#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACAT1	38	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108010844	108010844	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr11:108010844A>G	ENST00000265838.4	+	7	723	c.632A>G	c.(631-633)cAg>cGg	p.Q211R		NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	211					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	CGAAATGAACAGGACGCTTAT	0.348																																					p.Q211R		.											.	ACAT1	93	0			c.A632G						.						67.0	70.0	69.0					11																	108010844		2201	4298	6499	SO:0001583	missense	38	exon7			ATGAACAGGACGC	D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.632A>G	11.37:g.108010844A>G	ENSP00000265838:p.Gln211Arg	127.0	0.0		104.0	22.0	NM_000019	B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	ENST00000265838.4	37	CCDS8339.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.552267	0.86127	.	.	ENSG00000075239	ENST00000265838	D	0.94000	-3.33	5.99	5.99	0.97316	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	H	0.98218	4.175	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.99612	1.0981	10	0.87932	D	0	-26.3074	16.4943	0.84223	1.0:0.0:0.0:0.0	.	211	P24752	THIL_HUMAN	R	211	ENSP00000265838:Q211R	ENSP00000265838:Q211R	Q	+	2	0	ACAT1	107516054	1.000000	0.71417	1.000000	0.80357	0.628000	0.37860	8.923000	0.92808	2.291000	0.77112	0.533000	0.62120	CAG	.		0.348	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389474.1	NM_000019	
ARHGAP25	9938	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	69049534	69049534	+	Silent	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr2:69049534C>T	ENST00000295381.3	+	10	1679	c.1260C>T	c.(1258-1260)gaC>gaT	p.D420D	ARHGAP25_ENST00000479844.1_Silent_p.D114D|ARHGAP25_ENST00000409202.3_Silent_p.D421D|ARHGAP25_ENST00000467265.1_Silent_p.D381D|ARHGAP25_ENST00000409030.3_Silent_p.D413D|ARHGAP25_ENST00000409220.1_Silent_p.D414D	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	420					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						TTCCGGAGGACAGCAGCAAAG	0.498																																					p.D421D		.											.	ARHGAP25	274	0			c.C1263T						.						103.0	109.0	107.0					2																	69049534		2203	4300	6503	SO:0001819	synonymous_variant	9938	exon10			GGAGGACAGCAGC	D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1260C>T	2.37:g.69049534C>T		104.0	0.0		108.0	9.0	NM_001007231	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Silent	SNP	ENST00000295381.3	37		.	.	.	.	.	.	.	.	.	.	C	9.663	1.144592	0.21288	.	.	ENSG00000163219	ENST00000497259	.	.	.	5.17	-9.02	0.00741	.	.	.	.	.	T	0.17152	0.0412	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.20739	-1.0266	4	.	.	.	.	4.1065	0.10038	0.0785:0.2033:0.3431:0.3751	.	.	.	.	I	280	.	.	T	+	2	0	ARHGAP25	68903038	0.000000	0.05858	0.000000	0.03702	0.479000	0.33129	-1.819000	0.01716	-1.394000	0.02077	0.557000	0.71058	ACA	.		0.498	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882	
ARHGAP6	395	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	11162339	11162339	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chrX:11162339G>A	ENST00000337414.4	-	11	2809	c.1937C>T	c.(1936-1938)tCc>tTc	p.S646F	ARHGAP6_ENST00000413512.3_3'UTR|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.S471F|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.S646F|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.S443F|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.S443F	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	646					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CACGGAAAAGGAAACTTCCGA	0.498											OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S646F		.											.	ARHGAP6	227	0			c.C1937T						.						70.0	72.0	71.0					X																	11162339		2203	4300	6503	SO:0001583	missense	395	exon11			GAAAAGGAAACTT	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1937C>T	X.37:g.11162339G>A	ENSP00000338967:p.Ser646Phe	99.0	1.0	670	71.0	15.0	NM_006125	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	37	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743250	0.89663	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718	T;T;T;T;T;T	0.25414	1.81;1.84;1.84;1.83;1.8;1.81	5.51	5.51	0.81932	.	0.000000	0.52532	D	0.000080	T	0.49389	0.1554	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.71674	0.969;0.989;0.998;0.997	B;P;P;D	0.62955	0.438;0.769;0.898;0.909	T	0.51084	-0.8750	10	0.72032	D	0.01	.	18.5701	0.91132	0.0:0.0:1.0:0.0	.	443;646;646;646	O43182-5;O43182-2;O43182;A8KAL3	.;.;RHG06_HUMAN;.	F	471;443;443;646;482;646	ENSP00000438135:S471F;ENSP00000370112:S443F;ENSP00000302312:S443F;ENSP00000338967:S646F;ENSP00000370093:S482F;ENSP00000370094:S646F	ENSP00000302312:S443F	S	-	2	0	ARHGAP6	11072260	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.705000	0.91357	2.329000	0.79093	0.506000	0.49869	TCC	.		0.498	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
CDK12	51755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	37619175	37619175	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr17:37619175C>T	ENST00000447079.4	+	1	884	c.851C>T	c.(850-852)gCc>gTc	p.A284V	CDK12_ENST00000430627.2_Missense_Mutation_p.A284V	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	284					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GAGCCTTCGGCCTACCAGTCC	0.552			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																											p.A284V		.		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	.	CDK12	1055	0			c.C851T						.						59.0	61.0	60.0					17																	37619175		2203	4300	6503	SO:0001583	missense	51755	exon1			CTTCGGCCTACCA	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.851C>T	17.37:g.37619175C>T	ENSP00000398880:p.Ala284Val	105.0	0.0		114.0	15.0	NM_016507	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	ENST00000447079.4	37	CCDS11337.1	.	.	.	.	.	.	.	.	.	.	C	19.41	3.822495	0.71028	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.46063	0.88;1.53	5.3	5.3	0.74995	.	0.000000	0.46145	D	0.000304	T	0.54549	0.1865	L	0.36672	1.1	0.42644	D	0.993424	D;D;D	0.69078	0.995;0.997;0.991	D;D;D	0.70716	0.952;0.97;0.964	T	0.56306	-0.8001	10	0.59425	D	0.04	-8.0147	16.0239	0.80528	0.0:0.8659:0.1341:0.0	.	284;284;284	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	V	284	ENSP00000407720:A284V;ENSP00000398880:A284V	ENSP00000407720:A284V	A	+	2	0	CDK12	34872701	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	2.674000	0.46867	2.490000	0.84030	0.655000	0.94253	GCC	.		0.552	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256941.4	NM_016507	
CELSR2	1952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109794691	109794691	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr1:109794691G>A	ENST00000271332.3	+	1	2051	c.1990G>A	c.(1990-1992)Ggt>Agt	p.G664S		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	664	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCAAAGTGGTGGTGGGCTGGT	0.567																																					p.G664S	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2	526	0			c.G1990A						.						131.0	124.0	127.0					1																	109794691		2203	4300	6503	SO:0001583	missense	1952	exon1			AGTGGTGGTGGGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.1990G>A	1.37:g.109794691G>A	ENSP00000271332:p.Gly664Ser	374.0	0.0		322.0	63.0	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	11.12	1.545429	0.27652	.	.	ENSG00000143126	ENST00000271332	T	0.04317	3.65	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02533	0.0077	N	0.01874	-0.695	0.58432	D	0.999998	D	0.65815	0.995	D	0.67382	0.951	T	0.61691	-0.7011	9	0.09084	T	0.74	.	18.4313	0.90627	0.0:0.0:1.0:0.0	.	664	Q9HCU4	CELR2_HUMAN	S	664	ENSP00000271332:G664S	ENSP00000271332:G664S	G	+	1	0	CELSR2	109596214	1.000000	0.71417	0.842000	0.33263	0.992000	0.81027	7.393000	0.79851	2.600000	0.87896	0.650000	0.86243	GGT	.		0.567	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CHST13	166012	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	126255177	126255182	+	In_Frame_Del	DEL	AGCTCT	AGCTCT	-	rs562208555	byFrequency	TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	AGCTCT	AGCTCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr3:126255177_126255182delAGCTCT	ENST00000319340.2	+	2	211_216	c.161_166delAGCTCT	c.(160-168)aagctctat>aat	p.54_56KLY>N		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	54					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		CCCCTGCAGAAGCTCTATGACCTGGA	0.592																																					p.54_56del		.											.	CHST13	90	0			c.161_166del						.																																			SO:0001651	inframe_deletion	166012	exon2			TGCAGAAGCTCTA	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.161_166delAGCTCT	3.37:g.126255177_126255182delAGCTCT	ENSP00000317404:p.Lys54_Tyr56delinsAsn	159.0	0.0		159.0	17.0	NM_152889	Q3SYA3|Q3SYA5	In_Frame_Del	DEL	ENST00000319340.2	37	CCDS3039.1																																																																																			.		0.592	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889	
CSAD	51380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53553482	53553482	+	Silent	SNP	A	A	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr12:53553482A>G	ENST00000444623.1	-	16	1500	c.1233T>C	c.(1231-1233)aaT>aaC	p.N411N	CSAD_ENST00000267085.4_Silent_p.N438N|CSAD_ENST00000379846.1_Silent_p.N264N|CSAD_ENST00000379843.3_Silent_p.N264N|RP11-1136G11.8_ENST00000550908.1_lincRNA|CSAD_ENST00000453446.2_Silent_p.N411N	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	411					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	AGAAACACACATTGACAAACT	0.557											OREG0021859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N438N	Ovarian(109;252 1546 16882 28524 44645)	.											.	CSAD	91	0			c.T1314C						.						103.0	88.0	93.0					12																	53553482		2203	4300	6503	SO:0001819	synonymous_variant	51380	exon16			ACACACATTGACA	AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1233T>C	12.37:g.53553482A>G		96.0	0.0	993	130.0	41.0	NM_015989	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Silent	SNP	ENST00000444623.1	37	CCDS58235.1	.	.	.	.	.	.	.	.	.	.	A	9.792	1.178061	0.21787	.	.	ENSG00000139631	ENST00000379850	.	.	.	4.67	-1.42	0.08913	.	.	.	.	.	T	0.55705	0.1937	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51748	-0.8666	4	.	.	.	-29.7639	10.1078	0.42544	0.5876:0.0:0.4124:0.0	.	.	.	.	R	437	.	.	C	-	1	0	CSAD	51839749	0.283000	0.24277	0.995000	0.50966	0.959000	0.62525	-0.344000	0.07780	-0.163000	0.10946	-0.366000	0.07423	TGT	.		0.557	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343697.1	NM_015989	
DCLK1	9201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36428640	36428640	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr13:36428640T>G	ENST00000360631.3	-	6	1242	c.1031A>C	c.(1030-1032)cAg>cCg	p.Q344P	DCLK1_ENST00000255448.4_Missense_Mutation_p.Q344P|DCLK1_ENST00000460982.1_5'UTR|DCLK1_ENST00000379892.4_Missense_Mutation_p.Q344P|DCLK1_ENST00000379893.1_Missense_Mutation_p.Q37P			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	344					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CCTTACCCTCTGCTTCCGCAG	0.552																																					p.Q344P		.											.	DCLK1	826	0			c.A1031C						.						122.0	100.0	107.0					13																	36428640		2203	4300	6503	SO:0001583	missense	9201	exon6			ACCCTCTGCTTCC	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1031A>C	13.37:g.36428640T>G	ENSP00000353846:p.Gln344Pro	124.0	0.0		144.0	30.0	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	37		.	.	.	.	.	.	.	.	.	.	T	13.57	2.277968	0.40294	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451;ENST00000379892	T;T;T;T	0.68181	-0.27;-0.26;-0.31;1.89	5.67	5.67	0.87782	.	0.090520	0.48286	D	0.000195	T	0.59321	0.2185	L	0.34521	1.04	0.48087	D	0.999589	B;P;B	0.37423	0.439;0.594;0.439	B;B;B	0.39660	0.306;0.225;0.306	T	0.57376	-0.7822	10	0.27082	T	0.32	.	15.9173	0.79531	0.0:0.0:0.0:1.0	.	37;344;37	O15075-4;O15075-2;O15075-3	.;.;.	P	36;344;344;37;344;344	ENSP00000255448:Q344P;ENSP00000353846:Q344P;ENSP00000369223:Q37P;ENSP00000369222:Q344P	ENSP00000255448:Q344P	Q	-	2	0	DCLK1	35326640	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.035000	0.64158	2.170000	0.68504	0.533000	0.62120	CAG	.		0.552	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
DNHD1	144132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6588587	6588587	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr11:6588587T>A	ENST00000527990.2	+	34	11848	c.11848T>A	c.(11848-11850)Tca>Aca	p.S3950T	DNHD1_ENST00000254579.6_Missense_Mutation_p.S3950T			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3950					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		AGGGAAAGCATCAGAGCTGGA	0.612																																					p.S3950T		.											.	DNHD1	24	0			c.T11848A						.						48.0	56.0	53.0					11																	6588587		2073	4198	6271	SO:0001583	missense	144132	exon36			AAAGCATCAGAGC	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.11848T>A	11.37:g.6588587T>A	ENSP00000436180:p.Ser3950Thr	132.0	0.0		142.0	25.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	T	8.284	0.816116	0.16607	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000525883;ENST00000530197	T;T	0.26373	1.74;1.74	4.54	0.767	0.18482	.	0.274240	0.28841	N	0.013968	T	0.10121	0.0248	N	0.14661	0.345	0.21861	N	0.999506	B;B;B;B	0.09022	0.0;0.002;0.0;0.001	B;B;B;B	0.06405	0.001;0.002;0.001;0.002	T	0.30995	-0.9959	10	0.11182	T	0.66	-0.9633	3.8379	0.08902	0.1658:0.5054:0.0:0.3287	.	3038;218;3;3950	B0I1S4;D3DQT9;Q9NSW8;Q96M86	.;.;.;DNHD1_HUMAN	T	3950;3950;218;218	ENSP00000254579:S3950T;ENSP00000436180:S3950T	ENSP00000254579:S3950T	S	+	1	0	DNHD1	6545163	0.903000	0.30736	0.774000	0.31636	0.874000	0.50279	0.007000	0.13174	-0.055000	0.13244	0.459000	0.35465	TCA	.		0.612	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
DOPEY2	9980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	37618218	37618218	+	Silent	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr21:37618218C>T	ENST00000399151.3	+	19	4025	c.3940C>T	c.(3940-3942)Ctg>Ttg	p.L1314L		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1314					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCTCCTGGAGCTGCTCACCTA	0.607																																					p.L1314L		.											.	DOPEY2	91	0			c.C3940T						.						112.0	112.0	112.0					21																	37618218		2203	4300	6503	SO:0001819	synonymous_variant	9980	exon19			CTGGAGCTGCTCA	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3940C>T	21.37:g.37618218C>T		101.0	0.0		117.0	28.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	37	CCDS13643.1																																																																																			.		0.607	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
DSC2	1824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	28650775	28650775	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr18:28650775T>A	ENST00000280904.6	-	14	2610	c.2167A>T	c.(2167-2169)Aaa>Taa	p.K723*	snoU13_ENST00000459603.1_RNA|DSC2_ENST00000251081.6_Nonsense_Mutation_p.K723*	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	723					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TTTGGTTGTTTAGACGTCCCA	0.388																																					p.K723X		.											.	DSC2	517	0			c.A2167T						.						117.0	119.0	118.0					18																	28650775		2203	4300	6503	SO:0001587	stop_gained	1824	exon14			GTTGTTTAGACGT	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2167A>T	18.37:g.28650775T>A	ENSP00000280904:p.Lys723*	93.0	0.0		80.0	13.0	NM_024422		Nonsense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	T	32	5.157194	0.94686	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	.	.	.	6.08	2.21	0.28008	.	0.491568	0.15119	N	0.279484	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.3855	0.16216	0.0:0.1725:0.2733:0.5542	.	.	.	.	X	723;723;489;736	.	ENSP00000251081:K723X	K	-	1	0	DSC2	26904773	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.283000	0.18846	0.528000	0.28580	-0.435000	0.05868	AAA	.		0.388	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
FOXD2	2306	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	47904363	47904363	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr1:47904363G>C	ENST00000334793.5	+	1	2675	c.556G>C	c.(556-558)Gtc>Ctc	p.V186L		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	186					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		CGACTGCTTCGTCAAGATCCC	0.642																																					p.V186L		.											.	FOXD2	226	0			c.G556C						.						69.0	84.0	79.0					1																	47904363		2203	4300	6503	SO:0001583	missense	2306	exon1			TGCTTCGTCAAGA	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.556G>C	1.37:g.47904363G>C	ENSP00000335493:p.Val186Leu	191.0	0.0		268.0	45.0	NM_004474	Q5SVZ3	Missense_Mutation	SNP	ENST00000334793.5	37	CCDS30708.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248075	0.80024	.	.	ENSG00000186564	ENST00000334793	D	0.95656	-3.77	4.2	4.2	0.49525	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.063541	0.64402	U	0.000008	D	0.96929	0.8997	M	0.81497	2.545	0.80722	D	1	P	0.38582	0.638	P	0.52217	0.693	D	0.97614	1.0131	10	0.59425	D	0.04	.	15.3129	0.74048	0.0:0.0:1.0:0.0	.	186	O60548	FOXD2_HUMAN	L	186	ENSP00000335493:V186L	ENSP00000335493:V186L	V	+	1	0	FOXD2	47676950	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	9.101000	0.94219	1.866000	0.54105	0.436000	0.28706	GTC	.		0.642	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021831.1	NM_004474	
FOXRED2	80020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	36902221	36902221	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr22:36902221C>G	ENST00000397224.4	-	2	342	c.249G>C	c.(247-249)aaG>aaC	p.K83N	FOXRED2_ENST00000216187.6_Missense_Mutation_p.K83N|FOXRED2_ENST00000397223.4_Missense_Mutation_p.K83N	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	83					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CCGTGTACCGCTTGTTGATGC	0.652																																					p.K83N		.											.	FOXRED2	92	0			c.G249C						.						123.0	87.0	99.0					22																	36902221		2203	4300	6503	SO:0001583	missense	80020	exon2			GTACCGCTTGTTG	BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.249G>C	22.37:g.36902221C>G	ENSP00000380401:p.Lys83Asn	95.0	0.0		119.0	33.0	NM_001102371	B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	ENST00000397224.4	37	CCDS13929.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644565	0.87859	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000397223;ENST00000423980	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	5.04	5.04	0.67666	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.56171	0.1967	M	0.90705	3.14	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	T	0.64279	-0.6445	10	0.87932	D	0	-34.3659	11.1032	0.48188	0.0:0.9142:0.0:0.0858	.	83	Q8IWF2	FXRD2_HUMAN	N	83	ENSP00000380401:K83N;ENSP00000216187:K83N;ENSP00000380400:K83N;ENSP00000409692:K83N	ENSP00000216187:K83N	K	-	3	2	FOXRED2	35232167	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.007000	0.40883	2.337000	0.79520	0.561000	0.74099	AAG	.		0.652	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104098.2	NM_024955	
G6PC2	57818	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	169757874	169757874	+	Silent	SNP	A	A	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr2:169757874A>C	ENST00000375363.3	+	1	125	c.33A>C	c.(31-33)atA>atC	p.I11I	SPC25_ENST00000472216.2_Intron|G6PC2_ENST00000429379.2_Silent_p.I11I|G6PC2_ENST00000421979.1_Silent_p.I11I	NM_021176.2	NP_066999.1	Q9NQR9	G6PC2_HUMAN	glucose-6-phosphatase, catalytic, 2	11					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)			breast(1)|endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	13						GAGTGCTCATAATTCAGCATT	0.383																																					p.I11I		.											.	G6PC2	91	0			c.A33C						.						122.0	120.0	121.0					2																	169757874		2203	4300	6503	SO:0001819	synonymous_variant	57818	exon1			GCTCATAATTCAG	AF283575	CCDS2230.1, CCDS46443.1	2q24-q31	2008-02-05			ENSG00000152254	ENSG00000152254			28906	protein-coding gene	gene with protein product	"""islet specific glucose 6 phosphatase catalytic subunit related protein"""	608058				10078553, 10078554	Standard	NM_021176		Approved	IGRP	uc002uem.3	Q9NQR9	OTTHUMG00000132182	ENST00000375363.3:c.33A>C	2.37:g.169757874A>C		80.0	0.0		94.0	21.0	NM_021176	E9PAX2|Q6AHZ0	Silent	SNP	ENST00000375363.3	37	CCDS2230.1																																																																																			.		0.383	G6PC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255234.2	NM_021176	
GBAS	2631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	56049254	56049254	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr7:56049254C>T	ENST00000322090.3	+	4	396	c.367C>T	c.(367-369)Caa>Taa	p.Q123*	GBAS_ENST00000446778.1_Silent_p.T107T	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	123					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CGAGCAGGACCAAGCTGGTAG	0.398																																					p.Q123X		.											.	GBAS	514	0			c.C367T						.						153.0	141.0	145.0					7																	56049254		2203	4300	6503	SO:0001587	stop_gained	2631	exon4			CAGGACCAAGCTG	AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.367C>T	7.37:g.56049254C>T	ENSP00000313050:p.Gln123*	144.0	0.0		184.0	64.0	NM_001483	C9IYJ3|O43801|Q53X96	Nonsense_Mutation	SNP	ENST00000322090.3	37	CCDS5521.1	.	.	.	.	.	.	.	.	.	.	C	30	5.057879	0.93846	.	.	ENSG00000146729	ENST00000322090	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-9.5334	19.0063	0.92852	0.0:1.0:0.0:0.0	.	.	.	.	X	123	.	ENSP00000313050:Q123X	Q	+	1	0	GBAS	56016748	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	7.478000	0.81082	2.809000	0.96659	0.467000	0.42956	CAA	.		0.398	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251524.1	NM_001483	
GLDC	2731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	6558589	6558589	+	Silent	SNP	C	C	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr9:6558589C>A	ENST00000321612.6	-	17	2172	c.2022G>T	c.(2020-2022)ggG>ggT	p.G674G	GLDC_ENST00000460457.1_5'UTR	NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	674					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	CATCGATATTCCCATATTTAT	0.527																																					p.G674G		.											.	GLDC	92	0			c.G2022T						.						218.0	193.0	202.0					9																	6558589		2203	4300	6503	SO:0001819	synonymous_variant	2731	exon17			GATATTCCCATAT	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2022G>T	9.37:g.6558589C>A		137.0	0.0		132.0	25.0	NM_000170	Q2M2F8	Silent	SNP	ENST00000321612.6	37	CCDS34987.1																																																																																			.		0.527	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
RHOA	387	broad.mit.edu;bcgsc.ca	37	3	49395482	49395482	+	IGR	SNP	G	G	C	rs201944086	byFrequency	TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr3:49395482G>C	ENST00000418115.1	-	0	2031				GPX1_ENST00000419783.1_Missense_Mutation_p.P77R|GPX1_ENST00000496791.1_5'UTR|GPX1_ENST00000419349.1_Missense_Mutation_p.P77R	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CTGGTTGCACGGGAAGCCGAG	0.726																																					.		.											.	GPX1	68	0			.						.						11.0	14.0	13.0					3																	49395482		1848	4061	5909	SO:0001628	intergenic_variant	2876	.			TTGCACGGGAAGC	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395482G>C		21.0	0.0		19.0	7.0	.	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	G	36	5.745728	0.96882	.	.	ENSG00000233276	ENST00000419783;ENST00000419349	T;T	0.25085	1.82;1.82	5.88	5.88	0.94601	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.63070	0.2480	M	0.93150	3.385	0.80722	D	1	D;D	0.71674	0.998;0.988	D;P	0.68483	0.958;0.891	T	0.72279	-0.4340	10	0.87932	D	0	.	18.8152	0.92075	0.0:0.0:1.0:0.0	.	77;77	E9PAS1;P07203	.;GPX1_HUMAN	R	77	ENSP00000407375:P77R;ENSP00000391316:P77R	ENSP00000391316:P77R	P	-	2	0	GPX1	49370486	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.875000	0.87205	2.788000	0.95919	0.555000	0.69702	CCG	G|0.333;C|0.667		0.726	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
GPR171	29909	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	150916346	150916346	+	Silent	SNP	C	C	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr3:150916346C>A	ENST00000309180.5	-	3	1058	c.828G>T	c.(826-828)tcG>tcT	p.S276S	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_013308.3	NP_037440.3	O14626	GP171_HUMAN	G protein-coupled receptor 171	276					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(4)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	15			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGCACAGGTTCGACACAGCCA	0.478																																					p.S276S		.											.	GPR171	90	0			c.G828T						.						87.0	86.0	87.0					3																	150916346		2203	4300	6503	SO:0001819	synonymous_variant	29909	exon3			CAGGTTCGACACA	AF002986	CCDS3155.1	3q25.1	2012-08-21			ENSG00000174946	ENSG00000174946		"""GPCR / Class A : Orphans"""	30057	protein-coding gene	gene with protein product	"""platelet activating receptor homolog"""					9370294	Standard	NM_013308		Approved	H963	uc003eyq.4	O14626	OTTHUMG00000159861	ENST00000309180.5:c.828G>T	3.37:g.150916346C>A		158.0	1.0		173.0	22.0	NM_013308	D3DNJ4|Q8IV06	Silent	SNP	ENST00000309180.5	37	CCDS3155.1																																																																																			.		0.478	GPR171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357793.1	NM_013308	
GSE1	23199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	85697087	85697087	+	Silent	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr16:85697087G>A	ENST00000253458.7	+	11	2687	c.2511G>A	c.(2509-2511)caG>caA	p.Q837Q	GSE1_ENST00000405402.2_Silent_p.Q733Q|GSE1_ENST00000393243.1_Silent_p.Q764Q	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	837																	GCAAGCGGCAGACGCCTTCAC	0.562																																					p.Q837Q		.											.	.	.	0			c.G2511A						.						82.0	82.0	82.0					16																	85697087		2198	4300	6498	SO:0001819	synonymous_variant	23199	exon11			GCGGCAGACGCCT	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.2511G>A	16.37:g.85697087G>A		112.0	0.0		107.0	26.0	NM_014615	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Silent	SNP	ENST00000253458.7	37	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	G	9.872	1.199131	0.22121	.	.	ENSG00000131149	ENST00000412692;ENST00000438180	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	T	0.71230	0.3315	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70008	-0.4990	4	.	.	.	-30.1443	15.0773	0.72087	0.0:0.1425:0.8575:0.0	.	.	.	.	K	644;39	.	.	R	+	2	0	KIAA0182	84254588	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.959000	0.56744	2.438000	0.82558	0.561000	0.74099	AGA	.		0.562	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
GSTP1	2950	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	67352223	67352223	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr11:67352223G>A	ENST00000398606.3	+	4	461	c.212G>A	c.(211-213)cGt>cAt	p.R71H	GSTP1_ENST00000498765.1_3'UTR|GSTP1_ENST00000398603.1_Missense_Mutation_p.R71H	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	71	GST N-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	ACCATCCTGCGTCACCTGGGC	0.617																																					p.R71H		.											.	GSTP1	91	0			c.G212A						.						82.0	90.0	88.0					11																	67352223		2005	4157	6162	SO:0001583	missense	2950	exon4			TCCTGCGTCACCT	U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.212G>A	11.37:g.67352223G>A	ENSP00000381607:p.Arg71His	115.0	0.0		533.0	26.0	NM_000852	O00460|Q15690|Q5TZY3	Missense_Mutation	SNP	ENST00000398606.3	37	CCDS41679.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927369	0.73327	.	.	ENSG00000084207	ENST00000398606;ENST00000398603	T;T	0.09163	3.01;3.01	5.65	5.65	0.86999	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.143985	0.38492	N	0.001670	T	0.40015	0.1100	M	0.88640	2.97	0.42107	D	0.991360	D	0.89917	1.0	D	0.80764	0.994	T	0.51371	-0.8714	9	0.87932	D	0	-17.2282	15.2846	0.73819	0.0:0.0:1.0:0.0	.	71	P09211	GSTP1_HUMAN	H	71	ENSP00000381607:R71H;ENSP00000381604:R71H	ENSP00000381604:R71H	R	+	2	0	GSTP1	67108799	0.998000	0.40836	0.607000	0.28956	0.154000	0.21943	6.886000	0.75611	2.675000	0.91044	0.650000	0.86243	CGT	.		0.617	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852	
HMBS	3145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118955777	118955777	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr11:118955777G>A	ENST00000278715.3	+	1	184		c.e1+1		HMBS_ENST00000392841.1_5'Flank|HMBS_ENST00000537841.1_5'UTR|HMBS_ENST00000442944.2_Splice_Site|HMBS_ENST00000542729.1_5'UTR|HMBS_ENST00000543090.1_Splice_Site|HMBS_ENST00000544387.1_Splice_Site	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase						heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		TGCAACGGCGGTGAGTGCTGA	0.642																																					.		.											.	HMBS	90	0			c.33+1G>A	GRCh37	CS003342|CS890127	HMBS	S		.						42.0	36.0	38.0					11																	118955777		2200	4295	6495	SO:0001630	splice_region_variant	3145	exon1			ACGGCGGTGAGTG	X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.33+1G>A	11.37:g.118955777G>A		135.0	0.0		110.0	31.0	NM_000190	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Splice_Site	SNP	ENST00000278715.3	37	CCDS8409.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.311067	0.81358	.	.	ENSG00000256269	ENST00000278715;ENST00000536813;ENST00000546302;ENST00000544387;ENST00000543090	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7169	0.77674	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HMBS	118460987	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	4.484000	0.60271	2.785000	0.95823	0.650000	0.86243	.	.		0.642	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399188.1	NM_000190	Intron
KIAA0586	9786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	58965663	58965663	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr14:58965663T>G	ENST00000556134.1	+	28	4382	c.4108T>G	c.(4108-4110)Ttt>Gtt	p.F1370V	KIAA0586_ENST00000261244.5_Missense_Mutation_p.F1309V|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000354386.6_Missense_Mutation_p.F1438V|KIAA0586_ENST00000423743.3_Missense_Mutation_p.F1341V	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1370					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ATCTCGGCAATTTGACACAGT	0.373																																					p.F1438V		.											.	KIAA0586	23	0			c.T4312G						.						60.0	52.0	55.0					14																	58965663		1882	4118	6000	SO:0001583	missense	9786	exon29			CGGCAATTTGACA	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.4108T>G	14.37:g.58965663T>G	ENSP00000452351:p.Phe1370Val	107.0	0.0		148.0	49.0	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	T	7.543	0.661055	0.14645	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000555397	T;T;T;T	0.41400	1.0;1.02;1.01;1.01	4.83	0.828	0.18841	.	1.342700	0.04864	N	0.444663	T	0.30727	0.0774	.	.	.	0.09310	N	1	B;B;P;B;B	0.38370	0.012;0.023;0.628;0.012;0.021	B;B;B;B;B	0.40066	0.006;0.013;0.318;0.006;0.009	T	0.20505	-1.0273	9	0.26408	T	0.33	.	4.7549	0.13078	0.0:0.2631:0.1554:0.5815	.	1245;1438;1309;1370;1341	B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;K0586_HUMAN;.	V	1438;1370;1341;1309;67	ENSP00000346359:F1438V;ENSP00000452351:F1370V;ENSP00000399427:F1341V;ENSP00000261244:F1309V	ENSP00000261244:F1309V	F	+	1	0	KIAA0586	58035416	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.019000	0.13444	0.203000	0.20529	0.533000	0.62120	TTT	.		0.373	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
KIAA1024	23251	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79748973	79748973	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr15:79748973G>T	ENST00000305428.3	+	2	559	c.484G>T	c.(484-486)Gac>Tac	p.D162Y		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	162						integral component of membrane (GO:0016021)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						CCGGAAGATGGACTGCAAGGA	0.572																																					p.D162Y		.											.	KIAA1024	183	0			c.G484T						.						68.0	72.0	71.0					15																	79748973		2196	4293	6489	SO:0001583	missense	23251	exon2			AAGATGGACTGCA	AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.484G>T	15.37:g.79748973G>T	ENSP00000307461:p.Asp162Tyr	85.0	0.0		66.0	14.0	NM_015206	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716867	0.68844	.	.	ENSG00000169330	ENST00000305428	T	0.35973	1.28	5.24	5.24	0.73138	.	0.153847	0.64402	D	0.000017	T	0.45013	0.1321	L	0.60455	1.87	0.53005	D	0.999966	P	0.43094	0.799	P	0.45946	0.498	T	0.30475	-0.9977	9	.	.	.	.	18.8308	0.92139	0.0:0.0:1.0:0.0	.	162	Q9UPX6	K1024_HUMAN	Y	162	ENSP00000307461:D162Y	.	D	+	1	0	KIAA1024	77536028	1.000000	0.71417	0.642000	0.29436	0.994000	0.84299	8.248000	0.89832	2.443000	0.82685	0.591000	0.81541	GAC	.		0.572	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
KRT27	342574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38935981	38935981	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr17:38935981T>A	ENST00000301656.3	-	4	857	c.817A>T	c.(817-819)Agg>Tgg	p.R273W	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				TCCGCGTCCCTGCGGTTCTGC	0.642																																					p.R273W		.											.	KRT27	90	0			c.A817T						.						38.0	37.0	37.0					17																	38935981		2203	4300	6503	SO:0001583	missense	342574	exon4			CGTCCCTGCGGTT	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.817A>T	17.37:g.38935981T>A	ENSP00000301656:p.Arg273Trp	82.0	0.0		80.0	17.0	NM_181537		Missense_Mutation	SNP	ENST00000301656.3	37	CCDS11375.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.032164	0.75504	.	.	ENSG00000171446	ENST00000301656	D	0.89343	-2.5	5.51	1.73	0.24493	Filament (1);	0.000000	0.64402	D	0.000004	D	0.94019	0.8084	M	0.91354	3.2	0.39113	D	0.961502	D	0.71674	0.998	D	0.67382	0.951	D	0.93288	0.6666	10	0.87932	D	0	.	8.5883	0.33670	0.0:0.0698:0.4034:0.5268	.	273	Q7Z3Y8	K1C27_HUMAN	W	273	ENSP00000301656:R273W	ENSP00000301656:R273W	R	-	1	2	KRT27	36189507	0.000000	0.05858	1.000000	0.80357	0.809000	0.45718	-0.122000	0.10627	0.433000	0.26313	0.477000	0.44152	AGG	.		0.642	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
LMO7	4008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	76382095	76382095	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr13:76382095G>A	ENST00000321797.8	+	8	1698	c.977G>A	c.(976-978)tGt>tAt	p.C326Y	RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000465261.2_Missense_Mutation_p.C326Y|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000357063.3_Missense_Mutation_p.C611Y|LMO7_ENST00000377534.3_Missense_Mutation_p.C611Y			Q8WWI1	LMO7_HUMAN	LIM domain 7	611					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AAATTTCTCTGTGTACTTGAA	0.443																																					p.C326Y		.											.	LMO7	586	0			c.G977A						.						85.0	86.0	86.0					13																	76382095		1568	3582	5150	SO:0001583	missense	4008	exon7			TTCTCTGTGTACT	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.977G>A	13.37:g.76382095G>A	ENSP00000317802:p.Cys326Tyr	56.0	0.0		52.0	8.0	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.	.	.	.	.	.	.	.	.	.	G	19.06	3.754485	0.69648	.	.	ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.67	4.81	0.61882	.	0.046152	0.85682	D	0.000000	T	0.67552	0.2905	M	0.62723	1.935	0.47153	D	0.999334	D;D	0.76494	0.999;0.999	P;P	0.60789	0.879;0.879	T	0.72151	-0.4377	10	0.72032	D	0.01	-11.125	16.6107	0.84882	0.0:0.1345:0.8655:0.0	.	611;326	Q8WWI1;E9PLH4	LMO7_HUMAN;.	Y	611;611;326;326	ENSP00000349571:C611Y;ENSP00000366757:C611Y;ENSP00000317802:C326Y;ENSP00000433352:C326Y	ENSP00000317802:C326Y	C	+	2	0	LMO7	75280096	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	6.233000	0.72320	1.495000	0.48549	0.655000	0.94253	TGT	.		0.443	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
LPIN2	9663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	2939526	2939526	+	Silent	SNP	T	T	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr18:2939526T>C	ENST00000261596.4	-	6	1012	c.774A>G	c.(772-774)tcA>tcG	p.S258S		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	258					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		TGTGAGACTCTGATCTGAGCA	0.507																																					p.S258S		.											.	LPIN2	227	0			c.A774G						.						130.0	119.0	123.0					18																	2939526		2203	4300	6503	SO:0001819	synonymous_variant	9663	exon6			AGACTCTGATCTG	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.774A>G	18.37:g.2939526T>C		58.0	0.0		59.0	15.0	NM_014646	A7MD25|D3DUH3	Silent	SNP	ENST00000261596.4	37	CCDS11829.1																																																																																			.		0.507	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	40707956	40707956	+	Silent	SNP	T	T	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr12:40707956T>G	ENST00000298910.7	+	32	4777	c.4719T>G	c.(4717-4719)gtT>gtG	p.V1573V	LRRK2_ENST00000481256.1_3'UTR	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1573					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTCACGCAGTTCACTTTCTAA	0.343																																					p.V1573V		.											.	LRRK2	533	0			c.T4719G						.						64.0	54.0	57.0					12																	40707956		2203	4299	6502	SO:0001819	synonymous_variant	120892	exon32			CGCAGTTCACTTT	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.4719T>G	12.37:g.40707956T>G		148.0	0.0		197.0	50.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	ENST00000298910.7	37	CCDS31774.1																																																																																			.		0.343	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
LRSAM1	90678	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	130242224	130242224	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr9:130242224G>T	ENST00000323301.4	+	13	1614	c.1010G>T	c.(1009-1011)aGc>aTc	p.S337I	LRSAM1_ENST00000373322.1_Missense_Mutation_p.S337I|LRSAM1_ENST00000483302.1_3'UTR|LRSAM1_ENST00000300417.6_Missense_Mutation_p.S337I|LRSAM1_ENST00000373324.4_Missense_Mutation_p.S337I	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	337					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						AACATTTCCAGCCGGATCCAG	0.657																																					p.S337I		.											.	LRSAM1	90	0			c.G1010T						.						63.0	67.0	66.0					9																	130242224		2203	4300	6503	SO:0001583	missense	90678	exon14			TTTCCAGCCGGAT	AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.1010G>T	9.37:g.130242224G>T	ENSP00000322937:p.Ser337Ile	176.0	1.0		174.0	34.0	NM_001005373	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	ENST00000323301.4	37	CCDS6873.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340057	0.41398	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.86	-1.2	0.09554	.	0.536159	0.24532	N	0.037713	T	0.37128	0.0992	M	0.62723	1.935	0.19300	N	0.999971	B;B	0.30870	0.298;0.162	B;B	0.37091	0.241;0.091	T	0.31586	-0.9938	10	0.42905	T	0.14	-0.1393	6.6645	0.23032	0.4202:0.1227:0.4571:0.0	.	337;337	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	I	337	ENSP00000300417:S337I;ENSP00000362421:S337I;ENSP00000322937:S337I;ENSP00000362419:S337I	ENSP00000300417:S337I	S	+	2	0	LRSAM1	129282045	0.000000	0.05858	0.040000	0.18447	0.978000	0.69477	-0.171000	0.09883	-0.284000	0.09102	0.655000	0.94253	AGC	.		0.657	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054164.1	NM_138361	
LTN1	26046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	30343736	30343736	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr21:30343736C>A	ENST00000361371.5	-	7	920	c.841G>T	c.(841-843)Gca>Tca	p.A281S	LTN1_ENST00000389194.2_Missense_Mutation_p.A327S|LTN1_ENST00000389195.2_Missense_Mutation_p.A327S			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	281					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TGGCACAATGCAGAGACTAAC	0.373																																					p.A327S		.											.	LTN1	530	0			c.G979T						.						192.0	184.0	187.0					21																	30343736		2203	4300	6503	SO:0001583	missense	26046	exon7			ACAATGCAGAGAC	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.841G>T	21.37:g.30343736C>A	ENSP00000354977:p.Ala281Ser	126.0	0.0		113.0	28.0	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	C	24.7	4.561382	0.86335	.	.	ENSG00000198862	ENST00000389194;ENST00000361371;ENST00000446611;ENST00000389195	T;T;T	0.65916	3.63;3.63;-0.18	4.66	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.065142	0.64402	D	0.000010	T	0.65933	0.2739	L	0.46157	1.445	0.58432	D	0.999995	D	0.58620	0.983	P	0.53313	0.723	T	0.60647	-0.7222	10	0.19590	T	0.45	.	18.1081	0.89526	0.0:1.0:0.0:0.0	.	281	O94822	LTN1_HUMAN	S	327;281;283;327	ENSP00000373846:A327S;ENSP00000354977:A281S;ENSP00000373847:A327S	ENSP00000354977:A281S	A	-	1	0	LTN1	29265607	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.794000	0.47853	2.579000	0.87056	0.650000	0.86243	GCA	.		0.373	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
MAGI2	9863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	77885584	77885584	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr7:77885584C>A	ENST00000354212.4	-	10	1976	c.1723G>T	c.(1723-1725)Gat>Tat	p.D575Y	MAGI2_ENST00000536571.1_Missense_Mutation_p.D407Y|MAGI2_ENST00000535697.1_Missense_Mutation_p.D412Y|MAGI2_ENST00000522391.1_Missense_Mutation_p.D575Y|MAGI2_ENST00000419488.1_Missense_Mutation_p.D575Y	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	575					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				AGCTGACCATCAGTTGGCATG	0.488																																					p.D575Y		.											.	MAGI2	461	0			c.G1723T						.						111.0	95.0	100.0					7																	77885584		2203	4300	6503	SO:0001583	missense	9863	exon10			GACCATCAGTTGG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1723G>T	7.37:g.77885584C>A	ENSP00000346151:p.Asp575Tyr	391.0	0.0		479.0	161.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010687	0.75046	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.12147	2.81;2.8;2.71;3.72;3.73	5.94	5.94	0.96194	.	0.000000	0.37530	U	0.002044	T	0.40498	0.1119	M	0.72894	2.215	0.80722	D	1	D;B;D;D;D;D	0.89917	0.997;0.376;1.0;1.0;0.997;1.0	D;B;D;D;D;D	0.87578	0.946;0.293;0.998;0.998;0.964;0.997	T	0.07177	-1.0786	10	0.87932	D	0	.	19.3473	0.94370	0.0:1.0:0.0:0.0	.	412;407;575;575;575;575	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	Y	575;575;575;575;407;412	ENSP00000405766:D575Y;ENSP00000346151:D575Y;ENSP00000428389:D575Y;ENSP00000441584:D407Y;ENSP00000441603:D412Y	ENSP00000346151:D575Y	D	-	1	0	MAGI2	77723520	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	7.818000	0.86416	2.816000	0.96949	0.561000	0.74099	GAT	.		0.488	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
MAN2A2	4122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	91461902	91461902	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr15:91461902G>A	ENST00000559717.1	+	22	3676	c.3217G>A	c.(3217-3219)Gca>Aca	p.A1073T	MAN2A2_ENST00000431652.2_Missense_Mutation_p.A581T|AC068831.15_ENST00000560522.1_RNA|MAN2A2_ENST00000360468.3_Missense_Mutation_p.A1073T|MAN2A2_ENST00000558538.1_3'UTR|MAN2A2_ENST00000430376.2_Missense_Mutation_p.A263T			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	1073					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GGCGGAGACCGCACTCATCTT	0.607																																					p.A1073T		.											.	MAN2A2	136	0			c.G3217A						.						49.0	41.0	44.0					15																	91461902		2198	4298	6496	SO:0001583	missense	4122	exon21			GAGACCGCACTCA	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.3217G>A	15.37:g.91461902G>A	ENSP00000452948:p.Ala1073Thr	48.0	0.0		54.0	10.0	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	37	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	G	35	5.528441	0.96446	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	D;D;D	0.83673	-1.75;-1.75;-1.75	5.95	5.95	0.96441	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.92293	0.7555	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.989;0.995;0.997	D	0.91919	0.5546	10	0.59425	D	0.04	-17.2714	20.458	0.99154	0.0:0.0:1.0:0.0	.	581;701;1073	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	T	1073;581;263	ENSP00000353655:A1073T;ENSP00000388221:A581T;ENSP00000394372:A263T	ENSP00000353655:A1073T	A	+	1	0	MAN2A2	89262906	1.000000	0.71417	0.206000	0.23566	0.062000	0.15995	7.414000	0.80117	2.835000	0.97688	0.650000	0.86243	GCA	.		0.607	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
MAP7D3	79649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135309506	135309506	+	Silent	SNP	T	T	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chrX:135309506T>C	ENST00000316077.9	-	12	2191	c.1971A>G	c.(1969-1971)caA>caG	p.Q657Q	MAP7D3_ENST00000370663.5_Silent_p.Q639Q|MAP7D3_ENST00000370661.1_Silent_p.Q622Q|MAP7D3_ENST00000495432.1_5'UTR	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	657					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TCTCATTTTGTTGCTGCCCAT	0.438																																					p.Q657Q		.											.	MAP7D3	110	0			c.A1971G						.						232.0	203.0	212.0					X																	135309506		1948	4136	6084	SO:0001819	synonymous_variant	79649	exon12			ATTTTGTTGCTGC	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1971A>G	X.37:g.135309506T>C		251.0	0.0		283.0	46.0	NM_024597	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Silent	SNP	ENST00000316077.9	37	CCDS44004.1																																																																																			.		0.438	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
MYO1H	283446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	109879426	109879426	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr12:109879426C>T	ENST00000431443.2	+	25	2527	c.2527C>T	c.(2527-2529)Caa>Taa	p.Q843*	MYO1H_ENST00000310903.5_Nonsense_Mutation_p.Q833*	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	843	Myosin tail. {ECO:0000255}.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CCAGATGCAGCAAAAGGTAGT	0.408																																					p.Q833X		.											.	.	.	0			c.C2497T						.						83.0	72.0	76.0					12																	109879426		1858	4096	5954	SO:0001587	stop_gained	283446	exon25			ATGCAGCAAAAGG		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2527C>T	12.37:g.109879426C>T	ENSP00000444076:p.Gln843*	207.0	0.0		270.0	41.0	NM_001101421	F5H3C6	Nonsense_Mutation	SNP	ENST00000431443.2	37		.	.	.	.	.	.	.	.	.	.	C	39	7.598883	0.98381	.	.	ENSG00000174527	ENST00000310903;ENST00000431443;ENST00000542268	.	.	.	5.09	3.12	0.35913	.	0.158082	0.30109	N	0.010391	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	14.7318	0.69388	0.0:0.7276:0.2723:0.0	.	.	.	.	X	833;843;24	.	ENSP00000439182:Q833X	Q	+	1	0	MYO1H	108363809	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.340000	0.52143	1.258000	0.44101	0.655000	0.94253	CAA	.		0.408	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
MYO6	4646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76589582	76589582	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr6:76589582G>A	ENST00000369977.3	+	21	2262	c.2123G>A	c.(2122-2124)cGa>cAa	p.R708Q	MYO6_ENST00000369981.3_Missense_Mutation_p.R708Q|MYO6_ENST00000462633.1_3'UTR|MYO6_ENST00000369985.4_Missense_Mutation_p.R708Q|MYO6_ENST00000369975.1_Missense_Mutation_p.R708Q	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	708	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TACCCATCACGAGCTTCATTT	0.408																																					p.R708Q		.											.	MYO6	92	0			c.G2123A						.						174.0	158.0	163.0					6																	76589582		2203	4300	6503	SO:0001583	missense	4646	exon21			CATCACGAGCTTC	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2123G>A	6.37:g.76589582G>A	ENSP00000358994:p.Arg708Gln	210.0	0.0		240.0	39.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	37	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747060	0.89663	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.97529	0.9191	H	0.96111	3.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.983	D	0.98450	1.0591	10	0.87932	D	0	.	19.2649	0.93982	0.0:0.0:1.0:0.0	.	708;708	Q9UM54-2;Q9UM54-1	.;.	Q	708	ENSP00000358998:R708Q;ENSP00000359002:R708Q;ENSP00000358994:R708Q;ENSP00000358992:R708Q	ENSP00000358992:R708Q	R	+	2	0	MYO6	76646302	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	9.392000	0.97252	2.632000	0.89209	0.655000	0.94253	CGA	.		0.408	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
NASP	4678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	46073649	46073649	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr1:46073649G>T	ENST00000350030.3	+	6	1153	c.1066G>T	c.(1066-1068)Gct>Tct	p.A356S	NASP_ENST00000402363.3_Missense_Mutation_p.A358S|NASP_ENST00000537798.1_Missense_Mutation_p.A292S|NASP_ENST00000372052.4_Intron|NASP_ENST00000351223.3_Intron	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	356	Glu-rich (acidic).				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					AGAGGCCTCAGCTGTAGAGGC	0.532																																					p.A356S		.											.	NASP	91	0			c.G1066T						.						80.0	89.0	86.0					1																	46073649		2203	4300	6503	SO:0001583	missense	4678	exon6			GCCTCAGCTGTAG	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.1066G>T	1.37:g.46073649G>T	ENSP00000255120:p.Ala356Ser	339.0	0.0		339.0	57.0	NM_002482	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Missense_Mutation	SNP	ENST00000350030.3	37	CCDS524.1	.	.	.	.	.	.	.	.	.	.	G	9.209	1.030338	0.19512	.	.	ENSG00000132780	ENST00000537798;ENST00000402363;ENST00000341288;ENST00000350030	D;D;D	0.94576	-3.46;-3.46;-3.46	4.93	2.92	0.33932	.	0.737124	0.11710	N	0.537043	D	0.87265	0.6134	N	0.19112	0.55	0.09310	N	1	B;B;P;B;B	0.37061	0.16;0.437;0.58;0.099;0.253	B;B;B;B;B	0.35114	0.088;0.081;0.196;0.04;0.088	T	0.78375	-0.2228	9	.	.	.	-0.8291	7.0467	0.25050	0.1626:0.1426:0.6948:0.0	.	292;356;256;356;358	F5H3J2;Q53H03;B4DS57;P49321;P49321-3	.;.;.;NASP_HUMAN;.	S	292;358;256;356	ENSP00000438871:A292S;ENSP00000384529:A358S;ENSP00000255120:A356S	.	A	+	1	0	NASP	45846236	0.001000	0.12720	0.088000	0.20740	0.385000	0.30292	0.912000	0.28597	1.219000	0.43474	0.508000	0.49915	GCT	.		0.532	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
NEB	4703	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152506778	152506778	+	Missense_Mutation	SNP	C	C	T	rs373589529		TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr2:152506778C>T	ENST00000172853.10	-	54	7490	c.7343G>A	c.(7342-7344)cGt>cAt	p.R2448H	NEB_ENST00000427231.2_Missense_Mutation_p.R2448H|NEB_ENST00000397345.3_Missense_Mutation_p.R2448H|NEB_ENST00000409198.1_Missense_Mutation_p.R2448H|NEB_ENST00000604864.1_Missense_Mutation_p.R2448H|NEB_ENST00000603639.1_Missense_Mutation_p.R2448H			P20929	NEBU_HUMAN	nebulin	2448					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGAGGCTGACGATATTTCTT	0.463																																					p.R2448H		.											.	NEB	145	0			c.G7343A						.	C	HIS/ARG,HIS/ARG,HIS/ARG	1,3839		0,1,1919	159.0	150.0	153.0		7343,7343,7343	5.2	1.0	2		153	0,8262		0,0,4131	no	missense,missense,missense	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	29,29,29	0,1,6050	TT,TC,CC		0.0,0.026,0.0083	probably-damaging,probably-damaging,probably-damaging	2448/8526,2448/8526,2448/6670	152506778	1,12101	1920	4131	6051	SO:0001583	missense	4703	exon54			GGCTGACGATATT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7343G>A	2.37:g.152506778C>T	ENSP00000172853:p.Arg2448His	255.0	1.0		215.0	31.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	33	5.255863	0.95336	2.6E-4	0.0	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.09538	3.0;3.0;3.0;2.97	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.38931	0.1059	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.30822	-0.9965	10	0.59425	D	0.04	.	18.7871	0.91960	0.0:1.0:0.0:0.0	.	2448	P20929	NEBU_HUMAN	H	2448	ENSP00000386259:R2448H;ENSP00000380505:R2448H;ENSP00000416578:R2448H;ENSP00000172853:R2448H	ENSP00000172853:R2448H	R	-	2	0	NEB	152215024	1.000000	0.71417	0.980000	0.43619	0.989000	0.77384	7.770000	0.85390	2.456000	0.83038	0.650000	0.86243	CGT	.		0.463	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NPY5R	4889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	164271585	164271585	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr4:164271585C>A	ENST00000515560.1	+	4	1682	c.160C>A	c.(160-162)Ctt>Att	p.L54I	NPY5R_ENST00000506953.1_Missense_Mutation_p.L54I|NPY5R_ENST00000338566.3_Missense_Mutation_p.L54I			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	54					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				TGTAAGTCTTCTTGGCTTTAT	0.393																																					p.L54I	Melanoma(139;1287 1774 9781 19750 25599)	.											.	NPY5R	523	0			c.C160A						.						135.0	131.0	132.0					4																	164271585		2203	4300	6503	SO:0001583	missense	4889	exon4			AGTCTTCTTGGCT	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.160C>A	4.37:g.164271585C>A	ENSP00000423917:p.Leu54Ile	165.0	0.0		196.0	33.0	NM_006174	Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	37	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339472	0.41398	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.39056	1.1;1.1;1.1	5.35	5.35	0.76521	.	0.252536	0.27122	N	0.020832	T	0.32941	0.0846	L	0.29908	0.895	0.34337	D	0.688297	B	0.24576	0.106	B	0.17433	0.018	T	0.40175	-0.9577	10	0.42905	T	0.14	.	15.3271	0.74172	0.0:0.8208:0.1792:0.0	.	54	Q15761	NPY5R_HUMAN	I	54	ENSP00000339377:L54I;ENSP00000423917:L54I;ENSP00000423474:L54I	ENSP00000339377:L54I	L	+	1	0	NPY5R	164491035	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	1.974000	0.40559	2.668000	0.90789	0.655000	0.94253	CTT	.		0.393	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174	
NUMB	8650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	73746111	73746111	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr14:73746111A>C	ENST00000355058.3	-	12	1396	c.1118T>G	c.(1117-1119)tTc>tGc	p.F373C	NUMB_ENST00000544991.3_Intron|NUMB_ENST00000557597.1_Missense_Mutation_p.F362C|NUMB_ENST00000454166.4_Intron|NUMB_ENST00000555238.1_Missense_Mutation_p.F373C|NUMB_ENST00000556772.1_Missense_Mutation_p.F229C|NUMB_ENST00000359560.3_Missense_Mutation_p.F362C|NUMB_ENST00000559312.1_Intron|NUMB_ENST00000555394.1_Intron|NUMB_ENST00000555738.2_Intron|NUMB_ENST00000535282.1_Missense_Mutation_p.F362C|NUMB_ENST00000554546.1_Intron|NUMB_ENST00000560335.1_Intron|NUMB_ENST00000356296.4_Intron|NUMB_ENST00000554521.2_Intron			P49757	NUMB_HUMAN	numb homolog (Drosophila)	373					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		AAGCACATGGAAGGCTGAGTC	0.532																																					p.F373C		.											.	NUMB	1062	0			c.T1118G						.						112.0	92.0	99.0					14																	73746111		2203	4300	6503	SO:0001583	missense	8650	exon12			ACATGGAAGGCTG	L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1118T>G	14.37:g.73746111A>C	ENSP00000347169:p.Phe373Cys	160.0	0.0		218.0	33.0	NM_001005743	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	ENST00000355058.3	37	CCDS32116.1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.164946	0.57476	.	.	ENSG00000133961	ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000535282	T;T;T;T;T;T	0.49432	0.78;0.78;1.39;0.78;0.78;0.78	5.51	3.09	0.35607	.	0.101870	0.64402	D	0.000002	T	0.33235	0.0856	N	0.08118	0	0.48511	D	0.999662	P;P	0.45428	0.858;0.778	P;B	0.48368	0.575;0.371	T	0.09796	-1.0658	10	0.40728	T	0.16	-0.3505	10.3063	0.43683	0.8649:0.0:0.1351:0.0	.	362;373	P49757-3;P49757	.;NUMB_HUMAN	C	362;373;229;373;362;362	ENSP00000451117:F362C;ENSP00000451300:F373C;ENSP00000451513:F229C;ENSP00000347169:F373C;ENSP00000352563:F362C;ENSP00000441258:F362C	ENSP00000347169:F373C	F	-	2	0	NUMB	72815864	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.611000	0.54132	0.487000	0.27698	0.459000	0.35465	TTC	.		0.532	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1		
OR6N2	81442	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158747373	158747373	+	Missense_Mutation	SNP	G	G	A	rs200003269		TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr1:158747373G>A	ENST00000339258.1	-	1	52	c.53C>T	c.(52-54)gCc>gTc	p.A18V		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					GCCCACACTGGCAAAGCCAAG	0.468																																					p.A18V		.											.	OR6N2	68	0			c.C53T						.						71.0	73.0	72.0					1																	158747373		2203	4300	6503	SO:0001583	missense	81442	exon1			ACACTGGCAAAGC	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.53C>T	1.37:g.158747373G>A	ENSP00000344101:p.Ala18Val	322.0	1.0		282.0	54.0	NM_001005278	Q6IFR2	Missense_Mutation	SNP	ENST00000339258.1	37	CCDS30906.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.330434	0.24167	.	.	ENSG00000188340	ENST00000339258	T	0.01359	4.98	5.17	5.17	0.71159	.	0.202532	0.24810	N	0.035414	T	0.00666	0.0022	N	0.21508	0.67	0.25451	N	0.988002	B	0.25007	0.116	B	0.22880	0.042	T	0.49523	-0.8931	10	0.66056	D	0.02	-15.5517	15.6903	0.77446	0.0:0.0:1.0:0.0	.	18	Q8NGY6	OR6N2_HUMAN	V	18	ENSP00000344101:A18V	ENSP00000344101:A18V	A	-	2	0	OR6N2	157013997	0.061000	0.20836	0.981000	0.43875	0.051000	0.14879	1.404000	0.34623	2.686000	0.91538	0.650000	0.86243	GCC	G|0.999;A|0.001		0.468	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1		
OR7A5	26659	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	14938783	14938783	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr19:14938783C>A	ENST00000322301.3	-	2	358	c.271G>T	c.(271-273)Gtc>Ttc	p.V91F	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Missense_Mutation_p.V91F			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	91					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						TAGGTGATGACTTTGTTCTGT	0.443																																					p.V91F		.											.	OR7A5	90	0			c.G271T						.						204.0	182.0	190.0					19																	14938783		2203	4300	6503	SO:0001583	missense	26659	exon1			TGATGACTTTGTT	X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.271G>T	19.37:g.14938783C>A	ENSP00000316955:p.Val91Phe	125.0	0.0		171.0	8.0	NM_017506	B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	ENST00000322301.3	37	CCDS12318.1	.	.	.	.	.	.	.	.	.	.	c	8.052	0.766170	0.15983	.	.	ENSG00000188269	ENST00000322301	T	0.00555	6.63	3.13	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	1.152260	0.07204	U	0.857959	T	0.00754	0.0025	M	0.72353	2.195	0.09310	N	1	B	0.23937	0.094	B	0.25614	0.062	T	0.47169	-0.9138	10	0.40728	T	0.16	.	4.4453	0.11595	0.0:0.6307:0.2373:0.1319	.	91	Q15622	OR7A5_HUMAN	F	91	ENSP00000316955:V91F	ENSP00000316955:V91F	V	-	1	0	OR7A5	14799783	0.000000	0.05858	0.001000	0.08648	0.193000	0.23685	0.004000	0.13106	0.642000	0.30620	0.134000	0.15878	GTC	.		0.443	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466518.1	NM_017506	
OR7A10	390892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14952139	14952139	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr19:14952139A>G	ENST00000248058.1	-	1	550	c.551T>C	c.(550-552)gTg>gCg	p.V184A		NM_001005190.1	NP_001005190.1	O76100	OR7AA_HUMAN	olfactory receptor, family 7, subfamily A, member 10	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E180fs*7(1)		NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|stomach(1)	19	Ovarian(108;0.203)					AAGGTGGACCACCTGATTAAT	0.448																																					p.V184A		.											.	OR7A10	68	1	Deletion - Frameshift(1)	breast(1)	c.T551C						.						80.0	79.0	79.0					19																	14952139		2203	4300	6503	SO:0001583	missense	390892	exon1			TGGACCACCTGAT		CCDS32936.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8356	protein-coding gene	gene with protein product							Standard	NM_001005190		Approved		uc002mzx.1	O76100		ENST00000248058.1:c.551T>C	19.37:g.14952139A>G	ENSP00000248058:p.Val184Ala	169.0	0.0		189.0	20.0	NM_001005190	Q6IFP0|Q96R97	Missense_Mutation	SNP	ENST00000248058.1	37	CCDS32936.1	.	.	.	.	.	.	.	.	.	.	a	13.14	2.146903	0.37923	.	.	ENSG00000127515	ENST00000248058	T	0.00231	8.49	2.57	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.495796	0.14495	U	0.316089	T	0.00552	0.0018	M	0.93016	3.37	0.09310	N	1	P	0.52463	0.953	P	0.58331	0.837	T	0.28202	-1.0051	10	0.59425	D	0.04	.	8.7704	0.34728	1.0:0.0:0.0:0.0	.	184	O76100	OR7AA_HUMAN	A	184	ENSP00000248058:V184A	ENSP00000248058:V184A	V	-	2	0	OR7A10	14813139	0.451000	0.25705	0.932000	0.37286	0.325000	0.28411	5.638000	0.67861	1.210000	0.43336	0.113000	0.15668	GTG	.		0.448	OR7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466520.1	NM_001005190	
OR8H1	219469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56058048	56058048	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr11:56058048C>T	ENST00000313022.2	-	1	518	c.491G>A	c.(490-492)aGa>aAa	p.R164K		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					GAAATGCAGTCTGCTCATCCA	0.438																																					p.R164K		.											.	OR8H1	71	0			c.G491A						.						95.0	87.0	90.0					11																	56058048		2201	4296	6497	SO:0001583	missense	219469	exon1			TGCAGTCTGCTCA	AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.491G>A	11.37:g.56058048C>T	ENSP00000323595:p.Arg164Lys	158.0	0.0		254.0	51.0	NM_001005199	B2RNI7|Q6IFC5	Missense_Mutation	SNP	ENST00000313022.2	37	CCDS31526.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513805	0.27123	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00123	8.7	3.64	0.239	0.15484	GPCR, rhodopsin-like superfamily (1);	0.342922	0.25425	N	0.030778	T	0.00073	0.0002	N	0.16903	0.455	0.09310	N	1	B	0.12013	0.005	B	0.17979	0.02	T	0.25745	-1.0123	10	0.54805	T	0.06	.	6.1335	0.20219	0.0:0.3043:0.4796:0.2161	.	164	Q8NGG4	OR8H1_HUMAN	K	164;160	ENSP00000323595:R164K	ENSP00000323595:R164K	R	-	2	0	OR8H1	55814624	0.000000	0.05858	0.004000	0.12327	0.029000	0.11900	-4.223000	0.00271	0.284000	0.22305	0.446000	0.29264	AGA	.		0.438	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370019.1	NM_001005199	
P2RY4	5030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	69478612	69478612	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chrX:69478612T>C	ENST00000374519.2	-	1	1042	c.863A>G	c.(862-864)tAt>tGt	p.Y288C		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	288					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						AGTCACTTTATAGACCACGTT	0.552																																					p.Y288C		.											.	P2RY4	540	0			c.A863G						.						57.0	45.0	49.0					X																	69478612		2203	4300	6503	SO:0001583	missense	5030	exon1			ACTTTATAGACCA	X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.863A>G	X.37:g.69478612T>C	ENSP00000363643:p.Tyr288Cys	474.0	0.0		431.0	95.0	NM_002565	Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Missense_Mutation	SNP	ENST00000374519.2	37	CCDS14398.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618634	0.66787	.	.	ENSG00000186912	ENST00000374519	T	0.25414	1.8	4.7	4.7	0.59300	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000001	T	0.59985	0.2234	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70956	-0.4731	10	0.87932	D	0	.	12.4838	0.55859	0.0:0.0:0.0:1.0	.	288	P51582	P2RY4_HUMAN	C	288	ENSP00000363643:Y288C	ENSP00000363643:Y288C	Y	-	2	0	P2RY4	69395337	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.659000	0.68010	1.737000	0.51674	0.477000	0.44152	TAT	.		0.552	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057058.2	NM_002565	
PAPD7	11044	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	6754921	6754921	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr5:6754921G>A	ENST00000230859.6	+	13	1621	c.1492G>A	c.(1492-1494)Ggc>Agc	p.G498S		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	728					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						CCAAGGCGGCGGCTACAGCTC	0.602																																					p.G498S	NSCLC(7;212 333 5667 23379 46547)	.											.	PAPD7	69	0			c.G1492A						.						34.0	34.0	34.0					5																	6754921		2203	4300	6503	SO:0001583	missense	11044	exon13			GGCGGCGGCTACA	AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1492G>A	5.37:g.6754921G>A	ENSP00000230859:p.Gly498Ser	210.0	0.0		268.0	51.0	NM_006999	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	ENST00000230859.6	37	CCDS3871.1	.	.	.	.	.	.	.	.	.	.	G	9.341	1.063081	0.19987	.	.	ENSG00000112941	ENST00000230859	T	0.28255	1.62	4.76	-1.76	0.08006	.	0.630262	0.15298	N	0.269800	T	0.10551	0.0258	N	0.04508	-0.205	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36529	-0.9744	10	0.05620	T	0.96	-7.3183	10.6449	0.45615	0.402:0.0:0.598:0.0	.	497;498	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	S	498	ENSP00000230859:G498S	ENSP00000230859:G498S	G	+	1	0	PAPD7	6807921	0.047000	0.20315	0.174000	0.22961	0.989000	0.77384	0.099000	0.15210	-0.243000	0.09653	-0.345000	0.07892	GGC	.		0.602	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999	
PARP11	57097	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	3939151	3939151	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr12:3939151T>C	ENST00000228820.4	-	2	196	c.52A>G	c.(52-54)Aaa>Gaa	p.K18E	PARP11_ENST00000397096.2_Missense_Mutation_p.K11E|PARP11_ENST00000447133.3_5'UTR|PARP11_ENST00000427057.2_5'UTR	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	11	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TTTGTTGTTTTAGAAAATAAT	0.393																																					p.K18E		.											.	PARP11	523	0			c.A52G						.						134.0	122.0	126.0					12																	3939151		2203	4300	6503	SO:0001583	missense	57097	exon2			TTGTTTTAGAAAA	AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.52A>G	12.37:g.3939151T>C	ENSP00000228820:p.Lys18Glu	123.0	0.0		107.0	19.0	NM_020367	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	37	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	T	10.10	1.258544	0.23051	.	.	ENSG00000111224	ENST00000397096;ENST00000228820	T;T	0.32988	1.43;2.62	5.52	0.326	0.15908	.	0.404709	0.29537	N	0.011876	T	0.10294	0.0252	N	0.08118	0	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.31586	-0.9938	10	0.06757	T	0.87	.	4.6244	0.12470	0.0:0.2302:0.287:0.4827	.	18;11	Q9NR21-4;Q9NR21	.;PAR11_HUMAN	E	11;18	ENSP00000380284:K11E;ENSP00000228820:K18E	ENSP00000228820:K18E	K	-	1	0	PARP11	3809412	0.068000	0.21057	0.000000	0.03702	0.005000	0.04900	1.101000	0.31037	-0.079000	0.12707	0.460000	0.39030	AAA	.		0.393	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1		
PCDH10	57575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	134072907	134072907	+	Missense_Mutation	SNP	G	G	A	rs568804747	byFrequency	TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr4:134072907G>A	ENST00000264360.5	+	1	2438	c.1612G>A	c.(1612-1614)Gac>Aac	p.D538N	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	538	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GCAGCTGAAGGACTTCAGTTT	0.557																																					p.D538N		.											.	PCDH10	92	0			c.G1612A						.						56.0	61.0	59.0					4																	134072907		2160	4209	6369	SO:0001583	missense	57575	exon1			CTGAAGGACTTCA	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1612G>A	4.37:g.134072907G>A	ENSP00000264360:p.Asp538Asn	193.0	0.0		194.0	44.0	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321144	0.23994	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.51574	0.7	4.51	4.51	0.55191	Cadherin (5);Cadherin-like (1);	0.000000	0.45867	D	0.000336	T	0.37571	0.1008	N	0.21583	0.68	0.44890	D	0.9979	P;B	0.36683	0.565;0.0	B;B	0.42282	0.382;0.004	T	0.09885	-1.0654	10	0.09338	T	0.73	.	16.1677	0.81782	0.0:0.0:1.0:0.0	.	538;538	Q9P2E7;Q96SF0	PCD10_HUMAN;.	N	538	ENSP00000264360:D538N	ENSP00000264360:D538N	D	+	1	0	PCDH10	134292357	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.736000	0.62059	2.329000	0.79093	0.655000	0.94253	GAC	.		0.557	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
PCDHGA6	56109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140755726	140755726	+	Silent	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr5:140755726C>T	ENST00000517434.1	+	1	2076	c.2076C>T	c.(2074-2076)taC>taT	p.Y692Y	PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	692					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACTCTGTACCTGGTGGTGG	0.677																																					p.Y692Y		.											.	PCDHGA6	67	0			c.C2076T						.						61.0	70.0	67.0					5																	140755726		2203	4293	6496	SO:0001819	synonymous_variant	56109	exon1			TCTGTACCTGGTG	AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.2076C>T	5.37:g.140755726C>T		73.0	0.0		85.0	21.0	NM_018919	A6H8K7|B2RN55|Q9Y5D1	Silent	SNP	ENST00000517434.1	37	CCDS54926.1																																																																																			.		0.677	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374743.1	NM_018919	
RALGAPA2	57186	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	20621445	20621445	+	Silent	SNP	C	C	A	rs557876344		TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr20:20621445C>A	ENST00000202677.7	-	6	457	c.450G>T	c.(448-450)ctG>ctT	p.L150L		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	150					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						AAGCAAAAATCAGAACCTGCT	0.463																																					p.L150L		.											.	RALGAPA2	24	0			c.G450T						.						79.0	79.0	79.0					20																	20621445		1921	4130	6051	SO:0001819	synonymous_variant	57186	exon6			AAAAATCAGAACC	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.450G>T	20.37:g.20621445C>A		222.0	1.0		284.0	43.0	NM_020343	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Silent	SNP	ENST00000202677.7	37	CCDS46584.1	.	.	.	.	.	.	.	.	.	.	C	9.549	1.115371	0.20795	.	.	ENSG00000188559	ENST00000432524	.	.	.	5.62	3.48	0.39840	.	.	.	.	.	T	0.55481	0.1923	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52087	-0.8622	4	.	.	.	.	6.6089	0.22741	0.0:0.6085:0.0:0.3915	.	.	.	.	Y	2	.	.	D	-	1	0	RALGAPA2	20569445	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	0.555000	0.23422	1.388000	0.46506	0.591000	0.81541	GAT	.		0.463	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343	
RBM11	54033	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	15599354	15599354	+	Missense_Mutation	SNP	G	G	T	rs139439630	byFrequency	TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr21:15599354G>T	ENST00000400577.3	+	5	595	c.586G>T	c.(586-588)Gac>Tac	p.D196Y	RBM11_ENST00000468643.1_3'UTR	NM_144770.3	NP_658983.3	P57052	RBM11_HUMAN	RNA binding motif protein 11	196					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(U) RNA binding (GO:0008266)|protein homodimerization activity (GO:0042803)			endometrium(3)|kidney(3)|lung(7)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		ACAACCAAGTGACTCTGACCT	0.468																																					p.D196Y		.											.	.	.	0			c.G586T						.						326.0	307.0	313.0					21																	15599354		1981	4164	6145	SO:0001583	missense	54033	exon5			CCAAGTGACTCTG	AF130358	CCDS46635.1	21q11	2013-02-12			ENSG00000185272	ENSG00000185272		"""RNA binding motif (RRM) containing"""	9897	protein-coding gene	gene with protein product						12036298	Standard	NM_144770		Approved		uc002yjo.4	P57052	OTTHUMG00000074263	ENST00000400577.3:c.586G>T	21.37:g.15599354G>T	ENSP00000383421:p.Asp196Tyr	406.0	0.0		434.0	89.0	NM_144770	Q6YNC2|Q8NBA1|Q8NFF6	Missense_Mutation	SNP	ENST00000400577.3	37	CCDS46635.1	.	.	.	.	.	.	.	.	.	.	G	6.836	0.523440	0.13066	.	.	ENSG00000185272	ENST00000400577	T	0.09350	2.99	1.87	1.87	0.25490	.	0.067005	0.64402	D	0.000010	T	0.12689	0.0308	N	0.08118	0	0.25653	N	0.986073	D	0.71674	0.998	D	0.69654	0.965	T	0.09443	-1.0674	10	0.59425	D	0.04	.	11.1988	0.48728	0.0:0.0:1.0:0.0	.	196	P57052	RBM11_HUMAN	Y	196	ENSP00000383421:D196Y	ENSP00000383421:D196Y	D	+	1	0	RBM11	14521225	0.107000	0.21998	0.112000	0.21494	0.343000	0.28985	1.259000	0.32956	1.330000	0.45394	0.195000	0.17529	GAC	G|0.988;A|0.012		0.468	RBM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157818.1	NM_144770	
RGS12	6002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3318591	3318591	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr4:3318591G>A	ENST00000344733.5	+	2	1598	c.694G>A	c.(694-696)Gtg>Atg	p.V232M	RGS12_ENST00000382788.3_Missense_Mutation_p.V232M|RGS12_ENST00000543385.1_Missense_Mutation_p.V232M|RGS12_ENST00000336727.3_Missense_Mutation_p.V232M	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	232	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGCGATGATCGTGGGCTACTT	0.493																																					p.V232M		.											.	RGS12	226	0			c.G694A						.						76.0	70.0	72.0					4																	3318591		2203	4300	6503	SO:0001583	missense	6002	exon2			ATGATCGTGGGCT	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.694G>A	4.37:g.3318591G>A	ENSP00000339381:p.Val232Met	167.0	0.0		199.0	39.0	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	37	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939510	0.52972	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	T;T;T;T	0.31510	1.49;1.91;1.91;1.91	4.54	4.54	0.55810	Phosphotyrosine interaction domain (2);Pleckstrin homology-type (1);	0.068416	0.56097	D	0.000022	T	0.60534	0.2276	M	0.84846	2.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.69300	-0.5181	10	0.87932	D	0	-27.967	16.2746	0.82638	0.0:0.0:1.0:0.0	.	232;232;232	Q8WX97;O14924;O14924-4	.;RGS12_HUMAN;.	M	232	ENSP00000440566:V232M;ENSP00000339381:V232M;ENSP00000338509:V232M;ENSP00000372238:V232M	ENSP00000338509:V232M	V	+	1	0	RGS12	3288389	1.000000	0.71417	0.997000	0.53966	0.124000	0.20399	9.493000	0.97960	2.071000	0.62044	0.491000	0.48974	GTG	.		0.493	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
RNF113A	7737	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	119005302	119005302	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chrX:119005302T>A	ENST00000371442.2	-	1	489	c.275A>T	c.(274-276)gAg>gTg	p.E92V	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	92	Poly-Glu.						zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						ACTCTCGGGCTCATTTTCCTC	0.547																																					p.E92V		.											.	RNF113A	129	0			c.A275T						.						163.0	162.0	162.0					X																	119005302		2203	4300	6503	SO:0001583	missense	7737	exon1			TCGGGCTCATTTT	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.275A>T	X.37:g.119005302T>A	ENSP00000360497:p.Glu92Val	178.0	0.0		167.0	10.0	NM_006978	B2RBR7	Missense_Mutation	SNP	ENST00000371442.2	37	CCDS14589.1	.	.	.	.	.	.	.	.	.	.	T	8.051	0.766053	0.15983	.	.	ENSG00000125352	ENST00000371442	T	0.34275	1.37	5.49	3.04	0.35103	.	0.582240	0.18241	N	0.147224	T	0.34106	0.0886	M	0.73962	2.25	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31475	-0.9942	10	0.35671	T	0.21	-33.4748	5.5105	0.16878	0.0:0.0898:0.332:0.5783	.	92	O15541	R113A_HUMAN	V	92	ENSP00000360497:E92V	ENSP00000360497:E92V	E	-	2	0	RNF113A	118889330	0.001000	0.12720	0.001000	0.08648	0.304000	0.27724	0.693000	0.25497	0.235000	0.21160	-0.378000	0.06908	GAG	.		0.547	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058071.1	NM_006978	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	23912521	23912521	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr13:23912521A>T	ENST00000382292.3	-	9	5767	c.5494T>A	c.(5494-5496)Ttt>Att	p.F1832I	SACS_ENST00000382298.3_Missense_Mutation_p.F1832I|SACS_ENST00000402364.1_Missense_Mutation_p.F1082I			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1832					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTCAGGGAAAACTTCAGAGCC	0.488																																					p.F1832I		.											.	SACS	298	0			c.T5494A						.						133.0	130.0	131.0					13																	23912521		2203	4299	6502	SO:0001583	missense	26278	exon10			GGGAAAACTTCAG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.5494T>A	13.37:g.23912521A>T	ENSP00000371729:p.Phe1832Ile	91.0	0.0		89.0	8.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	A	34	5.296623	0.95574	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87412	-2.15;-2.25;-2.15	5.75	5.75	0.90469	.	0.052901	0.85682	N	0.000000	D	0.89171	0.6639	M	0.65975	2.015	0.53005	D	0.999968	D	0.54601	0.967	P	0.50314	0.637	D	0.87984	0.2745	10	0.31617	T	0.26	.	16.0591	0.80826	1.0:0.0:0.0:0.0	.	1832	Q9NZJ4	SACS_HUMAN	I	1832;1082;1832	ENSP00000371729:F1832I;ENSP00000385844:F1082I;ENSP00000371735:F1832I	ENSP00000371729:F1832I	F	-	1	0	SACS	22810521	1.000000	0.71417	0.973000	0.42090	0.960000	0.62799	8.962000	0.93254	2.190000	0.69967	0.482000	0.46254	TTT	.		0.488	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
SPRR2E	6704	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	153066128	153066128	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr1:153066128C>T	ENST00000368751.1	-	2	174	c.100G>A	c.(100-102)Gag>Aag	p.E34K	SPRR2E_ENST00000368750.3_Missense_Mutation_p.E34K|SPRR2B_ENST00000368752.4_Intron			P22531	SPR2E_HUMAN	small proline-rich protein 2E	34	3 X 9 AA tandem repeats of P-K-C-P-[EQ]- P-C-P-P.				epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGGCAGGGCTCAGGGCACTTC	0.617																																					p.E34K		.											.	SPRR2E	69	0			c.G100A						.						114.0	114.0	114.0					1																	153066128		2203	4297	6500	SO:0001583	missense	6704	exon2			AGGGCTCAGGGCA	AF333955	CCDS30866.1	1q21-q22	2008-02-05			ENSG00000203785	ENSG00000203785			11265	protein-coding gene	gene with protein product						8325635	Standard	NM_001024209		Approved		uc001fbh.3	P22531	OTTHUMG00000014397	ENST00000368751.1:c.100G>A	1.37:g.153066128C>T	ENSP00000357740:p.Glu34Lys	179.0	1.0		184.0	44.0	NM_001024209	Q5T9T4|Q96RM2	Missense_Mutation	SNP	ENST00000368751.1	37	CCDS30866.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780038	0.31502	.	.	ENSG00000203785	ENST00000368751;ENST00000368750	T;T	0.43688	0.94;0.94	4.3	3.31	0.37934	.	0.000000	0.33040	N	0.005357	T	0.14442	0.0349	.	.	.	0.09310	N	1	P	0.36535	0.557	B	0.31191	0.125	T	0.07635	-1.0762	9	0.87932	D	0	.	8.6249	0.33883	0.2285:0.7715:0.0:0.0	.	34	P22531	SPR2E_HUMAN	K	34	ENSP00000357740:E34K;ENSP00000357739:E34K	ENSP00000357739:E34K	E	-	1	0	SPRR2E	151332752	0.002000	0.14202	0.128000	0.21923	0.233000	0.25261	0.209000	0.17435	1.972000	0.57404	0.405000	0.27470	GAG	.		0.617	SPRR2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040054.1		
SEMA4A	64218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156146462	156146462	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr1:156146462G>C	ENST00000368285.3	+	15	2227	c.1960G>C	c.(1960-1962)Gca>Cca	p.A654P	SEMA4A_ENST00000355014.2_Missense_Mutation_p.A654P|SEMA4A_ENST00000368286.2_Missense_Mutation_p.A522P|SEMA4A_ENST00000368282.1_Missense_Mutation_p.A654P|SEMA4A_ENST00000368284.1_Missense_Mutation_p.A522P	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	654					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					TCCTGAACTGGCAGGCATCCC	0.612																																					p.A654P		.											.	SEMA4A	228	0			c.G1960C						.						72.0	73.0	73.0					1																	156146462		2203	4300	6503	SO:0001583	missense	64218	exon15			GAACTGGCAGGCA	AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.1960G>C	1.37:g.156146462G>C	ENSP00000357268:p.Ala654Pro	151.0	0.0		143.0	34.0	NM_001193300	B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Missense_Mutation	SNP	ENST00000368285.3	37	CCDS1132.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.112164	0.56398	.	.	ENSG00000196189	ENST00000355014;ENST00000368285;ENST00000368284;ENST00000368283;ENST00000544376;ENST00000368286;ENST00000368282	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.01	4.06	0.47325	.	0.583196	0.16753	N	0.200945	T	0.25158	0.0611	M	0.65975	2.015	0.34490	D	0.704919	P;P	0.48998	0.863;0.918	P;P	0.44477	0.451;0.451	T	0.08269	-1.0730	10	0.23302	T	0.38	.	8.0996	0.30848	0.1216:0.0:0.8784:0.0	.	522;654	Q5TCJ6;Q9H3S1	.;SEM4A_HUMAN	P	654;654;522;616;616;522;654	ENSP00000347117:A654P;ENSP00000357268:A654P;ENSP00000357267:A522P;ENSP00000357269:A522P;ENSP00000357265:A654P	ENSP00000347117:A654P	A	+	1	0	SEMA4A	154413086	0.305000	0.24481	0.937000	0.37676	0.688000	0.40055	3.500000	0.53318	1.032000	0.39892	0.313000	0.20887	GCA	.		0.612	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039484.2	NM_022367	
SYP	6855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49049852	49049852	+	Silent	SNP	C	C	A	rs140804164		TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chrX:49049852C>A	ENST00000263233.4	-	5	564	c.492G>T	c.(490-492)ctG>ctT	p.L164L	SYP_ENST00000479808.1_Silent_p.L164L|SYP_ENST00000538567.1_Silent_p.L46L	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	164	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				TCACATCTGACAGCCCCTTGG	0.562																																					p.L164L		.											.	SYP	556	0			c.G492T						.						101.0	66.0	78.0					X																	49049852		2203	4300	6503	SO:0001819	synonymous_variant	6855	exon5			ATCTGACAGCCCC	X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.492G>T	X.37:g.49049852C>A		298.0	0.0		271.0	43.0	NM_003179	B2R7L6|B7Z359|Q6P2F7	Silent	SNP	ENST00000263233.4	37	CCDS14321.1	.	.	.	.	.	.	.	.	.	.	C	8.367	0.834533	0.16820	.	.	ENSG00000102003	ENST00000472598	.	.	.	5.11	2.3	0.28687	.	.	.	.	.	T	0.45696	0.1355	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29518	-1.0009	4	.	.	.	-22.3663	3.0343	0.06117	0.1432:0.5503:0.1373:0.1692	.	.	.	.	F	54	.	.	C	-	2	0	SYP	48936796	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	1.089000	0.30890	0.539000	0.28788	-0.192000	0.12808	TGT	C|1.000;T|0.000		0.562	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083625.2	NM_003179	
TGS1	96764	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	56699053	56699053	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr8:56699053delA	ENST00000260129.5	+	4	1073	c.596delA	c.(595-597)gaafs	p.E199fs		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	199					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			GAGAAATGGGAAAAGTATTGG	0.378																																					p.E199fs	Esophageal Squamous(34;275 823 4842 34837 48447)	.											.	TGS1	227	0			c.596delA						.						100.0	103.0	102.0					8																	56699053		2203	4300	6503	SO:0001589	frameshift_variant	96764	exon4			AATGGGAAAAGTA	AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.596delA	8.37:g.56699053delA	ENSP00000260129:p.Glu199fs	83.0	0.0		95.0	39.0	NM_024831	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Frame_Shift_Del	DEL	ENST00000260129.5	37	CCDS34894.1																																																																																			.		0.378	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378152.1	NM_024831	
TRPC1	7220	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	142499740	142499740	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr3:142499740C>T	ENST00000476941.1	+	6	1315	c.829C>T	c.(829-831)Cgg>Tgg	p.R277W	TRPC1_ENST00000273482.6_Missense_Mutation_p.R243W	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	277					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TGCACAAGCCCGGAATTCTCG	0.383																																					p.R277W		.											.	TRPC1	92	0			c.C829T						.						91.0	89.0	90.0					3																	142499740		2203	4300	6503	SO:0001583	missense	7220	exon6			CAAGCCCGGAATT	X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.829C>T	3.37:g.142499740C>T	ENSP00000419313:p.Arg277Trp	106.0	0.0		83.0	4.0	NM_001251845	Q14CE4	Missense_Mutation	SNP	ENST00000476941.1	37	CCDS58856.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689611	0.88735	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	T;T	0.63913	-0.07;-0.07	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.76941	0.4058	M	0.64567	1.98	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.947	T	0.78275	-0.2267	10	0.87932	D	0	-19.4836	16.338	0.83073	0.1324:0.8676:0.0:0.0	.	277;243	P48995;P48995-2	TRPC1_HUMAN;.	W	277;243	ENSP00000419313:R277W;ENSP00000273482:R243W	ENSP00000273482:R243W	R	+	1	2	TRPC1	143982430	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.768000	0.68858	2.733000	0.93635	0.655000	0.94253	CGG	.		0.383	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	
TSPEAR	54084	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	45929169	45929169	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr21:45929169T>G	ENST00000323084.4	-	10	1732	c.1667A>C	c.(1666-1668)aAt>aCt	p.N556T	TSPEAR-AS1_ENST00000430181.1_RNA|TSPEAR-AS1_ENST00000451035.1_RNA|TSPEAR_ENST00000397916.1_Missense_Mutation_p.N488T	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	556					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						ATAGGAATCATTCTGGACTTG	0.542																																					p.N556T		.											.	TSPEAR	244	0			c.A1667C						.						220.0	137.0	165.0					21																	45929169		2203	4300	6503	SO:0001583	missense	54084	exon10			GAATCATTCTGGA	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1667A>C	21.37:g.45929169T>G	ENSP00000321987:p.Asn556Thr	268.0	2.0		225.0	42.0	NM_144991		Missense_Mutation	SNP	ENST00000323084.4	37	CCDS13712.1	.	.	.	.	.	.	.	.	.	.	T	5.012	0.187825	0.09547	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000397916;ENST00000341581	T;T	0.14144	2.53;2.55	3.98	2.81	0.32909	.	0.664292	0.15325	N	0.268322	T	0.09598	0.0236	L	0.38531	1.155	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.36286	-0.9754	10	0.18710	T	0.47	-16.943	6.9621	0.24603	0.0:0.087:0.1602:0.7528	.	556	Q8WU66	TSEAR_HUMAN	T	556;409;488;557	ENSP00000321987:N556T;ENSP00000381012:N488T	ENSP00000321987:N556T	N	-	2	0	TSPEAR	44753597	0.035000	0.19736	0.008000	0.14137	0.135000	0.20990	1.021000	0.30040	0.654000	0.30846	0.456000	0.33151	AAT	.		0.542	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991	
TTC28	23331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	28378887	28378887	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr22:28378887C>G	ENST00000397906.2	-	23	6909	c.6768G>C	c.(6766-6768)gaG>gaC	p.E2256D	TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000417497.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2256	Ser-rich.				mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						TGATGGACATCTCTGAGGTGG	0.587																																					p.E2256D		.											.	.	.	0			c.G6768C						.						22.0	25.0	24.0					22																	28378887		692	1591	2283	SO:0001583	missense	23331	exon23			GGACATCTCTGAG	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.6768G>C	22.37:g.28378887C>G	ENSP00000381003:p.Glu2256Asp	141.0	0.0		185.0	66.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	37	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062915	0.36373	.	.	ENSG00000100154	ENST00000397906	D	0.90197	-2.63	5.23	3.07	0.35406	.	0.000000	0.85682	D	0.000000	D	0.83096	0.5180	L	0.34521	1.04	0.41740	D	0.989602	B	0.13145	0.007	B	0.09377	0.004	T	0.79359	-0.1836	10	0.66056	D	0.02	-20.2271	6.8675	0.24102	0.1493:0.7033:0.0:0.1474	.	2256	Q96AY4	TTC28_HUMAN	D	2256	ENSP00000381003:E2256D	ENSP00000381003:E2256D	E	-	3	2	TTC28	26708887	0.991000	0.36638	0.344000	0.25628	0.095000	0.18619	1.836000	0.39191	1.318000	0.45170	0.655000	0.94253	GAG	.		0.587	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
USP6	9098	hgsc.bcm.edu;ucsc.edu	37	17	5042895	5042895	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr17:5042895G>A	ENST00000574788.1	+	22	3654	c.1424G>A	c.(1423-1425)tGg>tAg	p.W475*	USP6_ENST00000332776.4_Nonsense_Mutation_p.W475*|USP6_ENST00000304328.5_Nonsense_Mutation_p.W158*|USP6_ENST00000250066.6_Nonsense_Mutation_p.W475*			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	475			W -> R (in dbSNP:rs8073787). {ECO:0000269|PubMed:1565468}.		cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)	p.W475*(1)|p.R475Q(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GATTTTGAATGGAGCTGCTGG	0.592			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.W475X		.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	662	2	Substitution - Missense(1)|Substitution - Nonsense(1)	breast(2)	c.G1424A						.						47.0	52.0	51.0					17																	5042895		2203	4300	6503	SO:0001587	stop_gained	9098	exon14			TTGAATGGAGCTG	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.1424G>A	17.37:g.5042895G>A	ENSP00000460380:p.Trp475*	29.0	0.0		46.0	8.0	NM_004505	Q15634|Q86WP6|Q8IWT4	Nonsense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	G	48	14.206262	0.99784	.	.	ENSG00000129204	ENST00000332776;ENST00000250066;ENST00000304328	.	.	.	0.266	-0.532	0.11890	.	0.115600	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	.	.	.	.	.	.	.	X	475;475;158	.	ENSP00000250066:W475X	W	+	2	0	USP6	4983619	0.121000	0.22262	0.003000	0.11579	0.003000	0.03518	-0.046000	0.11983	-1.259000	0.02468	-1.242000	0.01536	TGG	.		0.592	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
UNC45B	146862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33486549	33486549	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr17:33486549T>A	ENST00000268876.5	+	8	1061	c.964T>A	c.(964-966)Tat>Aat	p.Y322N	UNC45B_ENST00000378449.1_Missense_Mutation_p.Y322N|UNC45B_ENST00000394570.2_Missense_Mutation_p.Y322N|UNC45B_ENST00000591048.1_Missense_Mutation_p.Y322N|UNC45B_ENST00000433649.1_Missense_Mutation_p.Y322N	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	322					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				ACGTACCATCTATGTGGTGGA	0.512																																					p.Y322N		.											.	UNC45B	157	0			c.T964A						.						104.0	89.0	94.0					17																	33486549		2203	4300	6503	SO:0001583	missense	146862	exon8			ACCATCTATGTGG	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.964T>A	17.37:g.33486549T>A	ENSP00000268876:p.Tyr322Asn	71.0	0.0		76.0	16.0	NM_001267052	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.325637	0.81580	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T;T	0.06933	3.24;3.24;3.24;3.25	5.61	5.61	0.85477	Armadillo-like helical (1);	0.108919	0.64402	D	0.000006	T	0.12263	0.0298	N	0.08118	0	0.52501	D	0.999956	D;D;P	0.67145	0.996;0.963;0.642	P;P;B	0.62184	0.899;0.532;0.366	T	0.30238	-0.9985	10	0.87932	D	0	-8.8596	15.283	0.73801	0.0:0.0:0.0:1.0	.	322;322;322	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	N	322	ENSP00000378071:Y322N;ENSP00000268876:Y322N;ENSP00000412840:Y322N;ENSP00000367710:Y322N	ENSP00000268876:Y322N	Y	+	1	0	UNC45B	30510662	1.000000	0.71417	0.675000	0.29917	0.968000	0.65278	7.055000	0.76656	2.254000	0.74563	0.533000	0.62120	TAT	.		0.512	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
UTP15	84135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	72874667	72874667	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr5:72874667G>T	ENST00000296792.4	+	10	1391	c.1136G>T	c.(1135-1137)aGa>aTa	p.R379I	UTP15_ENST00000508491.1_Missense_Mutation_p.R360I|UTP15_ENST00000543251.1_Missense_Mutation_p.R189I	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	379					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		GCACTCGATAGAGTTCTTGAT	0.353																																					p.R379I		.											.	UTP15	90	0			c.G1136T						.						99.0	102.0	101.0					5																	72874667		2203	4300	6503	SO:0001583	missense	84135	exon10			TCGATAGAGTTCT	AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.1136G>T	5.37:g.72874667G>T	ENSP00000296792:p.Arg379Ile	116.0	0.0		151.0	47.0	NM_032175	B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Missense_Mutation	SNP	ENST00000296792.4	37	CCDS34186.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.54|18.54	3.645207|3.645207	0.67358|0.67358	.|.	.|.	ENSG00000164338|ENSG00000164338	ENST00000509005|ENST00000296792;ENST00000543251;ENST00000508491	.|T;T;T	.|0.42900	.|0.96;0.96;0.96	5.98|5.98	5.98|5.98	0.97165|0.97165	.|U3 small nucleolar RNA-associated protein 15, C-terminal (1);	.|0.135767	.|0.64402	.|D	.|0.000011	.|T	.|0.35711	.|0.0941	L|L	0.50333|0.50333	1.59|1.59	0.52099|0.52099	D|D	0.999941|0.999941	.|P;P	.|0.38677	.|0.512;0.642	.|B;B	.|0.30855	.|0.121;0.121	.|T	.|0.15065	.|-1.0450	.|10	.|0.39692	.|T	.|0.17	.|.	14.7797|14.7797	0.69756|0.69756	0.0:0.2529:0.7471:0.0|0.0:0.2529:0.7471:0.0	.|.	.|360;379	.|B4DXK8;Q8TED0	.|.;UTP15_HUMAN	X|I	406|379;189;360	.|ENSP00000296792:R379I;ENSP00000440796:R189I;ENSP00000424609:R360I	.|ENSP00000296792:R379I	E|R	+|+	1|2	0|0	UTP15|UTP15	72910423|72910423	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	3.615000|3.615000	0.54167|0.54167	2.838000|2.838000	0.97847|0.97847	0.655000|0.655000	0.94253|0.94253	GAG|AGA	.		0.353	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368965.1	NM_032175	
WAS	7454	broad.mit.edu;mdanderson.org	37	X	48547190	48547190	+	Missense_Mutation	SNP	G	G	T	rs267606468		TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chrX:48547190G>T	ENST00000376701.4	+	10	1148	c.1073G>T	c.(1072-1074)gGa>gTa	p.G358V		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	358					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				ACACCCCGGGGACCCCCACCC	0.701			"""Mis, N, F, S"""			lymphoma																															p.G358V		.		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	.	WAS	563	0			c.G1073T	GRCh37	CD043710	WAS	D		.						3.0	4.0	4.0					X																	48547190		1948	3689	5637	SO:0001583	missense	7454	exon10			CCCGGGGACCCCC	AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1073G>T	X.37:g.48547190G>T	ENSP00000365891:p.Gly358Val	17.0	0.0		19.0	5.0	NM_000377	Q9BU11|Q9UNJ9	Missense_Mutation	SNP	ENST00000376701.4	37	CCDS14303.1	.	.	.	.	.	.	.	.	.	.	G	0.530	-0.858199	0.02610	.	.	ENSG00000015285	ENST00000376701	D	0.95656	-3.77	4.3	2.38	0.29361	Wiscott-Aldrich syndrome, C-terminal (1);	1.785120	0.04404	N	0.364751	D	0.92786	0.7706	L	0.46157	1.445	0.21782	N	0.999546	B	0.10296	0.003	B	0.04013	0.001	T	0.80174	-0.1492	10	0.39692	T	0.17	-1.2917	6.5527	0.22444	0.0:0.173:0.4672:0.3598	.	358	P42768	WASP_HUMAN	V	358	ENSP00000365891:G358V	ENSP00000365891:G358V	G	+	2	0	WAS	48432134	.	.	0.497000	0.27552	0.270000	0.26580	.	.	0.181000	0.19994	0.464000	0.42555	GGA	.		0.701	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083379.1	NM_000377	
ZC3H7B	23264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41752683	41752683	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr22:41752683G>C	ENST00000352645.4	+	22	2809	c.2552G>C	c.(2551-2553)aGc>aCc	p.S851T	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.S851T	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	867					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GGCAAGAACAGCAACAGCAAG	0.627																																					p.S851T		.											.	ZC3H7B	90	0			c.G2552C						.						112.0	97.0	102.0					22																	41752683		2203	4300	6503	SO:0001583	missense	23264	exon22			AGAACAGCAACAG		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2552G>C	22.37:g.41752683G>C	ENSP00000345793:p.Ser851Thr	93.0	0.0		117.0	10.0	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	ENST00000352645.4	37	CCDS14013.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218823	0.79464	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.40756	1.02;1.02	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.58821	0.2149	L	0.43152	1.355	0.54753	D	0.999987	D	0.63046	0.992	D	0.69824	0.966	T	0.57493	-0.7802	10	0.52906	T	0.07	-31.4131	19.4454	0.94844	0.0:0.0:1.0:0.0	.	851	Q9UGR2-2	.	T	851	ENSP00000345793:S851T;ENSP00000263243:S851T	ENSP00000263243:S851T	S	+	2	0	ZC3H7B	40082629	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.762000	0.98944	2.586000	0.87340	0.655000	0.94253	AGC	.		0.627	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu	37	16	72993867	72993867	+	Missense_Mutation	SNP	G	G	A	rs200390317		TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr16:72993867G>A	ENST00000268489.5	-	2	850	c.178C>T	c.(178-180)Cgc>Tgc	p.R60C	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	60					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TCCGCGAGGCGCTCATTGAAG	0.667													G|||	1	0.000199681	0.0	0.0014	5008	,	,		11900	0.0		0.0	False		,,,				2504	0.0				p.R60C		.											.	ZFHX3	72	0			c.C178T						.						53.0	56.0	55.0					16																	72993867		2197	4300	6497	SO:0001583	missense	463	exon2			CGAGGCGCTCATT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.178C>T	16.37:g.72993867G>A	ENSP00000268489:p.Arg60Cys	21.0	0.0		28.0	9.0	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	10.81	1.455455	0.26161	.	.	ENSG00000140836	ENST00000268489	T	0.73575	-0.76	5.11	5.11	0.69529	.	0.000000	0.51477	D	0.000097	T	0.58061	0.2096	N	0.14661	0.345	0.80722	D	1	B	0.18166	0.026	B	0.12837	0.008	T	0.57189	-0.7854	10	0.51188	T	0.08	.	11.9666	0.53038	0.0793:0.0:0.9207:0.0	.	60	Q15911	ZFHX3_HUMAN	C	60	ENSP00000268489:R60C	ENSP00000268489:R60C	R	-	1	0	ZFHX3	71551368	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.410000	0.44592	2.379000	0.81126	0.462000	0.41574	CGC	G|0.999;A|0.000		0.667	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZNF217	7764	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	52198139	52198139	+	Silent	SNP	G	G	C			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr20:52198139G>C	ENST00000371471.2	-	2	1652	c.1227C>G	c.(1225-1227)acC>acG	p.T409T	ZNF217_ENST00000540425.1_5'Flank|ZNF217_ENST00000302342.3_Silent_p.T409T			O75362	ZN217_HUMAN	zinc finger protein 217	409					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CCACAGACATGGTGGGCGACT	0.632																																					p.T409T		.											.	ZNF217	723	0			c.C1227G						.						45.0	48.0	47.0					20																	52198139		2203	4300	6503	SO:0001819	synonymous_variant	7764	exon1			AGACATGGTGGGC	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1227C>G	20.37:g.52198139G>C		58.0	0.0		76.0	10.0	NM_006526	E1P5Y6|Q14DB8	Silent	SNP	ENST00000371471.2	37	CCDS13443.1																																																																																			.		0.632	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
ZNF410	57862	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	74364881	74364881	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr14:74364881C>T	ENST00000555044.1	+	5	690	c.496C>T	c.(496-498)Ctc>Ttc	p.L166F	ZNF410_ENST00000442160.3_Missense_Mutation_p.L183F|ZNF410_ENST00000556797.1_Missense_Mutation_p.L113F|ZNF410_ENST00000334521.4_Missense_Mutation_p.L113F|ZNF410_ENST00000412490.3_3'UTR|RP5-1021I20.5_ENST00000554009.1_RNA|RP5-1021I20.4_ENST00000556551.2_3'UTR|ZNF410_ENST00000540593.1_Missense_Mutation_p.L93F|ZNF410_ENST00000324593.6_Missense_Mutation_p.L166F	NM_001242928.1|NM_021188.2	NP_001229857.1|NP_067011.1	Q86VK4	ZN410_HUMAN	zinc finger protein 410	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.00369)		TCCATGGTTCCTCCGGGTTCA	0.507																																					p.L183F		.											.	ZNF410	91	0			c.C547T						.						142.0	123.0	129.0					14																	74364881		2203	4300	6503	SO:0001583	missense	57862	exon6			TGGTTCCTCCGGG	U90919	CCDS9821.1, CCDS55929.1, CCDS55930.1, CCDS55931.1	14q24.3	2013-01-08				ENSG00000119725		"""Zinc fingers, C2H2-type"""	20144	protein-coding gene	gene with protein product						12370286	Standard	NM_001242924		Approved	APA1, APA-1	uc010arz.2	Q86VK4		ENST00000555044.1:c.496C>T	14.37:g.74364881C>T	ENSP00000451763:p.Leu166Phe	130.0	2.0		198.0	65.0	NM_001242924	B4DDV5|B4DR78|O00153|Q9BQ19	Missense_Mutation	SNP	ENST00000555044.1	37	CCDS9821.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.716002	0.68844	.	.	ENSG00000119725	ENST00000540593;ENST00000324593;ENST00000557363;ENST00000458102;ENST00000442160;ENST00000555044;ENST00000334521;ENST00000556797	T;T;T;T;T	0.12255	2.82;2.82;2.78;2.7;2.74	5.17	3.14	0.36123	.	0.504623	0.14797	N	0.297875	T	0.13072	0.0317	L	0.29908	0.895	0.54753	D	0.999982	D;D;P;P	0.54964	0.969;0.969;0.835;0.745	P;P;B;B	0.50490	0.621;0.642;0.367;0.202	T	0.08932	-1.0698	10	0.59425	D	0.04	.	3.7117	0.08423	0.1516:0.5705:0.1312:0.1467	.	93;183;166;166	B4DR78;B4DDV5;Q86VK4-3;Q86VK4	.;.;.;ZN410_HUMAN	F	93;166;113;155;183;166;113;113	ENSP00000442228:L93F;ENSP00000323293:L166F;ENSP00000407130:L183F;ENSP00000451763:L166F;ENSP00000334170:L113F	ENSP00000323293:L166F	L	+	1	0	ZNF410	73434634	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.856000	0.48341	1.354000	0.45846	0.655000	0.94253	CTC	.		0.507	ZNF410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412597.1	NM_021188	
ZNF99	7652	broad.mit.edu;ucsc.edu	37	19	22940429	22940429	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4ND-01A-11D-A25V-10	TCGA-DD-A4ND-11A-11D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	d9c5493e-f969-4c04-a646-9a3134011021	40381948-7dff-4254-8b81-bb6f34579ebf	g.chr19:22940429C>G	ENST00000596209.1	-	4	2372	c.2282G>C	c.(2281-2283)tGc>tCc	p.C761S	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.C670S	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	761					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C670S(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTCACATTTGCAGGGTTTCTC	0.358																																					p.C761S		.											.	ZNF99	24	1	Substitution - Missense(1)	lung(1)	c.G2282C						.																																			SO:0001583	missense	7652	exon4			CATTTGCAGGGTT	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2282G>C	19.37:g.22940429C>G	ENSP00000472969:p.Cys761Ser	13.0	0.0		15.0	4.0	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	c	3.041	-0.197479	0.06259	.	.	ENSG00000213973	ENST00000397104	T	0.14640	2.49	0.718	-1.22	0.09494	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08980	0.0222	N	0.16656	0.425	0.09310	N	1	B	0.30824	0.296	B	0.39660	0.306	T	0.40701	-0.9549	9	0.72032	D	0.01	.	1.9738	0.03412	0.2626:0.2044:0.0:0.533	.	670	A8MXY4	ZNF99_HUMAN	S	670	ENSP00000380293:C670S	ENSP00000380293:C670S	C	-	2	0	ZNF99	22732269	0.000000	0.05858	0.001000	0.08648	0.140000	0.21249	-0.888000	0.04148	-0.230000	0.09840	-0.741000	0.03529	TGC	.		0.358	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
