.1961778T>C	ENSP00000293937:p.Asn281Ser	172.0	1.0		116.0	27.0	NM_001009606	Q96RX7	Missense_Mutation	SNP	ENST00000293937.3	37		.	.	.	.	.	.	.	.	.	.	T	23.2	4.384206	0.82792	.	.	ENSG00000162040	ENST00000293937;ENST00000443547;ENST00000454677	D;D	0.82526	-1.62;-1.62	4.84	4.84	0.62591	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.92195	0.7525	M	0.90870	3.155	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	D	0.93801	0.7101	10	0.87932	D	0	.	13.641	0.62251	0.0:0.0:0.0:1.0	.	281	Q96QI5	HS3S6_HUMAN	S	281;250;320	ENSP00000293937:N281S;ENSP00000390354:N250S	ENSP00000293937:N281S	N	-	2	0	HS3ST6	1901779	1.000000	0.71417	0.990000	0.47175	0.952000	0.60782	7.836000	0.86788	1.826000	0.53198	0.414000	0.27820	AAC	.		0.697	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001009606	
IFNA7	3444	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	21201807	21201807	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:21201807C>T	ENST00000239347.3	-	1	397	c.358G>A	c.(358-360)Gaa>Aaa	p.E120K		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	120					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		ACACATGCTTCCAGGTCATTC	0.463																																					p.E120K		.											.	IFNA7	90	0			c.G358A						.						104.0	113.0	110.0					9																	21201807		2203	4297	6500	SO:0001583	missense	3444	exon1			ATGCTTCCAGGTC		CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.358G>A	9.37:g.21201807C>T	ENSP00000239347:p.Glu120Lys	477.0	0.0		370.0	107.0	NM_021057	Q14607|Q5VV14	Missense_Mutation	SNP	ENST00000239347.3	37	CCDS34995.1	.	.	.	.	.	.	.	.	.	.	C	9.849	1.193221	0.22037	.	.	ENSG00000214042	ENST00000239347	T	0.07114	3.22	3.71	-0.776	0.10984	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.654787	0.15810	N	0.243535	T	0.09379	0.0231	M	0.72118	2.19	0.09310	N	1	B	0.17038	0.02	B	0.23716	0.048	T	0.28106	-1.0054	10	0.40728	T	0.16	.	4.5619	0.12165	0.0:0.38:0.3202:0.2999	.	120	P01567	IFNA7_HUMAN	K	120	ENSP00000239347:E120K	ENSP00000239347:E120K	E	-	1	0	IFNA7	21191807	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.856000	0.04290	-0.483000	0.06772	-0.300000	0.09419	GAA	.		0.463	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051891.1	NM_021057	
HSPA5	3309	hgsc.bcm.edu;bcgsc.ca	37	9	128000515	128000515	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:128000515A>G	ENST00000324460.6	-	7	1510	c.1307T>C	c.(1306-1308)cTg>cCg	p.L436P		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	436					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CCTTGGAATCAGTTTGGTCAT	0.398										Prostate(1;0.17)																											p.L436P		.											.	HSPA5	230	0			c.T1307C						.						134.0	122.0	126.0					9																	128000515		2203	4300	6503	SO:0001583	missense	3309	exon7			GGAATCAGTTTGG		CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1307T>C	9.37:g.128000515A>G	ENSP00000324173:p.Leu436Pro	77.0	0.0		69.0	4.0	NM_005347	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	ENST00000324460.6	37	CCDS6863.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.466116	0.84425	.	.	ENSG00000044574	ENST00000324460	T	0.08102	3.13	4.61	4.61	0.57282	.	0.000000	0.64402	D	0.000001	T	0.51007	0.1649	H	0.99914	4.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74569	-0.3622	10	0.87932	D	0	-14.4956	13.1949	0.59732	1.0:0.0:0.0:0.0	.	436	P11021	GRP78_HUMAN	P	436	ENSP00000324173:L436P	ENSP00000324173:L436P	L	-	2	0	HSPA5	127040336	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.701000	0.51217	0.455000	0.32223	CTG	.		0.398	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1		
ITGA7	3679	hgsc.bcm.edu;bcgsc.ca	37	12	56091488	56091488	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr12:56091488A>G	ENST00000555728.1	-	10	1560	c.1532T>C	c.(1531-1533)gTg>gCg	p.V511A	ITGA7_ENST00000257880.7_Missense_Mutation_p.V511A|ITGA7_ENST00000452168.2_Missense_Mutation_p.V374A|ITGA7_ENST00000394230.2_Missense_Mutation_p.V471A|ITGA7_ENST00000394229.2_Missense_Mutation_p.V467A|ITGA7_ENST00000553804.1_Missense_Mutation_p.V471A|ITGA7_ENST00000347027.6_Missense_Mutation_p.V467A|ITGA7_ENST00000257879.6_Missense_Mutation_p.V467A			Q13683	ITA7_HUMAN	integrin, alpha 7	511					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCTGAAGAGCACTGCGGTGTC	0.592																																					p.V471A		.											.	ITGA7	229	0			c.T1412C						.						71.0	70.0	71.0					12																	56091488		2203	4300	6503	SO:0001583	missense	3679	exon9			AAGAGCACTGCGG		CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.1532T>C	12.37:g.56091488A>G	ENSP00000452387:p.Val511Ala	86.0	0.0		52.0	4.0	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	37		.	.	.	.	.	.	.	.	.	.	A	10.49	1.365605	0.24684	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000452168;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	T;T;T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64	4.28	0.256	0.15567	.	0.187105	0.34338	N	0.004060	T	0.51787	0.1695	L	0.38175	1.15	0.39978	D	0.974879	B;B;B;B	0.12630	0.001;0.001;0.0;0.006	B;B;B;B	0.16289	0.012;0.008;0.005;0.015	T	0.27839	-1.0062	10	0.14656	T	0.56	.	6.8805	0.24170	0.6017:0.0:0.3983:0.0	.	374;511;471;530	Q13683-13;Q13683;Q13683-3;Q4LE35	.;ITA7_HUMAN;.;.	A	471;467;467;374;511;471;467;511;511	ENSP00000452120:V471A;ENSP00000257879:V467A;ENSP00000343009:V467A;ENSP00000393844:V374A;ENSP00000257880:V511A;ENSP00000377777:V471A;ENSP00000377776:V467A;ENSP00000452387:V511A	ENSP00000257879:V467A	V	-	2	0	ITGA7	54377755	0.000000	0.05858	0.597000	0.28824	0.129000	0.20672	0.225000	0.17757	0.202000	0.20498	0.459000	0.35465	GTG	.		0.592	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
KCNMA1	3778	hgsc.bcm.edu;bcgsc.ca	37	10	78832856	78832856	+	Splice_Site	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:78832856T>C	ENST00000286628.8	-	14	1747	c.1748A>G	c.(1747-1749)aAg>aGg	p.K583R	KCNMA1_ENST00000286627.5_Splice_Site_p.K583R|KCNMA1_ENST00000484507.1_5'UTR|KCNMA1_ENST00000372440.1_Splice_Site_p.K583R|KCNMA1_ENST00000404857.1_Splice_Site_p.K583R|KCNMA1_ENST00000406533.3_Splice_Site_p.K583R|KCNMA1_ENST00000404771.3_Splice_Site_p.K583R|KCNMA1_ENST00000372443.1_Splice_Site_p.K583R|KCNMA1_ENST00000354353.5_Splice_Site_p.K583R	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	583					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	AGACGTTACCTTTATGAATGA	0.507																																					p.K583R		.											.	KCNMA1	93	0			c.A1748G						.						97.0	81.0	86.0					10																	78832856		2203	4300	6503	SO:0001630	splice_region_variant	3778	exon14			GTTACCTTTATGA	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1749+1A>G	10.37:g.78832856T>C		124.0	0.0		99.0	5.0	NM_002247	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.39|17.39	3.377367|3.377367	0.61735|0.61735	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372403;ENST00000428546	T;T;T;T;T;T;T;T;T|.	0.44482|.	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92|.	5.87|5.87	5.87|5.87	0.94306|0.94306	Potassium channel, calcium-activated, BK, alpha subunit (1);|.	0.094303|.	0.64402|.	D|.	0.000001|.	T|T	0.59307|0.59307	0.2184|0.2184	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	B;B;B;B;B;B;B;B|.	0.25486|.	0.127;0.004;0.001;0.037;0.003;0.009;0.102;0.001|.	B;B;B;B;B;B;B;B|.	0.31812|.	0.136;0.026;0.004;0.046;0.009;0.028;0.126;0.006|.	T|T	0.55386|0.55386	-0.8149|-0.8149	10|5	0.33940|.	T|.	0.23|.	-16.0588|-16.0588	16.2806|16.2806	0.82678|0.82678	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	583;583;583;583;583;365;583;583|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.	.;.;.;KCMA1_HUMAN;.;.;.;.|.	R|G	583;520;518;557;520;583;583;557;583;583;583;365|534;67	ENSP00000361517:K583R;ENSP00000361485:K520R;ENSP00000361514:K518R;ENSP00000396608:K557R;ENSP00000361520:K583R;ENSP00000286627:K583R;ENSP00000385552:K583R;ENSP00000346321:K583R;ENSP00000385806:K583R|.	ENSP00000286627:K583R|.	K|R	-|-	2|1	0|2	KCNMA1|KCNMA1	78502862|78502862	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.040000|8.040000	0.89188|0.89188	2.248000|2.248000	0.74166|0.74166	0.533000|0.533000	0.62120|0.62120	AAG|AGA	.		0.507	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	Missense_Mutation
KCNT2	343450	hgsc.bcm.edu;bcgsc.ca	37	1	196295981	196295981	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:196295981A>G	ENST00000294725.9	-	19	3057	c.2142T>C	c.(2140-2142)taT>taC	p.Y714Y	KCNT2_ENST00000451324.2_Silent_p.Y325Y|KCNT2_ENST00000367433.5_Silent_p.Y714Y|KCNT2_ENST00000367431.4_Silent_p.Y664Y|KCNT2_ENST00000498426.1_Intron|KCNT2_ENST00000609185.1_Silent_p.Y664Y			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	714					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTTTGAATCCATAGGCTTTTG	0.323																																					p.Y714Y		.											.	KCNT2	159	0			c.T2142C						.						94.0	98.0	97.0					1																	196295981		2203	4293	6496	SO:0001819	synonymous_variant	343450	exon19			GAATCCATAGGCT	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2142T>C	1.37:g.196295981A>G		89.0	0.0		78.0	4.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	37	CCDS1384.1																																																																																			.		0.323	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
KCTD17	79734	hgsc.bcm.edu;bcgsc.ca	37	22	37453518	37453518	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr22:37453518C>T	ENST00000403888.3	+	4	493	c.492C>T	c.(490-492)ggC>ggT	p.G164G	KCTD17_ENST00000402077.3_Silent_p.G164G|RN7SKP214_ENST00000364208.1_RNA	NM_001282684.1	NP_001269613.1	Q8N5Z5	KCD17_HUMAN	potassium channel tetramerization domain containing 17	164					protein homooligomerization (GO:0051260)		identical protein binding (GO:0042802)			NS(1)|breast(1)|endometrium(1)|lung(1)|prostate(1)	5						TGTCTGATGGCTGGCGCTTCG	0.652																																					p.G164G		.											.	KCTD17	68	0			c.C492T						.						82.0	63.0	69.0					22																	37453518		2203	4300	6503	SO:0001819	synonymous_variant	79734	exon4			TGATGGCTGGCGC	BC025403	CCDS13940.2, CCDS74854.1, CCDS74855.1	22q12.3	2013-06-20	2013-06-20		ENSG00000100379	ENSG00000100379			25705	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 17"""			12477932	Standard	XM_005261741		Approved	FLJ12242	uc011amv.2	Q8N5Z5	OTTHUMG00000150532	ENST00000403888.3:c.492C>T	22.37:g.37453518C>T		75.0	0.0		46.0	4.0	NM_024681	B0QYA9|B0QYB0|O95517	Silent	SNP	ENST00000403888.3	37		.	.	.	.	.	.	.	.	.	.	C	10.04	1.242295	0.22796	.	.	ENSG00000100379	ENST00000456470	.	.	.	4.46	2.28	0.28536	.	.	.	.	.	T	0.55689	0.1936	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49771	-0.8904	4	.	.	.	-0.2577	7.7435	0.28856	0.3389:0.5772:0.0:0.0839	.	.	.	.	V	119	.	.	A	+	2	0	KCTD17	35783464	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	2.135000	0.42112	0.837000	0.34925	0.407000	0.27541	GCT	.		0.652	KCTD17-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318781.1	NM_024681	
KIAA0355	9710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34818735	34818735	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:34818735C>T	ENST00000299505.6	+	5	1779	c.906C>T	c.(904-906)ttC>ttT	p.F302F		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	302										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AAGCCGGCTTCCACCTGAATC	0.433																																					p.F302F		.											.	KIAA0355	91	0			c.C906T						.						86.0	92.0	90.0					19																	34818735		2203	4300	6503	SO:0001819	synonymous_variant	9710	exon5			CGGCTTCCACCTG		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.906C>T	19.37:g.34818735C>T		99.0	0.0		88.0	13.0	NM_014686	Q2M3W4	Silent	SNP	ENST00000299505.6	37	CCDS12436.1																																																																																			.		0.433	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
KIAA0825	285600	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	93807341	93807341	+	Silent	SNP	C	C	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:93807341C>A	ENST00000513200.3	-	8	1623	c.1551G>T	c.(1549-1551)gtG>gtT	p.V517V	KIAA0825_ENST00000427991.2_Silent_p.V517V|KIAA0825_ENST00000312498.7_Silent_p.V517V	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	517										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						AACAGGCCTCCACCAAGTTTG	0.468																																					p.V517V		.											.	KIAA0825	91	0			c.G1551T						.						149.0	123.0	131.0					5																	93807341		692	1591	2283	SO:0001819	synonymous_variant	285600	exon9			GGCCTCCACCAAG	BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.1551G>T	5.37:g.93807341C>A		150.0	0.0		173.0	13.0	NM_001145678	O94914|Q6ZNN2	Silent	SNP	ENST00000513200.3	37																																																																																				.		0.468	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000254102.5	NM_173665	
KIAA1731	85459	hgsc.bcm.edu;bcgsc.ca	37	11	93455128	93455128	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:93455128A>G	ENST00000325212.6	+	20	6021	c.5859A>G	c.(5857-5859)acA>acG	p.T1953T	KIAA1731_ENST00000344196.4_Silent_p.T133T|KIAA1731_ENST00000411936.1_Silent_p.T1953T|KIAA1731_ENST00000531700.1_Silent_p.T133T|Y_RNA_ENST00000363005.1_RNA|SCARNA9_ENST00000530422.1_RNA|SCARNA9_ENST00000362805.1_RNA|SCARNA9_ENST00000364329.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731	1953						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGGCTAAAACACTGTCTTATG	0.398																																					p.T1953T		.											.	KIAA1731	22	0			c.A5859G						.						258.0	212.0	226.0					11																	93455128		692	1591	2283	SO:0001819	synonymous_variant	85459	exon20			TAAAACACTGTCT	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.5859A>G	11.37:g.93455128A>G		103.0	0.0		66.0	4.0	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Silent	SNP	ENST00000325212.6	37	CCDS44708.1																																																																																			.		0.398	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
KIAA2026	158358	hgsc.bcm.edu;bcgsc.ca	37	9	5920644	5920644	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:5920644A>G	ENST00000399933.3	-	8	5351	c.5352T>C	c.(5350-5352)acT>acC	p.T1784T	KIAA2026_ENST00000381461.2_Silent_p.T1754T	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1784										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACTGGAGTGAAGTCCGAGATT	0.423																																					p.T1784T		.											.	KIAA2026	92	0			c.T5352C						.						359.0	352.0	355.0					9																	5920644		1943	4133	6076	SO:0001819	synonymous_variant	158358	exon8			GAGTGAAGTCCGA	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5352T>C	9.37:g.5920644A>G		140.0	0.0		89.0	5.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																				.		0.423	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
KLHL28	54813	hgsc.bcm.edu;bcgsc.ca	37	14	45414969	45414969	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr14:45414969T>C	ENST00000396128.4	-	2	282	c.163A>G	c.(163-165)Agc>Ggc	p.S55G	KLHL28_ENST00000355081.2_Missense_Mutation_p.S69G	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	55	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						GGGCTGACGCTGGCAAGTACC	0.438																																					p.S55G		.											.	KLHL28	91	0			c.A163G						.						95.0	89.0	91.0					14																	45414969		2203	4300	6503	SO:0001583	missense	54813	exon2			TGACGCTGGCAAG	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.163A>G	14.37:g.45414969T>C	ENSP00000379434:p.Ser55Gly	115.0	0.0		85.0	5.0	NM_017658	Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.054061	0.55218	.	.	ENSG00000179454	ENST00000396128;ENST00000355081;ENST00000556500;ENST00000556239	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	5.81	5.81	0.92471	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.070640	0.85682	D	0.000000	T	0.73133	0.3548	M	0.78285	2.405	0.48040	D	0.999573	B;B	0.29481	0.178;0.245	B;B	0.37550	0.18;0.253	T	0.74337	-0.3698	10	0.66056	D	0.02	.	15.8323	0.78764	0.0:0.0:0.0:1.0	.	55;55	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	G	55;69;55;55	ENSP00000379434:S55G;ENSP00000347193:S69G;ENSP00000452061:S55G;ENSP00000452591:S55G	ENSP00000347193:S69G	S	-	1	0	KLHL28	44484719	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.796000	0.69080	2.225000	0.72522	0.533000	0.62120	AGC	.		0.438	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3		
KRT2	3849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	53039093	53039093	+	Nonsense_Mutation	SNP	G	G	A	rs571471637		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr12:53039093G>A	ENST00000309680.3	-	9	1651	c.1630C>T	c.(1630-1632)Cga>Tga	p.R544*		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	544	Tail.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		CCAGACTGTCGGCCTCCAGAG	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		19460	0.0		0.001	False		,,,				2504	0.0				p.R544X		.											.	KRT2	92	0			c.C1630T						.						117.0	122.0	120.0					12																	53039093		2203	4300	6503	SO:0001587	stop_gained	3849	exon9			ACTGTCGGCCTCC		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.1630C>T	12.37:g.53039093G>A	ENSP00000310861:p.Arg544*	74.0	0.0		67.0	13.0	NM_000423	Q4VAQ2	Nonsense_Mutation	SNP	ENST00000309680.3	37	CCDS8835.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.158842	0.57368	.	.	ENSG00000172867	ENST00000309680	.	.	.	4.06	-2.84	0.05751	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	4.008	0.09610	0.1189:0.1732:0.5177:0.1902	.	.	.	.	X	544	.	ENSP00000310861:R544X	R	-	1	2	KRT2	51325360	0.000000	0.05858	0.410000	0.26471	0.327000	0.28475	-0.305000	0.08188	-0.359000	0.08150	-0.397000	0.06425	CGA	.		0.572	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
KRTAP5-1	387264	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1606421	1606421	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:1606421C>G	ENST00000382171.2	-	1	92	c.59G>C	c.(58-60)gGc>gCc	p.G20A	KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	20						keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCCCCACAGCCGGAGCCACA	0.677																																					p.G20A		.											.	KRTAP5-1	44	0			c.G59C						.						39.0	50.0	47.0					11																	1606421		2172	4259	6431	SO:0001583	missense	387264	exon1			CCACAGCCGGAGC	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.59G>C	11.37:g.1606421C>G	ENSP00000371606:p.Gly20Ala	190.0	0.0		147.0	62.0	NM_001005922		Missense_Mutation	SNP	ENST00000382171.2	37	CCDS31330.1	.	.	.	.	.	.	.	.	.	.	C	0.885	-0.727559	0.03158	.	.	ENSG00000205869	ENST00000382171	T	0.04317	3.65	2.84	2.84	0.33178	.	.	.	.	.	T	0.07143	0.0181	L	0.60455	1.87	0.25427	N	0.98821	B	0.29612	0.251	B	0.35114	0.196	T	0.31971	-0.9924	9	0.10902	T	0.67	.	11.8714	0.52523	0.0:1.0:0.0:0.0	.	20	Q6L8H4	KRA51_HUMAN	A	20	ENSP00000371606:G20A	ENSP00000371606:G20A	G	-	2	0	KRTAP5-1	1562997	0.000000	0.05858	0.988000	0.46212	0.046000	0.14306	0.505000	0.22642	1.535000	0.49220	0.313000	0.20887	GGC	.		0.677	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1	NM_001005922	
LDB3	11155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	88459081	88459081	+	Missense_Mutation	SNP	C	C	T	rs121908335		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:88459081C>T	ENST00000372066.3	+	8	881	c.802C>T	c.(802-804)Cgc>Tgc	p.R268C	LDB3_ENST00000372056.4_Missense_Mutation_p.R383C|LDB3_ENST00000458213.2_Intron|LDB3_ENST00000263066.6_Intron|LDB3_ENST00000352360.5_Intron|LDB3_ENST00000542786.1_3'UTR|LDB3_ENST00000310944.6_Missense_Mutation_p.R315C|LDB3_ENST00000429277.2_Intron|LDB3_ENST00000361373.4_Intron	NM_001080116.1	NP_001073585.1			LIM domain binding 3											breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|soft_tissue(1)	25						TGCCAAATTGCGCAACTGGCA	0.512																																					p.R383C		.											.	LDB3	92	0			c.C1147T	GRCh37	CM050286	LDB3	M	rs121908335	.	C	,CYS/ARG,CYS/ARG,,CYS/ARG,	0,3846		0,0,1923	162.0	173.0	169.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,943,802,,1147,	5.1	1.0	10	dbSNP_133	169	1,8283		0,1,4141	no	intron,missense,missense,intron,missense,intron	LDB3	NM_001080114.1,NM_001080115.1,NM_001080116.1,NM_001171610.1,NM_001171611.1,NM_007078.2	,180,180,,180,	0,1,6064	TT,TC,CC		0.0121,0.0,0.0082	,,,,,	,315/331,268/284,,383/399,	88459081	1,12129	1923	4142	6065	SO:0001583	missense	11155	exon8			AAATTGCGCAACT	AB014513	CCDS7377.1, CCDS41544.1, CCDS41545.1, CCDS53549.1, CCDS53550.1	10q22.3-q23.2	2014-09-17			ENSG00000122367	ENSG00000122367			15710	protein-coding gene	gene with protein product	"""cypher"", ""oracle"", ""Z-band alternatively spliced PDZ motif protein"""	605906	"""cardiomyopathy, dilated 1C (autosomal dominant)"""	CMD1C		10427098, 23271734, 23996002, 14662268	Standard	NM_001080114		Approved	PDLIM6, KIAA0613, ZASP	uc001kdv.3	O75112	OTTHUMG00000018655	ENST00000372066.3:c.802C>T	10.37:g.88459081C>T	ENSP00000361136:p.Arg268Cys	72.0	0.0		104.0	19.0	NM_001171611		Missense_Mutation	SNP	ENST00000372066.3	37	CCDS41545.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478303	0.84747	0.0	1.21E-4	ENSG00000122367	ENST00000372066;ENST00000372056;ENST00000310944	T;T;T	0.50548	0.86;0.74;0.95	5.06	5.06	0.68205	.	.	.	.	.	T	0.65831	0.2729	L	0.55990	1.75	0.80722	A	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.76071	0.966;0.987;0.809	T	0.68161	-0.5482	8	0.87932	D	0	.	18.6293	0.91354	0.0:1.0:0.0:0.0	.	383;315;268	O75112-4;O75112-5;O75112-6	.;.;.	C	268;383;315	ENSP00000361136:R268C;ENSP00000361126:R383C;ENSP00000311913:R315C	ENSP00000311913:R315C	R	+	1	0	LDB3	88449061	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.468000	0.60162	2.642000	0.89623	0.561000	0.74099	CGC	.		0.512	LDB3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049161.1		
LDOC1	23641	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	140270987	140270987	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chrX:140270987delA	ENST00000370526.2	-	1	323	c.220delT	c.(220-222)tacfs	p.Y74fs	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	74					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					ACGAGCATGTAAGACGCCGTC	0.617																																					p.Y74fs		.											.	LDOC1	130	0			c.220delT						.						98.0	81.0	86.0					X																	140270987		2203	4300	6503	SO:0001589	frameshift_variant	23641	exon1			GCATGTAAGACGC	AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.220delT	X.37:g.140270987delA	ENSP00000359557:p.Tyr74fs	97.0	0.0		75.0	28.0	NM_012317	Q6IAR6	Frame_Shift_Del	DEL	ENST00000370526.2	37	CCDS14672.1																																																																																			.		0.617	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058592.1	NM_012317	
LILRB5	10990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54759311	54759311	+	Missense_Mutation	SNP	C	C	T	rs376519844		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:54759311C>T	ENST00000316219.5	-	5	897	c.790G>A	c.(790-792)Gtc>Atc	p.V264I	LILRB5_ENST00000449561.2_Missense_Mutation_p.V264I|LILRB5_ENST00000450632.1_Missense_Mutation_p.V255I|LILRB5_ENST00000345866.6_Missense_Mutation_p.V164I	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	264	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GAGCCCTGGACGAGGTCATGT	0.652																																					p.V264I		.											.	LILRB5	92	0			c.G790A						.	C	ILE/VAL,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	50.0	49.0	49.0		790,490,790	0.2	0.0	19		49	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	LILRB5	NM_001081442.1,NM_001081443.1,NM_006840.3	29,29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign,benign	264/592,164/492,264/591	54759311	2,13004	2203	4300	6503	SO:0001583	missense	10990	exon5			CCTGGACGAGGTC	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.790G>A	19.37:g.54759311C>T	ENSP00000320390:p.Val264Ile	217.0	0.0		228.0	28.0	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	2.988	-0.208894	0.06140	2.27E-4	1.16E-4	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.10382	2.88;2.88;2.88;2.88	2.62	0.214	0.15249	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.098760	0.02459	N	0.086366	T	0.05640	0.0148	N	0.16130	0.375	0.09310	N	1	B;P;B;B;B	0.41597	0.197;0.756;0.136;0.078;0.054	B;B;B;B;B	0.34038	0.067;0.174;0.035;0.015;0.046	T	0.27400	-1.0075	10	0.21540	T	0.41	.	4.7798	0.13197	0.0:0.2451:0.5056:0.2493	.	255;155;164;264;264	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	I	264;255;264;164	ENSP00000320390:V264I;ENSP00000414225:V255I;ENSP00000406478:V264I;ENSP00000263430:V164I	ENSP00000320390:V264I	V	-	1	0	LILRB5	59451123	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.659000	0.05323	0.136000	0.18733	-0.428000	0.05917	GTC	.		0.652	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
LRBA	987	hgsc.bcm.edu;bcgsc.ca	37	4	151727552	151727552	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:151727552T>C	ENST00000357115.3	-	33	5632	c.5389A>G	c.(5389-5391)Aca>Gca	p.T1797A	LRBA_ENST00000535741.1_Missense_Mutation_p.T1797A|LRBA_ENST00000510413.1_Missense_Mutation_p.T1797A|LRBA_ENST00000507224.1_Missense_Mutation_p.T1797A	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1797						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGCCTCTCTGTAATACTAAGG	0.338																																					p.T1797A		.											.	LRBA	157	0			c.A5389G						.						39.0	41.0	40.0					4																	151727552		2203	4300	6503	SO:0001583	missense	987	exon33			TCTCTGTAATACT	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5389A>G	4.37:g.151727552T>C	ENSP00000349629:p.Thr1797Ala	97.0	0.0		70.0	4.0	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.922047	0.73213	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.59638	0.68;0.83;0.69;0.25	5.55	5.55	0.83447	.	0.253838	0.40728	N	0.001023	T	0.62122	0.2402	M	0.81802	2.56	0.80722	D	1	B;P	0.34615	0.451;0.459	B;B	0.33960	0.137;0.173	T	0.67461	-0.5665	10	0.66056	D	0.02	.	15.692	0.77461	0.0:0.0:0.0:1.0	.	1797;1797	P50851;P50851-2	LRBA_HUMAN;.	A	1797	ENSP00000446299:T1797A;ENSP00000421552:T1797A;ENSP00000349629:T1797A;ENSP00000422180:T1797A	ENSP00000349629:T1797A	T	-	1	0	LRBA	151947002	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	4.856000	0.62932	2.104000	0.64026	0.533000	0.62120	ACA	.		0.338	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
MDN1	23195	hgsc.bcm.edu;bcgsc.ca	37	6	90461216	90461216	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:90461216T>C	ENST00000369393.3	-	23	3276	c.3161A>G	c.(3160-3162)gAg>gGg	p.E1054G	MDN1_ENST00000428876.1_Missense_Mutation_p.E1054G			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1054					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AATGTACGTCTCATCTATTGT	0.498																																					p.E1054G		.											.	MDN1	100	0			c.A3161G						.						157.0	135.0	142.0					6																	90461216		2203	4300	6503	SO:0001583	missense	23195	exon23			TACGTCTCATCTA	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.3161A>G	6.37:g.90461216T>C	ENSP00000358400:p.Glu1054Gly	164.0	0.0		109.0	5.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	15.42	2.829792	0.50845	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.42900	0.96;0.96;0.96	5.71	5.71	0.89125	.	0.185062	0.47852	D	0.000213	T	0.24431	0.0592	L	0.46819	1.47	0.41553	D	0.988584	B;B	0.25390	0.041;0.125	B;B	0.24394	0.017;0.053	T	0.05599	-1.0875	10	0.32370	T	0.25	.	15.9883	0.80179	0.0:0.0:0.0:1.0	.	981;1054	Q5T795;Q9NU22	.;MDN1_HUMAN	G	1054;1054;981	ENSP00000358400:E1054G;ENSP00000413970:E1054G;ENSP00000409664:E981G	ENSP00000358400:E1054G	E	-	2	0	MDN1	90517937	1.000000	0.71417	0.996000	0.52242	0.899000	0.52679	5.020000	0.64066	2.172000	0.68678	0.533000	0.62120	GAG	.		0.498	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
MAP3K4	4216	hgsc.bcm.edu;bcgsc.ca	37	6	161455479	161455479	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:161455479A>G	ENST00000392142.4	+	2	489	c.341A>G	c.(340-342)aAa>aGa	p.K114R	MAP3K4_ENST00000348824.7_Missense_Mutation_p.K114R|MAP3K4_ENST00000366919.2_Missense_Mutation_p.K114R|MAP3K4_ENST00000446500.1_3'UTR|MAP3K4_ENST00000366920.2_Missense_Mutation_p.K114R	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	114					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TCTAATTTGAAAGGTGAGTCT	0.413																																					p.K114R		.											.	MAP3K4	548	0			c.A341G						.						50.0	54.0	53.0					6																	161455479		2203	4300	6503	SO:0001583	missense	4216	exon2			ATTTGAAAGGTGA	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.341A>G	6.37:g.161455479A>G	ENSP00000375986:p.Lys114Arg	104.0	0.0		67.0	4.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	37	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.316897	0.81469	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824;ENST00000544209;ENST00000448119	T;T;T;T	0.75260	-0.9;-0.92;-0.91;-0.9	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.58409	0.2120	L	0.43152	1.355	0.39588	D	0.969533	P;P	0.44627	0.804;0.839	B;B	0.41571	0.36;0.276	T	0.60757	-0.7200	10	0.28530	T	0.3	-35.8541	16.1616	0.81721	1.0:0.0:0.0:0.0	.	114;114	Q9Y6R4-2;Q9Y6R4	.;M3K4_HUMAN	R	114;114;114;114;114;93;23	ENSP00000355886:K114R;ENSP00000375986:K114R;ENSP00000355887:K114R;ENSP00000297332:K114R	ENSP00000297332:K114R	K	+	2	0	MAP3K4	161375469	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.975000	0.56859	2.275000	0.75901	0.529000	0.55759	AAA	.		0.413	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
MED16	10025	hgsc.bcm.edu;bcgsc.ca	37	19	873468	873468	+	Missense_Mutation	SNP	A	A	G	rs367567945		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:873468A>G	ENST00000589119.1	-	10	1885	c.1886T>C	c.(1885-1887)cTg>cCg	p.L629P	MED16_ENST00000606828.1_5'Flank|MED16_ENST00000312090.6_Missense_Mutation_p.L629P|MED16_ENST00000269814.4_Missense_Mutation_p.L629P|MED16_ENST00000395808.3_Missense_Mutation_p.L629P|MED16_ENST00000325464.1_Missense_Mutation_p.L629P			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	629					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGGCTGGCCAGCAGGTACAG	0.642																																					p.L629P		.											.	MED16	186	0			c.T1886C						.						98.0	76.0	84.0					19																	873468		2202	4296	6498	SO:0001583	missense	10025	exon11			CTGGCCAGCAGGT	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1886T>C	19.37:g.873468A>G	ENSP00000464810:p.Leu629Pro	66.0	0.0		88.0	5.0	NM_005481	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	a	18.67	3.673050	0.67928	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000424039	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	4.44	4.44	0.53790	.	0.000000	0.64402	D	0.000006	T	0.49201	0.1543	M	0.67397	2.05	0.80722	D	1	B;B;B;B;P	0.35192	0.23;0.149;0.433;0.433;0.489	B;B;B;B;B	0.38106	0.124;0.065;0.11;0.172;0.265	T	0.53606	-0.8415	10	0.51188	T	0.08	-25.8475	12.866	0.57939	1.0:0.0:0.0:0.0	.	629;629;629;629;629	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	P	629	ENSP00000325612:L629P;ENSP00000308528:L629P;ENSP00000379153:L629P;ENSP00000269814:L629P	ENSP00000269814:L629P	L	-	2	0	MED16	824468	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.592000	0.90828	1.627000	0.50400	0.454000	0.30748	CTG	.		0.642	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
METAP1	23173	hgsc.bcm.edu;bcgsc.ca	37	4	99960538	99960538	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:99960538T>C	ENST00000296411.6	+	5	488	c.354T>C	c.(352-354)tcT>tcC	p.S118S	METAP1_ENST00000544031.1_Silent_p.S68S	NM_015143.2	NP_055958.2	P53582	MAP11_HUMAN	methionyl aminopeptidase 1	118					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|phototransduction, visible light (GO:0007603)|platelet aggregation (GO:0070527)|protein initiator methionine removal (GO:0070084)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of translation (GO:0006417)|rhodopsin mediated signaling pathway (GO:0016056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic ribosome (GO:0022626)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		TGTCTGAATCTGAACAGGCTC	0.333																																					p.S118S		.											.	.	.	0			c.T354C						.						121.0	114.0	116.0					4																	99960538		1811	4074	5885	SO:0001819	synonymous_variant	23173	exon5			TGAATCTGAACAG	D42084	CCDS47110.1	4q23	2010-08-20			ENSG00000164024	ENSG00000164024	3.4.11.18		15789	protein-coding gene	gene with protein product	"""Peptidase M"""	610151				7788527, 12144506	Standard	NM_015143		Approved	KIAA0094, MetAP1A, MAP1A	uc003huf.4	P53582	OTTHUMG00000161231	ENST00000296411.6:c.354T>C	4.37:g.99960538T>C		72.0	0.0		75.0	4.0	NM_015143	B4E2E6	Silent	SNP	ENST00000296411.6	37	CCDS47110.1																																																																																			.		0.333	METAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364237.1	NM_015143	
MGAT5	4249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	135170467	135170467	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr2:135170467G>A	ENST00000409645.1	+	13	1810	c.1558G>A	c.(1558-1560)Gag>Aag	p.E520K	MGAT5_ENST00000281923.2_Missense_Mutation_p.E520K			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	520					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GTTCCCTTACGAGGGCCCAGC	0.493																																					p.E520K		.											.	MGAT5	93	0			c.G1558A						.						168.0	151.0	157.0					2																	135170467		2203	4300	6503	SO:0001583	missense	4249	exon12			CCTTACGAGGGCC	D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.1558G>A	2.37:g.135170467G>A	ENSP00000386377:p.Glu520Lys	250.0	0.0		231.0	28.0	NM_002410	D3DP70	Missense_Mutation	SNP	ENST00000409645.1	37	CCDS2171.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.981741	0.93044	.	.	ENSG00000152127	ENST00000409645;ENST00000281923	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.83617	0.5293	M	0.80982	2.52	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.84896	0.0839	9	0.72032	D	0.01	-27.3571	19.8251	0.96614	0.0:0.0:1.0:0.0	.	520	Q09328	MGT5A_HUMAN	K	520	.	ENSP00000281923:E520K	E	+	1	0	MGAT5	134886937	1.000000	0.71417	0.965000	0.40720	0.988000	0.76386	9.785000	0.99042	2.685000	0.91497	0.655000	0.94253	GAG	.		0.493	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254584.3	NM_002410	
MRC2	9902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	60766239	60766239	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:60766239C>A	ENST00000303375.5	+	23	3654	c.3252C>A	c.(3250-3252)agC>agA	p.S1084R	MRC2_ENST00000580916.1_3'UTR|MRC2_ENST00000446119.2_Missense_Mutation_p.A30D	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1084	C-type lectin 6. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TCCTGCACAGCCCCTCAGCCC	0.647																																					p.S1084R		.											.	MRC2	117	0			c.C3252A						.						33.0	29.0	30.0					17																	60766239		2203	4300	6503	SO:0001583	missense	9902	exon23			GCACAGCCCCTCA	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3252C>A	17.37:g.60766239C>A	ENSP00000307513:p.Ser1084Arg	127.0	0.0		124.0	42.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.88|11.88	1.770068|1.770068	0.31320|0.31320	.|.	.|.	ENSG00000011028|ENSG00000011028	ENST00000446119|ENST00000303375	T|T	0.03301|0.18657	3.98|2.2	4.46|4.46	3.48|3.48	0.39840|0.39840	.|C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.|0.049850	.|0.85682	.|D	.|0.000000	T|T	0.20170|0.20170	0.0485|0.0485	L|L	0.34521|0.34521	1.04|1.04	0.25380|0.25380	N|N	0.988623|0.988623	D|P	0.58268|0.43938	0.982|0.822	P|P	0.50708|0.48400	0.648|0.576	T|T	0.09443|0.09443	-1.0674|-1.0674	9|10	0.40728|0.14656	T|T	0.16|0.56	-37.4987|-37.4987	10.8344|10.8344	0.46679|0.46679	0.0:0.7893:0.1319:0.0788|0.0:0.7893:0.1319:0.0788	.|.	30|1084	E7EME3|Q9UBG0	.|MRC2_HUMAN	D|R	30|1084	ENSP00000400445:A30D|ENSP00000307513:S1084R	ENSP00000400445:A30D|ENSP00000307513:S1084R	A|S	+|+	2|3	0|2	MRC2|MRC2	58119971|58119971	0.990000|0.990000	0.36364|0.36364	1.000000|1.000000	0.80357|0.80357	0.657000|0.657000	0.38888|0.38888	0.865000|0.865000	0.27940|0.27940	0.500000|0.500000	0.27991|0.27991	-1.598000|-1.598000	0.00824|0.00824	GCC|AGC	.		0.647	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
MRPS31	10240	hgsc.bcm.edu;bcgsc.ca	37	13	41323319	41323319	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr13:41323319T>C	ENST00000323563.6	-	6	949	c.913A>G	c.(913-915)Aca>Gca	p.T305A	MRPS31_ENST00000498078.1_5'UTR	NM_005830.3	NP_005821.2	Q92665	RT31_HUMAN	mitochondrial ribosomal protein S31	305						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)		CCCTCTTTTGTCCACTGGATC	0.398																																					p.T305A		.											.	MRPS31	226	0			c.A913G						.						129.0	123.0	125.0					13																	41323319		2203	4300	6503	SO:0001583	missense	10240	exon6			CTTTTGTCCACTG	Z68747	CCDS9372.1	13q14.11	2012-09-13			ENSG00000102738	ENSG00000102738		"""Mitochondrial ribosomal proteins / small subunits"""	16632	protein-coding gene	gene with protein product		611992				11279123, 8567980	Standard	NM_005830		Approved	IMOGN38	uc001uxm.4	Q92665	OTTHUMG00000016777	ENST00000323563.6:c.913A>G	13.37:g.41323319T>C	ENSP00000315397:p.Thr305Ala	146.0	0.0		67.0	4.0	NM_005830	B2RCS3|Q5VYC8|Q8WTV8	Missense_Mutation	SNP	ENST00000323563.6	37	CCDS9372.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.201477	0.79015	.	.	ENSG00000102738	ENST00000323563	T	0.55052	0.54	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	M	0.90309	3.105	0.80722	D	1	D	0.71674	0.998	D	0.74348	0.983	T	0.81890	-0.0725	10	0.87932	D	0	.	13.4195	0.60989	0.0:0.0:0.0:1.0	.	305	Q92665	RT31_HUMAN	A	305	ENSP00000315397:T305A	ENSP00000315397:T305A	T	-	1	0	MRPS31	40221319	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	6.864000	0.75494	1.854000	0.53819	0.524000	0.50904	ACA	.		0.398	MRPS31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044640.2		
MTMR11	10903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149901687	149901687	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:149901687C>T	ENST00000439741.2	-	16	2019	c.1769G>A	c.(1768-1770)cGt>cAt	p.R590H	MTMR11_ENST00000406732.3_3'UTR|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000361405.6_3'UTR|MTMR11_ENST00000369140.3_Missense_Mutation_p.R518H|SF3B4_ENST00000271628.8_5'Flank	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	590	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			AGGGAGCCAACGAGAAGAGAC	0.597																																					p.R590H		.											.	MTMR11	90	0			c.G1769A						.						58.0	63.0	61.0					1																	149901687		2203	4300	6503	SO:0001583	missense	10903	exon16			AGCCAACGAGAAG	AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.1769G>A	1.37:g.149901687C>T	ENSP00000391668:p.Arg590His	83.0	0.0		130.0	20.0	NM_001145862	B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	ENST00000439741.2	37	CCDS53360.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102395	0.37145	.	.	ENSG00000014914	ENST00000369140;ENST00000439741	T;T	0.40476	1.03;1.03	5.13	4.21	0.49690	Myotubularin phosphatase domain (1);	0.461097	0.23510	N	0.047406	T	0.11067	0.0270	N	0.08118	0	0.80722	D	1	B;B	0.17268	0.017;0.021	B;B	0.12837	0.005;0.008	T	0.05517	-1.0880	10	0.52906	T	0.07	.	9.8951	0.41314	0.0:0.9039:0.0:0.0961	.	518;590	A4FU01-4;A4FU01	.;MTMRB_HUMAN	H	518;590	ENSP00000358136:R518H;ENSP00000391668:R590H	ENSP00000358136:R518H	R	-	2	0	MTMR11	148168311	0.994000	0.37717	1.000000	0.80357	0.994000	0.84299	2.224000	0.42945	1.366000	0.46076	0.655000	0.94253	CGT	.		0.597	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_181873	
MYOM1	8736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	3090725	3090725	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr18:3090725C>T	ENST00000356443.4	-	27	4273	c.3940G>A	c.(3940-3942)Gga>Aga	p.G1314R	MYOM1_ENST00000261606.7_Missense_Mutation_p.G1218R|RNU7-25P_ENST00000516544.1_RNA|MYOM1_ENST00000400569.3_Missense_Mutation_p.G1314R	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1314					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GTGTACGTTCCCTCATCCTCA	0.403																																					p.G1314R		.											.	MYOM1	94	0			c.G3940A						.						201.0	197.0	198.0					18																	3090725		1967	4154	6121	SO:0001583	missense	8736	exon27			ACGTTCCCTCATC	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.3940G>A	18.37:g.3090725C>T	ENSP00000348821:p.Gly1314Arg	216.0	0.0		165.0	30.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426311	0.83667	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.17054	2.3;2.3;2.3	5.7	4.83	0.62350	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.42966	0.1226	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.41627	-0.9498	10	0.20046	T	0.44	.	14.4195	0.67173	0.0:0.9295:0.0:0.0704	.	1218;1314	P52179-2;P52179	.;MYOM1_HUMAN	R	1314;1314;1218	ENSP00000348821:G1314R;ENSP00000383413:G1314R;ENSP00000261606:G1218R	ENSP00000261606:G1218R	G	-	1	0	MYOM1	3080725	1.000000	0.71417	0.988000	0.46212	0.977000	0.68977	7.818000	0.86416	1.412000	0.46977	0.591000	0.81541	GGA	.		0.403	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
NAAA	27163	hgsc.bcm.edu;bcgsc.ca	37	4	76861242	76861242	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:76861242A>G	ENST00000286733.4	-	2	384	c.283T>C	c.(283-285)Ttc>Ctc	p.F95L	NAAA_ENST00000507956.1_Missense_Mutation_p.F95L|NAAA_ENST00000507187.2_Missense_Mutation_p.F95L|NAAA_ENST00000399497.3_Missense_Mutation_p.F95L|NAAA_ENST00000505594.1_5'UTR	NM_014435.3	NP_055250.2	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase	95					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	11						TCGCCGGTGAAGGGCTGGGGC	0.597																																					p.F95L		.											.	NAAA	91	0			c.T283C						.						52.0	60.0	57.0					4																	76861242		2035	4186	6221	SO:0001583	missense	27163	exon2			CGGTGAAGGGCTG	M92449	CCDS43239.1	4q21.1	2011-09-23	2008-04-24	2008-04-24	ENSG00000138744	ENSG00000138744	3.5.1.-		736	protein-coding gene	gene with protein product		607469	"""N-acylsphingosine amidohydrolase (acid ceramidase)-like"""	ASAHL		10610717, 1446826	Standard	NM_001042402		Approved		uc003hjb.3	Q02083	OTTHUMG00000160855	ENST00000286733.4:c.283T>C	4.37:g.76861242A>G	ENSP00000286733:p.Phe95Leu	132.0	0.0		105.0	5.0	NM_014435	Q5KTF2|Q96EY2|Q9BRA8	Missense_Mutation	SNP	ENST00000286733.4	37	CCDS43239.1	.	.	.	.	.	.	.	.	.	.	A	18.07	3.541104	0.65085	.	.	ENSG00000138744	ENST00000399497;ENST00000286733;ENST00000507956;ENST00000399490;ENST00000507187	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.1	3.91	0.45181	.	0.131674	0.53938	D	0.000047	T	0.42899	0.1223	M	0.70275	2.135	0.22803	N	0.998714	P;B	0.46952	0.887;0.376	B;B	0.40825	0.341;0.114	T	0.34204	-0.9838	10	0.27785	T	0.31	-6.1781	7.5806	0.27963	0.9044:0.0:0.0956:0.0	.	95;95	D6R9S9;Q02083	.;NAAA_HUMAN	L	95	ENSP00000382420:F95L;ENSP00000286733:F95L;ENSP00000427641:F95L;ENSP00000423142:F95L	ENSP00000286733:F95L	F	-	1	0	NAAA	77080266	1.000000	0.71417	0.199000	0.23439	0.990000	0.78478	4.680000	0.61656	0.960000	0.38005	0.477000	0.44152	TTC	.		0.597	NAAA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362843.4		
NAV2	89797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	20066708	20066708	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:20066708C>G	ENST00000396087.3	+	15	3562	c.3463C>G	c.(3463-3465)Ctg>Gtg	p.L1155V	NAV2_ENST00000360655.4_Missense_Mutation_p.L1068V|NAV2_ENST00000533917.1_Missense_Mutation_p.L218V|NAV2_ENST00000540292.1_Missense_Mutation_p.L1086V|NAV2_ENST00000527559.2_Missense_Mutation_p.L1084V|NAV2_ENST00000311043.8_Missense_Mutation_p.L218V|NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000396085.1_Missense_Mutation_p.L1132V|NAV2_ENST00000349880.4_Missense_Mutation_p.L1132V	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1155					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CGCCGCCGGCCTGGCCATGAT	0.587																																					p.L1155V		.											.	NAV2	96	0			c.C3463G						.						73.0	71.0	72.0					11																	20066708		2203	4300	6503	SO:0001583	missense	89797	exon15			GCCGGCCTGGCCA	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.3463C>G	11.37:g.20066708C>G	ENSP00000379396:p.Leu1155Val	78.0	0.0		54.0	12.0	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	ENST00000396087.3	37	CCDS58126.1	.	.	.	.	.	.	.	.	.	.	C	0.147	-1.095834	0.01858	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000525322;ENST00000311043;ENST00000536595	T;T;T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6	5.9	4.05	0.47172	.	0.124126	0.36591	N	0.002504	T	0.13200	0.0320	N	0.08118	0	0.31055	N	0.71483	B;B;B;B;B	0.14012	0.009;0.005;0.007;0.004;0.007	B;B;B;B;B	0.09377	0.003;0.002;0.004;0.004;0.004	T	0.16188	-1.0411	9	.	.	.	.	6.2904	0.21057	0.2349:0.6146:0.0:0.1505	.	1155;218;218;1132;1068	Q8IVL1;Q8IVL1-5;E9PNV5;Q8IVL1-3;Q8IVL1-4	NAV2_HUMAN;.;.;.;.	V	1068;1132;1132;1155;1084;1086;218;218;218;218	ENSP00000353871:L1068V;ENSP00000379394:L1132V;ENSP00000309577:L1132V;ENSP00000379396:L1155V;ENSP00000435395:L1084V;ENSP00000443489:L1086V;ENSP00000437316:L218V;ENSP00000437136:L218V;ENSP00000312169:L218V	.	L	+	1	2	NAV2	20023284	0.914000	0.31030	0.963000	0.40424	0.647000	0.38526	1.702000	0.37836	0.844000	0.35094	0.650000	0.86243	CTG	.		0.587	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
NCOA3	8202	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	46271003	46271003	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr20:46271003A>G	ENST00000371998.3	+	17	3318	c.3127A>G	c.(3127-3129)Aac>Gac	p.N1043D	NCOA3_ENST00000372004.3_Missense_Mutation_p.N1043D|NCOA3_ENST00000371997.3_Missense_Mutation_p.N1038D|NCOA3_ENST00000341724.6_Missense_Mutation_p.N973D			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1043	Interaction with CREBBP.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCCACCTTCCAACCTGGAAGG	0.448																																					p.N1043D		.											.	NCOA3	229	0			c.A3127G						.						155.0	145.0	148.0					20																	46271003		2203	4300	6503	SO:0001583	missense	8202	exon17			CCTTCCAACCTGG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3127A>G	20.37:g.46271003A>G	ENSP00000361066:p.Asn1043Asp	72.0	0.0		40.0	4.0	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	ENST00000371998.3	37	CCDS13407.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.289902	0.80914	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.02050	4.48;4.66;4.66;4.48	5.62	5.62	0.85841	.	0.130948	0.52532	D	0.000062	T	0.03608	0.0103	L	0.56769	1.78	0.37633	D	0.921752	B;P;B;B;B;B	0.47762	0.243;0.9;0.243;0.243;0.356;0.243	B;B;B;B;B;B	0.39258	0.09;0.295;0.09;0.09;0.185;0.09	T	0.59685	-0.7408	10	0.22109	T	0.4	-24.9681	16.1146	0.81295	1.0:0.0:0.0:0.0	.	1043;1038;1047;1043;1043;1043	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	D	1043;973;1043;1043;1038	ENSP00000342123:N973D;ENSP00000361073:N1043D;ENSP00000361066:N1043D;ENSP00000361065:N1038D	ENSP00000345671:N1043D	N	+	1	0	NCOA3	45704410	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.910000	0.92685	2.260000	0.74910	0.528000	0.53228	AAC	.		0.448	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
NDST4	64579	hgsc.bcm.edu;bcgsc.ca	37	4	115856381	115856381	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:115856381A>G	ENST00000264363.2	-	6	2195	c.1517T>C	c.(1516-1518)cTc>cCc	p.L506P		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	506	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAGGATTGTGAGAAAAAGTTC	0.348																																					p.L506P		.											.	NDST4	94	0			c.T1517C						.						192.0	194.0	194.0					4																	115856381		2203	4300	6503	SO:0001583	missense	64579	exon6			ATTGTGAGAAAAA	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1517T>C	4.37:g.115856381A>G	ENSP00000264363:p.Leu506Pro	140.0	0.0		82.0	4.0	NM_022569	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.858431	0.51376	.	.	ENSG00000138653	ENST00000264363	T	0.38401	1.14	5.12	5.12	0.69794	.	0.059132	0.64402	D	0.000001	T	0.48960	0.1529	M	0.75447	2.3	0.80722	D	1	P	0.40250	0.709	P	0.46510	0.519	T	0.52071	-0.8624	10	0.49607	T	0.09	.	14.9199	0.70829	1.0:0.0:0.0:0.0	.	506	Q9H3R1	NDST4_HUMAN	P	506	ENSP00000264363:L506P	ENSP00000264363:L506P	L	-	2	0	NDST4	116075830	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.248000	0.95456	1.912000	0.55364	0.482000	0.46254	CTC	.		0.348	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
NFASC	23114	hgsc.bcm.edu;bcgsc.ca	37	1	204978736	204978736	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:204978736T>C	ENST00000401399.1	+	27	3540	c.3341T>C	c.(3340-3342)cTt>cCt	p.L1114P	NFASC_ENST00000367171.4_Missense_Mutation_p.L1206P|NFASC_ENST00000338586.6_Missense_Mutation_p.L1098P|NFASC_ENST00000367169.4_Missense_Mutation_p.L945P|NFASC_ENST00000404076.1_Missense_Mutation_p.L1031P|NFASC_ENST00000404907.1_Missense_Mutation_p.L1048P|NFASC_ENST00000539706.1_Missense_Mutation_p.L1048P|NFASC_ENST00000513543.1_Missense_Mutation_p.L1043P|NFASC_ENST00000360049.4_Missense_Mutation_p.L1043P|NFASC_ENST00000338515.6_Missense_Mutation_p.L1131P|NFASC_ENST00000367170.4_Missense_Mutation_p.L1142P|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000339876.6_Missense_Mutation_p.L1114P|NFASC_ENST00000367172.4_Missense_Mutation_p.L1221P			O94856	NFASC_HUMAN	neurofascin	1221	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TTCATTGGGCTTATGTGCGCC	0.587																																					p.L1114P		.											.	NFASC	139	0			c.T3341C						.						106.0	82.0	90.0					1																	204978736		2203	4300	6503	SO:0001583	missense	23114	exon28			TTGGGCTTATGTG	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3341T>C	1.37:g.204978736T>C	ENSP00000385637:p.Leu1114Pro	67.0	0.0		60.0	5.0	NM_001005388	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.716338	0.89205	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393;ENST00000447819	T;T;T;T;T;T;T;T;T;T;T;T;T;T;D	0.82803	-0.77;-0.82;-0.53;-0.57;-0.79;-0.71;-0.42;-0.43;-0.47;-0.52;-0.79;-0.42;-0.43;-0.4;-1.65	5.27	5.27	0.74061	.	0.000000	0.44285	D	0.000480	D	0.91918	0.7441	M	0.87547	2.89	0.53005	D	0.999964	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.997;0.996;0.998;0.996;0.999;0.999	D	0.93338	0.6707	10	0.87932	D	0	.	14.856	0.70338	0.0:0.0:0.0:1.0	.	1221;1063;1048;1098;940;1114;1043	O94856;O94856-11;O94856-8;F8W8X7;O94856-4;O94856-9;O94856-3	NFASC_HUMAN;.;.;.;.;.;.	P	1221;1206;1142;1131;1114;1098;1063;1048;1043;945;1031;1114;1048;1043;1039;92	ENSP00000356140:L1221P;ENSP00000356139:L1206P;ENSP00000356138:L1142P;ENSP00000342128:L1131P;ENSP00000344786:L1114P;ENSP00000343509:L1098P;ENSP00000438614:L1048P;ENSP00000353154:L1043P;ENSP00000356137:L945P;ENSP00000385676:L1031P;ENSP00000385637:L1114P;ENSP00000384061:L1048P;ENSP00000425908:L1043P;ENSP00000415031:L1039P;ENSP00000416891:L92P	ENSP00000295776:L1063P	L	+	2	0	NFASC	203245359	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.988000	0.88194	1.966000	0.57179	0.533000	0.62120	CTT	.		0.587	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
NFAT5	10725	hgsc.bcm.edu;bcgsc.ca	37	16	69718852	69718852	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr16:69718852T>C	ENST00000354436.2	+	10	2017	c.1699T>C	c.(1699-1701)Tct>Cct	p.S567P	NFAT5_ENST00000432919.1_Missense_Mutation_p.S585P|NFAT5_ENST00000566899.1_Missense_Mutation_p.S491P|NFAT5_ENST00000393742.2_Missense_Mutation_p.S491P|NFAT5_ENST00000349945.1_Missense_Mutation_p.S491P|NFAT5_ENST00000567239.1_Missense_Mutation_p.S584P	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	567					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AAGACCTTGCTCTTTTGAAGA	0.343																																					p.S585P		.											.	NFAT5	90	0			c.T1753C						.						66.0	71.0	69.0					16																	69718852		2198	4300	6498	SO:0001583	missense	10725	exon11			CCTTGCTCTTTTG	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1699T>C	16.37:g.69718852T>C	ENSP00000346420:p.Ser567Pro	103.0	0.0		103.0	5.0	NM_138713	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	37	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.268392	0.80469	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.48836	0.81;0.81;0.8;0.81	5.32	5.32	0.75619	Immunoglobulin E-set (1);	0.113037	0.64402	D	0.000007	T	0.52805	0.1757	L	0.51422	1.61	0.58432	D	0.999996	D;D;D;D	0.60575	0.98;0.98;0.978;0.988	P;P;P;P	0.54706	0.578;0.578;0.585;0.759	T	0.52087	-0.8622	10	0.40728	T	0.16	.	10.5188	0.44907	0.1445:0.0:0.0:0.8555	.	584;567;585;491	A2RRB4;O94916;E9PHR7;O94916-2	.;NFAT5_HUMAN;.;.	P	585;584;491;567;491	ENSP00000396538:S585P;ENSP00000338806:S491P;ENSP00000346420:S567P;ENSP00000377343:S491P	ENSP00000338806:S491P	S	+	1	0	NFAT5	68276353	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.953000	0.63624	2.014000	0.59158	0.533000	0.62120	TCT	.		0.343	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
NKIRAS1	28512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	23942421	23942422	+	Missense_Mutation	DNP	GC	GC	CA			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G|C	G|C	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr3:23942421_23942422GC>CA	ENST00000443659.2	-	3	990_991	c.213_214GC>TG	c.(211-216)ctGCca>ctTGca	p.P72A	NKIRAS1_ENST00000416026.2_Missense_Mutation_p.P72A|NKIRAS1_ENST00000421515.2_Missense_Mutation_p.P72A|NKIRAS1_ENST00000415901.2_Missense_Mutation_p.P72A|NKIRAS1_ENST00000388759.3_Missense_Mutation_p.P72A|NKIRAS1_ENST00000425478.2_Missense_Mutation_p.P72A|NKIRAS1_ENST00000412028.1_Missense_Mutation_p.P72A|NKIRAS1_ENST00000437230.1_Missense_Mutation_p.P72A			Q9NYS0	KBRS1_HUMAN	NFKB inhibitor interacting Ras-like 1	72	Interactions with NFKBIA and NFKBIB.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	7						TAATGCTTTGGCAGCTCCACGC	0.411																																					p.P72A|p.L71L		.											.	NKIRAS1	659	0			c.C214G|c.G213T						.																																			SO:0001583	missense	28512	exon4			GCTTTGGCAGCTC|CTTTGGCAGCTCC	AF229839	CCDS33717.1	3p24.1	2014-05-09	2004-05-20		ENSG00000197885	ENSG00000197885			17899	protein-coding gene	gene with protein product		604496	"""NFKB inhibitor interacting Ras-like protein 1"""			10657303	Standard	NM_020345		Approved	KBRAS1, kappaB-Ras1	uc003ccj.3	Q9NYS0	OTTHUMG00000155605	ENST00000443659.2:c.213_214delinsCA	3.37:g.23942421_23942422delinsCA	ENSP00000393785:p.Pro72Ala	130.0|133.0	0.0|1.0		155.0|156.0	19.0	NM_020345	Q96K18	Missense_Mutation|Silent	SNP	ENST00000443659.2	37	CCDS33717.1																																																																																			.		0.411	NKIRAS1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340876.2	NM_020345	
NVL	4931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	224475603	224475603	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:224475603G>T	ENST00000281701.6	-	14	1927	c.1668C>A	c.(1666-1668)ttC>ttA	p.F556L	NVL_ENST00000391875.2_Missense_Mutation_p.F450L|NVL_ENST00000469075.1_Missense_Mutation_p.F465L|NVL_ENST00000361463.3_Missense_Mutation_p.F450L|NVL_ENST00000482491.1_Missense_Mutation_p.F280L|NVL_ENST00000340871.4_Missense_Mutation_p.F367L	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	556						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.F556L(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		GAGCAACAATGAAATCATTCA	0.478																																					p.F556L		.											.	NVL	92	1	Substitution - Missense(1)	central_nervous_system(1)	c.C1668A						.						101.0	84.0	90.0					1																	224475603		2203	4300	6503	SO:0001583	missense	4931	exon14			AACAATGAAATCA	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.1668C>A	1.37:g.224475603G>T	ENSP00000281701:p.Phe556Leu	163.0	0.0		108.0	26.0	NM_002533	B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	37	CCDS1541.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.454570|4.454570	0.84209|0.84209	.|.	.|.	ENSG00000143748|ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871;ENST00000361463|ENST00000469968	D;D;D;D;D;D|.	0.96104|.	-3.9;-3.84;-3.81;-3.7;-3.71;-3.91|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.047995|.	0.85682|.	D|.	0.000000|.	T|T	0.73273|0.73273	0.3566|0.3566	M|M	0.69523|0.69523	2.12|2.12	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.89917|.	0.985;0.985;1.0|.	P;P;D|.	0.91635|.	0.728;0.831;0.999|.	T|T	0.72554|0.72554	-0.4258|-0.4258	10|5	0.87932|.	D|.	0|.	-14.9811|-14.9811	14.7518|14.7518	0.69530|0.69530	0.0709:0.0:0.9291:0.0|0.0709:0.0:0.9291:0.0	.|.	367;465;556|.	B4DMC4;B4DP98;O15381|.	.;.;NVL_HUMAN|.	L|N	556;450;465;280;367;450|439	ENSP00000281701:F556L;ENSP00000375747:F450L;ENSP00000417826:F465L;ENSP00000417213:F280L;ENSP00000341362:F367L;ENSP00000354779:F450L|.	ENSP00000281701:F556L|.	F|H	-|-	3|1	2|0	NVL|NVL	222542226|222542226	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.093000|1.093000	0.30939|0.30939	2.624000|2.624000	0.88883|0.88883	0.655000|0.655000	0.94253|0.94253	TTC|CAT	.		0.478	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
OGFRL1	79627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	72003034	72003034	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:72003034A>G	ENST00000370435.4	+	2	407	c.273A>G	c.(271-273)agA>agG	p.R91R	RP11-154D6.1_ENST00000423255.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000412751.1_RNA|OGFRL1_ENST00000467503.1_3'UTR|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	91						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						AACCAAAGAGAAGTTTTTATG	0.373																																					p.R91R		.											.	OGFRL1	68	0			c.A273G						.						116.0	119.0	118.0					6																	72003034		2203	4300	6503	SO:0001819	synonymous_variant	79627	exon2			AAAGAGAAGTTTT		CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.273A>G	6.37:g.72003034A>G		127.0	0.0		143.0	22.0	NM_024576	Q2TAC1|Q8NEQ4|Q9H7B5	Silent	SNP	ENST00000370435.4	37	CCDS34482.1																																																																																			.		0.373	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041153.2	NM_024576	
OR1L6	392390	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	125512279	125512279	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:125512279C>T	ENST00000373684.1	+	1	261	c.261C>T	c.(259-261)taC>taT	p.Y87Y	OR1L6_ENST00000304720.2_Silent_p.Y51Y			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						CGGCCATCTACTCTGACCCCA	0.502																																					p.Y51Y		.											.	OR1L6	68	0			c.C153T						.						142.0	132.0	135.0					9																	125512279		2203	4300	6503	SO:0001819	synonymous_variant	392390	exon1			CATCTACTCTGAC		CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.261C>T	9.37:g.125512279C>T		311.0	0.0		228.0	45.0	NM_001004453	Q6IFM8|Q96R80	Silent	SNP	ENST00000373684.1	37																																																																																				.		0.502	OR1L6-201	KNOWN	basic	protein_coding	protein_coding			
OR5A1	219982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	59211305	59211305	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:59211305G>T	ENST00000302030.2	+	1	689	c.664G>T	c.(664-666)Ggt>Tgt	p.G222C		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						TATCTCCTATGGTTACATAGT	0.532																																					p.G222C		.											.	OR5A1	69	0			c.G664T						.						225.0	204.0	211.0					11																	59211305		2201	4295	6496	SO:0001583	missense	219982	exon1			TCCTATGGTTACA	AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.664G>T	11.37:g.59211305G>T	ENSP00000303096:p.Gly222Cys	201.0	0.0		135.0	24.0	NM_001004728	B9EH58|Q6IFF2|Q96RB1	Missense_Mutation	SNP	ENST00000302030.2	37	CCDS31561.1	.	.	.	.	.	.	.	.	.	.	G	7.376	0.627884	0.14257	.	.	ENSG00000172320	ENST00000302030	T	0.00107	8.72	5.98	-4.11	0.03928	GPCR, rhodopsin-like superfamily (1);	0.819845	0.10903	N	0.621456	T	0.00300	0.0009	M	0.66439	2.03	0.09310	N	1	D	0.53312	0.959	P	0.61800	0.894	T	0.27806	-1.0063	10	0.28530	T	0.3	-0.0131	9.6614	0.39958	0.3212:0.0:0.5648:0.114	.	222	Q8NGJ0	OR5A1_HUMAN	C	222	ENSP00000303096:G222C	ENSP00000303096:G222C	G	+	1	0	OR5A1	58967881	0.000000	0.05858	0.419000	0.26584	0.002000	0.02628	-0.846000	0.04336	-0.648000	0.05437	-0.781000	0.03364	GGT	.		0.532	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728	
OSR1	130497	hgsc.bcm.edu;bcgsc.ca	37	2	19552914	19552914	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr2:19552914A>G	ENST00000272223.2	-	2	997	c.653T>C	c.(652-654)cTg>cCg	p.L218P	OSR1_ENST00000536433.1_Missense_Mutation_p.L218P	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	218					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				GTGGTCTCGCAGGTGGTCTTG	0.592																																					p.L218P		.											.	OSR1	257	0			c.T653C						.						73.0	75.0	74.0					2																	19552914		2203	4300	6503	SO:0001583	missense	130497	exon2			TCTCGCAGGTGGT	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.653T>C	2.37:g.19552914A>G	ENSP00000272223:p.Leu218Pro	78.0	0.0		59.0	4.0	NM_145260	B3KV97|D6W521	Missense_Mutation	SNP	ENST00000272223.2	37	CCDS1694.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.281002	0.80692	.	.	ENSG00000143867	ENST00000272223;ENST00000536433	T;T	0.53857	0.6;0.6	6.04	6.04	0.98038	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.78227	0.4250	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82550	-0.0401	9	.	.	.	-10.3202	16.289	0.82738	1.0:0.0:0.0:0.0	.	218	Q8TAX0	OSR1_HUMAN	P	218	ENSP00000272223:L218P;ENSP00000441801:L218P	.	L	-	2	0	OSR1	19416395	1.000000	0.71417	0.999000	0.59377	0.812000	0.45895	9.339000	0.96797	2.330000	0.79161	0.529000	0.55759	CTG	.		0.592	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	NM_145260	
PCDHGA1	56114	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140712536	140712536	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:140712536A>G	ENST00000517417.1	+	1	2285	c.2285A>G	c.(2284-2286)gAc>gGc	p.D762G	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.D762G	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	762					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCACTGCGGACTCGCGGAAG	0.597																																					p.D762G		.											.	PCDHGA1	137	0			c.A2285G						.						101.0	110.0	107.0					5																	140712536		2203	4298	6501	SO:0001583	missense	56114	exon1			CTGCGGACTCGCG	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2285A>G	5.37:g.140712536A>G	ENSP00000431083:p.Asp762Gly	275.0	2.0		262.0	53.0	NM_018912	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	37	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	.	5.124	0.208572	0.09757	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.51325	0.87;0.71	3.89	1.44	0.22558	.	0.119987	0.36740	N	0.002436	T	0.34366	0.0895	L	0.33293	1	0.26796	N	0.969293	B;B	0.20459	0.042;0.045	B;B	0.28784	0.094;0.047	T	0.25363	-1.0134	10	0.44086	T	0.13	.	7.6366	0.28270	0.7315:0.0:0.2684:0.0	.	762;762	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	G	762	ENSP00000431083:D762G;ENSP00000367345:D762G	ENSP00000367345:D762G	D	+	2	0	PCDHGA1	140692720	0.075000	0.21258	0.033000	0.17914	0.356000	0.29392	0.688000	0.25422	0.192000	0.20272	0.477000	0.44152	GAC	.		0.597	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
PCDHGB3	56102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140750845	140750845	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:140750845A>G	ENST00000576222.1	+	1	1015	c.884A>G	c.(883-885)gAc>gGc	p.D295G	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	295	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAAGCTGGACAGTAAAACG	0.448																																					p.D295G		.											.	.	.	0			c.A884G						.						143.0	145.0	144.0					5																	140750845		2000	4177	6177	SO:0001583	missense	56102	exon1			AGCTGGACAGTAA	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.884A>G	5.37:g.140750845A>G	ENSP00000461862:p.Asp295Gly	85.0	0.0		98.0	32.0	NM_018924	A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	CCDS58980.1																																																																																			.		0.448	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
PDE4A	5141	hgsc.bcm.edu;bcgsc.ca	37	19	10572599	10572599	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:10572599T>C	ENST00000352831.6	+	13	1777	c.1667T>C	c.(1666-1668)cTg>cCg	p.L556P	PDE4A_ENST00000440014.2_Missense_Mutation_p.L495P|PDE4A_ENST00000344979.3_Missense_Mutation_p.L317P|PDE4A_ENST00000380702.2_Missense_Mutation_p.L534P|PDE4A_ENST00000592685.1_Missense_Mutation_p.L534P|PDE4A_ENST00000293683.5_Missense_Mutation_p.L530P	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	556	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	CTGGCTGACCTGAAGACCATG	0.632																																					p.L556P		.											.	PDE4A	523	0			c.T1667C						.						115.0	96.0	103.0					19																	10572599		2203	4300	6503	SO:0001583	missense	5141	exon13			CTGACCTGAAGAC		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1667T>C	19.37:g.10572599T>C	ENSP00000270474:p.Leu556Pro	50.0	0.0		30.0	4.0	NM_001111307	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.288532	0.80914	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979;ENST00000380686	D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1	3.73	3.73	0.42828	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.64402	D	0.000001	D	0.94295	0.8167	M	0.94021	3.485	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.98;1.0;0.999;0.999;1.0	D	0.94703	0.7885	10	0.87932	D	0	.	10.4073	0.44272	0.0:0.0:0.0:1.0	.	222;317;495;530;556	P27815-5;P27815-4;P27815-6;P27815-2;P27815	.;.;.;.;PDE4A_HUMAN	P	534;556;530;495;317;222	ENSP00000370078:L534P;ENSP00000270474:L556P;ENSP00000293683:L530P;ENSP00000394754:L495P;ENSP00000341007:L317P	ENSP00000293683:L530P	L	+	2	0	PDE4A	10433599	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.770000	0.85390	1.576000	0.49790	0.397000	0.26171	CTG	.		0.632	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
PGLYRP4	57115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153317700	153317700	+	Missense_Mutation	SNP	G	G	A	rs554667521		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:153317700G>A	ENST00000359650.5	-	4	362	c.298C>T	c.(298-300)Cgg>Tgg	p.R100W	PGLYRP4_ENST00000368739.3_Missense_Mutation_p.R96W|PGLYRP4_ENST00000490266.1_5'UTR	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	100					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCAGTTCCCGCAGTCTCTGG	0.552													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19259	0.0		0.0	False		,,,				2504	0.0				p.R100W		.											.	PGLYRP4	94	0			c.C298T						.						103.0	96.0	98.0					1																	153317700		2203	4300	6503	SO:0001583	missense	57115	exon4			GTTCCCGCAGTCT	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.298C>T	1.37:g.153317700G>A	ENSP00000352672:p.Arg100Trp	65.0	0.0		107.0	10.0	NM_020393	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	ENST00000359650.5	37	CCDS30871.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654278	0.29425	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.27720	1.65;1.65	3.2	1.06	0.20224	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	.	.	.	.	T	0.21347	0.0514	M	0.93420	3.415	0.27233	N	0.959342	P;P	0.36535	0.501;0.557	B;B	0.34093	0.109;0.175	T	0.31364	-0.9946	9	0.87932	D	0	-18.1578	3.3148	0.07029	0.1447:0.0:0.6002:0.255	.	96;100	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	W	96;100	ENSP00000357728:R96W;ENSP00000352672:R100W	ENSP00000352672:R100W	R	-	1	2	PGLYRP4	151584324	0.014000	0.17966	0.997000	0.53966	0.586000	0.36452	0.665000	0.25083	0.691000	0.31592	0.313000	0.20887	CGG	.		0.552	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
POLR3A	11128	hgsc.bcm.edu;bcgsc.ca	37	10	79752965	79752965	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:79752965T>C	ENST00000372371.3	-	20	2914	c.2777A>G	c.(2776-2778)gAc>gGc	p.D926G		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	926					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TTTGATGTTGTCCAGAACCCT	0.383																																					p.D926G		.											.	POLR3A	90	0			c.A2777G						.						130.0	131.0	131.0					10																	79752965		2203	4300	6503	SO:0001583	missense	11128	exon20			ATGTTGTCCAGAA	AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.2777A>G	10.37:g.79752965T>C	ENSP00000361446:p.Asp926Gly	76.0	0.0		57.0	4.0	NM_007055	Q8IW34|Q8TCW5	Missense_Mutation	SNP	ENST00000372371.3	37	CCDS7354.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372988	0.61624	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.67171	-0.25	5.74	5.74	0.90152	RNA polymerase Rpb1, domain 5 (1);	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	M	0.67625	2.065	0.80722	D	1	B	0.24675	0.109	B	0.27170	0.077	T	0.62723	-0.6794	9	.	.	.	-42.5692	16.3426	0.83092	0.0:0.0:0.0:1.0	.	926	O14802	RPC1_HUMAN	G	926	ENSP00000361446:D926G	.	D	-	2	0	POLR3A	79422971	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.655000	0.83696	2.317000	0.78254	0.460000	0.39030	GAC	.		0.383	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048923.1	NM_007055	
RAB14	51552	hgsc.bcm.edu;bcgsc.ca	37	9	123952841	123952841	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:123952841T>C	ENST00000373840.4	-	4	512	c.275A>G	c.(274-276)gAt>gGt	p.D92G		NM_016322.3	NP_057406.2	P61106	RAB14_HUMAN	RAB14, member RAS oncogene family	92					embryo development (GO:0009790)|endocytic recycling (GO:0032456)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi to endosome transport (GO:0006895)|GTP catabolic process (GO:0006184)|intracellular transport (GO:0046907)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CCTAGTGATATCATAGACCAT	0.373																																					p.D92G		.											.	RAB14	227	0			c.A275G						.						72.0	76.0	75.0					9																	123952841		2203	4300	6503	SO:0001583	missense	51552	exon4			GTGATATCATAGA	AF152463	CCDS6827.1	9q32-q34.11	2008-07-21			ENSG00000119396	ENSG00000119396		"""RAB, member RAS oncogene"""	16524	protein-coding gene	gene with protein product	"""F protein-binding protein 1"", ""bA165P4.3 (member RAS oncogene family)"", ""small GTP binding protein RAB14"""	612673				9792283, 15004230	Standard	NM_016322		Approved	FBP, RAB-14	uc004blc.3	P61106	OTTHUMG00000020582	ENST00000373840.4:c.275A>G	9.37:g.123952841T>C	ENSP00000362946:p.Asp92Gly	72.0	0.0		70.0	4.0	NM_016322	B3KR31|P35287|Q5JVD4|Q6Q7K5|Q969L0|Q9UI11	Missense_Mutation	SNP	ENST00000373840.4	37	CCDS6827.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.723595	0.89298	.	.	ENSG00000119396	ENST00000373840;ENST00000451303	D;T	0.87179	-2.22;-1.39	5.26	5.26	0.73747	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95984	0.8692	H	0.97962	4.115	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97465	1.0037	10	0.87932	D	0	.	14.3488	0.66685	0.0:0.0:0.0:1.0	.	92	P61106	RAB14_HUMAN	G	92	ENSP00000362946:D92G;ENSP00000400107:D92G	ENSP00000362946:D92G	D	-	2	0	RAB14	122992662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.985000	0.57927	0.528000	0.53228	GAT	.		0.373	RAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053857.1	NM_016322	
RABEP1	9135	hgsc.bcm.edu;bcgsc.ca	37	17	5235279	5235279	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:5235279G>A	ENST00000546142.2	+	3	386	c.199G>A	c.(199-201)Gca>Aca	p.A67T	RABEP1_ENST00000537505.1_Missense_Mutation_p.A24T|RABEP1_ENST00000262477.6_Missense_Mutation_p.A67T|RABEP1_ENST00000341923.6_Missense_Mutation_p.A67T|RABEP1_ENST00000408982.2_Missense_Mutation_p.A67T			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	67					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						ATTACAAGCTGCACAAGATGA	0.433																																					p.A67T		.											.	RABEP1	659	0			c.G199A						.						116.0	105.0	109.0					17																	5235279		1910	4123	6033	SO:0001583	missense	9135	exon3			CAAGCTGCACAAG	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.199G>A	17.37:g.5235279G>A	ENSP00000437701:p.Ala67Thr	38.0	0.0		41.0	4.0	NM_004703	B2RAG7|O95369|Q8IVX3	Missense_Mutation	SNP	ENST00000546142.2	37	CCDS45592.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903509	0.72754	.	.	ENSG00000029725	ENST00000262477;ENST00000408982;ENST00000539669;ENST00000546142;ENST00000341923;ENST00000537505	T;T;T;T;T	0.48836	0.84;0.85;0.84;0.85;0.8	6.17	6.17	0.99709	.	0.047483	0.85682	D	0.000000	T	0.42314	0.1197	L	0.47716	1.5	0.58432	D	0.99999	B;B;B;B;B;B	0.31318	0.141;0.214;0.214;0.087;0.141;0.319	B;B;B;B;B;B	0.26416	0.041;0.056;0.031;0.018;0.041;0.069	T	0.24119	-1.0169	10	0.13470	T	0.59	-12.8487	19.8676	0.96824	0.0:0.0:1.0:0.0	.	24;24;67;67;67;67	F5H355;B4DMM4;Q05BX6;Q15276;Q15276-2;F5GZU7	.;.;.;RABE1_HUMAN;.;.	T	67;67;67;67;67;24	ENSP00000262477:A67T;ENSP00000386150:A67T;ENSP00000437701:A67T;ENSP00000339569:A67T;ENSP00000445408:A24T	ENSP00000262477:A67T	A	+	1	0	RABEP1	5176003	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.295000	0.59049	2.941000	0.99782	0.655000	0.94253	GCA	.		0.433	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439349.1	NM_004703	
RASA1	5921	hgsc.bcm.edu;bcgsc.ca	37	5	86659274	86659274	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr5:86659274T>C	ENST00000274376.6	+	11	2127	c.1563T>C	c.(1561-1563)gaT>gaC	p.D521D	RASA1_ENST00000506290.1_Silent_p.D355D|RASA1_ENST00000512763.1_Silent_p.D354D|RASA1_ENST00000456692.2_Silent_p.D344D	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	521	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GATTAATAGATCTCAGTGTAT	0.328																																					p.D521D		.											.	RASA1	661	0			c.T1563C						.						105.0	105.0	105.0					5																	86659274		2203	4300	6503	SO:0001819	synonymous_variant	5921	exon11			AATAGATCTCAGT		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1563T>C	5.37:g.86659274T>C		83.0	0.0		69.0	4.0	NM_002890	B2R6W3|Q9UDI1	Silent	SNP	ENST00000274376.6	37	CCDS34200.1																																																																																			.		0.328	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
RIMKLA	284716	hgsc.bcm.edu;bcgsc.ca	37	1	42865162	42865162	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:42865162A>G	ENST00000431473.3	+	2	380	c.251A>G	c.(250-252)gAc>gGc	p.D84G		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	84					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TCAGACAGTGACATCACTGTC	0.537																																					p.D84G		.											.	RIMKLA	90	0			c.A251G						.						59.0	50.0	53.0					1																	42865162		2203	4300	6503	SO:0001583	missense	284716	exon2			ACAGTGACATCAC	BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.251A>G	1.37:g.42865162A>G	ENSP00000414330:p.Asp84Gly	113.0	0.0		123.0	5.0	NM_173642	Q5VUS5	Missense_Mutation	SNP	ENST00000431473.3	37	CCDS466.2	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163609	0.57476	.	.	ENSG00000177181	ENST00000431473	.	.	.	4.82	4.82	0.62117	.	0.100872	0.64402	D	0.000004	T	0.34106	0.0886	L	0.29908	0.895	0.53688	D	0.999971	P	0.34800	0.469	B	0.31751	0.135	T	0.22836	-1.0205	9	0.02654	T	1	-31.8	12.3756	0.55279	1.0:0.0:0.0:0.0	.	84	Q8IXN7	RIMKA_HUMAN	G	84	.	ENSP00000414330:D84G	D	+	2	0	RIMKLA	42637749	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	9.105000	0.94246	2.027000	0.59764	0.528000	0.53228	GAC	.		0.537	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019174.3	NM_173642	
RNF213	57674	hgsc.bcm.edu;bcgsc.ca	37	17	78346832	78346832	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:78346832T>C	ENST00000582970.1	+	49	12952	c.12809T>C	c.(12808-12810)gTg>gCg	p.V4270A	CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.V4319A|RNF213_ENST00000336301.6_Missense_Mutation_p.V2343A	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4270					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TGTATCCGGGTGGAGAACGAC	0.627																																					p.V4270A		.											.	RNF213	577	0			c.T12809C						.						80.0	78.0	79.0					17																	78346832		2203	4300	6503	SO:0001583	missense	57674	exon49			TCCGGGTGGAGAA	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.12809T>C	17.37:g.78346832T>C	ENSP00000464087:p.Val4270Ala	135.0	0.0		95.0	6.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	T	4.010	-0.000795	0.07819	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.20463	2.07	5.5	-11.0	0.00169	.	1.235040	0.05478	N	0.554278	T	0.08313	0.0207	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.30387	-0.9980	10	0.02654	T	1	.	9.9204	0.41462	0.0:0.5989:0.3196:0.0815	.	4319;2343	C9JCP4;Q63HN8	.;RN213_HUMAN	A	4270;4319;2343	ENSP00000338218:V2343A	ENSP00000338218:V2343A	V	+	2	0	RNF213	75961427	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.828000	0.04419	-2.486000	0.00520	-0.291000	0.09656	GTG	.		0.627	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
SBNO2	22904	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1112458	1112458	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:1112458G>A	ENST00000361757.3	-	21	2695	c.2458C>T	c.(2458-2460)Cgc>Tgc	p.R820C	SBNO2_ENST00000587024.1_Missense_Mutation_p.R810C|SBNO2_ENST00000438103.2_Missense_Mutation_p.R763C	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	820					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTGCACGCGGCGCCGCTGG	0.721																																					p.R820C		.											.	.	.	0			c.C2458T						.						14.0	20.0	18.0					19																	1112458		2020	4148	6168	SO:0001583	missense	22904	exon21			GCACGCGGCGCCG	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.2458C>T	19.37:g.1112458G>A	ENSP00000354733:p.Arg820Cys	104.0	0.0		49.0	15.0	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	37	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402718	0.83230	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.87346	0.6154	H	0.95645	3.7	0.52099	D	0.999943	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.91392	0.5136	9	0.87932	D	0	-31.7737	17.2654	0.87085	0.0:0.0:1.0:0.0	.	820;763	Q9Y2G9;Q9Y2G9-3	SBNO2_HUMAN;.	C	820;763;827	.	ENSP00000250872:R827C	R	-	1	0	SBNO2	1063458	1.000000	0.71417	0.931000	0.37212	0.771000	0.43674	2.526000	0.45607	2.323000	0.78572	0.448000	0.29417	CGC	.		0.721	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
SAMD4B	55095	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39868421	39868421	+	Silent	SNP	C	C	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:39868421C>G	ENST00000314471.6	+	10	2436	c.1401C>G	c.(1399-1401)gcC>gcG	p.A467A	SAMD4B_ENST00000596368.1_Intron|SAMD4B_ENST00000598913.1_Silent_p.A467A	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CTCCCGTCGCCGACGGAGACA	0.617																																					p.A467A		.											.	SAMD4B	90	0			c.C1401G						.						38.0	40.0	39.0					19																	39868421		2203	4299	6502	SO:0001819	synonymous_variant	55095	exon10			CGTCGCCGACGGA		CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.1401C>G	19.37:g.39868421C>G		88.0	0.0		78.0	12.0	NM_018028	A5Z0M6|Q6P194	Silent	SNP	ENST00000314471.6	37	CCDS33020.1																																																																																			.		0.617	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464467.1	NM_018028	
SEMA6D	80031	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	48056059	48056059	+	Missense_Mutation	SNP	C	C	T	rs543020539		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr15:48056059C>T	ENST00000316364.5	+	10	1199	c.760C>T	c.(760-762)Cgc>Tgc	p.R254C	SEMA6D_ENST00000536845.2_Missense_Mutation_p.R254C|SEMA6D_ENST00000389432.2_Missense_Mutation_p.R254C|SEMA6D_ENST00000389425.3_Missense_Mutation_p.R254C|SEMA6D_ENST00000355997.3_Missense_Mutation_p.R254C|SEMA6D_ENST00000358066.4_Missense_Mutation_p.R254C|SEMA6D_ENST00000354744.4_Missense_Mutation_p.R254C|SEMA6D_ENST00000389433.2_Missense_Mutation_p.R254C|SEMA6D_ENST00000537942.1_Missense_Mutation_p.R254C|SEMA6D_ENST00000558014.1_Missense_Mutation_p.R254C|SEMA6D_ENST00000389428.3_Missense_Mutation_p.R254C|SEMA6D_ENST00000558816.1_Missense_Mutation_p.R254C	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	254	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TGTGTATTCCCGCGTGGCCCG	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19135	0.0		0.0	False		,,,				2504	0.0				p.R254C		.											.	SEMA6D	138	0			c.C760T						.						132.0	131.0	131.0					15																	48056059		2198	4297	6495	SO:0001583	missense	80031	exon10			TATTCCCGCGTGG	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.760C>T	15.37:g.48056059C>T	ENSP00000324857:p.Arg254Cys	125.0	0.0		116.0	37.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559209	0.86335	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.87	5.87	0.94306	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.71913	0.3396	H	0.96916	3.905	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.81219	-0.1032	10	0.87932	D	0	.	20.206	0.98277	0.0:1.0:0.0:0.0	.	254;254;254;254;254	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	C	254	ENSP00000442040:R254C;ENSP00000446152:R254C;ENSP00000324857:R254C;ENSP00000374084:R254C;ENSP00000374083:R254C;ENSP00000346786:R254C;ENSP00000350770:R254C;ENSP00000374079:R254C;ENSP00000348276:R254C;ENSP00000374076:R254C	ENSP00000324857:R254C	R	+	1	0	SEMA6D	45843351	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.809000	0.55606	2.785000	0.95823	0.655000	0.94253	CGC	.		0.488	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
SEMA7A	8482	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	74709008	74709008	+	Missense_Mutation	SNP	C	C	T	rs140707085		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr15:74709008C>T	ENST00000261918.4	-	7	1257	c.709G>A	c.(709-711)Gat>Aat	p.D237N	SEMA7A_ENST00000542748.1_Missense_Mutation_p.D72N|SEMA7A_ENST00000543145.2_Missense_Mutation_p.D223N	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	237	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						ATCTTGTCATCGTAAGCCTGG	0.567																																					p.D237N		.											.	SEMA7A	153	0			c.G709A						.	C	ASN/ASP,ASN/ASP,ASN/ASP	0,4394		0,0,2197	335.0	290.0	306.0		667,214,709	1.2	0.9	15	dbSNP_134	306	3,8589	3.0+/-9.4	0,3,4293	yes	missense,missense,missense	SEMA7A	NM_001146029.1,NM_001146030.1,NM_003612.3	23,23,23	0,3,6490	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign	223/653,72/502,237/667	74709008	3,12983	2197	4296	6493	SO:0001583	missense	8482	exon7			TGTCATCGTAAGC	AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.709G>A	15.37:g.74709008C>T	ENSP00000261918:p.Asp237Asn	315.0	0.0		248.0	19.0	NM_003612	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	ENST00000261918.4	37	CCDS10262.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.396710	0.25205	0.0	3.49E-4	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.15718	2.4;2.4;2.4	5.39	1.22	0.21188	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.284277	0.37906	N	0.001891	T	0.11367	0.0277	L	0.37750	1.13	0.32117	N	0.588474	B;B	0.16802	0.009;0.019	B;B	0.12837	0.005;0.008	T	0.06127	-1.0844	10	0.87932	D	0	-10.0158	4.6518	0.12598	0.0:0.4045:0.1593:0.4362	.	223;237	F5H1S0;O75326	.;SEM7A_HUMAN	N	237;223;72	ENSP00000261918:D237N;ENSP00000438966:D223N;ENSP00000441493:D72N	ENSP00000261918:D237N	D	-	1	0	SEMA7A	72496061	0.153000	0.22777	0.907000	0.35723	0.991000	0.79684	0.533000	0.23082	0.573000	0.29400	0.655000	0.94253	GAT	C|1.000;T|0.000		0.567	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272904.3	NM_003612	
SIM2	6493	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	38095410	38095410	+	Silent	SNP	C	C	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr21:38095410C>A	ENST00000290399.6	+	5	1135	c.522C>A	c.(520-522)ggC>ggA	p.G174G	SIM2_ENST00000430056.3_Silent_p.G174G	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	174					cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						GGAACGCGGGCCTGACCTGCA	0.527																																					p.G174G		.											.	SIM2	90	0			c.C522A						.						133.0	121.0	126.0					21																	38095410		2203	4300	6503	SO:0001819	synonymous_variant	6493	exon5			CGCGGGCCTGACC		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.522C>A	21.37:g.38095410C>A		80.0	0.0		58.0	14.0	NM_005069	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Silent	SNP	ENST00000290399.6	37	CCDS13646.1	.	.	.	.	.	.	.	.	.	.	C	10.48	1.361190	0.24684	.	.	ENSG00000159263	ENST00000431229	.	.	.	5.24	3.21	0.36854	.	.	.	.	.	T	0.57651	0.2068	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53627	-0.8412	4	.	.	.	.	8.7021	0.34332	0.3174:0.5033:0.1793:0.0	.	.	.	.	T	112	.	.	P	+	1	0	SIM2	37017280	0.001000	0.12720	1.000000	0.80357	0.950000	0.60333	-0.375000	0.07475	2.445000	0.82738	0.655000	0.94253	CCT	.		0.527	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1	NM_009586	
SIRPB2	284759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1460431	1460431	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr20:1460431G>A	ENST00000359801.3	-	2	401	c.365C>T	c.(364-366)aCt>aTt	p.T122I	SIRPB2_ENST00000444444.2_Intron|SIRPB2_ENST00000608747.1_Intron|SIRPB2_ENST00000537284.1_5'UTR	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	114	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GTAGGTTCCAGTGTGCTCCCT	0.488																																					p.T122I		.											.	SIRPB2	226	0			c.C365T						.						134.0	119.0	124.0					20																	1460431		1568	3582	5150	SO:0001583	missense	284759	exon2			GTTCCAGTGTGCT	AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.365C>T	20.37:g.1460431G>A	ENSP00000352849:p.Thr122Ile	233.0	0.0		217.0	61.0	NM_001122962	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000359801.3	37	CCDS42849.1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.742104	0.30865	.	.	ENSG00000196209	ENST00000359801	T	0.68331	-0.32	4.13	2.12	0.27331	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.927056	0.09011	N	0.861546	T	0.56702	0.2003	L	0.46819	1.47	0.30217	N	0.797182	B	0.29862	0.259	B	0.28232	0.087	T	0.56763	-0.7925	10	0.72032	D	0.01	-1.7633	5.0834	0.14668	0.109:0.0:0.6862:0.2048	.	122	Q5JXA9	SIRB2_HUMAN	I	122	ENSP00000352849:T122I	ENSP00000352849:T122I	T	-	2	0	SIRPB2	1408431	0.082000	0.21442	0.739000	0.30968	0.880000	0.50808	0.075000	0.14686	0.492000	0.27815	0.655000	0.94253	ACT	.		0.488	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077544.1	NM_178459	
SKIDA1	387640	hgsc.bcm.edu;mdanderson.org	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E343E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		.											.	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	10.37:g.21805486C>T		46.0	0.0		50.0	9.0	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																			.		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
SLC16A4	9122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	110919677	110919678	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:110919677_110919678insCT	ENST00000369779.4	-	7	1385_1386	c.1136_1137insAG	c.(1135-1137)actfs	p.T379fs	SLC16A4_ENST00000497687.1_5'Flank|SLC16A4_ENST00000541986.1_Frame_Shift_Ins_p.T317fs|SLC16A4_ENST00000437429.2_Frame_Shift_Ins_p.T269fs|SLC16A4_ENST00000472422.2_Frame_Shift_Ins_p.T331fs|SLC16A4_ENST00000369781.4_Frame_Shift_Ins_p.T211fs	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	379					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	CAAGCAGGTTAGTGATGCCGCA	0.455																																					p.T379fs		.											.	SLC16A4	93	0			c.1137_1138insAG						.																																			SO:0001589	frameshift_variant	9122	exon7			CAGGTTAGTGATG	U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.1136_1137insAG	1.37:g.110919677_110919678insCT	ENSP00000358794:p.Thr379fs	145.0	0.0		98.0	32.0	NM_004696	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Frame_Shift_Ins	INS	ENST00000369779.4	37	CCDS823.1																																																																																			.		0.455	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696	
SLC16A4	9122	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	110919678	110919679	+	Frame_Shift_Ins	INS	-	-	A	rs147693872		TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:110919678_110919679insA	ENST00000369779.4	-	7	1384_1385	c.1135_1136insT	c.(1135-1137)actfs	p.T379fs	SLC16A4_ENST00000497687.1_5'Flank|SLC16A4_ENST00000541986.1_Frame_Shift_Ins_p.T317fs|SLC16A4_ENST00000437429.2_Frame_Shift_Ins_p.T269fs|SLC16A4_ENST00000472422.2_Frame_Shift_Ins_p.T331fs|SLC16A4_ENST00000369781.4_Frame_Shift_Ins_p.T211fs	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	379					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	AAGCAGGTTAGTGATGCCGCAG	0.455																																					p.T379fs		.											.	SLC16A4	93	0			c.1136_1137insT						.																																			SO:0001589	frameshift_variant	9122	exon7			AGGTTAGTGATGC	U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.1135_1136insT	1.37:g.110919678_110919679insA	ENSP00000358794:p.Thr379fs	147.0	0.0		98.0	32.0	NM_004696	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Frame_Shift_Ins	INS	ENST00000369779.4	37	CCDS823.1																																																																																			.		0.455	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696	
SLC17A2	10246	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	25917214	25917214	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:25917214A>G	ENST00000265425.3	-	6	771	c.751T>C	c.(751-753)Tcc>Ccc	p.S251P	SLC17A2_ENST00000377850.3_Missense_Mutation_p.S251P|SLC17A2_ENST00000360488.3_Missense_Mutation_p.S251P			O00624	NPT3_HUMAN	solute carrier family 17, member 2	251					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						GCCAGTGAGGACAGGATGTGC	0.532																																					p.S251P		.											.	SLC17A2	91	0			c.T751C						.						129.0	104.0	112.0					6																	25917214		2203	4300	6503	SO:0001583	missense	10246	exon7			GTGAGGACAGGAT	U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.751T>C	6.37:g.25917214A>G	ENSP00000265425:p.Ser251Pro	88.0	1.0		91.0	26.0	NM_005835	A6NK81|A6NLD6|Q5TB84|Q76P85	Missense_Mutation	SNP	ENST00000265425.3	37		.	.	.	.	.	.	.	.	.	.	A	13.74	2.328410	0.41197	.	.	ENSG00000112337	ENST00000360488;ENST00000377850;ENST00000265425	T;T;T	0.59502	0.26;0.26;0.26	4.65	3.49	0.39957	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.231696	0.31145	N	0.008177	T	0.63988	0.2558	M	0.92026	3.265	0.09310	N	1	P;P;P	0.48911	0.845;0.845;0.917	P;P;P	0.57057	0.812;0.812;0.73	T	0.60752	-0.7201	10	0.59425	D	0.04	.	8.4306	0.32755	0.7846:0.2153:0.0:0.0	.	251;251;251	O00624;A6NK81;O00624-2	NPT3_HUMAN;.;.	P	251	ENSP00000353677:S251P;ENSP00000367081:S251P;ENSP00000265425:S251P	ENSP00000265425:S251P	S	-	1	0	SLC17A2	26025193	0.035000	0.19736	0.046000	0.18839	0.496000	0.33645	1.276000	0.33156	0.900000	0.36469	0.460000	0.39030	TCC	.		0.532	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040075.1		
SLC25A30	253512	hgsc.bcm.edu;bcgsc.ca	37	13	45978525	45978525	+	Silent	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr13:45978525C>T	ENST00000539591.1	-	4	340	c.177G>A	c.(175-177)gtG>gtA	p.V59V				Q5SVS4	KMCP1_HUMAN	solute carrier family 25, member 30	110					mitochondrial transport (GO:0006839)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)		TTCCACATATCACATTTATCG	0.348																																					p.V110V		.											.	SLC25A30	135	0			c.G330A						.						165.0	156.0	159.0					13																	45978525		2203	4300	6503	SO:0001819	synonymous_variant	253512	exon5			ACATATCACATTT	AK074457	CCDS31967.1, CCDS66539.1	13q14	2013-05-22			ENSG00000174032	ENSG00000174032		"""Solute carriers"""	27371	protein-coding gene	gene with protein product		610793					Standard	XM_005266321		Approved		uc001vag.3	Q5SVS4	OTTHUMG00000016853	ENST00000539591.1:c.177G>A	13.37:g.45978525C>T		85.0	0.0		42.0	4.0	NM_001010875	B2RN96|B4DZK3|F5H8H8	Silent	SNP	ENST00000539591.1	37																																																																																				.		0.348	SLC25A30-201	KNOWN	basic	protein_coding	protein_coding		XM_170736	
SLC2A4RG	56731	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	62373927	62373927	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr20:62373927G>A	ENST00000266077.2	+	6	971	c.919G>A	c.(919-921)Gtt>Att	p.V307I	SLC2A4RG_ENST00000493772.1_3'UTR|RP4-583P15.10_ENST00000433905.2_RNA|RP4-583P15.10_ENST00000447343.2_RNA	NM_020062.3	NP_064446.2	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|lung(2)|prostate(2)|skin(1)	7	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CCTGAGCACCGTTGCTAACCC	0.721																																					p.V307I		.											.	SLC2A4RG	90	0			c.G919A						.						6.0	8.0	7.0					20																	62373927		1855	3904	5759	SO:0001583	missense	56731	exon6			AGCACCGTTGCTA	AF249267	CCDS13537.1	20q13.33	2010-03-11			ENSG00000125520	ENSG00000125520			15930	protein-coding gene	gene with protein product	"""GLUT4 enhancer factor"", ""Huntington's disease gene regulatory region-binding protein 1"""	609493				10825161	Standard	NM_020062		Approved	GEF, HDBP1, Si-1-2, Si-1-2-19	uc002ygq.3	Q9NR83	OTTHUMG00000032997	ENST00000266077.2:c.919G>A	20.37:g.62373927G>A	ENSP00000266077:p.Val307Ile	40.0	0.0		39.0	6.0	NM_020062	Q2PHL5|Q6F6I6|Q6F6I7|Q6GTK5|Q8TAH5|Q8WVW7|Q96QD3|Q9BV85	Missense_Mutation	SNP	ENST00000266077.2	37	CCDS13537.1	.	.	.	.	.	.	.	.	.	.	G	6.082	0.383377	0.11524	.	.	ENSG00000125520	ENST00000266077	T	0.44482	0.92	3.07	-3.4	0.04853	.	.	.	.	.	T	0.14830	0.0358	N	0.14661	0.345	0.09310	N	1	P	0.38863	0.65	B	0.26614	0.071	T	0.09907	-1.0653	9	0.39692	T	0.17	.	0.4685	0.00528	0.2102:0.2887:0.2089:0.2922	.	307	Q9NR83	S2A4R_HUMAN	I	307	ENSP00000266077:V307I	ENSP00000266077:V307I	V	+	1	0	SLC2A4RG	61844371	0.004000	0.15560	0.000000	0.03702	0.041000	0.13682	0.412000	0.21131	-1.174000	0.02754	0.313000	0.20887	GTT	.		0.721	SLC2A4RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080202.1	NM_020062	
SMCR8	140775	hgsc.bcm.edu;bcgsc.ca	37	17	18219495	18219495	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:18219495G>A	ENST00000406438.3	+	1	872	c.392G>A	c.(391-393)gGc>gAc	p.G131D	TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000542570.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	131						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TCTAAGGAGGGCGCCTTTGCA	0.557																																					p.G131D		.											.	SMCR8	91	0			c.G392A						.						89.0	91.0	90.0					17																	18219495		2203	4300	6503	SO:0001583	missense	140775	exon1			AGGAGGGCGCCTT	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.392G>A	17.37:g.18219495G>A	ENSP00000385025:p.Gly131Asp	42.0	0.0		61.0	4.0	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	37	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143160	0.57044	.	.	ENSG00000176994	ENST00000406438	D	0.98684	-5.07	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.98005	0.9343	L	0.35723	1.085	0.58432	D	0.999999	D	0.56035	0.974	P	0.53912	0.737	D	0.97766	1.0223	10	0.36615	T	0.2	-45.2015	20.073	0.97731	0.0:0.0:1.0:0.0	.	131	Q8TEV9	SMCR8_HUMAN	D	131	ENSP00000385025:G131D	ENSP00000385025:G131D	G	+	2	0	SMCR8	18160220	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.794000	0.62482	2.750000	0.94351	0.655000	0.94253	GGC	.		0.557	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
SNX32	254122	hgsc.bcm.edu;bcgsc.ca	37	11	65618862	65618862	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr11:65618862A>G	ENST00000308342.6	+	8	1198	c.773A>G	c.(772-774)aAc>aGc	p.N258S		NM_152760.2	NP_689973.2	Q86XE0	SNX32_HUMAN	sorting nexin 32	258					intracellular protein transport (GO:0006886)	endosome (GO:0005768)	phosphatidylinositol binding (GO:0035091)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				READ - Rectum adenocarcinoma(159;0.171)		CAGGAAGTCAACCAGCTAAGG	0.557											OREG0021087	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N258S		.											.	SNX32	68	0			c.A773G						.						100.0	86.0	91.0					11																	65618862		2201	4297	6498	SO:0001583	missense	254122	exon8			AAGTCAACCAGCT	AK055496	CCDS8113.2	11q13.1	2008-03-11	2008-03-11	2008-03-11	ENSG00000172803	ENSG00000172803		"""Sorting nexins"""	26423	protein-coding gene	gene with protein product			"""sorting nexin 6B"""	SNX6B		16782399	Standard	XM_005273871		Approved	FLJ30934	uc001ofr.3	Q86XE0	OTTHUMG00000128491	ENST00000308342.6:c.773A>G	11.37:g.65618862A>G	ENSP00000310620:p.Asn258Ser	65.0	0.0	1085	51.0	4.0	NM_152760	Q8IW53|Q96NG4	Missense_Mutation	SNP	ENST00000308342.6	37	CCDS8113.2	.	.	.	.	.	.	.	.	.	.	A	10.29	1.310563	0.23821	.	.	ENSG00000172803	ENST00000308342	T	0.26518	1.73	5.73	3.39	0.38822	Vps5 C-terminal (1);	0.114234	0.39407	N	0.001369	T	0.10465	0.0256	N	0.10972	0.075	0.25035	N	0.991241	B	0.22604	0.072	B	0.23419	0.046	T	0.26467	-1.0102	10	0.17832	T	0.49	-17.0534	2.6412	0.04971	0.6167:0.1546:0.0803:0.1484	.	258	Q86XE0	SNX32_HUMAN	S	258	ENSP00000310620:N258S	ENSP00000310620:N258S	N	+	2	0	SNX32	65375438	0.042000	0.20092	0.629000	0.29254	0.998000	0.95712	0.561000	0.23515	0.424000	0.26061	0.533000	0.62120	AAC	.		0.557	SNX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250295.3	NM_152760	
SPEG	10290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220333960	220333960	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr2:220333960C>T	ENST00000312358.7	+	13	3706	c.3574C>T	c.(3574-3576)Cgg>Tgg	p.R1192W	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1192	Ig-like 6.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGACTTCCTGCGGCCACTGCA	0.622																																					p.R1192W		.											.	SPEG	383	0			c.C3574T						.						33.0	42.0	39.0					2																	220333960		2149	4262	6411	SO:0001583	missense	10290	exon13			TTCCTGCGGCCAC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3574C>T	2.37:g.220333960C>T	ENSP00000311684:p.Arg1192Trp	174.0	0.0		169.0	58.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	37	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783430	0.49891	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.68624	-0.34	4.94	3.99	0.46301	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37955	N	0.001873	T	0.81054	0.4743	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.83667	0.0164	10	0.72032	D	0.01	.	15.1123	0.72368	0.1788:0.8211:0.0:0.0	.	1192	Q15772	SPEG_HUMAN	W	1192	ENSP00000311684:R1192W	ENSP00000265327:R1192W	R	+	1	2	SPEG	220042204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.476000	0.35420	2.573000	0.86826	0.655000	0.94253	CGG	.		0.622	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
STXBP5	134957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	147680286	147680286	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:147680286G>T	ENST00000321680.6	+	23	2372	c.2372G>T	c.(2371-2373)cGa>cTa	p.R791L	STXBP5_ENST00000179882.6_Missense_Mutation_p.R446L|STXBP5_ENST00000367481.3_Missense_Mutation_p.R755L|STXBP5_ENST00000367480.3_Missense_Mutation_p.R738L	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	791					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		AAAGAATCCCGAGAAGCGATC	0.443																																					p.R791L		.											.	STXBP5	90	0			c.G2372T						.						94.0	93.0	93.0					6																	147680286		2203	4300	6503	SO:0001583	missense	134957	exon23			AATCCCGAGAAGC	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.2372G>T	6.37:g.147680286G>T	ENSP00000321826:p.Arg791Leu	92.0	0.0		58.0	24.0	NM_001127715	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280085	0.59758	.	.	ENSG00000164506	ENST00000367479;ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882;ENST00000392291	T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.41743	0.1172	L	0.60455	1.87	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.80764	0.994;0.992;0.991	T	0.15292	-1.0442	10	0.49607	T	0.09	.	19.3349	0.94312	0.0:0.0:1.0:0.0	.	755;791;446	Q5T5C0-2;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	L	130;755;791;738;446;115	ENSP00000356451:R755L;ENSP00000321826:R791L;ENSP00000356450:R738L;ENSP00000179882:R446L;ENSP00000376112:R115L	ENSP00000179882:R446L	R	+	2	0	STXBP5	147721979	1.000000	0.71417	0.996000	0.52242	0.431000	0.31685	9.476000	0.97823	2.570000	0.86706	0.655000	0.94253	CGA	.		0.443	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
STXBP5L	9515	hgsc.bcm.edu;bcgsc.ca	37	3	120941904	120941904	+	Silent	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr3:120941904A>G	ENST00000273666.6	+	11	1282	c.1011A>G	c.(1009-1011)agA>agG	p.R337R	STXBP5L_ENST00000492541.1_Silent_p.R337R|STXBP5L_ENST00000497029.1_Silent_p.R337R|STXBP5L_ENST00000471454.1_Silent_p.R337R|STXBP5L_ENST00000472879.1_Silent_p.R337R	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	337					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CTTGTAGAAGACCAAGTTTAA	0.363																																					p.R337R		.											.	STXBP5L	77	0			c.A1011G						.						160.0	151.0	154.0					3																	120941904		1878	4102	5980	SO:0001819	synonymous_variant	9515	exon11			TAGAAGACCAAGT	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1011A>G	3.37:g.120941904A>G		132.0	0.0		114.0	5.0	NM_014980	Q4G1B4|Q6PIC3	Silent	SNP	ENST00000273666.6	37	CCDS43137.1																																																																																			.		0.363	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	113169740	113169740	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr9:113169740A>G	ENST00000401783.2	-	38	8476	c.8140T>C	c.(8140-8142)Tca>Cca	p.S2714P	SVEP1_ENST00000374469.1_Missense_Mutation_p.S2691P|SVEP1_ENST00000297826.5_Missense_Mutation_p.S640P	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2714	Sushi 21. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CATTCAATTGAAATGCAGGAT	0.463																																					p.S2714P		.											.	SVEP1	75	0			c.T8140C						.						140.0	138.0	139.0					9																	113169740		1963	4173	6136	SO:0001583	missense	79987	exon38			CAATTGAAATGCA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8140T>C	9.37:g.113169740A>G	ENSP00000384917:p.Ser2714Pro	109.0	0.0		131.0	7.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	8.616	0.890207	0.17613	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826;ENST00000374463	T;T;T	0.22539	1.95;1.95;1.95	5.87	5.87	0.94306	Sushi/SCR/CCP (1);	0.061117	0.64402	D	0.000002	T	0.08492	0.0211	N	0.01809	-0.71	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.28744	-1.0034	10	0.29301	T	0.29	.	10.5898	0.45304	0.9285:0.0:0.0715:0.0	.	2714	Q4LDE5	SVEP1_HUMAN	P	2714;2691;640;386	ENSP00000384917:S2714P;ENSP00000363593:S2691P;ENSP00000297826:S640P	ENSP00000297826:S640P	S	-	1	0	SVEP1	112209561	1.000000	0.71417	0.996000	0.52242	0.907000	0.53573	5.099000	0.64554	2.247000	0.74100	0.477000	0.44152	TCA	.		0.463	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TBC1D2B	23102	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	78305187	78305187	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr15:78305187C>G	ENST00000300584.3	-	9	2247	c.2248G>C	c.(2248-2250)Ggc>Cgc	p.G750R	TBC1D2B_ENST00000409931.3_Missense_Mutation_p.G750R	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	750	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						TGACAGTAGCCGATATCTGGA	0.537																																					p.G750R		.											.	TBC1D2B	136	0			c.G2248C						.						95.0	80.0	85.0					15																	78305187		2196	4293	6489	SO:0001583	missense	23102	exon9			AGTAGCCGATATC	AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2248G>C	15.37:g.78305187C>G	ENSP00000300584:p.Gly750Arg	234.0	0.0		232.0	16.0	NM_144572	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	ENST00000300584.3	37	CCDS45314.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141177	0.77775	.	.	ENSG00000167202	ENST00000409931;ENST00000300584	T;T	0.10763	2.84;2.84	5.47	5.47	0.80525	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.45337	0.1337	M	0.92970	3.365	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.56523	-0.7965	10	0.87932	D	0	.	18.6826	0.91551	0.0:1.0:0.0:0.0	.	750;202;750	Q9UPU7-2;Q9UPU7-3;Q9UPU7	.;.;TBD2B_HUMAN	R	750	ENSP00000387165:G750R;ENSP00000300584:G750R	ENSP00000300584:G750R	G	-	1	0	TBC1D2B	76092242	1.000000	0.71417	0.984000	0.44739	0.473000	0.32948	7.631000	0.83237	2.723000	0.93209	0.655000	0.94253	GGC	.		0.537	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328369.3	NM_015079	
TGM1	7051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24729674	24729674	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr14:24729674A>G	ENST00000206765.6	-	4	862	c.739T>C	c.(739-741)Ttc>Ctc	p.F247L	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	247					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	CAGGGGTTGAAGAGGATGTAG	0.592																																					p.F247L		.											.	TGM1	91	0			c.T739C						.						82.0	73.0	76.0					14																	24729674		2203	4300	6503	SO:0001583	missense	7051	exon4			GGTTGAAGAGGAT	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.739T>C	14.37:g.24729674A>G	ENSP00000206765:p.Phe247Leu	89.0	0.0		57.0	21.0	NM_000359	B4DWR7|Q197M4	Missense_Mutation	SNP	ENST00000206765.6	37	CCDS9622.1	.	.	.	.	.	.	.	.	.	.	A	34	5.397022	0.96009	.	.	ENSG00000092295	ENST00000206765	D	0.94613	-3.47	5.49	5.49	0.81192	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98002	0.9342	H	0.95328	3.655	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.99153	1.0859	10	0.87932	D	0	-30.3127	14.7155	0.69265	1.0:0.0:0.0:0.0	.	247	P22735	TGM1_HUMAN	L	247	ENSP00000206765:F247L	ENSP00000206765:F247L	F	-	1	0	TGM1	23799514	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.599000	0.90856	2.311000	0.77944	0.533000	0.62120	TTC	.		0.592	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
TNRC6B	23112	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	40521858	40521858	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr22:40521858A>G	ENST00000301923.9	+	3	339	c.37A>G	c.(37-39)Agt>Ggt	p.S13G	TNRC6B_ENST00000402203.1_Missense_Mutation_p.S13G	NM_001024843.1	NP_001020014.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	0	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GGAAGAAAGCAGTTCCAAGGT	0.388																																					p.S13G		.											.	TNRC6B	22	0			c.A37G						.						72.0	66.0	68.0					22																	40521858		1842	4095	5937	SO:0001583	missense	23112	exon3			GAAAGCAGTTCCA	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000301923.9:c.37A>G	22.37:g.40521858A>G	ENSP00000306759:p.Ser13Gly	90.0	1.0		74.0	17.0	NM_001024843	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000301923.9	37	CCDS46712.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.758141	0.49468	.	.	ENSG00000100354	ENST00000441751;ENST00000301923;ENST00000402203	T;T	0.33654	1.4;1.4	5.08	3.95	0.45737	.	0.782049	0.09792	U	0.755219	T	0.35480	0.0933	.	.	.	0.80722	D	1	B	0.20988	0.05	B	0.30029	0.11	T	0.27536	-1.0071	9	0.87932	D	0	.	9.9709	0.41754	0.7681:0.0:0.0:0.2319	.	13	Q9UPQ9-2	.	G	13	ENSP00000306759:S13G;ENSP00000384795:S13G	ENSP00000306759:S13G	S	+	1	0	TNRC6B	38851804	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.569000	0.36428	1.900000	0.55004	0.460000	0.39030	AGT	.		0.388	TNRC6B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321393.1		
TSHZ3	57616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	31769301	31769301	+	Silent	SNP	C	C	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:31769301C>G	ENST00000240587.4	-	2	1725	c.1398G>C	c.(1396-1398)ctG>ctC	p.L466L		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	466					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCTCCACATTCAGTTTTGGGG	0.542																																					p.L466L		.											.	TSHZ3	232	0			c.G1398C						.						142.0	144.0	143.0					19																	31769301		2203	4300	6503	SO:0001819	synonymous_variant	57616	exon2			CACATTCAGTTTT	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1398G>C	19.37:g.31769301C>G		191.0	0.0		177.0	34.0	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																			.		0.542	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
TTN	7273	hgsc.bcm.edu;bcgsc.ca	37	2	179506015	179506015	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr2:179506015T>C	ENST00000591111.1	-	170	35887	c.35663A>G	c.(35662-35664)gAa>gGa	p.E11888G	TTN_ENST00000460472.2_Missense_Mutation_p.E4464G|TTN_ENST00000359218.5_Missense_Mutation_p.E4589G|TTN_ENST00000342992.6_Missense_Mutation_p.E10961G|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E13529G|TTN_ENST00000342175.6_Missense_Mutation_p.E4656G|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11888	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACTTTAGGTTCTTCTTCTTC	0.294																																					p.E13529G		.											.	TTN	636	0			c.A40586G						.						101.0	88.0	92.0					2																	179506015		1754	3994	5748	SO:0001583	missense	7273	exon220			TTAGGTTCTTCTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35663A>G	2.37:g.179506015T>C	ENSP00000465570:p.Glu11888Gly	83.0	0.0		67.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	15.02	2.708096	0.48412	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000414766	T;T;T;T	0.69435	-0.4;0.06;0.04;0.04	5.51	5.51	0.81932	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.74230	0.3689	L	0.43923	1.385	0.33545	D	0.595423	P;P;P;P;D	0.76494	0.849;0.849;0.849;0.849;0.999	P;P;P;P;D	0.71414	0.478;0.478;0.478;0.478;0.973	T	0.81675	-0.0825	9	0.87932	D	0	.	11.2668	0.49114	0.1365:0.0:0.0:0.8635	.	4464;4589;4656;11888;10655	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-5	.;.;.;TITIN_HUMAN;.	G	10961;4464;4656;4589;4464;850	ENSP00000343764:E10961G;ENSP00000434586:E4464G;ENSP00000340554:E4656G;ENSP00000352154:E4589G	ENSP00000340554:E4656G	E	-	2	0	TTN	179214260	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	3.635000	0.54309	2.105000	0.64084	0.482000	0.46254	GAA	.		0.294	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UGT2B28	54490	broad.mit.edu;ucsc.edu	37	4	70160274	70160274	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:70160274C>G	ENST00000335568.5	+	6	1339	c.1337C>G	c.(1336-1338)tCa>tGa	p.S446*	UGT2B28_ENST00000511240.1_3'UTR	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	446					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						ATGAAATTATCAATAATTCAA	0.373																																					p.S446X		.											.	UGT2B28	91	0			c.C1337G						.						38.0	44.0	42.0					4																	70160274		2037	4233	6270	SO:0001587	stop_gained	54490	exon6			AATTATCAATAAT	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1337C>G	4.37:g.70160274C>G	ENSP00000334276:p.Ser446*	72.0	0.0		63.0	11.0	NM_053039	B5BUM0|Q9BY62|Q9BY63	Nonsense_Mutation	SNP	ENST00000335568.5	37	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	-	11.25	1.584006	0.28268	.	.	ENSG00000135226	ENST00000335568	.	.	.	2.17	1.19	0.21007	.	0.000000	0.64402	U	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.2654	0.26227	0.2654:0.7346:0.0:0.0	.	.	.	.	X	446	.	ENSP00000334276:S446X	S	+	2	0	UGT2B28	70194863	1.000000	0.71417	0.003000	0.11579	0.049000	0.14656	6.652000	0.74377	0.175000	0.19841	0.184000	0.17185	TCA	.		0.373	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
UTRN	7402	hgsc.bcm.edu;bcgsc.ca	37	6	144801024	144801024	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr6:144801024A>G	ENST00000367545.3	+	25	3413	c.3413A>G	c.(3412-3414)cAg>cGg	p.Q1138R		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1138					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GCAGAGATGCAGGAATGGATG	0.468																																					p.Q1138R		.											.	UTRN	95	0			c.A3413G						.						112.0	113.0	113.0					6																	144801024		2203	4300	6503	SO:0001583	missense	7402	exon25			AGATGCAGGAATG	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3413A>G	6.37:g.144801024A>G	ENSP00000356515:p.Gln1138Arg	55.0	0.0		50.0	5.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093745	0.76870	.	.	ENSG00000152818	ENST00000367545	T	0.50548	0.74	5.95	5.95	0.96441	.	0.000000	0.49916	D	0.000124	T	0.47192	0.1432	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.48186	-0.9057	10	0.39692	T	0.17	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	1138	P46939	UTRO_HUMAN	R	1138	ENSP00000356515:Q1138R	ENSP00000356515:Q1138R	Q	+	2	0	UTRN	144842717	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.219000	0.78000	2.279000	0.76181	0.533000	0.62120	CAG	.		0.468	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
WDR19	57728	hgsc.bcm.edu;bcgsc.ca	37	4	39191330	39191330	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr4:39191330T>C	ENST00000399820.3	+	4	373	c.219T>C	c.(217-219)gcT>gcC	p.A73A	WDR19_ENST00000288634.7_5'UTR|WDR19_ENST00000506503.1_Silent_p.A73A	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	73					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						CAGTGATTGCTGAGAAATCTA	0.348																																					p.A73A		.											.	WDR19	67	0			c.T219C						.						109.0	107.0	108.0					4																	39191330		1850	4114	5964	SO:0001819	synonymous_variant	57728	exon4			GATTGCTGAGAAA	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.219T>C	4.37:g.39191330T>C		152.0	0.0		103.0	5.0	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Silent	SNP	ENST00000399820.3	37	CCDS47042.1																																																																																			.		0.348	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
WDR26	80232	hgsc.bcm.edu;bcgsc.ca	37	1	224588733	224588733	+	Silent	SNP	T	T	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr1:224588733T>C	ENST00000414423.2	-	9	1531	c.1338A>G	c.(1336-1338)gaA>gaG	p.E446E	WDR26_ENST00000295024.6_Silent_p.E299E|MIR4742_ENST00000581069.1_RNA|WDR26_ENST00000479727.1_5'Flank|WDR26_ENST00000366852.2_3'UTR	NM_001115113.2|NM_025160.6	NP_001108585.2|NP_079436.4	Q9H7D7	WDR26_HUMAN	WD repeat domain 26	446						cytoplasm (GO:0005737)|nucleus (GO:0005634)				biliary_tract(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	18				GBM - Glioblastoma multiforme(131;0.0104)		TCAAACTGTCTTCATGAGACT	0.443																																					p.E446E		.											.	WDR26	90	0			c.A1338G						.						97.0	83.0	88.0					1																	224588733		2203	4300	6503	SO:0001819	synonymous_variant	80232	exon9			ACTGTCTTCATGA	AK024669	CCDS31037.1, CCDS31037.2	1q42.13	2013-01-09			ENSG00000162923	ENSG00000162923		"""WD repeat domain containing"""	21208	protein-coding gene	gene with protein product	"""GID complex subunit 7 homolog (S. cerevisiae)"""						Standard	NM_001115113		Approved	FLJ21016, GID7	uc001hop.4	Q9H7D7	OTTHUMG00000037636	ENST00000414423.2:c.1338A>G	1.37:g.224588733T>C		79.0	0.0		78.0	5.0	NM_025160	A0MNN3|Q4G100|Q59EC4|Q5GLZ9|Q86UY4|Q9H3C2	Silent	SNP	ENST00000414423.2	37	CCDS31037.2	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390187	0.25118	.	.	ENSG00000162923	ENST00000480676	.	.	.	5.73	3.39	0.38822	.	.	.	.	.	T	0.59266	0.2181	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52726	-0.8537	4	.	.	.	.	9.5525	0.39319	0.0:0.1475:0.0:0.8525	.	.	.	.	G	80	.	.	R	-	1	2	WDR26	222655356	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.794000	0.26958	0.447000	0.26695	0.477000	0.44152	AGA	.		0.443	WDR26-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091760.2	NM_025160	
ZNF106	64397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42742306	42742306	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr15:42742306A>C	ENST00000263805.4	-	2	2421	c.2095T>G	c.(2095-2097)Ttg>Gtg	p.L699V	ZNF106_ENST00000565611.1_Intron|ZNF106_ENST00000565380.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	699					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TCTGCATCCAAGCTAGCACTC	0.448																																					p.L699V		.											.	ZFP106	515	0			c.T2095G						.						116.0	117.0	117.0					15																	42742306		2203	4299	6502	SO:0001583	missense	64397	exon2			CATCCAAGCTAGC	AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.2095T>G	15.37:g.42742306A>C	ENSP00000263805:p.Leu699Val	104.0	0.0		106.0	26.0	NM_022473	B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	ENST00000263805.4	37	CCDS32208.1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.201313	0.58234	.	.	ENSG00000103994	ENST00000263805	T	0.66280	-0.2	5.52	2.61	0.31194	.	0.534263	0.18523	N	0.138708	T	0.52175	0.1718	L	0.50333	1.59	0.80722	D	1	B;B	0.20550	0.046;0.012	B;B	0.19946	0.027;0.006	T	0.42783	-0.9431	10	0.45353	T	0.12	-2.2957	7.1598	0.25657	0.7653:0.1355:0.0992:0.0	.	482;699	B4DGC7;Q9H2Y7	.;ZF106_HUMAN	V	699	ENSP00000263805:L699V	ENSP00000263805:L699V	L	-	1	2	ZFP106	40529598	0.996000	0.38824	0.402000	0.26371	0.972000	0.66771	3.602000	0.54066	0.268000	0.21939	0.528000	0.53228	TTG	.		0.448	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422587.1	NM_022473	
ZNF232	7775	hgsc.bcm.edu;bcgsc.ca	37	17	5009622	5009622	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr17:5009622A>G	ENST00000250076.3	-	5	1486	c.832T>C	c.(832-834)Tgg>Cgg	p.W278R	ZNF232_ENST00000575898.1_Missense_Mutation_p.W269R|ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575538.1_5'Flank	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	251					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						GCAGGGGACCACCTCAGTCTC	0.468																																					p.W278R		.											.	ZNF232	154	0			c.T832C						.						102.0	101.0	101.0					17																	5009622		2203	4300	6503	SO:0001583	missense	7775	exon5			GGGACCACCTCAG	AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.832T>C	17.37:g.5009622A>G	ENSP00000250076:p.Trp278Arg	80.0	0.0		78.0	4.0	NM_014519		Missense_Mutation	SNP	ENST00000250076.3	37	CCDS11068.1	.	.	.	.	.	.	.	.	.	.	A	6.227	0.410026	0.11812	.	.	ENSG00000167840	ENST00000250076	T	0.00912	5.55	2.99	-5.98	0.02220	.	3.492970	0.01390	N	0.013220	T	0.00724	0.0024	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.48115	-0.9063	10	0.22109	T	0.4	.	2.9235	0.05777	0.5675:0.1174:0.1756:0.1394	.	251;242	Q9UNY5;Q9UNY5-2	ZN232_HUMAN;.	R	278	ENSP00000250076:W278R	ENSP00000250076:W278R	W	-	1	0	ZNF232	4950346	0.000000	0.05858	0.000000	0.03702	0.566000	0.35808	-1.363000	0.02592	-1.665000	0.01477	-0.242000	0.12053	TGG	.		0.468	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216915.1	NM_014519	
ZNF91	7644	hgsc.bcm.edu;bcgsc.ca	37	19	23556628	23556628	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:23556628A>G	ENST00000300619.7	-	3	374	c.169T>C	c.(169-171)Tct>Cct	p.S57P	ZNF91_ENST00000397082.2_Intron|ZNF91_ENST00000599743.1_Missense_Mutation_p.S57P	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	57	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TCTGGCTTAGAGAGAGCAATA	0.398																																					p.S57P		.											.	ZNF91	90	0			c.T169C						.						74.0	78.0	76.0					19																	23556628		2202	4299	6501	SO:0001583	missense	7644	exon3			GCTTAGAGAGAGC	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.169T>C	19.37:g.23556628A>G	ENSP00000300619:p.Ser57Pro	117.0	0.0		71.0	4.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	A	0.178	-1.065310	0.01934	.	.	ENSG00000167232	ENST00000300619	T	0.00824	5.65	0.158	0.158	0.14942	Krueppel-associated box (3);	.	.	.	.	T	0.01061	0.0035	L	0.45470	1.425	0.09310	N	1	B	0.21147	0.052	B	0.24269	0.052	T	0.45512	-0.9256	8	0.23891	T	0.37	.	.	.	.	.	57	Q05481	ZNF91_HUMAN	P	57	ENSP00000300619:S57P	ENSP00000300619:S57P	S	-	1	0	ZNF91	23348468	0.363000	0.24989	0.080000	0.20451	0.079000	0.17450	0.149000	0.16243	0.175000	0.19841	0.172000	0.16884	TCT	.		0.398	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ZNF71	58491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57133319	57133319	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39X-01A-11D-A20W-10	TCGA-DD-A39X-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	0d48a532-df89-439c-8c4f-4b284cfdbb79	c27b95f8-bb8d-429a-b193-81f1caf006ee	g.chr19:57133319G>A	ENST00000328070.6	+	3	898	c.664G>A	c.(664-666)Gcc>Acc	p.A222T		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		GTGTGGCAAGGCCTTCCGGAA	0.647																																					p.A222T		.											.	ZNF71	91	0			c.G664A						.						55.0	46.0	49.0					19																	57133319		2203	4300	6503	SO:0001583	missense	58491	exon3			GGCAAGGCCTTCC	X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.664G>A	19.37:g.57133319G>A	ENSP00000328245:p.Ala222Thr	100.0	0.0		118.0	18.0	NM_021216	Q15919|Q9UC09|Q9UQD3	Missense_Mutation	SNP	ENST00000328070.6	37	CCDS12947.1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.694000	0.30052	.	.	ENSG00000197951	ENST00000328070	T	0.13778	2.56	3.47	2.39	0.29439	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04407	0.0121	N	0.01817	-0.705	0.21861	N	0.999505	B	0.33883	0.43	B	0.31869	0.137	T	0.30650	-0.9971	9	0.27785	T	0.31	.	5.6102	0.17400	0.1098:0.0:0.6973:0.1929	.	222	Q9NQZ8	ZNF71_HUMAN	T	222	ENSP00000328245:A222T	ENSP00000328245:A222T	A	+	1	0	ZNF71	61825131	0.000000	0.05858	0.993000	0.49108	0.457000	0.32468	-0.946000	0.03905	1.777000	0.52277	0.561000	0.74099	GCC	.		0.647	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459798.2	NM_021216	
