#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA3	21	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2327903	2327903	+	Missense_Mutation	SNP	G	G	A	rs368905104		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr16:2327903G>A	ENST00000301732.5	-	31	5586	c.4886C>T	c.(4885-4887)gCc>gTc	p.A1629V	ABCA3_ENST00000382381.3_Missense_Mutation_p.A1571V	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1629					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GTCCACGAAGGCCTTGAACTC	0.677																																					p.A1629V		.											.	ABCA3	1015	0			c.C4886T						.	G	VAL/ALA	1,4395	2.1+/-5.4	0,1,2197	26.0	27.0	26.0		4886	3.9	1.0	16		26	0,8600		0,0,4300	no	missense	ABCA3	NM_001089.2	64	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	benign	1629/1705	2327903	1,12995	2198	4300	6498	SO:0001583	missense	21	exon31			ACGAAGGCCTTGA	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.4886C>T	16.37:g.2327903G>A	ENSP00000301732:p.Ala1629Val	34.0	0.0		32.0	13.0	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398143	0.25205	2.27E-4	0.0	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.84370	-1.84	4.96	3.93	0.45458	.	0.192618	0.43747	D	0.000532	T	0.79695	0.4490	M	0.63843	1.955	0.80722	D	1	B;B	0.33135	0.054;0.399	B;B	0.32533	0.065;0.147	T	0.75368	-0.3342	10	0.30078	T	0.28	.	7.1254	0.25469	0.0982:0.0:0.7269:0.1749	.	1633;1629	Q4LE27;Q99758	.;ABCA3_HUMAN	V	1629;1633	ENSP00000301732:A1629V	ENSP00000301732:A1629V	A	-	2	0	ABCA3	2267904	1.000000	0.71417	0.959000	0.39883	0.416000	0.31233	4.548000	0.60718	2.584000	0.87258	0.561000	0.74099	GCC	.		0.677	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52440918	52440918	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr3:52440918A>C	ENST00000460680.1	-	8	1057	c.586T>G	c.(586-588)Tgg>Ggg	p.W196G	BAP1_ENST00000296288.5_Missense_Mutation_p.W196G	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TCCTCCCCCCAGGGCCCTAGT	0.612			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.W196G	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,uveal_tract,malignant_melanoma,+2	BAP1	1032	0			c.T586G						.						40.0	34.0	36.0					3																	52440918		2197	4297	6494	SO:0001583	missense	8314	exon8			CCCCCCAGGGCCC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.586T>G	3.37:g.52440918A>C	ENSP00000417132:p.Trp196Gly	135.0	0.0		98.0	54.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Missense_Mutation	SNP	ENST00000460680.1	37	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.077545	0.76528	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	T;T	0.54279	0.58;0.58	6.04	6.04	0.98038	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (3);	0.000000	0.85682	D	0.000000	T	0.72859	0.3513	M	0.75447	2.3	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.75300	-0.3366	10	0.62326	D	0.03	-8.1917	16.2573	0.82524	1.0:0.0:0.0:0.0	.	196	Q92560	BAP1_HUMAN	G	196	ENSP00000417132:W196G;ENSP00000296288:W196G	ENSP00000296288:W196G	W	-	1	0	BAP1	52415958	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	9.297000	0.96120	2.319000	0.78375	0.528000	0.53228	TGG	.		0.612	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
C16orf96	342346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4606689	4606689	+	Missense_Mutation	SNP	G	G	A	rs367941862		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr16:4606689G>A	ENST00000444310.4	+	1	199	c.199G>A	c.(199-201)Gcc>Acc	p.A67T		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GGAAGGAGACGCCCAGCCTAT	0.592																																					p.A67T		.											.	.	.	0			c.G199A						.	G	THR/ALA	0,1384		0,0,692	68.0	78.0	75.0		199	0.7	0.2	16		75	1,3181		0,1,1590	no	missense	C16orf96	NM_001145011.1	58	0,1,2282	AA,AG,GG		0.0314,0.0,0.0219	possibly-damaging	67/1142	4606689	1,4565	692	1591	2283	SO:0001583	missense	342346	exon1			GGAGACGCCCAGC		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.199G>A	16.37:g.4606689G>A	ENSP00000415027:p.Ala67Thr	156.0	0.0		132.0	15.0	NM_001145011		Missense_Mutation	SNP	ENST00000444310.4	37	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.285182	0.23478	0.0	3.14E-4	ENSG00000205832	ENST00000444310	T	0.22134	1.97	5.22	0.719	0.18208	.	0.662796	0.13422	N	0.389056	T	0.17916	0.0430	L	0.48362	1.52	0.09310	N	0.999996	P	0.50710	0.938	B	0.42692	0.395	T	0.12167	-1.0558	10	0.72032	D	0.01	-6.69	6.0835	0.19954	0.0914:0.0:0.433:0.4756	.	67	A6NNT2	CP096_HUMAN	T	67	ENSP00000415027:A67T	ENSP00000415027:A67T	A	+	1	0	C16orf96	4546690	0.000000	0.05858	0.184000	0.23157	0.076000	0.17211	0.031000	0.13710	-0.018000	0.14079	0.655000	0.94253	GCC	.		0.592	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
CEP164	22897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	117263284	117263284	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr11:117263284G>T	ENST00000278935.3	+	19	2581	c.2434G>T	c.(2434-2436)Ggg>Tgg	p.G812W	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	812	Glu-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GAAGTGCCTTGGGCAAGTGGA	0.577																																					p.G815W		.											.	CEP164	69	0			c.G2443T						.						137.0	129.0	132.0					11																	117263284		2201	4296	6497	SO:0001583	missense	22897	exon18			TGCCTTGGGCAAG	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.2434G>T	11.37:g.117263284G>T	ENSP00000278935:p.Gly812Trp	100.0	0.0		143.0	45.0	NM_001271933	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.569748	0.28003	.	.	ENSG00000110274	ENST00000278935;ENST00000529538;ENST00000375253	T	0.43688	0.94	4.33	3.42	0.39159	.	0.132235	0.35772	N	0.002996	T	0.47021	0.1423	L	0.29908	0.895	0.09310	N	1	D;D;D;D	0.69078	0.996;0.997;0.995;0.997	P;D;D;D	0.74348	0.908;0.958;0.938;0.983	T	0.22208	-1.0223	10	0.72032	D	0.01	-30.7039	7.7052	0.28646	0.0938:0.179:0.7272:0.0	.	786;586;812;815	E9PI34;Q9NTH6;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	W	812;786;693	ENSP00000278935:G812W	ENSP00000278935:G812W	G	+	1	0	CEP164	116768494	0.003000	0.15002	0.899000	0.35326	0.242000	0.25591	1.210000	0.32370	1.044000	0.40200	0.561000	0.74099	GGG	.		0.577	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
DMGDH	29958	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	78322295	78322295	+	Silent	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr5:78322295G>A	ENST00000255189.3	-	13	2170	c.2142C>T	c.(2140-2142)gcC>gcT	p.A714A	DMGDH_ENST00000380311.4_Silent_p.A513A|DMGDH_ENST00000540686.1_Silent_p.A334A	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	714					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		AGGCATTCATGGCATAGGTTC	0.433																																					p.A714A		.											.	DMGDH	94	0			c.C2142T						.						119.0	109.0	113.0					5																	78322295		2203	4300	6503	SO:0001819	synonymous_variant	29958	exon13			ATTCATGGCATAG	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.2142C>T	5.37:g.78322295G>A		241.0	0.0		278.0	100.0	NM_013391	B2RBN0|B4E1J9	Silent	SNP	ENST00000255189.3	37	CCDS4044.1																																																																																			.		0.433	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226963.3	NM_013391	
EML4	27436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	42488346	42488346	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr2:42488346C>T	ENST00000318522.5	+	4	686	c.424C>T	c.(424-426)Cga>Tga	p.R142*	EML4_ENST00000401738.3_Nonsense_Mutation_p.R142*|EML4_ENST00000402711.2_Intron	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	142					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						TCCACAAATTCGAGCATCACC	0.388			T	ALK	NSCLC																																p.R142X		.		Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	.	EML4	3734	0			c.C424T						.						144.0	142.0	143.0					2																	42488346		2203	4300	6503	SO:0001587	stop_gained	27436	exon4			CAAATTCGAGCAT	AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.424C>T	2.37:g.42488346C>T	ENSP00000320663:p.Arg142*	37.0	0.0		54.0	9.0	NM_019063	A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Nonsense_Mutation	SNP	ENST00000318522.5	37	CCDS1807.1	.	.	.	.	.	.	.	.	.	.	C	30	5.052548	0.93793	.	.	ENSG00000143924	ENST00000318522;ENST00000401738	.	.	.	5.52	5.52	0.82312	.	0.993065	0.08186	N	0.984631	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.6849	19.4311	0.94768	0.0:1.0:0.0:0.0	.	.	.	.	X	142	.	ENSP00000320663:R142X	R	+	1	2	EML4	42341850	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.677000	0.68142	2.591000	0.87537	0.555000	0.69702	CGA	.		0.388	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250463.3	NM_019063	
HCCS	3052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	11139831	11139831	+	Silent	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chrX:11139831G>A	ENST00000321143.4	+	7	910	c.708G>A	c.(706-708)aaG>aaA	p.K236K	HCCS_ENST00000380762.4_Silent_p.K236K|HCCS_ENST00000380763.3_Silent_p.K236K|ARHGAP6_ENST00000534860.1_Intron	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	236					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)	7						AAGTCAACAAGGACTACCAGT	0.463																																					p.K236K	Ovarian(86;1338 1347 1462 10340 37882)	.											.	HCCS	226	0			c.G708A						.						186.0	149.0	162.0					X																	11139831		2203	4300	6503	SO:0001819	synonymous_variant	3052	exon7			CAACAAGGACTAC		CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.708G>A	X.37:g.11139831G>A		226.0	0.0		205.0	70.0	NM_001122608	B3KUS1|Q502X8	Silent	SNP	ENST00000321143.4	37	CCDS14139.1																																																																																			.		0.463	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055742.1		
GEMIN8	54960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	14027050	14027050	+	Silent	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chrX:14027050G>A	ENST00000380523.4	-	5	1029	c.711C>T	c.(709-711)gtC>gtT	p.V237V	GEMIN8_ENST00000398355.3_Silent_p.V237V	NM_017856.2	NP_060326.1	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8	237					spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	9						TCAGGGGGATGACCGGCCAGT	0.557																																					p.V237V		.											.	GEMIN8	130	0			c.C711T						.						74.0	69.0	71.0					X																	14027050		2203	4300	6503	SO:0001819	synonymous_variant	54960	exon5			GGGGATGACCGGC	BC020785	CCDS14159.1	Xp22	2010-03-16	2006-11-24	2006-11-24	ENSG00000046647	ENSG00000046647			26044	protein-coding gene	gene with protein product			"""family with sequence similarity 51, member A1"""	FAM51A1		16434402	Standard	NM_017856		Approved	FLJ20514	uc004cwd.3	Q9NWZ8	OTTHUMG00000021160	ENST00000380523.4:c.711C>T	X.37:g.14027050G>A		257.0	0.0		233.0	83.0	NM_017856	C4AMC4|Q2LJ66|Q6ZV27	Silent	SNP	ENST00000380523.4	37	CCDS14159.1																																																																																			.		0.557	GEMIN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055815.1	NM_017856	
HLA-E	3133	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	30457628	30457628	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr6:30457628C>A	ENST00000376630.4	+	2	255	c.190C>A	c.(190-192)Ccg>Acg	p.P64T		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	64	Alpha-1.				antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						CGCCGCGAGTCCGAGGATGGT	0.677																																					p.P64T		.											.	HLA-E	516	0			c.C190A						.						62.0	69.0	66.0					6																	30457628		1510	2707	4217	SO:0001583	missense	3133	exon2			GCGAGTCCGAGGA	M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.190C>A	6.37:g.30457628C>A	ENSP00000365817:p.Pro64Thr	96.0	0.0		47.0	14.0	NM_005516	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Missense_Mutation	SNP	ENST00000376630.4	37	CCDS34379.1	.	.	.	.	.	.	.	.	.	.	.	15.34	2.803154	0.50315	.	.	ENSG00000204592	ENST00000376630	T	0.00832	5.64	1.67	1.67	0.24075	.	.	.	.	.	T	0.01870	0.0059	H	0.95982	3.75	0.09310	N	1	P;P	0.43578	0.811;0.698	P;B	0.48368	0.575;0.402	T	0.24368	-1.0162	9	0.87932	D	0	.	6.7735	0.23607	0.0:1.0:0.0:0.0	.	105;64	E7ENN9;Q6DU44	.;.	T	64	ENSP00000365817:P64T	ENSP00000365817:P64T	P	+	1	0	HLA-E	30565607	0.001000	0.12720	0.128000	0.21923	0.167000	0.22549	0.260000	0.18424	1.235000	0.43724	0.462000	0.41574	CCG	.		0.677	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076282.2	NM_005516	
IL18R1	8809	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	103013028	103013028	+	Silent	SNP	C	C	T			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr2:103013028C>T	ENST00000409599.1	+	12	1664	c.1308C>T	c.(1306-1308)agC>agT	p.S436S	IL18R1_ENST00000233957.1_Silent_p.S436S			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	436	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TAGAGAAAAGCCGAAGACTAA	0.353																																					p.S436S		.											.	IL18R1	93	0			c.C1308T						.						52.0	53.0	53.0					2																	103013028		2203	4300	6503	SO:0001819	synonymous_variant	8809	exon10			GAAAAGCCGAAGA	U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.1308C>T	2.37:g.103013028C>T		64.0	0.0		97.0	5.0	NM_003855	B2R9Y5|Q52LC9	Silent	SNP	ENST00000409599.1	37	CCDS2060.1																																																																																			.		0.353	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855	
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	209113113	209113113	+	Missense_Mutation	SNP	G	G	C	rs121913499		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr2:209113113G>C	ENST00000415913.1	-	4	775	c.394C>G	c.(394-396)Cgt>Ggt	p.R132G	IDH1_ENST00000446179.1_Missense_Mutation_p.R132G|IDH1_ENST00000345146.2_Missense_Mutation_p.R132G	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132C(446)|p.R132G(125)|p.R132S(106)|p.G131_R132>VL(1)|p.R132V(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TAAGCATGACGACCTATGATG	0.398			Mis		gliobastoma																																p.R132G	Pancreas(158;264 1958 3300 35450 36047)	.		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	IDH1,brain,glioma,+1	IDH1	23522	679	Substitution - Missense(678)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(280)|central_nervous_system(181)|bone(177)|biliary_tract(21)|soft_tissue(12)|large_intestine(2)|skin(2)|autonomic_ganglia(1)|endometrium(1)|NS(1)|prostate(1)	c.C394G						.						81.0	74.0	76.0					2																	209113113		2203	4300	6503	SO:0001583	missense	3417	exon4			CATGACGACCTAT		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.394C>G	2.37:g.209113113G>C	ENSP00000390265:p.Arg132Gly	185.0	0.0		186.0	86.0	NM_005896	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286370	0.80803	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.57	5.57	0.84162	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.96636	0.8902	H	0.99379	4.54	0.80722	D	1	D	0.57899	0.981	P	0.62813	0.907	D	0.98312	1.0524	10	0.87932	D	0	-20.0399	19.5341	0.95242	0.0:0.0:1.0:0.0	.	132	O75874	IDHC_HUMAN	G	132	ENSP00000260985:R132G;ENSP00000410513:R132G;ENSP00000390265:R132G;ENSP00000391075:R132G	ENSP00000260985:R132G	R	-	1	0	IDH1	208821358	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.074000	0.76791	2.616000	0.88540	0.555000	0.69702	CGT	.		0.398	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1		
IRAK4	51135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	44176211	44176211	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr12:44176211T>C	ENST00000448290.2	+	9	1114	c.1043T>C	c.(1042-1044)aTt>aCt	p.I348T	IRAK4_ENST00000440781.2_Missense_Mutation_p.I224T|IRAK4_ENST00000551736.1_Missense_Mutation_p.I348T|IRAK4_ENST00000431837.1_Missense_Mutation_p.I224T	NM_016123.3	NP_057207.2	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	348	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)					all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		ACTAGCAGAATTGTGGGAACA	0.418																																					p.I348T		.											.	IRAK4	1366	0			c.T1043C						.						80.0	79.0	79.0					12																	44176211		2203	4300	6503	SO:0001583	missense	51135	exon9			GCAGAATTGTGGG	AF155118	CCDS8744.1, CCDS44862.1	12q12	2014-09-17				ENSG00000198001			17967	protein-coding gene	gene with protein product		606883				3772297, 10508479	Standard	NM_001114182		Approved	NY-REN-64	uc001rnt.3	Q9NWZ3		ENST00000448290.2:c.1043T>C	12.37:g.44176211T>C	ENSP00000390651:p.Ile348Thr	76.0	0.0		89.0	37.0	NM_016123	Q69FE1|Q8TDF7|Q9Y589	Missense_Mutation	SNP	ENST00000448290.2	37	CCDS8744.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.518415	0.85495	.	.	ENSG00000198001	ENST00000440781;ENST00000431837;ENST00000448290;ENST00000551736	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.62	5.62	0.85841	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.054522	0.64402	D	0.000001	T	0.66327	0.2778	L	0.48218	1.51	0.80722	D	1	B	0.33637	0.42	P	0.44422	0.449	T	0.69128	-0.5227	10	0.87932	D	0	-23.6069	15.8229	0.78673	0.0:0.0:0.0:1.0	.	348	Q9NWZ3	IRAK4_HUMAN	T	224;224;348;348	ENSP00000408734:I224T;ENSP00000390327:I224T;ENSP00000390651:I348T;ENSP00000446490:I348T	ENSP00000390327:I224T	I	+	2	0	IRAK4	42462478	1.000000	0.71417	0.987000	0.45799	0.988000	0.76386	7.698000	0.84413	2.130000	0.65690	0.477000	0.44152	ATT	.		0.418	IRAK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403947.1		
IVL	3713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152883644	152883644	+	Silent	SNP	G	G	C			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr1:152883644G>C	ENST00000368764.3	+	2	1435	c.1371G>C	c.(1369-1371)gtG>gtC	p.V457V	IVL_ENST00000392667.2_Silent_p.V311V			P07476	INVO_HUMAN	involucrin	457	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCAGCAGGTGGGGCAGCCAA	0.622																																					p.V457V		.											.	IVL	93	0			c.G1371C						.						29.0	36.0	34.0					1																	152883644		2176	4270	6446	SO:0001819	synonymous_variant	3713	exon2			GCAGGTGGGGCAG	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1371G>C	1.37:g.152883644G>C		160.0	0.0		167.0	61.0	NM_005547	Q5T7P4	Silent	SNP	ENST00000368764.3	37	CCDS1030.1																																																																																			.		0.622	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
LHB	3972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49519408	49519408	+	Missense_Mutation	SNP	G	G	C	rs201749590		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr19:49519408G>C	ENST00000221421.2	-	3	342	c.343C>G	c.(343-345)Cgc>Ggc	p.R115G	CTB-60B18.10_ENST00000600007.1_lincRNA	NM_000894.2	NP_000885.1	P01229	LSHB_HUMAN	luteinizing hormone beta polypeptide	115					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|male gonad development (GO:0008584)|peptide hormone processing (GO:0016486)|progesterone biosynthetic process (GO:0006701)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GAGGTGCTGCGGCGGCAGGGT	0.662																																					p.R115G		.											.	LHB	90	0			c.C343G						.						56.0	61.0	59.0					19																	49519408		2203	4300	6503	SO:0001583	missense	3972	exon3			TGCTGCGGCGGCA		CCDS12748.1	19q13.3	2013-02-26				ENSG00000104826		"""Endogenous ligands"""	6584	protein-coding gene	gene with protein product	"""lutropin, beta chain"", ""interstitial cell stimulating hormone, beta chain"", ""luteinizing hormone beta subunit"""	152780				1191677	Standard	NM_000894		Approved	LSH-B, CGB4, hLHB	uc002plt.3	P01229		ENST00000221421.2:c.343C>G	19.37:g.49519408G>C	ENSP00000221421:p.Arg115Gly	70.0	0.0		54.0	21.0	NM_000894	Q9UDI0	Missense_Mutation	SNP	ENST00000221421.2	37	CCDS12748.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941487	0.34283	.	.	ENSG00000104826	ENST00000221421;ENST00000391870	T	0.57752	0.38	4.71	3.66	0.41972	Cystine knot (1);Gonadotropin, beta subunit, conserved site (1);	0.298608	0.34025	N	0.004337	T	0.62672	0.2447	L	0.55481	1.735	0.26806	N	0.969103	P	0.44344	0.833	P	0.58873	0.847	T	0.56323	-0.7998	10	0.72032	D	0.01	-14.5685	10.529	0.44965	0.0:0.0:0.8059:0.1941	.	115	P01229	LSHB_HUMAN	G	115;131	ENSP00000221421:R115G	ENSP00000221421:R115G	R	-	1	0	LHB	54211220	1.000000	0.71417	0.997000	0.53966	0.003000	0.03518	2.930000	0.48924	1.090000	0.41315	0.462000	0.41574	CGC	G|0.999;A|0.000		0.662	LHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466246.1	NM_000894	
LRP2	4036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	170029679	170029679	+	Silent	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr2:170029679G>A	ENST00000263816.3	-	57	11355	c.11070C>T	c.(11068-11070)taC>taT	p.Y3690Y		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3690	LDL-receptor class A 30. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GGATGCAGCGGTAATTTGTTT	0.517																																					p.Y3690Y		.											.	LRP2	175	0			c.C11070T						.						127.0	117.0	120.0					2																	170029679		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon57			GCAGCGGTAATTT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11070C>T	2.37:g.170029679G>A		167.0	0.0		185.0	70.0	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	37	CCDS2232.1																																																																																			.		0.517	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LRRD1	401387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	91794266	91794266	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr7:91794266T>C	ENST00000458448.1	-	2	451	c.251A>G	c.(250-252)aAt>aGt	p.N84S	LRRD1_ENST00000454089.2_5'UTR|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000422722.1_Intron|LRRD1_ENST00000430130.2_Missense_Mutation_p.N84S			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	84					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						AAATTGAAGATTTTTCTTTTG	0.363																																					p.N84S		.											.	.	.	0			c.A251G						.						189.0	158.0	167.0					7																	91794266		692	1591	2283	SO:0001583	missense	401387	exon1			TGAAGATTTTTCT	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.251A>G	7.37:g.91794266T>C	ENSP00000405987:p.Asn84Ser	82.0	0.0		136.0	15.0	NM_001161528	B7ZMM9|Q49AT9	Missense_Mutation	SNP	ENST00000458448.1	37	CCDS55124.1	.	.	.	.	.	.	.	.	.	.	T	4.051	0.007120	0.07866	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	T;T	0.35789	1.29;1.29	5.2	-9.04	0.00734	.	.	.	.	.	T	0.09555	0.0235	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.20974	-1.0259	9	0.10377	T	0.69	.	2.1324	0.03754	0.1603:0.2983:0.3209:0.2205	.	84	A4D1F6	LRRD1_HUMAN	S	84	ENSP00000405987:N84S;ENSP00000411568:N84S	ENSP00000411568:N84S	N	-	2	0	LRRD1	91632202	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.247000	0.02893	-1.144000	0.02862	-1.079000	0.02226	AAT	.		0.363	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342027.2	NM_001045475	
MAPK7	5598	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	19285247	19285247	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr17:19285247G>A	ENST00000308406.5	+	5	2017	c.1631G>A	c.(1630-1632)gGg>gAg	p.G544E	MAPK7_ENST00000299612.7_Missense_Mutation_p.G405E|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000395604.3_Missense_Mutation_p.G544E|MAPK7_ENST00000571657.1_Intron|MAPK7_ENST00000395602.4_Missense_Mutation_p.G544E	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	544	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)			autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					aaggaacggggggctggggcC	0.677																																					p.G544E		.											.	MAPK7	1402	0			c.G1631A						.						11.0	23.0	19.0					17																	19285247		2028	3994	6022	SO:0001583	missense	5598	exon5			AACGGGGGGCTGG	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1631G>A	17.37:g.19285247G>A	ENSP00000311005:p.Gly544Glu	27.0	0.0		16.0	12.0	NM_002749	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.013489	0.35511	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.73047	-0.43;-0.71;-0.43;-0.43	5.06	4.07	0.47477	.	0.301968	0.23777	N	0.044675	T	0.52435	0.1734	N	0.22421	0.69	0.30198	N	0.798865	B	0.06786	0.001	B	0.04013	0.001	T	0.48258	-0.9051	10	0.33141	T	0.24	-15.0732	7.2289	0.26030	0.0923:0.1734:0.7342:0.0	.	544	Q13164	MK07_HUMAN	E	544;405;544;544	ENSP00000311005:G544E;ENSP00000299612:G405E;ENSP00000378968:G544E;ENSP00000378966:G544E	ENSP00000299612:G405E	G	+	2	0	MAPK7	19225840	0.440000	0.25618	0.715000	0.30552	0.873000	0.50193	0.886000	0.28241	1.088000	0.41272	0.561000	0.74099	GGG	.		0.677	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
MED15	51586	hgsc.bcm.edu;bcgsc.ca	37	22	20939289	20939289	+	Missense_Mutation	SNP	G	G	T	rs147995933		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr22:20939289G>T	ENST00000263205.7	+	15	2020	c.1951G>T	c.(1951-1953)Ggc>Tgc	p.G651C	MED15_ENST00000425759.2_Missense_Mutation_p.G500C|MED15_ENST00000382974.2_Missense_Mutation_p.G540C|MED15_ENST00000292733.7_Missense_Mutation_p.G611C|MED15_ENST00000541476.1_Missense_Mutation_p.G585C|MED15_ENST00000406969.1_Missense_Mutation_p.G585C|MED15_ENST00000542773.1_3'UTR	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	651					gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.G611S(1)|p.G651S(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CGCCATTCACGGCCCACCCAT	0.657																																					p.G651C		.											.	MED15	211	2	Substitution - Missense(2)	urinary_tract(2)	c.G1951T						.						130.0	124.0	126.0					22																	20939289		2203	4300	6503	SO:0001583	missense	51586	exon15			ATTCACGGCCCAC	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1951G>T	22.37:g.20939289G>T	ENSP00000263205:p.Gly651Cys	78.0	0.0		75.0	4.0	NM_001003891	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	ENST00000263205.7	37	CCDS33602.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692122	0.88735	.	.	ENSG00000099917	ENST00000425759;ENST00000292733;ENST00000263205;ENST00000406969;ENST00000382974;ENST00000541476;ENST00000542312	.	.	.	5.04	5.04	0.67666	Mediator complex, subunit Med15, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.80105	0.4562	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.995;1.0;0.998;1.0	T	0.83231	-0.0063	9	0.87932	D	0	.	15.8666	0.79069	0.0:0.0:1.0:0.0	.	581;630;267;585;611;651	B4DGD6;Q6PKB8;B3KWF1;G3V1P5;Q96RN5-2;Q96RN5	.;.;.;.;.;MED15_HUMAN	C	500;611;651;585;540;585;581	.	ENSP00000263205:G651C	G	+	1	0	MED15	19269289	1.000000	0.71417	0.993000	0.49108	0.984000	0.73092	9.316000	0.96319	2.355000	0.79922	0.561000	0.74099	GGC	G|1.000;A|0.000		0.657	MED15-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320177.2	NM_015889	
MEX3A	92312	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	156051766	156051766	+	Silent	SNP	T	T	C			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr1:156051766T>C	ENST00000532414.2	-	1	23	c.24A>G	c.(22-24)ggA>ggG	p.G8G	LMNA_ENST00000368301.2_5'Flank|MEX3A_ENST00000442784.1_5'Flank	NM_001093725.1	NP_001087194.1	A1L020	MEX3A_HUMAN	mex-3 RNA binding family member A	8						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	Hepatocellular(266;0.158)|all_neural(408;0.195)					TTTCCATTATTCCAGATACCA	0.552																																					p.G8G		.											.	MEX3A	158	0			c.A24G						.						21.0	20.0	20.0					1																	156051766		1402	2987	4389	SO:0001819	synonymous_variant	92312	exon1			CATTATTCCAGAT	AK024097	CCDS53377.1	1q22	2013-09-24	2013-08-21	2007-07-18	ENSG00000254726	ENSG00000254726		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	33482	protein-coding gene	gene with protein product		611007	"""ring finger and KH domain containing 4"", ""mex-3 homolog A (C. elegans)"""	RKHD4		17267406	Standard	NM_001093725		Approved		uc001fnd.4	A1L020	OTTHUMG00000017465	ENST00000532414.2:c.24A>G	1.37:g.156051766T>C		164.0	1.0		187.0	56.0	NM_001093725		Silent	SNP	ENST00000532414.2	37	CCDS53377.1																																																																																			.		0.552	MEX3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046218.3	NM_001093725	
MUC16	94025	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9033614	9033614	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr19:9033614C>T	ENST00000397910.4	-	9	36526	c.36323G>A	c.(36322-36324)gGt>gAt	p.G12108D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12110	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCTCACCAGACCCTGCAGTTC	0.612																																					p.G12108D		.											.	MUC16	566	0			c.G36323A						.						94.0	98.0	97.0					19																	9033614		2116	4205	6321	SO:0001583	missense	94025	exon9			ACCAGACCCTGCA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36323G>A	19.37:g.9033614C>T	ENSP00000381008:p.Gly12108Asp	167.0	1.0		216.0	28.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888721	0.33348	.	.	ENSG00000181143	ENST00000397910	T	0.28454	1.61	4.26	0.0582	0.14326	.	.	.	.	.	T	0.23249	0.0562	L	0.44542	1.39	.	.	.	B	0.27656	0.184	B	0.26416	0.069	T	0.25572	-1.0128	8	0.87932	D	0	.	6.1043	0.20065	0.0:0.5239:0.0:0.4761	.	12108	B5ME49	.	D	12108	ENSP00000381008:G12108D	ENSP00000381008:G12108D	G	-	2	0	MUC16	8894614	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.134000	0.00589	0.115000	0.18071	0.650000	0.86243	GGT	.		0.612	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC4	4585	broad.mit.edu;mdanderson.org	37	3	195512355	195512355	+	Silent	SNP	C	C	T	rs542225416		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr3:195512355C>T	ENST00000463781.3	-	2	6555	c.6096G>A	c.(6094-6096)ccG>ccA	p.P2032P	MUC4_ENST00000475231.1_Silent_p.P2032P|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGACAGGAAGCGGCGTGGTGT	0.582																																					p.P2032P		.											.	MUC4	90	0			c.G6096A						.						26.0	23.0	24.0					3																	195512355		686	1573	2259	SO:0001819	synonymous_variant	4585	exon2			AGGAAGCGGCGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6096G>A	3.37:g.195512355C>T		634.0	1.0		674.0	59.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MYO7B	4648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128366325	128366325	+	Missense_Mutation	SNP	G	G	A	rs531750826		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr2:128366325G>A	ENST00000409816.2	+	21	2718	c.2686G>A	c.(2686-2688)Gct>Act	p.A896T	MYO7B_ENST00000389524.4_Missense_Mutation_p.A896T|MYO7B_ENST00000428314.1_Missense_Mutation_p.A896T			Q6PIF6	MYO7B_HUMAN	myosin VIIB	896						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AAGCCAAGGCGCTCTCCCTGC	0.652																																					p.A896T		.											.	MYO7B	47	0			c.G2686A						.						37.0	43.0	41.0					2																	128366325		2090	4197	6287	SO:0001583	missense	4648	exon22			CAAGGCGCTCTCC		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.2686G>A	2.37:g.128366325G>A	ENSP00000386461:p.Ala896Thr	149.0	0.0		146.0	48.0	NM_001080527	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072437	0.36566	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.87650	-2.28;-2.28;-2.28	4.81	2.97	0.34412	.	0.660604	0.14594	N	0.310077	T	0.79545	0.4464	L	0.56769	1.78	0.09310	N	1	P	0.37158	0.585	B	0.19666	0.026	T	0.65331	-0.6194	10	0.30078	T	0.28	.	8.4557	0.32897	0.0839:0.1539:0.7622:0.0	.	896	Q6PIF6	MYO7B_HUMAN	T	896	ENSP00000374175:A896T;ENSP00000415090:A896T;ENSP00000386461:A896T	ENSP00000374175:A896T	A	+	1	0	MYO7B	128082795	0.001000	0.12720	0.000000	0.03702	0.627000	0.37826	0.777000	0.26718	0.596000	0.29794	0.462000	0.41574	GCT	.		0.652	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
PDE7B	27115	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	136268612	136268612	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr6:136268612delA	ENST00000308191.6	+	2	335	c.32delA	c.(31-33)gaafs	p.E11fs		NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	11					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	AGGTGTGGCGAAATCTTGTTT	0.368																																					p.E11fs		.											.	PDE7B	91	0			c.32delA						.						117.0	114.0	115.0					6																	136268612		2203	4300	6503	SO:0001589	frameshift_variant	27115	exon2			GTGGCGAAATCTT	AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.32delA	6.37:g.136268612delA	ENSP00000310661:p.Glu11fs	128.0	0.0		82.0	56.0	NM_018945	Q5W154	Frame_Shift_Del	DEL	ENST00000308191.6	37	CCDS5175.1																																																																																			.		0.368	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042371.1		
PODNL1	79883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14046601	14046601	+	Missense_Mutation	SNP	C	C	T	rs147712582	byFrequency	TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr19:14046601C>T	ENST00000339560.5	-	5	721	c.448G>A	c.(448-450)Gcg>Acg	p.A150T	PODNL1_ENST00000254320.3_Missense_Mutation_p.A68T|PODNL1_ENST00000538517.2_Intron|PODNL1_ENST00000538371.2_Missense_Mutation_p.A148T	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	150	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			GCCAGATCCGCGACACGGAGG	0.667																																					p.A150T		.											.	PODNL1	90	0			c.G448A						.		THR/ALA,,THR/ALA	4,4402	8.1+/-20.4	0,4,2199	26.0	28.0	28.0		442,,448	3.9	0.0	19	dbSNP_134	28	0,8600		0,0,4300	no	missense,intron,missense	PODNL1	NM_001146254.1,NM_001146255.1,NM_024825.3	58,,58	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	possibly-damaging,,possibly-damaging	148/511,,150/513	14046601	4,13002	2203	4300	6503	SO:0001583	missense	79883	exon5			GATCCGCGACACG	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.448G>A	19.37:g.14046601C>T	ENSP00000345175:p.Ala150Thr	84.0	1.0		57.0	24.0	NM_024825	B7Z564|Q9H5G9	Missense_Mutation	SNP	ENST00000339560.5	37	CCDS12300.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282377	0.40394	9.08E-4	0.0	ENSG00000132000	ENST00000538371;ENST00000339560;ENST00000254320	T;T;T	0.24538	1.85;5.5;1.85	4.97	3.92	0.45320	.	0.272209	0.25836	N	0.027983	T	0.36496	0.0969	L	0.44542	1.39	0.09310	N	1	D;D;D	0.69078	0.997;0.975;0.995	P;P;P	0.59948	0.848;0.586;0.866	T	0.10706	-1.0618	10	0.87932	D	0	.	10.7284	0.46083	0.0:0.9077:0.0:0.0923	.	148;68;150	F5H7F9;B7Z3M0;Q6PEZ8	.;.;PONL1_HUMAN	T	148;150;68	ENSP00000442553:A148T;ENSP00000345175:A150T;ENSP00000254320:A68T	ENSP00000254320:A68T	A	-	1	0	PODNL1	13907601	0.065000	0.20965	0.004000	0.12327	0.219000	0.24729	3.572000	0.53849	1.080000	0.41073	0.479000	0.44913	GCG	C|1.000;T|0.000		0.667	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	
RASSF4	83937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	45486412	45486412	+	Silent	SNP	A	A	G			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr10:45486412A>G	ENST00000340258.5	+	9	815	c.702A>G	c.(700-702)aaA>aaG	p.K234K	RASSF4_ENST00000374417.2_3'UTR|RASSF4_ENST00000334940.6_Silent_p.K243K|RASSF4_ENST00000472561.1_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CAAAATTAAAAGACTGCGAGT	0.473																																					p.K234K		.											.	RASSF4	290	0			c.A702G						.						76.0	87.0	83.0					10																	45486412		2203	4300	6503	SO:0001819	synonymous_variant	83937	exon9			ATTAAAAGACTGC	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.702A>G	10.37:g.45486412A>G		35.0	0.0		41.0	15.0	NM_032023	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000340258.5	37	CCDS7208.1																																																																																			.		0.473	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	NM_032023	
RPP40	10799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	4996590	4996590	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr6:4996590T>G	ENST00000380051.2	-	6	668	c.624A>C	c.(622-624)aaA>aaC	p.K208N	RPP40_ENST00000319533.5_Missense_Mutation_p.K185N|RPP40_ENST00000464646.1_Missense_Mutation_p.K148N	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	208					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				TCAGTGCTACTTTTGGCTGAT	0.502																																					p.K208N		.											.	RPP40	90	0			c.A624C						.						98.0	94.0	95.0					6																	4996590		2203	4300	6503	SO:0001583	missense	10799	exon6			TGCTACTTTTGGC	U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.624A>C	6.37:g.4996590T>G	ENSP00000369391:p.Lys208Asn	94.0	0.0		125.0	49.0	NM_006638	Q5VX97|Q8WVK8	Missense_Mutation	SNP	ENST00000380051.2	37	CCDS34333.1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.541448	0.27563	.	.	ENSG00000124787	ENST00000380051;ENST00000319533;ENST00000464646	T;T;T	0.43294	0.95;0.95;0.95	5.33	4.15	0.48705	.	0.263661	0.43919	D	0.000520	T	0.31040	0.0784	M	0.80028	2.48	0.40610	D	0.981662	P;P	0.42296	0.775;0.72	B;B	0.40901	0.295;0.343	T	0.12682	-1.0538	10	0.31617	T	0.26	-6.1148	11.7027	0.51579	0.0:0.0:0.1483:0.8517	.	185;208	O75818-2;O75818	.;RPP40_HUMAN	N	208;185;148	ENSP00000369391:K208N;ENSP00000317998:K185N;ENSP00000419431:K148N	ENSP00000317998:K185N	K	-	3	2	RPP40	4941589	0.938000	0.31826	0.097000	0.21041	0.398000	0.30690	1.747000	0.38298	0.845000	0.35118	0.528000	0.53228	AAA	.		0.502	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039733.2	NM_006638	
S1PR4	8698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3179635	3179635	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr19:3179635C>A	ENST00000246115.3	+	1	900	c.845C>A	c.(844-846)gCc>gAc	p.A282D		NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	282					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						AACCTCTGGGCCCAGGAGTAC	0.647																																					p.A282D	GBM(82;318 1638 33279 49708)	.											.	S1PR4	591	0			c.C845A						.						75.0	76.0	76.0					19																	3179635		2203	4300	6503	SO:0001583	missense	8698	exon1			TCTGGGCCCAGGA	AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.845C>A	19.37:g.3179635C>A	ENSP00000246115:p.Ala282Asp	93.0	0.0		56.0	31.0	NM_003775	D6W612	Missense_Mutation	SNP	ENST00000246115.3	37	CCDS12105.1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350864	0.61183	.	.	ENSG00000125910	ENST00000246115	T	0.72505	-0.66	4.23	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.122706	0.52532	D	0.000065	T	0.70718	0.3256	L	0.45228	1.405	0.40698	D	0.982457	D	0.57257	0.979	P	0.52343	0.696	T	0.68977	-0.5267	10	0.23302	T	0.38	.	15.1914	0.73047	0.0:1.0:0.0:0.0	.	282	O95977	S1PR4_HUMAN	D	282	ENSP00000246115:A282D	ENSP00000246115:A282D	A	+	2	0	S1PR4	3130635	0.985000	0.35326	0.998000	0.56505	0.624000	0.37722	1.771000	0.38542	1.923000	0.55706	0.462000	0.41574	GCC	.		0.647	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452517.1	NM_003775	
SAMD8	142891	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	76910777	76910777	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr10:76910777G>T	ENST00000542569.1	+	2	594	c.491G>T	c.(490-492)gGa>gTa	p.G164V	SAMD8_ENST00000372690.3_Missense_Mutation_p.G227V|SAMD8_ENST00000372687.4_Missense_Mutation_p.G164V	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	164					ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)	p.G227A(1)|p.G164A(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					ATAGTATTTGGATTTACATCT	0.358																																					p.G164V		.											.	SAMD8	90	2	Substitution - Missense(2)	lung(2)	c.G491T						.						55.0	52.0	53.0					10																	76910777		2203	4300	6503	SO:0001583	missense	142891	exon2			TATTTGGATTTAC	AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.491G>T	10.37:g.76910777G>T	ENSP00000438042:p.Gly164Val	147.0	1.0		111.0	43.0	NM_144660	Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	ENST00000542569.1	37	CCDS53543.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159421	0.57368	.	.	ENSG00000156671	ENST00000447533;ENST00000372690;ENST00000542569;ENST00000372687	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.14830	0.0358	N	0.21448	0.665	0.80722	D	1	D;B	0.55800	0.973;0.332	P;B	0.53593	0.73;0.147	T	0.12708	-1.0537	10	0.11794	T	0.64	-20.8945	19.8333	0.96644	0.0:0.0:1.0:0.0	.	164;164	Q96LT4-2;Q96LT4	.;SAMD8_HUMAN	V	164;227;164;164	ENSP00000391799:G164V;ENSP00000361775:G227V;ENSP00000438042:G164V;ENSP00000361772:G164V	ENSP00000361772:G164V	G	+	2	0	SAMD8	76580783	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	9.869000	0.99810	2.698000	0.92095	0.491000	0.48974	GGA	.		0.358	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_144660	
SDCBP2	27111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1299029	1299029	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr20:1299029T>A	ENST00000360779.3	-	4	331	c.158A>T	c.(157-159)tAt>tTt	p.Y53F	SDCBP2_ENST00000381812.1_Missense_Mutation_p.Y53F|SDCBP2_ENST00000339987.3_Missense_Mutation_p.Y53F	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	53					intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						AAGACCCATATAATTTTCCAG	0.488																																					p.Y53F		.											.	SDCBP2	154	0			c.A158T						.						78.0	79.0	78.0					20																	1299029		1863	4107	5970	SO:0001583	missense	27111	exon4			CCCATATAATTTT	AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.158A>T	20.37:g.1299029T>A	ENSP00000354013:p.Tyr53Phe	66.0	0.0		58.0	20.0	NM_080489	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	ENST00000360779.3	37	CCDS42848.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.226551	0.58668	.	.	ENSG00000125775	ENST00000381812;ENST00000360779;ENST00000339987	T;T;T	0.39406	1.08;1.08;1.08	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000001	T	0.58552	0.2130	M	0.65320	2	0.50313	D	0.999867	D;P	0.89917	1.0;0.568	D;B	0.85130	0.997;0.355	T	0.58634	-0.7602	10	0.45353	T	0.12	-0.8873	10.7034	0.45942	0.0:0.0:0.0:1.0	.	53;53	B4DKI5;Q9H190	.;SDCB2_HUMAN	F	53	ENSP00000371233:Y53F;ENSP00000354013:Y53F;ENSP00000342935:Y53F	ENSP00000342935:Y53F	Y	-	2	0	SDCBP2	1247029	1.000000	0.71417	0.713000	0.30519	0.984000	0.73092	6.295000	0.72744	2.021000	0.59480	0.533000	0.62120	TAT	.		0.488	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077513.2	NM_080489	
SDK2	54549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	71437017	71437017	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr17:71437017G>A	ENST00000392650.3	-	6	659	c.659C>T	c.(658-660)cCa>cTa	p.P220L	SDK2_ENST00000388726.3_Missense_Mutation_p.P220L	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	220	Ig-like C2-type 3.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GTTTTTAGGTGGGATGATGAT	0.602																																					p.P220L		.											.	SDK2	24	0			c.C659T						.						84.0	92.0	90.0					17																	71437017		692	1591	2283	SO:0001583	missense	54549	exon6			TTAGGTGGGATGA	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.659C>T	17.37:g.71437017G>A	ENSP00000376421:p.Pro220Leu	175.0	0.0		217.0	63.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798561	0.90538	.	.	ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.12147	2.71;2.71	4.83	4.83	0.62350	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000002	T	0.25717	0.0626	L	0.48877	1.53	0.80722	D	1	D	0.53151	0.958	P	0.55161	0.77	T	0.00792	-1.1564	10	0.38643	T	0.18	.	17.9911	0.89169	0.0:0.0:1.0:0.0	.	220	Q58EX2	SDK2_HUMAN	L	220	ENSP00000376421:P220L;ENSP00000373378:P220L	ENSP00000324967:P220L	P	-	2	0	SDK2	68948612	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	9.173000	0.94815	2.241000	0.73720	0.556000	0.70494	CCA	.		0.602	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SGSM1	129049	broad.mit.edu;bcgsc.ca	37	22	25246291	25246291	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr22:25246291C>A	ENST00000400359.4	+	5	354	c.347C>A	c.(346-348)cCg>cAg	p.P116Q	SGSM1_ENST00000400358.4_Missense_Mutation_p.P116Q	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	116	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CGGAAGCTGCCGAAGCTGCCC	0.478											OREG0026418	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P116Q		.											.	SGSM1	27	0			c.C347A						.						66.0	66.0	66.0					22																	25246291		1970	4154	6124	SO:0001583	missense	129049	exon5			AGCTGCCGAAGCT	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.347C>A	22.37:g.25246291C>A	ENSP00000383212:p.Pro116Gln	90.0	2.0	777	117.0	36.0	NM_001098497	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	37	CCDS46674.1	.	.	.	.	.	.	.	.	.	.	C	6.912	0.537845	0.13188	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.06371	3.31;3.32	4.83	4.83	0.62350	RUN (2);	0.048418	0.85682	D	0.000000	T	0.09069	0.0224	L	0.41824	1.3	0.49130	D	0.999754	B;B;P;B;P	0.40602	0.273;0.32;0.676;0.404;0.723	B;B;B;B;P	0.47573	0.083;0.136;0.414;0.109;0.55	T	0.37033	-0.9723	10	0.14252	T	0.57	-0.5005	12.0482	0.53491	0.2923:0.7077:0.0:0.0	.	116;91;91;116;91	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1;B9A6J4	.;.;.;SGSM1_HUMAN;.	Q	91;116;116	ENSP00000383211:P116Q;ENSP00000383212:P116Q	ENSP00000383211:P116Q	P	+	2	0	SGSM1	23576291	0.789000	0.28775	0.927000	0.36925	0.413000	0.31143	2.437000	0.44828	2.406000	0.81754	0.585000	0.79938	CCG	.		0.478	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318	
SLC6A2	6530	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	55725913	55725913	+	Silent	SNP	T	T	C	rs567119800		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr16:55725913T>C	ENST00000379906.2	+	5	1122	c.867T>C	c.(865-867)aaT>aaC	p.N289N	SLC6A2_ENST00000414754.3_Silent_p.N289N|SLC6A2_ENST00000566163.1_Intron|SLC6A2_ENST00000567238.1_Silent_p.N184N|SLC6A2_ENST00000219833.8_Silent_p.N289N|SLC6A2_ENST00000568943.1_Silent_p.N289N|SLC6A2_ENST00000561820.1_Silent_p.N289N	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	289					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GAGCCTCCAATGGCATCAATG	0.587																																					p.N289N		.											.	SLC6A2	526	0			c.T867C						.						137.0	95.0	109.0					16																	55725913		2198	4300	6498	SO:0001819	synonymous_variant	6530	exon6			CTCCAATGGCATC		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.867T>C	16.37:g.55725913T>C		152.0	1.0		123.0	52.0	NM_001172501	B2R707|B4DX48|Q96KH8	Silent	SNP	ENST00000379906.2	37	CCDS10754.1																																																																																			.		0.587	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2		
SUCO	51430	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	172571313	172571313	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr1:172571313A>T	ENST00000263688.3	+	21	3347	c.3128A>T	c.(3127-3129)tAt>tTt	p.Y1043F	SUCO_ENST00000610051.1_Missense_Mutation_p.Y672F|SUCO_ENST00000367723.4_Missense_Mutation_p.Y1194F|SUCO_ENST00000608151.1_Missense_Mutation_p.Y1195F	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1043					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											GATGGAGATTATATTTCAAAA	0.313																																					p.Y1043F		.											.	.	.	0			c.A3128T						.						93.0	85.0	88.0					1																	172571313		2201	4300	6501	SO:0001583	missense	51430	exon21			GAGATTATATTTC	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3128A>T	1.37:g.172571313A>T	ENSP00000263688:p.Tyr1043Phe	70.0	0.0		81.0	28.0	NM_014283	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	ENST00000263688.3	37	CCDS1303.1	.	.	.	.	.	.	.	.	.	.	A	16.99	3.274443	0.59649	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.54	5.54	0.83059	.	0.434355	0.24975	N	0.034111	T	0.29976	0.0750	L	0.56769	1.78	0.31651	N	0.646754	B;B;B;B	0.24882	0.113;0.005;0.007;0.001	B;B;B;B	0.19148	0.024;0.007;0.004;0.004	T	0.17715	-1.0360	9	0.16896	T	0.51	-4.0466	14.505	0.67746	1.0:0.0:0.0:0.0	.	672;1043;1195;1043	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	F	1195;1043	.	ENSP00000263688:Y1043F	Y	+	2	0	C1orf9	170837936	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	3.074000	0.50065	2.090000	0.63153	0.528000	0.53228	TAT	.		0.313	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
TAS2R39	259285	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	142881004	142881004	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr7:142881004T>C	ENST00000446620.1	+	1	493	c.493T>C	c.(493-495)Tcc>Ccc	p.S165P		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	165					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					TCTGTGGCTGTCCGTGTTTAT	0.433																																					p.S165P		.											.	TAS2R39	1	0			c.T493C						.						87.0	77.0	80.0					7																	142881004		1967	4159	6126	SO:0001583	missense	259285	exon1			TGGCTGTCCGTGT	AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.493T>C	7.37:g.142881004T>C	ENSP00000405095:p.Ser165Pro	156.0	1.0		191.0	63.0	NM_176881	A4FUI7|Q3ZCN6|Q645W4	Missense_Mutation	SNP	ENST00000446620.1	37	CCDS47729.1	.	.	.	.	.	.	.	.	.	.	T	11.98	1.801221	0.31869	.	.	ENSG00000236398	ENST00000446620	T	0.37235	1.21	4.86	4.86	0.63082	.	.	.	.	.	T	0.57607	0.2065	M	0.79123	2.44	0.09310	N	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.49428	-0.8941	9	0.33940	T	0.23	.	9.4812	0.38902	0.1577:0.0:0.0:0.8423	.	165	P59534	T2R39_HUMAN	P	165	ENSP00000405095:S165P	ENSP00000405095:S165P	S	+	1	0	TAS2R39	142591126	0.809000	0.29036	0.094000	0.20943	0.094000	0.18550	3.390000	0.52523	2.167000	0.68274	0.528000	0.53228	TCC	.		0.433	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327090.2	NM_176881	
THBS3	7059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	155170766	155170766	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr1:155170766delC	ENST00000368378.3	-	13	1490	c.1470delG	c.(1468-1470)gggfs	p.G490fs	THBS3_ENST00000541990.1_Frame_Shift_Del_p.G19fs|THBS3_ENST00000541576.1_5'UTR|RP11-263K19.4_ENST00000430312.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|THBS3_ENST00000457183.2_Frame_Shift_Del_p.G370fs|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	490					bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CATCTTCCTGCCCAGAGTTGG	0.552																																					p.G490fs		.											.	THBS3	222	0			c.1470delG						.						304.0	269.0	281.0					1																	155170766		2203	4300	6503	SO:0001589	frameshift_variant	7059	exon13			TTCCTGCCCAGAG	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.1470delG	1.37:g.155170766delC	ENSP00000357362:p.Gly490fs	242.0	0.0		310.0	107.0	NM_007112	B1AVR8|B4DQ20|Q8WV34	Frame_Shift_Del	DEL	ENST00000368378.3	37	CCDS1099.1																																																																																			.		0.552	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
THBS3	7059	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	155175006	155175006	+	Nonsense_Mutation	SNP	G	G	A	rs552940002		TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr1:155175006G>A	ENST00000368378.3	-	3	408	c.388C>T	c.(388-390)Cga>Tga	p.R130*	THBS3_ENST00000541990.1_5'UTR|RP11-263K19.4_ENST00000430312.1_RNA|THBS3_ENST00000457183.2_Intron|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000422665.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	130	Laminin G-like.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAGGGACCTCGGAGTCGCAGG	0.622																																					p.R130X		.											.	THBS3	222	0			c.C388T						.						108.0	92.0	98.0					1																	155175006		2203	4300	6503	SO:0001587	stop_gained	7059	exon3			GACCTCGGAGTCG	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.388C>T	1.37:g.155175006G>A	ENSP00000357362:p.Arg130*	176.0	0.0		146.0	59.0	NM_007112	B1AVR8|B4DQ20|Q8WV34	Nonsense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.481439	0.44147	.	.	ENSG00000169231	ENST00000368378	.	.	.	4.85	4.85	0.62838	.	0.070640	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-6.8032	10.8234	0.46619	0.0:0.0:0.8114:0.1886	.	.	.	.	X	130	.	ENSP00000357362:R130X	R	-	1	2	THBS3	153441630	1.000000	0.71417	0.999000	0.59377	0.538000	0.34931	1.809000	0.38922	2.679000	0.91253	0.579000	0.79373	CGA	.		0.622	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
TLX3	30012	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	170736726	170736726	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr5:170736726C>A	ENST00000296921.5	+	1	439	c.357C>A	c.(355-357)agC>agA	p.S119R		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	119					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CGGTCTCCAGCCTTGGCGGTC	0.706			T	BCL11B	T-ALL																																p.S119R	Esophageal Squamous(33;43 807 3116 3348 30094)	.		Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	.	TLX3	658	0			c.C357A						.						14.0	17.0	16.0					5																	170736726		2181	4258	6439	SO:0001583	missense	30012	exon1			CTCCAGCCTTGGC	AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.357C>A	5.37:g.170736726C>A	ENSP00000296921:p.Ser119Arg	61.0	0.0		32.0	10.0	NM_021025	Q96AD3	Missense_Mutation	SNP	ENST00000296921.5	37	CCDS34288.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.448559	0.26074	.	.	ENSG00000164438	ENST00000296921	D	0.91407	-2.84	4.16	3.28	0.37604	.	0.057883	0.64402	D	0.000001	D	0.85440	0.5697	L	0.29908	0.895	0.35207	D	0.774832	B	0.30584	0.286	B	0.40199	0.322	T	0.81435	-0.0934	10	0.13108	T	0.6	.	11.1602	0.48512	0.0:0.9065:0.0:0.0935	.	119	O43711	TLX3_HUMAN	R	119	ENSP00000296921:S119R	ENSP00000296921:S119R	S	+	3	2	TLX3	170669331	0.278000	0.24230	1.000000	0.80357	0.360000	0.29518	0.101000	0.15251	0.950000	0.37743	0.555000	0.69702	AGC	.		0.706	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372076.3		
TMEM5	10329	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	64196151	64196151	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr12:64196151G>A	ENST00000261234.6	+	4	867	c.709G>A	c.(709-711)Gtg>Atg	p.V237M	TMEM5_ENST00000537373.1_5'UTR	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	237						integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		GATTAATGACGTGGATGTTTT	0.388																																					p.V237M		.											.	TMEM5	90	0			c.G709A						.						82.0	80.0	81.0					12																	64196151		2203	4300	6503	SO:0001583	missense	10329	exon4			AATGACGTGGATG	AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.709G>A	12.37:g.64196151G>A	ENSP00000261234:p.Val237Met	76.0	1.0		91.0	24.0	NM_014254	A8K017|Q6PKD6	Missense_Mutation	SNP	ENST00000261234.6	37	CCDS8966.1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.678125	0.29783	.	.	ENSG00000118600	ENST00000261234	.	.	.	4.93	1.52	0.23074	.	0.400549	0.28895	N	0.013783	T	0.28101	0.0693	N	0.12182	0.205	0.80722	D	1	B	0.18968	0.032	B	0.11329	0.006	T	0.04281	-1.0963	8	.	.	.	-7.3711	8.2173	0.31519	0.112:0.1249:0.763:0.0	.	237	Q9Y2B1	TMEM5_HUMAN	M	237	.	.	V	+	1	0	TMEM5	62482418	1.000000	0.71417	0.237000	0.24090	0.841000	0.47740	3.244000	0.51399	0.595000	0.29777	0.591000	0.81541	GTG	.		0.388	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1	NM_014254	
TNRC18	84629	hgsc.bcm.edu;bcgsc.ca	37	7	5353127	5353127	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr7:5353127G>T	ENST00000430969.1	-	27	7743	c.7395C>A	c.(7393-7395)gaC>gaA	p.D2465E	TNRC18_ENST00000399537.4_Missense_Mutation_p.D2465E	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2465							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CACCCTCGTGGTCCAGTTTGA	0.692																																					p.D2465E		.											.	TNRC18	46	0			c.C7395A						.						27.0	25.0	26.0					7																	5353127		1568	3582	5150	SO:0001583	missense	84629	exon27			CTCGTGGTCCAGT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7395C>A	7.37:g.5353127G>T	ENSP00000395538:p.Asp2465Glu	92.0	0.0		69.0	4.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	21.6|21.6	4.178561|4.178561	0.78564|0.78564	.|.	.|.	ENSG00000182095|ENSG00000182095	ENST00000399537;ENST00000430969|ENST00000328270	T;T|.	0.54071|.	0.59;0.62|.	5.01|5.01	4.12|4.12	0.48240|0.48240	.|.	0.000000|.	0.40469|.	N|.	0.001096|.	T|T	0.64768|0.64768	0.2628|0.2628	M|M	0.71206|0.71206	2.165|2.165	0.37810|0.37810	D|D	0.928025|0.928025	D|.	0.76494|.	0.999|.	D|.	0.63192|.	0.912|.	T|T	0.67273|0.67273	-0.5712|-0.5712	10|5	0.62326|.	D|.	0.03|.	.|.	9.361|9.361	0.38195|0.38195	0.1638:0.0:0.8362:0.0|0.1638:0.0:0.8362:0.0	.|.	2465|.	O15417|.	TNC18_HUMAN|.	E|T	2465|279	ENSP00000382452:D2465E;ENSP00000395538:D2465E|.	ENSP00000382452:D2465E|.	D|P	-|-	3|1	2|0	TNRC18|TNRC18	5319653|5319653	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.955000|0.955000	0.61496|0.61496	3.819000|3.819000	0.55686|0.55686	1.095000|1.095000	0.41419|0.41419	0.561000|0.561000	0.74099|0.74099	GAC|CCA	.		0.692	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TRPC7	57113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	135692416	135692416	+	Silent	SNP	G	G	A			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr5:135692416G>A	ENST00000513104.1	-	2	942	c.660C>T	c.(658-660)aaC>aaT	p.N220N	TRPC7_ENST00000355180.3_Silent_p.N220N|TRPC7_ENST00000426057.2_Silent_p.N220N	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	220					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.N220N(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTTGTAGGCGTTCATGCGCG	0.607																																					p.N220N		.											.	.	.	2	Substitution - coding silent(2)	NS(2)	c.C660T						.						50.0	57.0	55.0					5																	135692416		2143	4255	6398	SO:0001819	synonymous_variant	57113	exon2			GTAGGCGTTCATG	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.660C>T	5.37:g.135692416G>A		235.0	1.0		238.0	103.0	NM_001167576	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Silent	SNP	ENST00000513104.1	37	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	G	8.513	0.866919	0.17250	.	.	ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753	.	.	.	5.26	-9.63	0.00544	.	.	.	.	.	T	0.60919	0.2306	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70842	-0.4762	4	.	.	.	-22.007	15.4967	0.75658	0.434:0.0:0.566:0.0	.	.	.	.	C	220	.	.	R	-	1	0	TRPC7	135720315	0.372000	0.25064	0.657000	0.29651	0.994000	0.84299	-0.116000	0.10724	-2.153000	0.00793	-0.157000	0.13467	CGC	.		0.607	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
TRPM2	7226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45810827	45810827	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr21:45810827C>G	ENST00000397928.1	+	10	1804	c.1359C>G	c.(1357-1359)gaC>gaG	p.D453E	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Missense_Mutation_p.D453E|TRPM2_ENST00000300481.9_Missense_Mutation_p.D453E|TRPM2_ENST00000300482.5_Missense_Mutation_p.D453E	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	453					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						AGAACTGGGACCACCAGCTGA	0.557																																					p.D453E		.											.	TRPM2	92	0			c.C1359G						.						155.0	136.0	142.0					21																	45810827		2203	4300	6503	SO:0001583	missense	7226	exon10			CTGGGACCACCAG	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1359C>G	21.37:g.45810827C>G	ENSP00000381023:p.Asp453Glu	106.0	0.0		132.0	53.0	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.635726	0.29068	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	4.6	3.71	0.42584	.	0.118260	0.64402	D	0.000016	T	0.62270	0.2414	L	0.49699	1.58	0.42064	D	0.991179	B;B	0.15719	0.014;0.007	B;B	0.16289	0.015;0.009	T	0.58901	-0.7554	10	0.40728	T	0.16	-43.3468	9.7382	0.40401	0.0:0.8375:0.0:0.1625	.	453;453	E9PGK7;O94759	.;TRPM2_HUMAN	E	453	ENSP00000300482:D453E;ENSP00000381023:D453E;ENSP00000300481:D453E;ENSP00000381026:D453E	ENSP00000300481:D453E	D	+	3	2	TRPM2	44635255	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.682000	0.25335	1.047000	0.40274	0.655000	0.94253	GAC	.		0.557	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
USP38	84640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	144134995	144134995	+	Silent	SNP	T	T	C			TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr4:144134995T>C	ENST00000307017.4	+	9	2372	c.1866T>C	c.(1864-1866)ccT>ccC	p.P622P	USP38_ENST00000510377.1_Silent_p.P622P	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	622	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CCTTTTGTCCTTCCTCTTCTT	0.448																																					p.P622P		.											.	USP38	660	0			c.T1866C						.						116.0	118.0	117.0					4																	144134995		2203	4299	6502	SO:0001819	synonymous_variant	84640	exon9			TTGTCCTTCCTCT	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.1866T>C	4.37:g.144134995T>C		103.0	0.0		144.0	57.0	NM_032557	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Silent	SNP	ENST00000307017.4	37	CCDS3758.1																																																																																			.		0.448	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
ZNF804B	219578	bcgsc.ca;mdanderson.org	37	7	88965873	88965873	+	Missense_Mutation	SNP	T	T	A	rs147794726	byFrequency	TCGA-DD-A4NA-01A-11D-A25V-10	TCGA-DD-A4NA-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_1	WXS	none	.		Illumina HiSeq	5ead73fe-1c34-48ed-b20d-89fc3c82dbd6	85fa6efb-2977-466f-b260-4e95585f2e37	g.chr7:88965873T>A	ENST00000333190.4	+	4	4186	c.3577T>A	c.(3577-3579)Tca>Aca	p.S1193T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1193							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CTCTCCGGCCTCAACCGTACA	0.507										HNSCC(36;0.09)																											p.S1193T		.											.	ZNF804B	101	0			c.T3577A						.						127.0	106.0	113.0					7																	88965873		2203	4300	6503	SO:0001583	missense	219578	exon4			CCGGCCTCAACCG	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3577T>A	7.37:g.88965873T>A	ENSP00000329638:p.Ser1193Thr	250.0	2.0		359.0	21.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	T	1.253	-0.617918	0.03663	.	.	ENSG00000182348	ENST00000333190	T	0.04551	3.6	4.98	2.48	0.30137	.	0.368513	0.23558	N	0.046891	T	0.03783	0.0107	L	0.33485	1.01	0.09310	N	1	P	0.48764	0.915	P	0.45071	0.468	T	0.35351	-0.9792	10	0.31617	T	0.26	-5.0829	0.4054	0.00432	0.1796:0.2228:0.187:0.4106	.	1193	A4D1E1	Z804B_HUMAN	T	1193	ENSP00000329638:S1193T	ENSP00000329638:S1193T	S	+	1	0	ZNF804B	88803809	0.925000	0.31364	0.031000	0.17742	0.027000	0.11550	1.500000	0.35682	1.032000	0.39892	0.533000	0.62120	TCA	T|0.989;C|0.011		0.507	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
