#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA1	19	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107547843	107547843	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr9:107547843C>G	ENST00000374736.3	-	49	6873	c.6479G>C	c.(6478-6480)gGa>gCa	p.G2160A		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	2160					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	AAATGCAAGTCCAAAGAAATC	0.438																																					p.G2160A		.											.	ABCA1	1016	0			c.G6479C						.						100.0	102.0	102.0					9																	107547843		2203	4300	6503	SO:0001583	missense	19	exon49			GCAAGTCCAAAGA	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.6479G>C	9.37:g.107547843C>G	ENSP00000363868:p.Gly2160Ala	84.0	0.0		60.0	7.0	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	9.251	1.040816	0.19669	.	.	ENSG00000165029	ENST00000374736	D	0.82526	-1.62	6.0	4.08	0.47627	.	0.215214	0.49916	D	0.000138	T	0.60196	0.2250	N	0.02802	-0.49	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.50600	-0.8809	10	0.12430	T	0.62	.	10.5915	0.45312	0.0:0.7862:0.0:0.2138	.	2160	O95477	ABCA1_HUMAN	A	2160	ENSP00000363868:G2160A	ENSP00000363868:G2160A	G	-	2	0	ABCA1	106587664	0.998000	0.40836	1.000000	0.80357	0.985000	0.73830	1.613000	0.36900	0.794000	0.33899	0.650000	0.86243	GGA	.		0.438	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
ABCC10	89845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43406411	43406411	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr6:43406411G>A	ENST00000372530.4	+	8	2220	c.2005G>A	c.(2005-2007)Gcc>Acc	p.A669T	ABCC10_ENST00000244533.3_Missense_Mutation_p.A641T	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	669	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	CTTTGGCCTGGCCACCCAGGA	0.592																																					p.A669T		.											.	ABCC10	96	0			c.G2005A						.						101.0	96.0	98.0					6																	43406411		2203	4300	6503	SO:0001583	missense	89845	exon8			GGCCTGGCCACCC	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.2005G>A	6.37:g.43406411G>A	ENSP00000361608:p.Ala669Thr	41.0	0.0		103.0	19.0	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	ENST00000372530.4	37	CCDS56430.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810282	0.90707	.	.	ENSG00000124574	ENST00000372515;ENST00000372530;ENST00000244533	D;D;D	0.90676	-2.71;-2.71;-2.71	5.61	5.61	0.85477	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.132335	0.49916	D	0.000128	D	0.90000	0.6878	L	0.58510	1.815	0.51482	D	0.999926	P;P	0.40794	0.729;0.659	B;P	0.45971	0.439;0.499	D	0.90438	0.4429	10	0.56958	D	0.05	-44.5866	19.6435	0.95767	0.0:0.0:1.0:0.0	.	641;669	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	T	225;669;641	ENSP00000361593:A225T;ENSP00000361608:A669T;ENSP00000244533:A641T	ENSP00000244533:A641T	A	+	1	0	ABCC10	43514389	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.799000	0.85936	2.640000	0.89533	0.655000	0.94253	GCC	.		0.592	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
ADAM8	101	broad.mit.edu;ucsc.edu	37	10	135084292	135084292	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:135084292C>T	ENST00000445355.3	-	15	1632	c.1582G>A	c.(1582-1584)Gag>Aag	p.E528K	ADAM8_ENST00000485491.2_Missense_Mutation_p.E489K|ADAM8_ENST00000415217.3_Missense_Mutation_p.E528K|ADAM8_ENST00000559180.1_5'Flank	NM_001109.4	NP_001100.3	P78325	ADAM8_HUMAN	ADAM metallopeptidase domain 8	528					activation of MAPK activity involved in innate immune response (GO:0035419)|angiogenesis (GO:0001525)|cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration involved in inflammatory response (GO:0002523)|lymphocyte chemotaxis (GO:0048247)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell adhesion (GO:0045785)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of fibronectin-dependent thymocyte migration (GO:2000415)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neutrophil extravasation (GO:2000391)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein processing (GO:0010954)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|regulation of cell-cell adhesion (GO:0022407)|single organismal cell-cell adhesion (GO:0016337)	alpha9-beta1 integrin-ADAM8 complex (GO:0071133)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dense core granule membrane (GO:0032127)|integral component of plasma membrane (GO:0005887)|phagolysosome (GO:0032010)|plasma membrane (GO:0005886)|podosome (GO:0002102)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein self-association (GO:0043621)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)	17		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)		AAGCAGGACTCCTCGGCAGCC	0.662																																					p.E528K		.											.	ADAM8	90	0			c.G1582A						.						25.0	24.0	24.0					10																	135084292		2190	4298	6488	SO:0001583	missense	101	exon15			AGGACTCCTCGGC	D26579	CCDS31319.2, CCDS58102.1, CCDS58103.1	10q26.3	2014-03-20	2005-08-18		ENSG00000151651	ENSG00000151651		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	215	protein-coding gene	gene with protein product		602267	"""a disintegrin and metalloproteinase domain 8"""			9126482	Standard	NM_001109		Approved	CD156, MS2, CD156a	uc021qbe.1	P78325	OTTHUMG00000019309	ENST00000445355.3:c.1582G>A	10.37:g.135084292C>T	ENSP00000453302:p.Glu528Lys	65.0	1.0		77.0	11.0	NM_001164489	B4DVM6|H0YL36|H0YLR0|H0YN39	Missense_Mutation	SNP	ENST00000445355.3	37	CCDS31319.2																																																																																			.		0.662	ADAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051118.4	NM_001109	
ALOX12B	242	broad.mit.edu;bcgsc.ca	37	17	7980386	7980386	+	Silent	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr17:7980386C>T	ENST00000319144.4	-	9	1457	c.1197G>A	c.(1195-1197)ctG>ctA	p.L399L	ALOX12B_ENST00000577351.1_5'UTR|AC129492.6_ENST00000399413.3_5'Flank	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	399	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						GTGTCTCCAGCAGGTGGGCGA	0.612										Multiple Myeloma(8;0.094)																											p.L399L		.											.	ALOX12B	226	0			c.G1197A						.						59.0	49.0	52.0					17																	7980386		2203	4300	6503	SO:0001819	synonymous_variant	242	exon9			CTCCAGCAGGTGG	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.1197G>A	17.37:g.7980386C>T		53.0	0.0		60.0	4.0	NM_001139		Silent	SNP	ENST00000319144.4	37	CCDS11129.1																																																																																			.		0.612	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3		
ANKRD30A	91074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	37506693	37506693	+	Silent	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:37506693T>C	ENST00000602533.1	+	33	3085	c.2986T>C	c.(2986-2988)Tta>Cta	p.L996L	ANKRD30A_ENST00000361713.1_Silent_p.L996L|ANKRD30A_ENST00000374660.1_Silent_p.L1115L			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1052					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TAGGGAAGAATTAGGAAGAAT	0.323																																					p.L996L		.											.	ANKRD30A	161	0			c.T2986C						.						61.0	61.0	61.0					10																	37506693		1804	4062	5866	SO:0001819	synonymous_variant	91074	exon33			GAAGAATTAGGAA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2986T>C	10.37:g.37506693T>C		279.0	0.0		217.0	46.0	NM_052997	Q5W025	Silent	SNP	ENST00000602533.1	37																																																																																				.		0.323	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
APBB1	322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6422643	6422643	+	Missense_Mutation	SNP	C	C	G	rs142613637		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:6422643C>G	ENST00000609360.1	-	11	1619	c.1520G>C	c.(1519-1521)cGt>cCt	p.R507P	APBB1_ENST00000389906.2_Missense_Mutation_p.R507P|APBB1_ENST00000608645.1_Missense_Mutation_p.R248P|APBB1_ENST00000609331.1_Missense_Mutation_p.R272P|APBB1_ENST00000608394.1_Missense_Mutation_p.R248P|APBB1_ENST00000530885.1_Missense_Mutation_p.R285P|APBB1_ENST00000299402.6_Missense_Mutation_p.R505P|APBB1_ENST00000608655.1_Missense_Mutation_p.R287P|APBB1_ENST00000608704.1_Missense_Mutation_p.R248P|APBB1_ENST00000529519.1_Missense_Mutation_p.R32P|APBB1_ENST00000311051.3_Missense_Mutation_p.R505P	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	507	PID 1. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		GCGGGCATTACGCCGTTCGGC	0.567																																					p.R507P	GBM(147;1810 2556 5672 39622)	.											.	APBB1	136	0			c.G1520C						.	C	PRO/ARG,PRO/ARG	0,4402		0,0,2201	65.0	60.0	62.0		1520,1514	4.9	1.0	11	dbSNP_134	62	1,8591	1.2+/-3.3	0,1,4295	no	missense,missense	APBB1	NM_001164.2,NM_145689.1	103,103	0,1,6496	GG,GC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	507/711,505/709	6422643	1,12993	2201	4296	6497	SO:0001583	missense	322	exon10			GCATTACGCCGTT	L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.1520G>C	11.37:g.6422643C>G	ENSP00000477213:p.Arg507Pro	48.0	0.0		38.0	16.0	NM_001164	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	ENST00000609360.1	37		.	.	.	.	.	.	.	.	.	.	C	16.58	3.162721	0.57368	0.0	1.16E-4	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758;ENST00000536523;ENST00000544288;ENST00000530885	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	4.94	4.94	0.65067	Phosphotyrosine interaction domain (3);	0.164923	0.41097	D	0.000957	T	0.38401	0.1039	L	0.43923	1.385	0.45762	D	0.998657	D;D;D;D	0.89917	1.0;0.998;0.994;0.999	D;D;D;D	0.72338	0.977;0.931;0.912;0.971	T	0.09997	-1.0649	10	0.52906	T	0.07	-6.0845	15.6382	0.76973	0.0:1.0:0.0:0.0	.	110;507;285;505	B7Z4M4;O00213;B7Z2Y0;O00213-2	.;APBB1_HUMAN;.;.	P	505;505;507;356;248;272;285	ENSP00000299402:R505P;ENSP00000311912:R505P;ENSP00000374556:R507P;ENSP00000433338:R285P	ENSP00000299402:R505P	R	-	2	0	APBB1	6379219	0.739000	0.28196	1.000000	0.80357	0.997000	0.91878	1.084000	0.30828	2.269000	0.75478	0.655000	0.94253	CGT	C|1.000;G|0.000		0.567	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164	
ASIC5	51802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	156784657	156784657	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr4:156784657T>A	ENST00000537611.2	-	2	336	c.290A>T	c.(289-291)gAg>gTg	p.E97V	TDO2_ENST00000506181.1_Intron	NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	97					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										ATATTGAACCTCAATGGACGT	0.393																																					p.E97V		.											.	.	.	0			c.A290T						.						85.0	73.0	77.0					4																	156784657		2203	4300	6503	SO:0001583	missense	51802	exon2			TGAACCTCAATGG	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.290A>T	4.37:g.156784657T>A	ENSP00000442477:p.Glu97Val	99.0	0.0		104.0	19.0	NM_017419		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	T	8.227	0.803802	0.16467	.	.	ENSG00000256394	ENST00000537611	T	0.65732	-0.17	4.34	3.12	0.35913	.	1.299300	0.05484	N	0.555311	T	0.56529	0.1991	L	0.52126	1.63	0.09310	N	0.999997	B	0.14438	0.01	B	0.18263	0.021	T	0.41233	-0.9520	10	0.34782	T	0.22	-25.0944	6.5124	0.22228	0.1898:0.0:0.1295:0.6807	.	97	Q9NY37	ACCN5_HUMAN	V	97	ENSP00000442477:E97V	ENSP00000264432:E97V	E	-	2	0	ACCN5	157004107	0.426000	0.25506	0.101000	0.21167	0.855000	0.48748	1.320000	0.33666	0.761000	0.33130	0.528000	0.53228	GAG	.		0.393	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
ATAD2	29028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	124361670	124361670	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr8:124361670G>A	ENST00000287394.5	-	14	1768	c.1661C>T	c.(1660-1662)aCc>aTc	p.T554I	MIR548AA1_ENST00000384971.2_RNA|ATAD2_ENST00000521903.1_Intron	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	554					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			AGCTAGCAGGGTGGAAACAAT	0.358																																					p.T554I		.											.	ATAD2	92	0			c.C1661T						.						97.0	92.0	93.0					8																	124361670		2203	4300	6503	SO:0001583	missense	29028	exon14			AGCAGGGTGGAAA	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1661C>T	8.37:g.124361670G>A	ENSP00000287394:p.Thr554Ile	51.0	0.0		59.0	31.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979088	0.92982	.	.	ENSG00000156802	ENST00000287394	D	0.93247	-3.19	5.7	5.7	0.88788	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.045489	0.85682	D	0.000000	D	0.95043	0.8395	L	0.31926	0.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95521	0.8594	10	0.87932	D	0	-12.3641	19.8338	0.96646	0.0:0.0:1.0:0.0	.	554	Q6PL18	ATAD2_HUMAN	I	554	ENSP00000287394:T554I	ENSP00000287394:T554I	T	-	2	0	ATAD2	124430851	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.692000	0.91855	0.591000	0.81541	ACC	.		0.358	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
BBS9	27241	broad.mit.edu;bcgsc.ca	37	7	33545255	33545255	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr7:33545255delT	ENST00000242067.6	+	20	2817	c.2296delT	c.(2296-2298)ttgfs	p.L766fs	BBS9_ENST00000396127.2_Frame_Shift_Del_p.L731fs|BBS9_ENST00000354265.4_Frame_Shift_Del_p.L731fs|BBS9_ENST00000355070.2_Frame_Shift_Del_p.L761fs|BBS9_ENST00000350941.3_Frame_Shift_Del_p.L726fs	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	766					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			CACTCAAGAATTGGTAAGGAC	0.463									Bardet-Biedl syndrome																												p.L766fs		.											.	BBS9	230	0			c.2296delT						.						38.0	38.0	38.0					7																	33545255		2203	4300	6503	SO:0001589	frameshift_variant	27241	exon20	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CAAGAATTGGTAA		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.2296delT	7.37:g.33545255delT	ENSP00000242067:p.Leu766fs	42.0	0.0		30.0	7.0	NM_198428	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Frame_Shift_Del	DEL	ENST00000242067.6	37	CCDS43566.1																																																																																			.		0.463	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
C10orf12	26148	broad.mit.edu;bcgsc.ca	37	10	98741247	98741247	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:98741247T>C	ENST00000286067.2	+	1	207	c.100T>C	c.(100-102)Ttc>Ctc	p.F34L		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	34										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAGAAATTTGTTCAAAGCTTT	0.373																																					p.F34L		.											.	C10orf12	92	0			c.T100C						.						74.0	73.0	74.0					10																	98741247		2203	4300	6503	SO:0001583	missense	26148	exon1			AATTTGTTCAAAG	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.100T>C	10.37:g.98741247T>C	ENSP00000286067:p.Phe34Leu	126.0	0.0		79.0	4.0	NM_015652	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	37	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	T	6.450	0.451227	0.12223	.	.	ENSG00000155640	ENST00000286067	T	0.10099	2.91	5.95	1.06	0.20224	.	0.254272	0.27513	N	0.019022	T	0.05731	0.0150	N	0.24115	0.695	0.28430	N	0.917329	B	0.11235	0.004	B	0.11329	0.006	T	0.26018	-1.0115	10	0.49607	T	0.09	-0.0029	1.6854	0.02840	0.1172:0.205:0.1453:0.5326	.	34	Q8N655	CJ012_HUMAN	L	34	ENSP00000286067:F34L	ENSP00000286067:F34L	F	+	1	0	C10orf12	98731237	0.935000	0.31712	0.822000	0.32727	0.000000	0.00434	0.658000	0.24979	-0.054000	0.13266	-0.327000	0.08410	TTC	.		0.373	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
CCDC168	643677	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	13	103392139	103392139	+	5'Flank	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr13:103392139G>T	ENST00000322527.2	-	0	0					NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168																		TATTCAATTTGAAGTGAGGTA	0.328																																					p.F3636L		.											.	.	.	0			c.C10908A						.						230.0	176.0	192.0					13																	103392139		692	1591	2283	SO:0001631	upstream_gene_variant	643677	exon4			CAATTTGAAGTGA		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287		13.37:g.103392139G>T	Exception_encountered	177.0	0.0		192.0	76.0	NM_001146197	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	37																																																																																				.		0.328	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
CLEC4F	165530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71043685	71043685	+	Silent	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:71043685A>G	ENST00000272367.2	-	4	904	c.828T>C	c.(826-828)aaT>aaC	p.N276N	CLEC4F_ENST00000426626.1_Silent_p.N276N	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	276					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CTTCCAAACTATTTCTTAAAA	0.408																																					p.N276N	Colon(107;10 2157 6841 26035)	.											.	CLEC4F	95	0			c.T828C						.						75.0	79.0	78.0					2																	71043685		2202	4298	6500	SO:0001819	synonymous_variant	165530	exon4			CAAACTATTTCTT	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.828T>C	2.37:g.71043685A>G		250.0	0.0		208.0	110.0	NM_173535	A4QPA5	Silent	SNP	ENST00000272367.2	37	CCDS1910.1																																																																																			.		0.408	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
CDCA7	83879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	174231134	174231134	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:174231134G>A	ENST00000347703.3	+	7	1066	c.922G>A	c.(922-924)Gag>Aag	p.E308K	CDCA7_ENST00000410101.3_Missense_Mutation_p.E343K|CDCA7_ENST00000306721.3_Missense_Mutation_p.E387K|CDCA7_ENST00000410019.3_Missense_Mutation_p.E266K|CDCA7_ENST00000392567.2_Intron	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	308	Mediates transcriptional activity.				apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			TTATGGTGAAGAGGTCAGGGA	0.547																																					p.E387K		.											.	CDCA7	91	0			c.G1159A						.						129.0	120.0	123.0					2																	174231134		2203	4300	6503	SO:0001583	missense	83879	exon8			GGTGAAGAGGTCA	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.922G>A	2.37:g.174231134G>A	ENSP00000272789:p.Glu308Lys	88.0	0.0		94.0	28.0	NM_031942	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	G	36	5.797466	0.96952	.	.	ENSG00000144354	ENST00000347703;ENST00000306721;ENST00000410101;ENST00000410019	T;T;T;T	0.47177	0.85;0.86;0.85;0.86	5.67	5.67	0.87782	Zinc-finger domain of monoamine-oxidase A repressor R1 (1);	0.049200	0.85682	D	0.000000	T	0.57548	0.2061	L	0.31476	0.935	0.80722	D	1	P;P;D;P	0.56521	0.908;0.955;0.976;0.887	P;D;P;P	0.63113	0.881;0.911;0.867;0.7	T	0.55515	-0.8129	10	0.45353	T	0.12	-25.6724	19.773	0.96379	0.0:0.0:1.0:0.0	.	266;343;308;387	B4DLP8;B4DV66;Q9BWT1;Q9BWT1-2	.;.;CDCA7_HUMAN;.	K	308;387;343;266	ENSP00000272789:E308K;ENSP00000306968:E387K;ENSP00000386656:E343K;ENSP00000386833:E266K	ENSP00000306968:E387K	E	+	1	0	CDCA7	173939380	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.831000	0.99420	2.677000	0.91161	0.655000	0.94253	GAG	.		0.547	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
CLK4	57396	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	178050338	178050338	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr5:178050338T>C	ENST00000316308.4	-	2	248	c.80A>G	c.(79-81)cAc>cGc	p.H27R	CLK4_ENST00000520957.1_Missense_Mutation_p.H27R	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	27					protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		CTTCCGCTTGTGACTTCCACG	0.418																																					p.H27R		.											.	CLK4	359	0			c.A80G						.						263.0	233.0	243.0					5																	178050338		2203	4300	6503	SO:0001583	missense	57396	exon2			CGCTTGTGACTTC	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.80A>G	5.37:g.178050338T>C	ENSP00000316948:p.His27Arg	108.0	1.0		127.0	70.0	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	37	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.180796	0.57800	.	.	ENSG00000113240	ENST00000316308;ENST00000536763;ENST00000520957	T	0.07114	3.22	5.83	3.47	0.39725	.	0.309656	0.34828	N	0.003652	T	0.06416	0.0165	L	0.39397	1.21	0.31162	N	0.704211	B;B;B;B;B	0.09022	0.0;0.0;0.002;0.0;0.0	B;B;B;B;B	0.09377	0.002;0.001;0.004;0.002;0.0	T	0.30504	-0.9976	10	0.13470	T	0.59	.	7.3412	0.26637	0.0:0.1716:0.0:0.8284	.	27;27;27;27;27	B7Z990;B7ZL31;E7EWJ6;Q4G0Z5;Q9HAZ1	.;.;.;.;CLK4_HUMAN	R	27	ENSP00000316948:H27R	ENSP00000316948:H27R	H	-	2	0	CLK4	177982944	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	1.814000	0.38972	0.489000	0.27749	0.402000	0.26972	CAC	.		0.418	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
CMAS	55907	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	22199469	22199479	+	Frame_Shift_Del	DEL	GCGGCCCTGGA	GCGGCCCTGGA	-			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	GCGGCCCTGGA	GCGGCCCTGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr12:22199469_22199479delGCGGCCCTGGA	ENST00000229329.2	+	1	362_372	c.232_242delGCGGCCCTGGA	c.(232-243)gcggccctggatfs	p.AALD78fs		NM_018686.4	NP_061156.1	Q8NFW8	NEUA_HUMAN	cytidine monophosphate N-acetylneuraminic acid synthetase	78					lipopolysaccharide biosynthetic process (GO:0009103)|N-acetylneuraminate metabolic process (GO:0006054)	membrane (GO:0016020)|nucleus (GO:0005634)	N-acylneuraminate cytidylyltransferase activity (GO:0008781)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24						GGTCCTGCGTGCGGCCCTGGATTCAGGGGCC	0.701																																					p.78_81del		.											.	CMAS	93	0			c.232_242del						.																																			SO:0001589	frameshift_variant	55907	exon1			CTGCGTGCGGCCC	AF271388	CCDS8696.1	12p12.1	2008-08-04			ENSG00000111726	ENSG00000111726			18290	protein-coding gene	gene with protein product	"""CMP-Neu5Ac synthetase"""	603316				8889549, 7566098	Standard	NM_018686		Approved		uc001rfm.4	Q8NFW8	OTTHUMG00000169097	ENST00000229329.2:c.232_242delGCGGCCCTGGA	12.37:g.22199469_22199479delGCGGCCCTGGA	ENSP00000229329:p.Ala78fs	24.0	0.0		83.0	39.0	NM_018686	Q96AX5|Q9NQZ0	Frame_Shift_Del	DEL	ENST00000229329.2	37	CCDS8696.1																																																																																			.		0.701	CMAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402235.1	NM_018686	
COX15	1355	ucsc.edu;bcgsc.ca	37	10	101476143	101476143	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:101476143T>C	ENST00000016171.5	-	8	1113	c.1063A>G	c.(1063-1065)Atg>Gtg	p.M355V	CUTC_ENST00000493385.1_Intron|COX15_ENST00000497381.1_5'UTR|COX15_ENST00000370483.5_Missense_Mutation_p.M355V			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	355					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		ACTGCTGCCATCTTGGTCCTT	0.473																																					p.M355V		.											.	COX15	227	0			c.A1063G						.						136.0	137.0	136.0					10																	101476143		2203	4300	6503	SO:0001583	missense	1355	exon8			CTGCCATCTTGGT	AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.1063A>G	10.37:g.101476143T>C	ENSP00000016171:p.Met355Val	30.0	0.0		31.0	4.0	NM_004376	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Missense_Mutation	SNP	ENST00000016171.5	37	CCDS7482.1	.	.	.	.	.	.	.	.	.	.	T	8.976	0.974087	0.18736	.	.	ENSG00000014919	ENST00000370483;ENST00000016171	D;D	0.82081	-1.57;-1.57	5.59	-1.01	0.10169	.	0.492254	0.25747	N	0.028580	T	0.60830	0.2299	N	0.12853	0.265	0.39571	D	0.969271	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.32241	-0.9914	10	0.15952	T	0.53	-0.2469	6.6087	0.22739	0.0:0.3482:0.1238:0.5279	.	355;355	Q7KZN9-2;Q7KZN9	.;COX15_HUMAN	V	355	ENSP00000359514:M355V;ENSP00000016171:M355V	ENSP00000016171:M355V	M	-	1	0	COX15	101466133	1.000000	0.71417	0.963000	0.40424	0.983000	0.72400	1.164000	0.31810	-0.430000	0.07318	-0.366000	0.07423	ATG	.		0.473	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870	
CPA6	57094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	68658311	68658311	+	Nonsense_Mutation	SNP	G	G	T	rs376152262		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr8:68658311G>T	ENST00000297770.4	-	1	269	c.54C>A	c.(52-54)tgC>tgA	p.C18*	CPA6_ENST00000518549.1_Nonsense_Mutation_p.C18*|CPA6_ENST00000297769.4_De_novo_Start_OutOfFrame	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	18						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			AAAAGAGCCAGCAAAGAGGCA	0.512																																					p.C18X		.											.	CPA6	92	0			c.C54A						.						48.0	48.0	48.0					8																	68658311		2203	4300	6503	SO:0001587	stop_gained	57094	exon1			GAGCCAGCAAAGA	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.54C>A	8.37:g.68658311G>T	ENSP00000297770:p.Cys18*	88.0	0.0		75.0	28.0	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Nonsense_Mutation	SNP	ENST00000297770.4	37	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	G	39	7.869385	0.98534	.	.	ENSG00000165078	ENST00000297770;ENST00000518549	.	.	.	5.62	4.64	0.57946	.	0.390953	0.25078	N	0.033309	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4399	0.21845	0.1512:0.0:0.8488:0.0	.	.	.	.	X	18	.	ENSP00000297770:C18X	C	-	3	2	CPA6	68820865	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.341000	0.52151	2.640000	0.89533	0.655000	0.94253	TGC	.		0.512	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
DCAF8L2	347442	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	27765469	27765469	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chrX:27765469C>T	ENST00000451261.2	+	5	856	c.457C>T	c.(457-459)Cca>Tca	p.P153S		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	153	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						TCGGGCGGGTCCACAAGGCAG	0.617																																					p.P153S		.											.	DCAF8L2	42	0			c.C457T						.						20.0	20.0	20.0					X																	27765469		691	1591	2282	SO:0001583	missense	347442	exon1			GCGGGTCCACAAG		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.457C>T	X.37:g.27765469C>T	ENSP00000462745:p.Pro153Ser	86.0	0.0		68.0	60.0	NM_001136533	B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																			.		0.617	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
DCSTAMP	81501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	105361092	105361092	+	Silent	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr8:105361092G>T	ENST00000297581.2	+	2	361	c.312G>T	c.(310-312)ggG>ggT	p.G104G	DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000517991.1_Silent_p.G104G	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	104					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											CTGGCACAGGGATCGTCATCT	0.438																																					p.G104G		.											.	.	.	0			c.G312T						.						65.0	64.0	65.0					8																	105361092		2203	4300	6503	SO:0001819	synonymous_variant	81501	exon2			CACAGGGATCGTC	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.312G>T	8.37:g.105361092G>T		121.0	0.0		155.0	25.0	NM_001257317	B7ZVW2|E7ESG0|Q2M2D5	Silent	SNP	ENST00000297581.2	37	CCDS6301.1																																																																																			.		0.438	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788	
DGAT1	8694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145540267	145540267	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr8:145540267C>T	ENST00000332324.4	-	17	1690	c.1417G>A	c.(1417-1419)Gtc>Atc	p.V473I	DGAT1_ENST00000527438.1_5'UTR|GS1-393G12.12_ENST00000525023.1_RNA	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	473					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			TAGTCGTGGACGTACATGAGG	0.612																																					p.V473I		.											.	.	.	0			c.G1417A						.						63.0	49.0	53.0					8																	145540267		2197	4295	6492	SO:0001583	missense	8694	exon17			CGTGGACGTACAT	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.1417G>A	8.37:g.145540267C>T	ENSP00000332258:p.Val473Ile	37.0	0.0		69.0	40.0	NM_012079	B2RWQ2|D3DWL6|Q96BB8	Missense_Mutation	SNP	ENST00000332324.4	37	CCDS6420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.618925|4.618925	0.87460|0.87460	.|.	.|.	ENSG00000185000|ENSG00000185000	ENST00000526479|ENST00000332324	.|T	.|0.72394	.|-0.65	4.55|4.55	4.55|4.55	0.56014|0.56014	.|.	.|0.074813	.|0.52532	.|D	.|0.000065	T|T	0.78375|0.78375	0.4273|0.4273	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	D|D	0.69078|0.62365	0.997|0.991	P|P	0.58130|0.56163	0.833|0.793	T|T	0.80301|0.80301	-0.1440|-0.1440	8|10	0.87932|0.52906	D|T	0|0.07	-11.1254|-11.1254	14.8307|14.8307	0.70146|0.70146	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	307|473	E9PS80|O75907	.|DGAT1_HUMAN	H|I	307|473	.|ENSP00000332258:V473I	ENSP00000435883:R307H|ENSP00000332258:V473I	R|V	-|-	2|1	0|0	DGAT1|DGAT1	145511075|145511075	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.807000|0.807000	0.45602|0.45602	4.972000|4.972000	0.63756|0.63756	2.368000|2.368000	0.80403|0.80403	0.561000|0.561000	0.74099|0.74099	CGT|GTC	.		0.612	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382059.3	NM_012079	
DPYSL5	56896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27156166	27156166	+	Missense_Mutation	SNP	C	C	T	rs372829541		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:27156166C>T	ENST00000288699.6	+	7	913	c.755C>T	c.(754-756)tCg>tTg	p.S252L	DPYSL5_ENST00000401478.1_Missense_Mutation_p.S252L	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	252					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.S252L(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAGTATCTCGGCTGGTGAC	0.517																																					p.S252L		.											.	DPYSL5	92	1	Substitution - Missense(1)	lung(1)	c.C755T						.	C	LEU/SER	0,4406		0,0,2203	246.0	178.0	201.0		755	6.0	1.0	2		201	1,8599	1.2+/-3.3	0,1,4299	no	missense	DPYSL5	NM_020134.3	145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	252/565	27156166	1,13005	2203	4300	6503	SO:0001583	missense	56896	exon7			GTATCTCGGCTGG	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.755C>T	2.37:g.27156166C>T	ENSP00000288699:p.Ser252Leu	119.0	0.0		118.0	55.0	NM_001253724	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	37	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303258	0.81136	0.0	1.16E-4	ENSG00000157851	ENST00000288699;ENST00000401478	D;D	0.90385	-2.66;-2.66	6.04	6.04	0.98038	Amidohydrolase 1 (1);	0.110781	0.64402	D	0.000007	D	0.87212	0.6121	L	0.48174	1.505	0.46478	D	0.999068	P	0.40360	0.714	B	0.31390	0.129	D	0.87568	0.2476	10	0.54805	T	0.06	-9.1882	19.3507	0.94384	0.0:1.0:0.0:0.0	.	252	Q9BPU6	DPYL5_HUMAN	L	252	ENSP00000288699:S252L;ENSP00000385549:S252L	ENSP00000288699:S252L	S	+	2	0	DPYSL5	27009670	0.999000	0.42202	0.998000	0.56505	0.991000	0.79684	4.261000	0.58841	2.873000	0.98535	0.561000	0.74099	TCG	.		0.517	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
DUSP27	92235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167096333	167096333	+	Silent	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:167096333G>C	ENST00000361200.2	+	6	2131	c.1965G>C	c.(1963-1965)ggG>ggC	p.G655G	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Silent_p.G655G|DUSP27_ENST00000443333.1_Silent_p.G655G			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	655					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CGGCCAGCGGGAGCATTCCCC	0.642																																					p.G655G		.											.	DUSP27	71	0			c.G1965C						.						46.0	41.0	43.0					1																	167096333		2203	4300	6503	SO:0001819	synonymous_variant	92235	exon5			CAGCGGGAGCATT	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1965G>C	1.37:g.167096333G>C		69.0	0.0		92.0	17.0	NM_001080426	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	CCDS30932.1																																																																																			.		0.642	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
DYNC1H1	1778	broad.mit.edu;mdanderson.org	37	14	102510668	102510668	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr14:102510668G>T	ENST00000360184.4	+	71	12906	c.12742G>T	c.(12742-12744)Gcc>Tcc	p.A4248S	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4248					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GACCTTAATGGCCCAGTCCAT	0.567																																					p.A4248S		.											.	DYNC1H1	98	0			c.G12742T						.						62.0	52.0	55.0					14																	102510668		2203	4300	6503	SO:0001583	missense	1778	exon71			TTAATGGCCCAGT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.12742G>T	14.37:g.102510668G>T	ENSP00000348965:p.Ala4248Ser	49.0	0.0		24.0	3.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	G	8.227	0.803891	0.16467	.	.	ENSG00000197102	ENST00000360184	T	0.07908	3.15	5.38	4.48	0.54585	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.02970	0.0088	N	0.00521	-1.4	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.48375	-0.9041	10	0.28530	T	0.3	.	16.1889	0.81972	0.0:0.1332:0.8668:0.0	.	4248	Q14204	DYHC1_HUMAN	S	4248	ENSP00000348965:A4248S	ENSP00000348965:A4248S	A	+	1	0	DYNC1H1	101580421	1.000000	0.71417	0.998000	0.56505	0.782000	0.44232	7.863000	0.87023	1.256000	0.44068	0.655000	0.94253	GCC	.		0.567	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
DYSF	8291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71892431	71892431	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:71892431A>G	ENST00000258104.3	+	46	5474	c.5197A>G	c.(5197-5199)Ata>Gta	p.I1733V	DYSF_ENST00000410041.1_Missense_Mutation_p.I1751V|DYSF_ENST00000409762.1_Missense_Mutation_p.I1750V|DYSF_ENST00000409366.1_Missense_Mutation_p.I1755V|DYSF_ENST00000394120.2_Missense_Mutation_p.I1734V|DYSF_ENST00000409582.3_Missense_Mutation_p.I1771V|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409651.1_Missense_Mutation_p.I1765V|DYSF_ENST00000409744.1_Missense_Mutation_p.I1741V|DYSF_ENST00000410020.3_Missense_Mutation_p.I1772V|DYSF_ENST00000413539.2_Missense_Mutation_p.I1764V|DYSF_ENST00000429174.2_Missense_Mutation_p.I1754V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1733					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CATTGAAGAGATAGGTGAGCT	0.517																																					p.I1772V		.											.	DYSF	158	0			c.A5314G						.						69.0	67.0	68.0					2																	71892431		2203	4300	6503	SO:0001583	missense	8291	exon47			GAAGAGATAGGTG	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5197A>G	2.37:g.71892431A>G	ENSP00000258104:p.Ile1733Val	48.0	0.0		59.0	33.0	NM_001130987	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	A	11.11	1.542111	0.27563	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.62;-1.62;-1.63;-1.63;-1.63;-1.62;-1.62;-1.62;-1.63	5.41	2.9	0.33743	.	0.181095	0.48767	N	0.000161	T	0.63873	0.2548	N	0.11427	0.14	0.41804	D	0.989933	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.32425	0.001;0.371;0.203;0.171;0.082;0.171;0.004;0.009;0.004;0.371;0.005;0.032;0.036;0.082;0.021	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.34991	0.002;0.193;0.096;0.193;0.096;0.193;0.022;0.022;0.01;0.193;0.064;0.061;0.027;0.096;0.012	T	0.55244	-0.8171	10	0.24483	T	0.36	-3.3791	5.4205	0.16398	0.6056:0.3027:0.0917:0.0	.	497;1765;1772;1755;1720;1751;1741;1750;1740;1764;1771;1754;1719;1734;1733	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	V	1764;1750;1771;1754;1733;1765;1734;1741;1755;1772;1751	ENSP00000407046:I1764V;ENSP00000387137:I1750V;ENSP00000386547:I1771V;ENSP00000398305:I1754V;ENSP00000258104:I1733V;ENSP00000386683:I1765V;ENSP00000377678:I1734V;ENSP00000386285:I1741V;ENSP00000386512:I1755V;ENSP00000386881:I1772V;ENSP00000386617:I1751V	ENSP00000258104:I1733V	I	+	1	0	DYSF	71745939	0.986000	0.35501	0.399000	0.26333	0.586000	0.36452	1.720000	0.38022	0.896000	0.36366	0.533000	0.62120	ATA	.		0.517	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
ENTHD2	146705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79203158	79203158	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr17:79203158G>C	ENST00000300714.3	-	12	1205	c.1148C>G	c.(1147-1149)cCt>cGt	p.P383R	ENTHD2_ENST00000374769.2_Missense_Mutation_p.P299R|AC027601.1_ENST00000569559.1_RNA|AC027601.1_ENST00000575922.1_RNA	NM_144679.2	NP_653280.1	Q96N21	AP4AT_HUMAN	ENTH domain containing 2	383	Pro-rich.					cytoplasmic vesicle (GO:0031410)											CCCAGGGAGAGGCACAGCGTC	0.701																																					p.P383R		.											.	.	.	0			c.C1148G						.						11.0	9.0	10.0					17																	79203158		2164	4270	6434	SO:0001583	missense	146705	exon12			GGGAGAGGCACAG	AK056090	CCDS11779.1	17q25.3	2012-07-18	2012-07-18	2012-07-18	ENSG00000167302	ENSG00000167302			26458	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 56"""	C17orf56			Standard	NM_144679		Approved	FLJ31528	uc002jzu.2	Q96N21	OTTHUMG00000177866	ENST00000300714.3:c.1148C>G	17.37:g.79203158G>C	ENSP00000300714:p.Pro383Arg	138.0	0.0		101.0	40.0	NM_144679	Q6ZQU0|Q6ZSQ9	Missense_Mutation	SNP	ENST00000300714.3	37	CCDS11779.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.517162	0.64634	.	.	ENSG00000167302	ENST00000300714;ENST00000374769	T;T	0.64085	-0.08;-0.08	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000005	T	0.76870	0.4048	M	0.67953	2.075	0.29709	N	0.839528	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.74957	-0.3487	10	0.87932	D	0	-15.6768	15.0886	0.72174	0.0:0.0:1.0:0.0	.	383;299	Q96N21;Q96N21-2	CQ056_HUMAN;.	R	383;299	ENSP00000300714:P383R;ENSP00000363901:P299R	ENSP00000300714:P383R	P	-	2	0	C17orf56	76817753	0.998000	0.40836	0.206000	0.23566	0.255000	0.26057	2.330000	0.43885	2.310000	0.77875	0.591000	0.81541	CCT	.		0.701	ENTHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439315.1	NM_144679	
ETV3L	440695	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	157069139	157069139	+	Silent	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:157069139G>A	ENST00000454449.2	-	2	374	c.90C>T	c.(88-90)gcC>gcT	p.A30A		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	30					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GGGACGACTCGGCTTTGTAGG	0.647																																					p.A30A		.											.	ETV3L	228	0			c.C90T						.						48.0	49.0	48.0					1																	157069139		2203	4300	6503	SO:0001819	synonymous_variant	440695	exon2			CGACTCGGCTTTG	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.90C>T	1.37:g.157069139G>A		96.0	1.0		93.0	15.0	NM_001004341		Silent	SNP	ENST00000454449.2	37	CCDS30893.1																																																																																			.		0.647	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2	NM_001004341	
FGFR2	2263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123325033	123325033	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:123325033G>A	ENST00000358487.5	-	3	567	c.295C>T	c.(295-297)Cct>Tct	p.P99S	FGFR2_ENST00000357555.5_Intron|FGFR2_ENST00000369059.1_Intron|FGFR2_ENST00000351936.6_Missense_Mutation_p.P99S|FGFR2_ENST00000346997.2_Missense_Mutation_p.P99S|FGFR2_ENST00000369061.4_Missense_Mutation_p.P99S|FGFR2_ENST00000356226.4_Intron|FGFR2_ENST00000360144.3_Intron|FGFR2_ENST00000359354.2_Missense_Mutation_p.P99S|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000369056.1_Missense_Mutation_p.P99S|FGFR2_ENST00000369060.4_Missense_Mutation_p.P99S|FGFR2_ENST00000457416.2_Missense_Mutation_p.P99S	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	99	Ig-like C2-type 1.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	GAGTCTCTAGGCGTGGCGCCC	0.537		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.P99S		.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	FGFR2	2607	0			c.C295T						.						174.0	149.0	157.0					10																	123325033		2203	4300	6503	SO:0001583	missense	2263	exon3	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	CTCTAGGCGTGGC	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.295C>T	10.37:g.123325033G>A	ENSP00000351276:p.Pro99Ser	75.0	0.0		78.0	44.0	NM_000141	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	ENST00000358487.5	37	CCDS31298.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373326	0.24857	.	.	ENSG00000066468	ENST00000369062;ENST00000369061;ENST00000358487;ENST00000369060;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000369056;ENST00000369058;ENST00000359354	T;T;T;T;T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64;2.64;2.64;2.64;2.64	5.24	1.16	0.20824	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.273628	0.42172	N	0.000759	T	0.11110	0.0271	L	0.41079	1.255	0.50039	D	0.999849	B;B;B;B;B;B;B;B	0.22541	0.003;0.071;0.011;0.009;0.016;0.02;0.011;0.029	B;B;B;B;B;B;B;B	0.34346	0.021;0.18;0.023;0.014;0.025;0.023;0.057;0.013	T	0.16100	-1.0414	10	0.23891	T	0.37	.	5.3591	0.16077	0.3175:0.1354:0.5472:0.0	.	118;118;99;118;99;99;118;99	D3DRD9;D3DRD4;B5A960;D3DRD5;P21802-18;P21802;D3DRE0;P21802-17	.;.;.;.;.;FGFR2_HUMAN;.;.	S	99	ENSP00000358057:P99S;ENSP00000351276:P99S;ENSP00000358056:P99S;ENSP00000263451:P99S;ENSP00000410294:P99S;ENSP00000309878:P99S;ENSP00000358052:P99S;ENSP00000358054:P99S;ENSP00000352309:P99S	ENSP00000263451:P99S	P	-	1	0	FGFR2	123315023	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.958000	0.40402	0.262000	0.21774	0.643000	0.83706	CCT	.		0.537	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
FHDC1	85462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	153896719	153896719	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr4:153896719G>A	ENST00000511601.1	+	12	2464	c.2276G>A	c.(2275-2277)aGc>aAc	p.S759N	FHDC1_ENST00000260008.3_Missense_Mutation_p.S759N			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	759									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TCTGTGGGTAGCAGCGACCCT	0.607																																					p.S759N		.											.	FHDC1	136	0			c.G2276A						.						53.0	53.0	53.0					4																	153896719		2203	4300	6503	SO:0001583	missense	85462	exon11			TGGGTAGCAGCGA	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2276G>A	4.37:g.153896719G>A	ENSP00000427567:p.Ser759Asn	67.0	0.0		78.0	17.0	NM_033393		Missense_Mutation	SNP	ENST00000511601.1	37	CCDS34081.1	.	.	.	.	.	.	.	.	.	.	G	9.834	1.189087	0.21954	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.32515	1.45;1.45	5.47	1.95	0.26073	.	0.583830	0.14959	N	0.288451	T	0.13798	0.0334	N	0.24115	0.695	0.09310	N	1	P	0.38335	0.627	B	0.32677	0.15	T	0.08911	-1.0699	10	0.18710	T	0.47	.	3.7374	0.08515	0.0963:0.3498:0.4236:0.1303	.	759	Q9C0D6	FHDC1_HUMAN	N	759	ENSP00000427567:S759N;ENSP00000260008:S759N	ENSP00000260008:S759N	S	+	2	0	FHDC1	154116169	0.998000	0.40836	0.033000	0.17914	0.178000	0.23041	2.753000	0.47524	1.240000	0.43803	0.563000	0.77884	AGC	.		0.607	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
FILIP1L	11259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	99643072	99643072	+	Splice_Site	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr3:99643072A>G	ENST00000354552.3	-	4	1076		c.e4+1		CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000398326.2_Splice_Site|CMSS1_ENST00000496116.1_Intron|FILIP1L_ENST00000331335.5_Splice_Site	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like							cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						AAGCAGCCTTACCTTTCACAT	0.408																																					.		.											.	FILIP1L	45	0			c.605+2T>C						.						262.0	243.0	249.0					3																	99643072		1933	4141	6074	SO:0001630	splice_region_variant	11259	exon5			AGCCTTACCTTTC		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.605+1T>C	3.37:g.99643072A>G		189.0	0.0		192.0	37.0	NM_182909	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Splice_Site	SNP	ENST00000354552.3	37	CCDS43117.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.620208	0.87460	.	.	ENSG00000168386	ENST00000354552;ENST00000331335;ENST00000398326	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5956	0.76578	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FILIP1L	101125762	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.589000	0.90817	2.100000	0.63781	0.477000	0.44152	.	.		0.408	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	Intron
FLG2	388698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152327575	152327575	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:152327575C>T	ENST00000388718.5	-	3	2759	c.2687G>A	c.(2686-2688)gGc>gAc	p.G896D	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	896	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCCAAAGCCACTGGACTG	0.493																																					p.G896D		.											.	FLG2	151	0			c.G2687A						.						308.0	266.0	281.0					1																	152327575		2198	4262	6460	SO:0001583	missense	388698	exon3			CCAAAGCCACTGG	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2687G>A	1.37:g.152327575C>T	ENSP00000373370:p.Gly896Asp	152.0	0.0		162.0	30.0	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	4.843	0.156628	0.09236	.	.	ENSG00000143520	ENST00000388718	T	0.03831	3.79	4.05	3.11	0.35812	.	.	.	.	.	T	0.01800	0.0057	L	0.56769	1.78	0.09310	N	1	P	0.41978	0.767	B	0.33846	0.171	T	0.43310	-0.9399	9	0.19147	T	0.46	-2.7266	9.8431	0.41010	0.0:0.8945:0.0:0.1055	.	896	Q5D862	FILA2_HUMAN	D	896	ENSP00000373370:G896D	ENSP00000373370:G896D	G	-	2	0	FLG2	150594199	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.023000	0.12456	2.111000	0.64477	0.650000	0.86243	GGC	.		0.493	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
HERC4	26091	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	69797855	69797855	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:69797855G>C	ENST00000395198.3	-	5	705	c.458C>G	c.(457-459)tCt>tGt	p.S153C	HERC4_ENST00000395187.2_Missense_Mutation_p.L100V|HERC4_ENST00000373700.4_Missense_Mutation_p.S153C|HERC4_ENST00000277817.6_Missense_Mutation_p.S43C|HERC4_ENST00000412272.2_Missense_Mutation_p.S153C	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	153					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						CTTACCTTTAGAAAGTGCAAG	0.318																																					p.S153C		.											.	HERC4	659	0			c.C458G						.						80.0	78.0	79.0					10																	69797855		2203	4299	6502	SO:0001583	missense	26091	exon5			CCTTTAGAAAGTG	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.458C>G	10.37:g.69797855G>C	ENSP00000378624:p.Ser153Cys	158.0	0.0		125.0	27.0	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	37	CCDS41533.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.546086|4.546086	0.86022|0.86022	.|.	.|.	ENSG00000148634|ENSG00000148634	ENST00000395187|ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700;ENST00000513996	T|T;T;T;T;D	0.14893|0.81821	2.47|-1.48;-1.48;-1.48;-1.48;-1.54	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	.|0.125660	.|0.56097	.|D	.|0.000023	D|D	0.87047|0.87047	0.6080|0.6080	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	.|D;P;D;D	.|0.76494	.|0.999;0.864;0.984;0.975	.|D;B;P;P	.|0.63192	.|0.912;0.318;0.881;0.764	D|D	0.88278|0.88278	0.2934|0.2934	7|10	0.14252|0.87932	T|D	0.57|0	.|.	18.8473|18.8473	0.92212|0.92212	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|153;153;153;153	.|Q5GLZ8-3;A8K9U4;Q5GLZ8-2;Q5GLZ8	.|.;.;.;HERC4_HUMAN	V|C	100|43;153;153;153;177	ENSP00000378614:L100V|ENSP00000277817:S43C;ENSP00000416504:S153C;ENSP00000378624:S153C;ENSP00000362804:S153C;ENSP00000427191:S177C	ENSP00000378614:L100V|ENSP00000277817:S43C	L|S	-|-	1|2	2|0	HERC4|HERC4	69467861|69467861	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.809000|9.809000	0.99208|0.99208	2.452000|2.452000	0.82932|0.82932	0.563000|0.563000	0.77884|0.77884	CTA|TCT	.		0.318	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
HK2	3099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	75113781	75113781	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:75113781C>T	ENST00000290573.2	+	15	2800	c.2200C>T	c.(2200-2202)Ctc>Ttc	p.L734F	HK2_ENST00000409174.1_Missense_Mutation_p.L706F	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	734	Catalytic.|Hexokinase type-2 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						TGAGCTTTCACTCAACCCCGG	0.547																																					p.L734F		.											.	HK2	252	0			c.C2200T						.						74.0	77.0	76.0					2																	75113781		2203	4300	6503	SO:0001583	missense	3099	exon15			CTTTCACTCAACC		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2200C>T	2.37:g.75113781C>T	ENSP00000290573:p.Leu734Phe	49.0	0.0		51.0	27.0	NM_000189	D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	37	CCDS1956.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937196	0.52972	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.96774	-4.12;-4.12	5.49	4.62	0.57501	Hexokinase, C-terminal (1);	0.170671	0.52532	D	0.000073	D	0.97723	0.9253	M	0.89353	3.025	0.46609	D	0.99912	D	0.67145	0.996	P	0.59221	0.854	D	0.98080	1.0403	10	0.72032	D	0.01	-25.3378	11.8844	0.52594	0.0:0.9169:0.0:0.0831	.	734	P52789	HXK2_HUMAN	F	734;734;706	ENSP00000290573:L734F;ENSP00000387140:L706F	ENSP00000290573:L734F	L	+	1	0	HK2	74967289	0.867000	0.29959	0.992000	0.48379	0.993000	0.82548	1.812000	0.38952	1.566000	0.49654	0.655000	0.94253	CTC	.		0.547	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	NM_000189	
HOXB3	3213	ucsc.edu;bcgsc.ca	37	17	46628059	46628059	+	Silent	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr17:46628059A>G	ENST00000470495.1	-	2	2380	c.933T>C	c.(931-933)ccT>ccC	p.P311P	HOXB3_ENST00000472863.1_Silent_p.P238P|HOXB3_ENST00000490677.1_Silent_p.P177P|HOXB3_ENST00000476342.1_Silent_p.P311P|HOXB3_ENST00000498678.1_Silent_p.P311P|HOXB3_ENST00000460160.1_Silent_p.P179P|HOXB-AS3_ENST00000465846.2_RNA|HOXB3_ENST00000311626.4_Silent_p.P311P|HOXB3_ENST00000489475.1_Silent_p.P238P|HOXB-AS1_ENST00000502764.2_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000485909.2_Silent_p.P179P|HOXB-AS1_ENST00000508688.1_RNA			P14651	HXB3_HUMAN	homeobox B3	311					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						AGCCTTTGAGAGGGGGCTGGT	0.682											OREG0024516	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P311P		.											.	HOXB3	514	0			c.T933C						.						45.0	56.0	53.0					17																	46628059		2203	4298	6501	SO:0001819	synonymous_variant	3213	exon4			TTTGAGAGGGGGC		CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.933T>C	17.37:g.46628059A>G		24.0	0.0	940	24.0	4.0	NM_002146	A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Silent	SNP	ENST00000470495.1	37	CCDS11528.1																																																																																			.		0.682	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358261.1		
HPS5	11234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18333521	18333521	+	Silent	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:18333521T>C	ENST00000349215.3	-	3	436	c.159A>G	c.(157-159)ggA>ggG	p.G53G	HPS5_ENST00000438420.2_5'UTR|HPS5_ENST00000396253.3_5'UTR|HPS5_ENST00000531848.1_5'UTR	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	53					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GGAGTCCTCCTCCTGAACTGC	0.453									Hermansky-Pudlak syndrome																												p.G53G		.											.	HPS5	133	0			c.A159G						.						119.0	125.0	123.0					11																	18333521		2199	4293	6492	SO:0001819	synonymous_variant	11234	exon3	Familial Cancer Database	HPS, HPS1-8	TCCTCCTCCTGAA	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.159A>G	11.37:g.18333521T>C		57.0	0.0		59.0	12.0	NM_181507	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Silent	SNP	ENST00000349215.3	37	CCDS7836.1																																																																																			.		0.453	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1	NM_181507	
HTT	3064	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3224125	3224125	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr4:3224125C>T	ENST00000355072.5	+	54	7526	c.7381C>T	c.(7381-7383)Cgt>Tgt	p.R2461C		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2461					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CTGGACCAGTCGTACTCAGTT	0.552																																					p.R2461C		.											.	HTT	281	0			c.C7381T						.						74.0	75.0	75.0					4																	3224125		1988	4161	6149	SO:0001583	missense	3064	exon54			ACCAGTCGTACTC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7381C>T	4.37:g.3224125C>T	ENSP00000347184:p.Arg2461Cys	61.0	1.0		64.0	24.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356461	0.82243	.	.	ENSG00000197386	ENST00000355072	T	0.11821	2.74	5.17	5.17	0.71159	.	0.108387	0.64402	D	0.000006	T	0.35624	0.0938	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.04593	-1.0940	10	0.87932	D	0	.	19.0998	0.93269	0.0:1.0:0.0:0.0	.	2461	P42858	HD_HUMAN	C	2461	ENSP00000347184:R2461C	ENSP00000347184:R2461C	R	+	1	0	HTT	3193923	1.000000	0.71417	0.997000	0.53966	0.888000	0.51559	4.631000	0.61304	2.600000	0.87896	0.650000	0.86243	CGT	.		0.552	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
IGSF5	150084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	41137531	41137531	+	Missense_Mutation	SNP	G	G	T	rs372378189		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr21:41137531G>T	ENST00000380588.4	+	3	273	c.170G>T	c.(169-171)cGc>cTc	p.R57L	IGSF5_ENST00000479378.1_3'UTR	NM_001080444.1	NP_001073913.1	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily, member 5	57	Ig-like V-type 1.				single organismal cell-cell adhesion (GO:0016337)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.R57H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(7)|skin(2)|stomach(1)	23		Prostate(19;5.35e-06)				TCCCAGGCTCGCTTCAACTGC	0.527																																					p.R57L		.											.	IGSF5	68	1	Substitution - Missense(1)	large_intestine(1)	c.G170T						.						71.0	63.0	66.0					21																	41137531		2203	4300	6503	SO:0001583	missense	150084	exon3			AGGCTCGCTTCAA		CCDS33562.1	21q22.2	2013-01-29			ENSG00000183067	ENSG00000183067		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5952	protein-coding gene	gene with protein product	"""junctional adhesion molecule 4"""	610638					Standard	NM_001080444		Approved	JAM4	uc002yyo.3	Q9NSI5	OTTHUMG00000086724	ENST00000380588.4:c.170G>T	21.37:g.41137531G>T	ENSP00000369962:p.Arg57Leu	49.0	0.0		62.0	23.0	NM_001080444		Missense_Mutation	SNP	ENST00000380588.4	37	CCDS33562.1	.	.	.	.	.	.	.	.	.	.	G	15.56	2.868593	0.51588	.	.	ENSG00000183067	ENST00000380588	T	0.26810	1.71	4.05	2.18	0.27775	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.290921	0.33631	N	0.004711	T	0.40398	0.1115	M	0.64997	1.995	0.34166	D	0.669226	D	0.69078	0.997	D	0.66979	0.948	T	0.49818	-0.8899	10	0.30078	T	0.28	-12.2058	9.2585	0.37597	0.1767:0.0:0.8233:0.0	.	57	Q9NSI5	IGSF5_HUMAN	L	57	ENSP00000369962:R57L	ENSP00000369962:R57L	R	+	2	0	IGSF5	40059401	0.998000	0.40836	0.999000	0.59377	0.533000	0.34776	1.174000	0.31932	0.430000	0.26230	-0.142000	0.14014	CGC	.		0.527	IGSF5-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195005.1		
KCNN1	3780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18092829	18092829	+	Silent	SNP	G	G	A	rs374014650		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:18092829G>A	ENST00000222249.9	+	5	1129	c.810G>A	c.(808-810)acG>acA	p.T270T		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	270					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	CCTTCAACACGCGCTTCGTCA	0.607																																					p.T270T		.											.	KCNN1	22	0			c.G810A						.	G		1,4403	2.1+/-5.4	0,1,2201	55.0	40.0	45.0		810	-6.9	1.0	19		45	0,8600		0,0,4300	no	coding-synonymous	KCNN1	NM_002248.3		0,1,6501	AA,AG,GG		0.0,0.0227,0.0077		270/544	18092829	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	3780	exon5			CAACACGCGCTTC	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.810G>A	19.37:g.18092829G>A		35.0	0.0		100.0	17.0	NM_002248	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37																																																																																				.		0.607	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
KDM6B	23135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7755291	7755291	+	Silent	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr17:7755291C>T	ENST00000448097.2	+	18	4519	c.4188C>T	c.(4186-4188)ttC>ttT	p.F1396F	KDM6B_ENST00000254846.5_Silent_p.F1396F			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1396	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						ATAACAACTTCTGCTCCGTCA	0.612											OREG0024145	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F1396F		.											.	KDM6B	205	0			c.C4188T						.						75.0	66.0	69.0					17																	7755291		2203	4299	6502	SO:0001819	synonymous_variant	23135	exon18			CAACTTCTGCTCC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.4188C>T	17.37:g.7755291C>T		79.0	0.0	644	89.0	14.0	NM_001080424	C9IZ40|Q96G33	Silent	SNP	ENST00000448097.2	37																																																																																				.		0.612	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
KTN1	3895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	56079097	56079097	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr14:56079097G>T	ENST00000395314.3	+	2	399	c.331G>T	c.(331-333)Gtt>Ttt	p.V111F	KTN1_ENST00000438792.2_Missense_Mutation_p.V111F|KTN1_ENST00000395309.3_Missense_Mutation_p.V111F|KTN1_ENST00000395308.1_Missense_Mutation_p.V111F|KTN1_ENST00000416613.1_Missense_Mutation_p.V111F|KTN1_ENST00000413890.2_Missense_Mutation_p.V111F|KTN1_ENST00000395311.1_Missense_Mutation_p.V111F	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	111					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						TTCAAGTAGTGTTAGGGAAAG	0.388			T	RET	papillary thryoid																																p.V111F		.		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1	1147	0			c.G331T						.						82.0	86.0	85.0					14																	56079097		2203	4300	6503	SO:0001583	missense	3895	exon2			AGTAGTGTTAGGG		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.331G>T	14.37:g.56079097G>T	ENSP00000378725:p.Val111Phe	119.0	0.0		157.0	49.0	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	37	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.764921	0.49574	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	D;D;D;D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51;-5.51;-5.51;-5.51	5.9	3.98	0.46160	.	0.305062	0.23883	N	0.043633	D	0.97291	0.9114	L	0.36672	1.1	0.33721	D	0.616973	P;D;P;P	0.55800	0.842;0.973;0.842;0.677	B;P;B;B	0.49999	0.394;0.628;0.394;0.394	D	0.98036	1.0379	10	0.62326	D	0.03	-9.83	5.5939	0.17317	0.2328:0.2687:0.4985:0.0	.	111;111;111;111	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	F	111	ENSP00000394992:V111F;ENSP00000378720:V111F;ENSP00000391964:V111F;ENSP00000378725:V111F;ENSP00000378719:V111F;ENSP00000378722:V111F;ENSP00000388807:V111F	ENSP00000378719:V111F	V	+	1	0	KTN1	55148850	0.813000	0.29090	1.000000	0.80357	0.965000	0.64279	-0.075000	0.11431	1.504000	0.48704	0.591000	0.81541	GTT	.		0.388	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
LAP3	51056	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	17579110	17579110	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr4:17579110G>A	ENST00000226299.4	+	1	296	c.22G>A	c.(22-24)Gct>Act	p.A8T	LAP3_ENST00000606142.1_5'Flank	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	8					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						GCCTCTTCCGGCTGCGGGGCG	0.697																																					p.A8T		.											.	LAP3	90	0			c.G22A						.						23.0	22.0	22.0					4																	17579110		2201	4294	6495	SO:0001583	missense	51056	exon1			CTTCCGGCTGCGG	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.22G>A	4.37:g.17579110G>A	ENSP00000226299:p.Ala8Thr	17.0	0.0		76.0	13.0	NM_015907	B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	SNP	ENST00000226299.4	37	CCDS3422.1	.	.	.	.	.	.	.	.	.	.	G	35	5.435778	0.96168	.	.	ENSG00000002549	ENST00000226299	T	0.44881	0.91	5.39	5.39	0.77823	.	0.156705	0.56097	D	0.000024	T	0.42966	0.1226	N	0.08118	0	0.35161	D	0.770648	D	0.63880	0.993	D	0.74674	0.984	T	0.52931	-0.8509	10	0.29301	T	0.29	-19.3561	14.9931	0.71406	0.0:0.0:1.0:0.0	.	8	P28838	AMPL_HUMAN	T	8	ENSP00000226299:A8T	ENSP00000226299:A8T	A	+	1	0	LAP3	17188208	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	2.853000	0.48317	2.684000	0.91462	0.585000	0.79938	GCT	.		0.697	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1		
LIG3	3980	broad.mit.edu;ucsc.edu	37	17	33318795	33318795	+	Missense_Mutation	SNP	C	C	T	rs201706144		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr17:33318795C>T	ENST00000378526.4	+	6	1280	c.1147C>T	c.(1147-1149)Cgg>Tgg	p.R383W	LIG3_ENST00000262327.5_Missense_Mutation_p.R383W	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	383					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	GTTCCTTCTGCGGCTGTCCAA	0.562								Other BER factors																													p.R383W		.											.	LIG3	728	0			c.C1147T						.	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	73.0	65.0	68.0		1147,1147	3.5	0.0	17		68	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	LIG3	NM_002311.4,NM_013975.3	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	383/950,383/1010	33318795	1,13005	2203	4300	6503	SO:0001583	missense	3980	exon6			CTTCTGCGGCTGT		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1147C>T	17.37:g.33318795C>T	ENSP00000367787:p.Arg383Trp	53.0	1.0		39.0	4.0	NM_013975	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	37	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	C	18.74	3.689001	0.68271	0.0	1.16E-4	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.20738	2.05;2.05	5.5	3.5	0.40072	DNA ligase, ATP-dependent, N-terminal (3);	0.611655	0.18330	N	0.144522	T	0.30603	0.0770	M	0.68952	2.095	0.24798	N	0.992718	D;D;D	0.64830	0.994;0.994;0.989	P;P;P	0.51453	0.67;0.67;0.67	T	0.12785	-1.0534	10	0.87932	D	0	0.0029	7.8933	0.29691	0.2855:0.6415:0.0:0.073	.	383;383;383	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	W	383	ENSP00000367787:R383W;ENSP00000262327:R383W	ENSP00000262327:R383W	R	+	1	2	LIG3	30342908	0.007000	0.16637	0.002000	0.10522	0.794000	0.44872	2.256000	0.43231	0.868000	0.35678	-0.182000	0.12963	CGG	.		0.562	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975	
MED25	81857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50331706	50331706	+	Splice_Site	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:50331706G>T	ENST00000312865.6	+	4	359	c.306G>T	c.(304-306)aaG>aaT	p.K102N	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	102	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)	p.K102N(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		GCCCCTGCAGGTTCATGGGCG	0.607																																					p.K102N	GBM(51;894 1657 37868)	.											.	MED25	91	2	Substitution - Missense(2)	lung(2)	c.G306T						.						84.0	90.0	88.0					19																	50331706		2203	4300	6503	SO:0001630	splice_region_variant	81857	exon4			CTGCAGGTTCATG	AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.306-1G>T	19.37:g.50331706G>T		63.0	0.0		86.0	46.0	NM_030973	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	ENST00000312865.6	37	CCDS33075.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697289	0.30142	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000542221;ENST00000544580	T	0.15603	2.41	4.89	4.89	0.63831	.	0.329600	0.32372	N	0.006197	T	0.13243	0.0321	L	0.29908	0.895	0.80722	D	1	B	0.26708	0.157	B	0.31191	0.125	T	0.10451	-1.0629	9	.	.	.	.	11.4311	0.50041	0.0868:0.0:0.9131:0.0	.	102	Q71SY5	MED25_HUMAN	N	102	ENSP00000326767:K102N	.	K	+	3	2	MED25	55023518	1.000000	0.71417	1.000000	0.80357	0.080000	0.17528	6.350000	0.73017	2.709000	0.92574	0.655000	0.94253	AAG	.		0.607	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1	NM_030973	Missense_Mutation
MPDZ	8777	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	13109010	13109010	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr9:13109010T>A	ENST00000319217.7	-	46	6238	c.5991A>T	c.(5989-5991)ttA>ttT	p.L1997F	MPDZ_ENST00000546205.1_Missense_Mutation_p.L2011F|MPDZ_ENST00000447879.1_Missense_Mutation_p.L1964F|MPDZ_ENST00000536827.1_Missense_Mutation_p.L1935F|MPDZ_ENST00000538841.1_Missense_Mutation_p.L856F|MPDZ_ENST00000381015.4_Missense_Mutation_p.L1997F|MPDZ_ENST00000541718.1_Missense_Mutation_p.L1968F|MPDZ_ENST00000541093.1_Missense_Mutation_p.L231F|MPDZ_ENST00000381022.2_Missense_Mutation_p.L1968F	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1997	PDZ 13. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TACTGAAGCCTAAGCCATCTG	0.383																																					p.L1968F		.											.	MPDZ	231	0			c.A5904T						.						39.0	39.0	39.0					9																	13109010		1866	4100	5966	SO:0001583	missense	8777	exon45			GAAGCCTAAGCCA	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.5991A>T	9.37:g.13109010T>A	ENSP00000320006:p.Leu1997Phe	51.0	0.0		59.0	31.0	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	T	19.95	3.921071	0.73213	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000438511;ENST00000541093;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.44	-4.4	0.03600	PDZ/DHR/GLGF (4);	0.000000	0.35320	N	0.003289	T	0.53562	0.1804	L	0.56280	1.765	0.46356	D	0.999002	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0;1.0;1.0;0.998	D;D;D;D;D;D;D;D	0.97110	0.999;0.978;0.967;0.999;0.999;0.999;1.0;0.951	T	0.56980	-0.7889	10	0.72032	D	0.01	.	7.8076	0.29211	0.2071:0.4643:0.0:0.3286	.	1935;856;702;1964;1877;1968;1997;690	B7ZMI4;B7ZB24;B4DGX5;O75970-3;E7EPZ1;O75970-2;O75970;B3KRN5	.;.;.;.;.;.;MPDZ_HUMAN;.	F	1997;1968;1968;538;231;933;856;1935;1964;1997;1877;2011	ENSP00000320006:L1997F;ENSP00000439807:L1968F;ENSP00000370410:L1968F;ENSP00000415964:L538F;ENSP00000445259:L231F;ENSP00000444230:L933F;ENSP00000444717:L856F;ENSP00000444151:L1935F;ENSP00000415208:L1964F;ENSP00000370403:L1997F;ENSP00000446358:L2011F	ENSP00000320006:L1997F	L	-	3	2	MPDZ	13099010	0.026000	0.19158	0.990000	0.47175	0.997000	0.91878	-0.794000	0.04584	-0.363000	0.08101	0.533000	0.62120	TTA	.		0.383	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
MRFAP1	93621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6642727	6642727	+	Silent	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr4:6642727C>T	ENST00000320912.4	+	2	791	c.138C>T	c.(136-138)caC>caT	p.H46H	MRFAP1_ENST00000382581.4_Silent_p.H46H|MRFAP1_ENST00000507420.1_Silent_p.H46H	NM_001272053.1	NP_001258982.1			Morf4 family associated protein 1											lung(1)	1						CGCGCGAGCACGGGCGGGCGT	0.622																																					p.H46H		.											.	.	.	0			c.C138T						.						75.0	72.0	73.0					4																	6642727		2203	4300	6503	SO:0001819	synonymous_variant	93621	exon2			CGAGCACGGGCGG	AF116272	CCDS3389.1	4p16.1	2011-01-27	2011-01-27		ENSG00000179010	ENSG00000179010			24549	protein-coding gene	gene with protein product						15367658	Standard	NM_033296		Approved	PAM14, PGR1	uc003gjh.2	Q9Y605	OTTHUMG00000125504	ENST00000320912.4:c.138C>T	4.37:g.6642727C>T		98.0	0.0		118.0	89.0	NM_001272053		Silent	SNP	ENST00000320912.4	37	CCDS3389.1																																																																																			.		0.622	MRFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246831.1	NM_033296	
MT1F	4494	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	56692645	56692645	+	Silent	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr16:56692645C>T	ENST00000334350.6	+	2	452	c.87C>T	c.(85-87)tgC>tgT	p.C29C	MT1F_ENST00000394501.2_Silent_p.C30C|MT1F_ENST00000568475.1_Silent_p.C29C			P04733	MT1F_HUMAN	metallothionein 1F	29	Beta.				cellular response to cadmium ion (GO:0071276)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)										GCACCTCCTGCAAGAAGAGTG	0.567																																					p.C29C	Colon(159;794 1866 3818 8748 33331)	.											.	MT1F	44	0			c.C87T						.						57.0	55.0	56.0					16																	56692645		2198	4300	6498	SO:0001819	synonymous_variant	4494	exon2			CTCCTGCAAGAAG	BC029453	CCDS32456.1	16q13	2008-02-05	2007-03-02			ENSG00000198417		"""Metallothioneins"""	7398	protein-coding gene	gene with protein product		156352		MT1		6089206, 2581970	Standard	NM_005949		Approved		uc002ejt.3	P04733		ENST00000334350.6:c.87C>T	16.37:g.56692645C>T		54.0	0.0		42.0	25.0	NM_005949	Q9UI97	Silent	SNP	ENST00000334350.6	37	CCDS32456.1																																																																																			.		0.567	MT1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433995.2	NM_005949	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1277989	1277989	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:1277989G>A	ENST00000529681.1	+	39	16283	c.16225G>A	c.(16225-16227)Gtg>Atg	p.V5409M	MUC5B_ENST00000447027.1_Missense_Mutation_p.V5412M	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5409					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGGCATCTGCGTGCAGGCCTG	0.652																																					p.V5409M		.											.	.	.	0			c.G16225A						.						15.0	20.0	18.0					11																	1277989		1999	4114	6113	SO:0001583	missense	727897	exon39			ATCTGCGTGCAGG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16225G>A	11.37:g.1277989G>A	ENSP00000436812:p.Val5409Met	23.0	0.0		39.0	10.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	8.473	0.858093	0.17178	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844	T;T	0.64803	-0.12;-0.12	4.21	4.21	0.49690	.	.	.	.	.	T	0.81522	0.4840	M	0.88450	2.955	0.23636	N	0.997236	D;D	0.89917	1.0;1.0	D;D	0.71656	0.944;0.974	T	0.73707	-0.3898	9	0.87932	D	0	.	14.4235	0.67200	0.0:0.0:1.0:0.0	.	5746;5412	A7Y9J9;E9PBJ0	.;.	M	5409;5412;5353;308;5121	ENSP00000436812:V5409M;ENSP00000415793:V5412M	ENSP00000343037:V5353M	V	+	1	0	MUC5B	1234565	0.330000	0.24705	0.754000	0.31244	0.032000	0.12392	2.765000	0.47621	2.063000	0.61619	0.416000	0.27883	GTG	.		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
NLRC3	197358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3613089	3613089	+	RNA	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr16:3613089C>T	ENST00000301749.7	-	0	2254				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGGTTGGCCTCCTGGGCACAG	0.706																																					p.E617K		.											.	NLRC3	96	0			c.G1849A						.						7.0	10.0	9.0					16																	3613089		1992	4146	6138			197358	exon5			TGGCCTCCTGGGC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3613089C>T		21.0	0.0		58.0	40.0	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	37		.	.	.	.	.	.	.	.	.	.	C	13.91	2.378785	0.42207	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	T;T;T;T	0.79141	-0.76;-0.79;-0.77;-1.24	5.15	4.2	0.49525	.	0.067509	0.64402	D	0.000012	T	0.67655	0.2916	.	.	.	0.23050	N	0.998376	B	0.25441	0.126	B	0.24394	0.053	T	0.59862	-0.7374	9	0.46703	T	0.11	.	11.0252	0.47741	0.0:0.9091:0.0:0.0909	.	664	C9JLH9	.	K	617;617;617;664;599	ENSP00000301749:E617K;ENSP00000352039:E617K;ENSP00000414415:E664K;ENSP00000323897:E599K	ENSP00000301749:E617K	E	-	1	0	NLRC3	3553090	0.995000	0.38212	0.013000	0.15412	0.778000	0.44026	3.188000	0.50958	1.166000	0.42689	0.655000	0.94253	GAG	.		0.706	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
N4BP1	9683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	48595690	48595690	+	Silent	SNP	A	A	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr16:48595690A>T	ENST00000262384.3	-	2	1100	c.864T>A	c.(862-864)tcT>tcA	p.S288S	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	288					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				CTTCAGAATCAGAAAATCTCC	0.393																																					p.S288S		.											.	N4BP1	22	0			c.T864A						.						80.0	77.0	78.0					16																	48595690		1832	4081	5913	SO:0001819	synonymous_variant	9683	exon2			AGAATCAGAAAAT	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.864T>A	16.37:g.48595690A>T		98.0	0.0		67.0	44.0	NM_153029	A7MD49|Q2YDX1	Silent	SNP	ENST00000262384.3	37	CCDS45479.1																																																																																			.		0.393	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
OR2D3	120775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6942827	6942827	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:6942827G>T	ENST00000317834.3	+	1	623	c.595G>T	c.(595-597)Gcc>Tcc	p.A199S		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGAACCTCCTGCCCTCCTGAA	0.488																																					p.A199S		.											.	OR2D3	68	0			c.G595T						.						113.0	96.0	102.0					11																	6942827		2201	4296	6497	SO:0001583	missense	120775	exon1			CCTCCTGCCCTCC	BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.595G>T	11.37:g.6942827G>T	ENSP00000320560:p.Ala199Ser	249.0	0.0		264.0	135.0	NM_001004684	B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	ENST00000317834.3	37	CCDS31417.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.416187	0.62511	.	.	ENSG00000178358	ENST00000317834	T	0.00107	8.72	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44483	D	0.000448	T	0.00241	0.0007	L	0.35723	1.085	0.35845	D	0.826304	B	0.31790	0.34	B	0.43783	0.431	D	0.86135	0.1577	10	0.52906	T	0.07	-47.4386	16.5766	0.84681	0.0:0.0:1.0:0.0	.	199	Q8NGH3	OR2D3_HUMAN	S	199	ENSP00000320560:A199S	ENSP00000320560:A199S	A	+	1	0	OR2D3	6899403	0.044000	0.20184	1.000000	0.80357	0.973000	0.67179	0.386000	0.20702	2.865000	0.98341	0.655000	0.94253	GCC	.		0.488	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385987.1	NM_001004684	
OR4N4	283694	broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	22382912	22382912	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr15:22382912C>T	ENST00000328795.4	+	1	531	c.440C>T	c.(439-441)gCt>gTt	p.A147V	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A147D(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		ATGATGTTGGCTCTGTGGCTT	0.527																																					p.A147V		.											.	OR4N4	73	1	Substitution - Missense(1)	lung(1)	c.C440T						.						141.0	123.0	129.0					15																	22382912		2189	4262	6451	SO:0001583	missense	283694	exon1			TGTTGGCTCTGTG	AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.440C>T	15.37:g.22382912C>T	ENSP00000332500:p.Ala147Val	352.0	1.0		393.0	26.0	NM_001005241	Q6IEY3|Q6IF56	Missense_Mutation	SNP	ENST00000328795.4	37	CCDS32173.1	.	.	.	.	.	.	.	.	.	.	.	2.349	-0.349272	0.05173	.	.	ENSG00000183706	ENST00000328795	T	0.36878	1.23	3.37	0.203	0.15195	GPCR, rhodopsin-like superfamily (1);	0.978321	0.08345	N	0.960256	T	0.26846	0.0657	L	0.46741	1.465	0.09310	N	1	B	0.15473	0.013	B	0.22880	0.042	T	0.36768	-0.9734	10	0.07644	T	0.81	-1.223	6.6776	0.23103	0.0:0.5516:0.3429:0.1055	.	147	Q8N0Y3	OR4N4_HUMAN	V	147	ENSP00000332500:A147V	ENSP00000332500:A147V	A	+	2	0	OR4N4	19884276	0.000000	0.05858	0.074000	0.20217	0.128000	0.20619	-0.513000	0.06305	-0.056000	0.13221	-0.714000	0.03626	GCT	.		0.527	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414922.1		
OR51T1	401665	broad.mit.edu;bcgsc.ca	37	11	4904015	4904015	+	Silent	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:4904015T>C	ENST00000322049.1	+	1	886	c.886T>C	c.(886-888)Ttg>Ctg	p.L296L	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron|OR51T1_ENST00000380378.1_Silent_p.L323L			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	296						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATTTACAGCTTGAAGACCAA	0.507																																					p.L323L		.											.	OR51T1	115	0			c.T967C						.						105.0	98.0	100.0					11																	4904015		2201	4298	6499	SO:0001819	synonymous_variant	401665	exon1			TACAGCTTGAAGA	BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.886T>C	11.37:g.4904015T>C		135.0	0.0		142.0	8.0	NM_001004759	Q6IFH9	Silent	SNP	ENST00000322049.1	37																																																																																				.		0.507	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000142180.1	NM_001004759	
PBRM1	55193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52584506	52584506	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr3:52584506A>G	ENST00000296302.7	-	29	4829	c.4828T>C	c.(4828-4830)Tac>Cac	p.Y1610H	PBRM1_ENST00000409057.1_Missense_Mutation_p.Y1555H|RNU6-856P_ENST00000516959.1_RNA|PBRM1_ENST00000409767.1_Missense_Mutation_p.Y1518H|PBRM1_ENST00000410007.1_Missense_Mutation_p.Y1530H|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000394830.3_Missense_Mutation_p.Y1503H|PBRM1_ENST00000356770.4_Missense_Mutation_p.Y1523H|PBRM1_ENST00000337303.4_Missense_Mutation_p.Y1503H|PBRM1_ENST00000409114.3_Missense_Mutation_p.Y1573H			Q86U86	PB1_HUMAN	polybromo 1	1610					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TATTTCAGGTAGGCCTCTGAG	0.517			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.Y1503H		.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	575	0			c.T4507C						.						75.0	75.0	75.0					3																	52584506		2203	4300	6503	SO:0001583	missense	55193	exon29			TCAGGTAGGCCTC	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.4828T>C	3.37:g.52584506A>G	ENSP00000296302:p.Tyr1610His	49.0	0.0		35.0	28.0	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	A	19.37	3.813720	0.70912	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767	T;T;T;T;T;T;T;T	0.72167	-0.6;-0.56;-0.53;-0.35;-0.63;-0.59;0.23;-0.36	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.84406	0.5465	M	0.79475	2.455	0.48040	D	0.999579	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0;0.998;0.999;0.999	D;D;D;D;D;D;D;D	0.85130	0.996;0.996;0.996;0.996;0.997;0.991;0.996;0.996	D	0.86482	0.1792	10	0.87932	D	0	-7.1164	15.9958	0.80243	1.0:0.0:0.0:0.0	.	1530;1503;1555;1573;1518;1610;1523;1503	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	H	1523;1503;1610;1503;1555;1530;1573;1518	ENSP00000349213:Y1523H;ENSP00000378307:Y1503H;ENSP00000296302:Y1610H;ENSP00000338302:Y1503H;ENSP00000386593:Y1555H;ENSP00000386529:Y1530H;ENSP00000386643:Y1573H;ENSP00000386601:Y1518H	ENSP00000296302:Y1610H	Y	-	1	0	PBRM1	52559546	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.188000	0.69820	0.533000	0.62120	TAC	.		0.517	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
PIWIL1	9271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130827612	130827612	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr12:130827612G>C	ENST00000245255.3	+	3	428	c.156G>C	c.(154-156)caG>caC	p.Q52H		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	52					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GTGGACGGCAGAGAGGAACAG	0.443																																					p.Q52H		.											.	PIWIL1	92	0			c.G156C						.						67.0	58.0	61.0					12																	130827612		2203	4300	6503	SO:0001583	missense	9271	exon3			ACGGCAGAGAGGA	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.156G>C	12.37:g.130827612G>C	ENSP00000245255:p.Gln52His	167.0	0.0		218.0	35.0	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802030	0.50315	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000539400;ENST00000539995;ENST00000535956;ENST00000542723	T;T;T;T;T;T	0.09630	2.96;2.96;2.96;2.96;2.96;2.96	5.13	4.22	0.49857	.	0.310182	0.35585	N	0.003101	T	0.28333	0.0700	M	0.67953	2.075	0.50632	D	0.999889	D;D	0.67145	0.996;0.994	D;D	0.79108	0.992;0.986	T	0.00411	-1.1756	10	0.45353	T	0.12	-11.8924	12.125	0.53913	0.0847:0.0:0.9153:0.0	.	52;52	Q96J94;Q96J94-2	PIWL1_HUMAN;.	H	52	ENSP00000245255:Q52H;ENSP00000442086:Q52H;ENSP00000440677:Q52H;ENSP00000439096:Q52H;ENSP00000444353:Q52H;ENSP00000438582:Q52H	ENSP00000245255:Q52H	Q	+	3	2	PIWIL1	129393565	1.000000	0.71417	0.997000	0.53966	0.438000	0.31896	3.187000	0.50950	2.544000	0.85801	0.467000	0.42956	CAG	.		0.443	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110495324	110495324	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr8:110495324T>A	ENST00000378402.5	+	57	9670	c.9566T>A	c.(9565-9567)gTg>gAg	p.V3189E		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3189					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATGGATGCTGTGGATTGGCAG	0.378										HNSCC(38;0.096)																											p.V3189E		.											.	PKHD1L1	145	0			c.T9566A						.						84.0	80.0	81.0					8																	110495324		1870	4094	5964	SO:0001583	missense	93035	exon57			ATGCTGTGGATTG	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9566T>A	8.37:g.110495324T>A	ENSP00000367655:p.Val3189Glu	102.0	0.0		134.0	35.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.453744	0.84209	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85773	-2.03;-2.03	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000001	D	0.94142	0.8121	H	0.94222	3.51	0.44092	D	0.996859	D	0.76494	0.999	D	0.75484	0.986	D	0.95130	0.8254	10	0.56958	D	0.05	.	13.7881	0.63121	0.0:0.0:0.0:1.0	.	3189	Q86WI1	PKHL1_HUMAN	E	3189;117	ENSP00000367655:V3189E;ENSP00000437376:V117E	ENSP00000367655:V3189E	V	+	2	0	PKHD1L1	110564500	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.173000	0.71937	2.144000	0.66660	0.477000	0.44152	GTG	.		0.378	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLB1	151056	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	28825786	28825786	+	Silent	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:28825786C>T	ENST00000327757.5	+	39	2816	c.2772C>T	c.(2770-2772)gcC>gcT	p.A924A	PLB1_ENST00000422425.2_Silent_p.A913A|PLB1_ENST00000541605.1_5'UTR	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	924	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TGCAGCAGGCCAGGTAGGCAG	0.602																																					p.A924A		.											.	PLB1	141	0			c.C2772T						.						95.0	88.0	90.0					2																	28825786		2203	4300	6503	SO:0001819	synonymous_variant	151056	exon39			GCAGGCCAGGTAG		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2772C>T	2.37:g.28825786C>T		30.0	0.0		29.0	11.0	NM_153021	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Silent	SNP	ENST00000327757.5	37	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172781	0.38413	.	.	ENSG00000163803	ENST00000404858	.	.	.	5.97	5.02	0.67125	.	.	.	.	.	T	0.56746	0.2006	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54036	-0.8353	4	.	.	.	-10.3566	6.5975	0.22683	0.2544:0.6554:0.0:0.0902	.	.	.	.	L	912	.	.	P	+	2	0	PLB1	28679290	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	1.273000	0.33121	2.828000	0.97474	0.655000	0.94253	CCA	.		0.602	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
PRKAA1	5562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	40777637	40777637	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr5:40777637C>T	ENST00000397128.2	-	2	187	c.179G>A	c.(178-180)cGa>cAa	p.R60Q	PRKAA1_ENST00000354209.3_Missense_Mutation_p.R60Q|PRKAA1_ENST00000296800.4_Missense_Mutation_p.R51Q	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	60	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	AATCTTCTGTCGATTGAGTAT	0.348																																					p.R60Q		.											.	PRKAA1	792	0			c.G179A						.						85.0	81.0	82.0					5																	40777637		1818	4086	5904	SO:0001583	missense	5562	exon2			TTCTGTCGATTGA		CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.179G>A	5.37:g.40777637C>T	ENSP00000380317:p.Arg60Gln	198.0	0.0		271.0	28.0	NM_006251	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Missense_Mutation	SNP	ENST00000397128.2	37	CCDS3932.2	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998296	0.93227	.	.	ENSG00000132356	ENST00000397128;ENST00000354209;ENST00000296800	T;T;T	0.65364	-0.15;-0.15;-0.15	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70859	0.3272	N	0.21324	0.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.74097	-0.3775	10	0.87932	D	0	-7.7554	20.066	0.97704	0.0:1.0:0.0:0.0	.	60;60	Q13131;Q13131-2	AAPK1_HUMAN;.	Q	60;60;51	ENSP00000380317:R60Q;ENSP00000346148:R60Q;ENSP00000296800:R51Q	ENSP00000296800:R51Q	R	-	2	0	AC008810.1	40813394	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.484000	0.81180	2.730000	0.93505	0.650000	0.86243	CGA	.		0.348	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253833.2	NM_006251	
PSMF1	9491	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	1106148	1106148	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr20:1106148C>T	ENST00000335877.6	+	2	313	c.137C>T	c.(136-138)cCc>cTc	p.P46L	PSMF1_ENST00000246015.4_Missense_Mutation_p.P46L|PSMF1_ENST00000438768.2_Missense_Mutation_p.P46L|PSMF1_ENST00000333082.3_Missense_Mutation_p.P46L|PSMF1_ENST00000381898.4_5'UTR	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	46	Important for homodimerization and interaction with FBXO7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						CAGCCGGGTCCCAATGATAAG	0.458																																					p.P46L		.											.	PSMF1	90	0			c.C137T						.						83.0	75.0	78.0					20																	1106148		2203	4300	6503	SO:0001583	missense	9491	exon2			CGGGTCCCAATGA	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.137C>T	20.37:g.1106148C>T	ENSP00000338039:p.Pro46Leu	85.0	1.0		90.0	34.0	NM_006814	A0AVQ9|D3DVW3|Q9H4I1	Missense_Mutation	SNP	ENST00000335877.6	37	CCDS13010.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017068	0.35606	.	.	ENSG00000125818	ENST00000333082;ENST00000381899;ENST00000246015;ENST00000335877;ENST00000438768	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	4.87	4.87	0.63330	.	0.358558	0.29767	N	0.011257	T	0.30230	0.0758	L	0.54323	1.7	0.80722	D	1	P;B;B	0.38167	0.621;0.144;0.144	B;B;B	0.30105	0.111;0.032;0.02	T	0.08597	-1.0714	10	0.20519	T	0.43	-4.3849	15.0252	0.71663	0.0:1.0:0.0:0.0	.	46;46;46	E7ER20;Q5QPM7;Q92530	.;.;PSMF1_HUMAN	L	46	ENSP00000327704:P46L;ENSP00000371324:P46L;ENSP00000246015:P46L;ENSP00000338039:P46L;ENSP00000401404:P46L	ENSP00000246015:P46L	P	+	2	0	PSMF1	1054148	0.300000	0.24435	0.264000	0.24511	0.552000	0.35366	3.385000	0.52485	2.527000	0.85204	0.585000	0.79938	CCC	.		0.458	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077504.2	NM_178578	
RARG	5916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53607025	53607025	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr12:53607025G>A	ENST00000425354.2	-	9	1508	c.1021C>T	c.(1021-1023)Cgc>Tgc	p.R341C	RARG_ENST00000543762.1_5'UTR|RARG_ENST00000394426.1_Missense_Mutation_p.R341C|RARG_ENST00000327550.3_Missense_Mutation_p.R269C|RARG_ENST00000338561.5_Missense_Mutation_p.R330C|RARG_ENST00000543726.1_Missense_Mutation_p.R319C	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	341	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R341C(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	AGGTCCATGCGGTCTATGGGG	0.607											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R341C		.											.	RARG	722	1	Substitution - Missense(1)	breast(1)	c.C1021T						.						34.0	37.0	36.0					12																	53607025		2203	4300	6503	SO:0001583	missense	5916	exon9			CCATGCGGTCTAT	M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.1021C>T	12.37:g.53607025G>A	ENSP00000388510:p.Arg341Cys	36.0	0.0	993	67.0	35.0	NM_000966	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	ENST00000425354.2	37	CCDS8850.1	.	.	.	.	.	.	.	.	.	.	G	33	5.266300	0.95399	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000327550;ENST00000338561;ENST00000543726	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.42	5.42	0.78866	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.053635	0.85682	D	0.000000	T	0.71350	0.3329	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.76091	-0.3086	10	0.62326	D	0.03	.	18.3727	0.90412	0.0:0.0:1.0:0.0	.	319;341;330	B7Z4F1;P13631;F1D8P1	.;RARG_HUMAN;.	C	341;341;269;330;319	ENSP00000388510:R341C;ENSP00000377947:R341C;ENSP00000332695:R269C;ENSP00000343698:R330C;ENSP00000444335:R319C	ENSP00000332695:R269C	R	-	1	0	RARG	51893292	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.837000	0.99465	2.712000	0.92718	0.563000	0.77884	CGC	.		0.607	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109404.2	NM_000966	
RGPD4	285190	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	108487292	108487292	+	Silent	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:108487292T>C	ENST00000408999.3	+	20	2909	c.2832T>C	c.(2830-2832)gaT>gaC	p.D944D	RGPD4_ENST00000354986.4_Silent_p.D944D	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	944					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TTGAAAATGATACTGGCTTCC	0.408																																					p.D944D		.											.	RGPD4	2	0			c.T2832C						.						119.0	100.0	106.0					2																	108487292		692	1586	2278	SO:0001819	synonymous_variant	285190	exon20			AAATGATACTGGC	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2832T>C	2.37:g.108487292T>C		1081.0	1.0		1165.0	178.0	NM_182588	B9A029	Silent	SNP	ENST00000408999.3	37	CCDS46381.1																																																																																			.		0.408	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
RIN3	79890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	93118817	93118817	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr14:93118817C>T	ENST00000216487.7	+	6	1582	c.1423C>T	c.(1423-1425)Cca>Tca	p.P475S	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	475	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				CTCGACCCTCCCAGCTCCCTT	0.632																																					p.P475S		.											.	RIN3	522	0			c.C1423T						.						83.0	104.0	97.0					14																	93118817		2203	4300	6503	SO:0001583	missense	79890	exon6			ACCCTCCCAGCTC	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.1423C>T	14.37:g.93118817C>T	ENSP00000216487:p.Pro475Ser	57.0	0.0		28.0	23.0	NM_024832	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	ENST00000216487.7	37	CCDS32144.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.421498	0.25639	.	.	ENSG00000100599	ENST00000216487;ENST00000428147	T	0.05580	3.42	4.49	2.65	0.31530	.	11.404600	0.00166	N	0.000005	T	0.06234	0.0161	L	0.38531	1.155	0.18873	N	0.999981	P;B;B;P	0.45715	0.865;0.024;0.013;0.787	B;B;B;B	0.39503	0.301;0.008;0.003;0.158	T	0.38415	-0.9662	10	0.12103	T	0.63	0.0344	5.4136	0.16361	0.0:0.6096:0.1637:0.2267	.	475;521;400;475	Q8TB24-4;Q86U22;Q6ZRC2;Q8TB24	.;.;.;RIN3_HUMAN	S	475;399	ENSP00000216487:P475S	ENSP00000216487:P475S	P	+	1	0	RIN3	92188570	0.000000	0.05858	0.000000	0.03702	0.441000	0.31987	0.524000	0.22940	0.356000	0.24157	0.491000	0.48974	CCA	.		0.632	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1		
S100A7	6278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153430321	153430321	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:153430321C>A	ENST00000368723.3	-	3	377	c.267G>T	c.(265-267)caG>caT	p.Q89H	S100A7_ENST00000368722.1_Missense_Mutation_p.Q89H	NM_002963.3	NP_002954.2	P31151	S10A7_HUMAN	S100 calcium binding protein A7	89					angiogenesis (GO:0001525)|defense response to Gram-negative bacterium (GO:0050829)|epidermis development (GO:0008544)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of granulocyte chemotaxis (GO:0071624)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of T cell chemotaxis (GO:0010820)|response to lipopolysaccharide (GO:0032496)|response to reactive oxygen species (GO:0000302)|sequestering of metal ion (GO:0051238)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(5)|skin(2)	10	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTCCATGGCTCTGCTTGTGGT	0.522																																					p.Q89H		.											.	S100A7	91	0			c.G267T						.						89.0	81.0	83.0					1																	153430321		2203	4300	6503	SO:0001583	missense	6278	exon3			ATGGCTCTGCTTG	BC034687	CCDS1039.1	1q21	2013-01-10	2006-09-11		ENSG00000143556	ENSG00000143556		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10497	protein-coding gene	gene with protein product		600353	"""S100 calcium-binding protein A7 (psoriasin 1)"", ""S100 calcium binding protein A7 (psoriasin 1)"""	PSOR1		1940442	Standard	NM_002963		Approved	S100A7c	uc001fbv.1	P31151	OTTHUMG00000013123	ENST00000368723.3:c.267G>T	1.37:g.153430321C>A	ENSP00000357712:p.Gln89His	199.0	0.0		199.0	35.0	NM_002963	Q5SY67|Q6FGE3|Q9H1E2	Missense_Mutation	SNP	ENST00000368723.3	37	CCDS1039.1	.	.	.	.	.	.	.	.	.	.	.	1.191	-0.635439	0.03584	.	.	ENSG00000143556	ENST00000368723;ENST00000368722	T;T	0.06528	3.29;3.29	2.15	-1.25	0.09405	EF-hand-like domain (1);	.	.	.	.	T	0.01061	0.0035	N	0.24115	0.695	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.47446	-0.9117	9	0.25106	T	0.35	.	4.8606	0.13581	0.0:0.4455:0.4112:0.1433	.	89	P31151	S10A7_HUMAN	H	89	ENSP00000357712:Q89H;ENSP00000357711:Q89H	ENSP00000357711:Q89H	Q	-	3	2	S100A7	151696945	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.992000	0.03724	-0.385000	0.07833	-1.050000	0.02344	CAG	.		0.522	S100A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036789.1	NM_002963	
SAAL1	113174	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	18127543	18127543	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:18127543C>G	ENST00000524803.1	-	1	95	c.46G>C	c.(46-48)Gag>Cag	p.E16Q	SAAL1_ENST00000533851.1_5'UTR|SAAL1_ENST00000300013.4_Missense_Mutation_p.E16Q|SAAL1_ENST00000529318.1_Missense_Mutation_p.E16Q			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	16										breast(2)|large_intestine(5)|lung(8)	15						TCCTCCTCCTCCTCCTTGTCG	0.657											OREG0020819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E16Q		.											.	SAAL1	90	0			c.G46C						.						40.0	31.0	34.0					11																	18127543		2200	4292	6492	SO:0001583	missense	113174	exon1			CCTCCTCCTCCTT	AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.46G>C	11.37:g.18127543C>G	ENSP00000432487:p.Glu16Gln	17.0	0.0	723	19.0	6.0	NM_138421	A6NH05	Missense_Mutation	SNP	ENST00000524803.1	37	CCDS31439.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.93|11.93	1.786852|1.786852	0.31593|0.31593	.|.	.|.	ENSG00000166788|ENSG00000166788	ENST00000524803;ENST00000300013;ENST00000529318;ENST00000530180|ENST00000532452	T;T;T;T|.	0.34275|.	1.37;1.37;1.37;1.37|.	4.91|4.91	0.398|0.398	0.16319|0.16319	.|.	1.096140|.	0.06859|.	N|.	0.798736|.	T|T	0.22898|0.22898	0.0553|0.0553	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B;B|.	0.18968|.	0.032;0.032;0.032|.	B;B;B|.	0.24701|.	0.055;0.055;0.055|.	T|T	0.26815|0.26815	-1.0092|-1.0092	10|5	0.33940|.	T|.	0.23|.	-0.0423|-0.0423	6.3338|6.3338	0.21285|0.21285	0.0:0.6164:0.1315:0.2521|0.0:0.6164:0.1315:0.2521	.|.	16;16;16|.	E9PRZ1;G1UCX3;Q96ER3|.	.;.;SAAL1_HUMAN|.	Q|S	16|8	ENSP00000432487:E16Q;ENSP00000300013:E16Q;ENSP00000432216:E16Q;ENSP00000431489:E16Q|.	ENSP00000300013:E16Q|.	E|R	-|-	1|3	0|2	SAAL1|SAAL1	18084119|18084119	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.024000|0.024000	0.10985|0.10985	0.289000|0.289000	0.18957|0.18957	0.126000|0.126000	0.18424|0.18424	-0.165000|-0.165000	0.13383|0.13383	GAG|AGG	.		0.657	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421	
SAMSN1	64092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	15858388	15858388	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr21:15858388C>A	ENST00000400566.1	-	8	1048	c.967G>T	c.(967-969)Gac>Tac	p.D323Y	SAMSN1_ENST00000400564.1_Missense_Mutation_p.D155Y|SAMSN1_ENST00000285670.2_Missense_Mutation_p.D391Y	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	323					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		AAGGAGATGTCTGAGCTCAAG	0.403																																					p.D391Y		.											.	SAMSN1	94	0			c.G1171T						.						77.0	68.0	71.0					21																	15858388		1844	4092	5936	SO:0001583	missense	64092	exon9			AGATGTCTGAGCT	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.967G>T	21.37:g.15858388C>A	ENSP00000383411:p.Asp323Tyr	137.0	0.0		149.0	37.0	NM_001256370	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000400566.1	37	CCDS42906.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490225	0.26686	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	T;T	0.47528	0.84;0.87	5.96	4.99	0.66335	.	0.951458	0.08934	N	0.872550	T	0.53786	0.1818	L	0.60455	1.87	0.38207	D	0.940354	P;P;P	0.45474	0.834;0.859;0.666	B;P;B	0.46389	0.311;0.515;0.126	T	0.52268	-0.8598	10	0.72032	D	0.01	-8.7687	11.2823	0.49201	0.0:0.7921:0.1323:0.0756	.	155;391;323	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	Y	391;323;155	ENSP00000285670:D391Y;ENSP00000383411:D323Y	ENSP00000285670:D391Y	D	-	1	0	SAMSN1	14780259	1.000000	0.71417	0.997000	0.53966	0.249000	0.25844	2.171000	0.42453	1.371000	0.46172	0.591000	0.81541	GAC	.		0.403	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1		
SEC16A	9919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139370175	139370175	+	Silent	SNP	C	C	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr9:139370175C>A	ENST00000371706.3	-	1	1392	c.1359G>T	c.(1357-1359)gtG>gtT	p.V453V	SEC16A_ENST00000313050.7_Silent_p.V631V|SEC16A_ENST00000431893.2_Silent_p.V453V|SEC16A_ENST00000290037.6_Silent_p.V453V			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	453					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CTTCACCAACCACGTTGGCGC	0.527																																					p.V631V		.											.	.	.	0			c.G1893T						.						36.0	41.0	39.0					9																	139370175		2129	4230	6359	SO:0001819	synonymous_variant	9919	exon3			ACCAACCACGTTG	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.1359G>T	9.37:g.139370175C>A		66.0	0.0		45.0	33.0	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	37																																																																																				.		0.527	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
SESN1	27244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	109315748	109315748	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr6:109315748C>A	ENST00000356644.7	-	6	954	c.860G>T	c.(859-861)cGa>cTa	p.R287L	SESN1_ENST00000302071.2_Missense_Mutation_p.R221L|SESN1_ENST00000436639.2_Missense_Mutation_p.R346L	NM_001199933.1	NP_001186862.1	Q9Y6P5	SESN1_HUMAN	sestrin 1	287					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of cell proliferation (GO:0008285)|regulation of protein kinase B signaling (GO:0051896)|regulation of response to reactive oxygen species (GO:1901031)	nucleus (GO:0005634)				cervix(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	10		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		TTCTTCATCTCGACATTCCTG	0.378																																					p.R346L		.											.	SESN1	227	0			c.G1037T						.						145.0	119.0	128.0					6																	109315748		2203	4300	6503	SO:0001583	missense	27244	exon6			TCATCTCGACATT	AF033120	CCDS5070.1, CCDS56444.1, CCDS56445.1	6q21	2008-10-23			ENSG00000080546	ENSG00000080546			21595	protein-coding gene	gene with protein product		606103				9926927, 7938006	Standard	NM_014454		Approved	SEST1, PA26	uc003psu.3	Q9Y6P5	OTTHUMG00000015338	ENST00000356644.7:c.860G>T	6.37:g.109315748C>A	ENSP00000349061:p.Arg287Leu	85.0	0.0		54.0	17.0	NM_014454	Q2M2B7|Q5T316|Q9NV00|Q9UPD5|Q9Y6P6	Missense_Mutation	SNP	ENST00000356644.7	37	CCDS56445.1	.	.	.	.	.	.	.	.	.	.	C	34	5.356975	0.95854	.	.	ENSG00000080546	ENST00000436639;ENST00000302071;ENST00000356644	T;T;T	0.23348	1.91;1.91;1.91	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.39332	0.1074	L	0.60957	1.885	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.81914	0.992;0.995	T	0.01858	-1.1259	10	0.24483	T	0.36	-8.1299	19.8401	0.96679	0.0:1.0:0.0:0.0	.	346;287	Q9Y6P5-2;Q9Y6P5	.;SESN1_HUMAN	L	346;221;287	ENSP00000393762:R346L;ENSP00000306734:R221L;ENSP00000349061:R287L	ENSP00000306734:R221L	R	-	2	0	SESN1	109422441	0.991000	0.36638	0.999000	0.59377	0.991000	0.79684	2.939000	0.48995	2.675000	0.91044	0.591000	0.81541	CGA	.		0.378	SESN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041738.4	NM_014454	
SGPL1	8879	broad.mit.edu;bcgsc.ca	37	10	72604395	72604395	+	Splice_Site	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:72604395A>G	ENST00000373202.3	+	3	393	c.193A>G	c.(193-195)Agt>Ggt	p.S65G		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	65					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						CCAGCCAGAGAGTAAGTATGC	0.448																																					p.S65G	Colon(151;1054 2458 6676 40971)	.											.	SGPL1	226	0			c.A193G						.						137.0	124.0	128.0					10																	72604395		2203	4300	6503	SO:0001630	splice_region_variant	8879	exon3			CCAGAGAGTAAGT	AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.193+1A>G	10.37:g.72604395A>G		46.0	0.0		43.0	5.0	NM_003901	B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	ENST00000373202.3	37	CCDS31216.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.090941	0.76756	.	.	ENSG00000166224	ENST00000373202;ENST00000299297	T;T	0.45668	0.89;1.02	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.40040	0.1101	L	0.59436	1.845	0.58432	D	0.999994	B	0.17667	0.023	B	0.19148	0.024	T	0.20706	-1.0267	10	0.21014	T	0.42	-16.0931	13.8079	0.63246	1.0:0.0:0.0:0.0	.	65	O95470	SGPL1_HUMAN	G	65;48	ENSP00000362298:S65G;ENSP00000299297:S48G	ENSP00000299297:S48G	S	+	1	0	SGPL1	72274401	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.154000	0.64894	2.242000	0.73789	0.528000	0.53228	AGT	.		0.448	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048533.1	NM_003901	Missense_Mutation
SLC16A1	6566	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	113471853	113471853	+	Silent	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:113471853A>G	ENST00000538576.1	-	2	909	c.78T>C	c.(76-78)gcT>gcC	p.A26A	SLC16A1_ENST00000433570.4_Silent_p.A26A|SLC16A1_ENST00000369626.3_Silent_p.A26A|SLC16A1_ENST00000478835.1_5'UTR	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	26					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TGGAAATGAAAGCTCCAATTA	0.458																																					p.A26A		.											.	SLC16A1	514	0			c.T78C						.						54.0	53.0	53.0					1																	113471853		2203	4300	6503	SO:0001819	synonymous_variant	6566	exon2			AATGAAAGCTCCA	BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.78T>C	1.37:g.113471853A>G		37.0	0.0		30.0	5.0	NM_001166496	Q49A45|Q5T8R6|Q9NSJ9	Silent	SNP	ENST00000538576.1	37	CCDS858.1																																																																																			.		0.458	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033539.1	NM_003051	
SLC17A6	57084	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	22399124	22399124	+	Silent	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:22399124G>T	ENST00000263160.3	+	12	2024	c.1587G>T	c.(1585-1587)ggG>ggT	p.G529G		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	529					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						AAGAAACAGGGGACATTACTC	0.428																																					p.G529G		.											.	SLC17A6	580	0			c.G1587T						.						59.0	65.0	63.0					11																	22399124		2203	4300	6503	SO:0001819	synonymous_variant	57084	exon12			AACAGGGGACATT	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1587G>T	11.37:g.22399124G>T		145.0	1.0		128.0	36.0	NM_020346	A6NKS2	Silent	SNP	ENST00000263160.3	37	CCDS7856.1																																																																																			.		0.428	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
SLC35C1	55343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	45832329	45832329	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:45832329G>A	ENST00000314134.3	+	2	1934	c.538G>A	c.(538-540)Ggc>Agc	p.G180S	SLC35C1_ENST00000442528.2_Missense_Mutation_p.G167S|SLC35C1_ENST00000456334.1_Missense_Mutation_p.G167S|CTD-2210P24.6_ENST00000534128.1_lincRNA	NM_018389.4	NP_060859.4	Q96A29	FUCT1_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C1	180					carbohydrate transport (GO:0008643)|lipid glycosylation (GO:0030259)|negative regulation of Notch signaling pathway (GO:0045746)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10				GBM - Glioblastoma multiforme(35;0.227)		CACTGCAGGGGGCTTCTGGCT	0.612																																					p.G180S		.											.	SLC35C1	90	0			c.G538A						.						33.0	36.0	35.0					11																	45832329		2203	4299	6502	SO:0001583	missense	55343	exon2			GCAGGGGGCTTCT		CCDS7914.1, CCDS44575.1	11p11.2	2014-09-17	2013-07-17			ENSG00000181830		"""Solute carriers"""	20197	protein-coding gene	gene with protein product		605881	"""solute carrier family 35, member C1"""			11326279, 11326280	Standard	NM_018389		Approved	FUCT1, FLJ11320	uc010rgm.2	Q96A29		ENST00000314134.3:c.538G>A	11.37:g.45832329G>A	ENSP00000313318:p.Gly180Ser	30.0	0.0		54.0	17.0	NM_018389	B2RDB2|Q9BV76|Q9NUJ8	Missense_Mutation	SNP	ENST00000314134.3	37	CCDS7914.1	.	.	.	.	.	.	.	.	.	.	G	36	5.620545	0.96660	.	.	ENSG00000181830	ENST00000442528;ENST00000456334;ENST00000530670;ENST00000314134;ENST00000540685	D;D;D	0.85339	-1.97;-1.97;-1.97	6.08	6.08	0.98989	Drug/metabolite transporter (1);	0.092273	0.85682	D	0.000000	D	0.94188	0.8135	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93188	0.6580	10	0.45353	T	0.12	-31.4081	20.6634	0.99662	0.0:0.0:1.0:0.0	.	180	Q96A29	FUCT1_HUMAN	S	167;167;101;180;180	ENSP00000412408:G167S;ENSP00000399779:G167S;ENSP00000313318:G180S	ENSP00000313318:G180S	G	+	1	0	SLC35C1	45788905	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.538000	0.98072	2.894000	0.99253	0.655000	0.94253	GGC	.		0.612	SLC35C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390139.1	NM_018389	
SLCO2A1	6578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	133654650	133654650	+	Silent	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr3:133654650G>A	ENST00000310926.4	-	13	2055	c.1782C>T	c.(1780-1782)tgC>tgT	p.C594C	SLCO2A1_ENST00000493729.1_Silent_p.C518C	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	594					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	CATAGTAGGCGCAGGCCCCTC	0.597																																					p.C594C		.											.	SLCO2A1	90	0			c.C1782T						.						76.0	65.0	69.0					3																	133654650		2203	4300	6503	SO:0001819	synonymous_variant	6578	exon13			GTAGGCGCAGGCC		CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1782C>T	3.37:g.133654650G>A		115.0	0.0		118.0	33.0	NM_005630	Q86V98|Q8IUN2	Silent	SNP	ENST00000310926.4	37	CCDS3084.1																																																																																			.		0.597	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357131.1	NM_005630	
SMC6	79677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	17877588	17877588	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:17877588G>A	ENST00000448223.2	-	22	2769	c.2500C>T	c.(2500-2502)Cga>Tga	p.R834*	SMC6_ENST00000351948.4_Nonsense_Mutation_p.R834*|SMC6_ENST00000381272.4_Nonsense_Mutation_p.R860*|SMC6_ENST00000402989.1_Nonsense_Mutation_p.R834*	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	834					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TCCAGTTCTCGTTTCTTTTTA	0.318																																					p.R834X		.											.	SMC6	292	0			c.C2500T						.						145.0	140.0	142.0					2																	17877588		2202	4300	6502	SO:0001587	stop_gained	79677	exon22			GTTCTCGTTTCTT	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.2500C>T	2.37:g.17877588G>A	ENSP00000404092:p.Arg834*	139.0	0.0		111.0	18.0	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Nonsense_Mutation	SNP	ENST00000448223.2	37	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	G	41	9.072005	0.99055	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989	.	.	.	5.27	2.02	0.26589	.	0.424462	0.24703	N	0.036291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	7.1425	0.25564	0.0:0.2992:0.3276:0.3732	.	.	.	.	X	834;834;860;834	.	ENSP00000323439:R834X	R	-	1	2	SMC6	17741069	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	0.408000	0.21065	0.652000	0.30806	0.591000	0.81541	CGA	.		0.318	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
SNX8	29886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2302995	2302995	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr7:2302995G>T	ENST00000222990.3	-	7	827	c.785C>A	c.(784-786)gCa>gAa	p.A262E		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	262					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		AGACCCTATTGCACTGAGGGA	0.617																																					p.A262E		.											.	SNX8	290	0			c.C785A						.						32.0	31.0	31.0					7																	2302995		2202	4298	6500	SO:0001583	missense	29886	exon7			CCTATTGCACTGA	AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.785C>A	7.37:g.2302995G>T	ENSP00000222990:p.Ala262Glu	41.0	0.0		36.0	16.0	NM_013321	A4D207|Q96I67	Missense_Mutation	SNP	ENST00000222990.3	37	CCDS5331.1	.	.	.	.	.	.	.	.	.	.	G	3.713	-0.059067	0.07317	.	.	ENSG00000106266	ENST00000222990	T	0.21734	1.99	5.47	5.47	0.80525	.	0.257277	0.36703	N	0.002452	T	0.10508	0.0257	N	0.04959	-0.14	0.38254	D	0.941698	B	0.02656	0.0	B	0.08055	0.003	T	0.09975	-1.0650	10	0.05525	T	0.97	.	17.5154	0.87771	0.0:0.0:1.0:0.0	.	262	Q9Y5X2	SNX8_HUMAN	E	262	ENSP00000222990:A262E	ENSP00000222990:A262E	A	-	2	0	SNX8	2269521	1.000000	0.71417	0.440000	0.26846	0.050000	0.14768	5.773000	0.68898	2.570000	0.86706	0.655000	0.94253	GCA	.		0.617	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322949.2		
SP4	6671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	21470288	21470288	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr7:21470288G>C	ENST00000222584.3	+	3	1723	c.1505G>C	c.(1504-1506)aGt>aCt	p.S502T		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	502					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GTGTCTTCAAGTGGTGGCACA	0.458																																					p.S502T		.											.	SP4	95	0			c.G1505C						.						122.0	125.0	124.0					7																	21470288		2203	4300	6503	SO:0001583	missense	6671	exon3			CTTCAAGTGGTGG		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1505G>C	7.37:g.21470288G>C	ENSP00000222584:p.Ser502Thr	143.0	0.0		172.0	94.0	NM_003112	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.240152	0.58995	.	.	ENSG00000105866	ENST00000222584	T	0.10005	2.92	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.12817	0.0311	L	0.36672	1.1	0.48975	D	0.999737	P	0.48764	0.915	B	0.44108	0.441	T	0.06991	-1.0796	10	0.27082	T	0.32	.	18.8556	0.92251	0.0:0.0:1.0:0.0	.	502	Q02446	SP4_HUMAN	T	502	ENSP00000222584:S502T	ENSP00000222584:S502T	S	+	2	0	SP4	21436813	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	6.201000	0.72124	2.758000	0.94735	0.655000	0.94253	AGT	.		0.458	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
SRRM5	100170229	broad.mit.edu;bcgsc.ca	37	19	44117754	44117754	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:44117754A>G	ENST00000607544.1	+	3	1803	c.1481A>G	c.(1480-1482)gAg>gGg	p.E494G	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Missense_Mutation_p.E494G|SRRM5_ENST00000526798.1_Missense_Mutation_p.E509G			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	494	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						CCCAGCAAAGAGAGAGATCAC	0.522																																					p.E494G		.											.	.	.	0			c.A1481G						.						92.0	95.0	94.0					19																	44117754		692	1591	2283	SO:0001583	missense	100170229	exon1			GCAAAGAGAGAGA	AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1481A>G	19.37:g.44117754A>G	ENSP00000476253:p.Glu494Gly	47.0	0.0		70.0	4.0	NM_001145641	B4DNF0	Missense_Mutation	SNP	ENST00000607544.1	37	CCDS46095.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.482135	0.44147	.	.	ENSG00000226763	ENST00000526798;ENST00000417606	.	.	.	4.38	1.22	0.21188	.	.	.	.	.	T	0.28632	0.0709	L	0.29908	0.895	0.09310	N	1	B	0.18461	0.028	B	0.19946	0.027	T	0.21999	-1.0229	8	0.35671	T	0.21	.	7.3331	0.26594	0.7226:0.0:0.2774:0.0	.	494	B3KS81	SRRM5_HUMAN	G	509;494	.	ENSP00000414512:E494G	E	+	2	0	SRRM5	48809594	0.000000	0.05858	0.001000	0.08648	0.058000	0.15608	-0.200000	0.09478	0.141000	0.18875	0.533000	0.62120	GAG	.		0.522	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000384398.2	NM_001145641	
STARD7	56910	broad.mit.edu;mdanderson.org	37	2	96874004	96874004	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:96874004G>A	ENST00000337288.5	-	1	552	c.169C>T	c.(169-171)Ctc>Ttc	p.L57F	AC012307.3_ENST00000446816.1_RNA	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7	57						mitochondrion (GO:0005739)	lipid binding (GO:0008289)			endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						CGGCCGAGGAGAACGCGGCGT	0.701																																					p.L57F		.											.	STARD7	68	0			c.C169T						.						12.0	13.0	13.0					2																	96874004		2190	4283	6473	SO:0001583	missense	56910	exon1			CGAGGAGAACGCG	AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.169C>T	2.37:g.96874004G>A	ENSP00000338030:p.Leu57Phe	39.0	0.0		56.0	11.0	NM_020151	D3DXG9|Q53T44|Q6GU43|Q969M6	Missense_Mutation	SNP	ENST00000337288.5	37	CCDS2017.2	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945046	0.53079	.	.	ENSG00000084090	ENST00000337288	T	0.36699	1.24	5.32	5.32	0.75619	.	.	.	.	.	T	0.51839	0.1698	L	0.46157	1.445	0.37428	D	0.913928	D	0.71674	0.998	D	0.78314	0.991	T	0.51996	-0.8634	9	0.40728	T	0.16	-14.249	14.3713	0.66840	0.0:0.0:1.0:0.0	.	57	Q9NQZ5	STAR7_HUMAN	F	57	ENSP00000338030:L57F	ENSP00000338030:L57F	L	-	1	0	STARD7	96237731	1.000000	0.71417	0.948000	0.38648	0.163000	0.22366	4.628000	0.61282	2.767000	0.95098	0.655000	0.94253	CTC	.		0.701	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252848.2		
STIM1	6786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4076832	4076832	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:4076832C>A	ENST00000300737.4	+	4	1031	c.462C>A	c.(460-462)ttC>ttA	p.F154L	STIM1_ENST00000527651.1_Missense_Mutation_p.F154L|STIM1_ENST00000527484.1_3'UTR	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	154	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		AGGAGACCTTCCGGAAGCTGC	0.547																																					p.F154L		.											.	STIM1	91	0			c.C462A						.						85.0	74.0	78.0					11																	4076832		2201	4298	6499	SO:0001583	missense	6786	exon4			GACCTTCCGGAAG	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.462C>A	11.37:g.4076832C>A	ENSP00000300737:p.Phe154Leu	112.0	0.0		123.0	17.0	NM_003156	E9PQJ4|Q8N382	Missense_Mutation	SNP	ENST00000300737.4	37	CCDS7749.1	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436533	0.62955	.	.	ENSG00000167323	ENST00000525403;ENST00000300737;ENST00000527651;ENST00000532610;ENST00000532919;ENST00000530554;ENST00000525055;ENST00000528656	D;D;D;D;D;T;T;D	0.89552	-2.53;-2.53;-2.53;-2.53;-2.53;0.35;0.35;-2.53	5.78	4.88	0.63580	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.053094	0.85682	D	0.000000	D	0.88262	0.6389	M	0.76574	2.34	0.80722	D	1	B;B	0.31485	0.325;0.158	B;B	0.31686	0.134;0.095	D	0.87626	0.2513	10	0.72032	D	0.01	-32.2044	12.6938	0.56992	0.0:0.9203:0.0:0.0797	.	154;154	E9PQJ4;Q13586	.;STIM1_HUMAN	L	80;154;154;80;80;80;80;80	ENSP00000432210:F80L;ENSP00000300737:F154L;ENSP00000436208:F154L;ENSP00000434848:F80L;ENSP00000433949:F80L;ENSP00000431878:F80L;ENSP00000431191:F80L;ENSP00000432378:F80L	ENSP00000300737:F154L	F	+	3	2	STIM1	4033408	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.830000	0.48136	1.462000	0.47948	0.591000	0.81541	TTC	.		0.547	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257196.1	NM_003156	
STX4	6810	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31045531	31045531	+	Intron	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr16:31045531C>T	ENST00000313843.3	+	3	447				STX4_ENST00000493902.1_Intron|STX4_ENST00000394998.1_Silent_p.L37L	NM_004604.3	NP_004595.2	Q12846	STX4_HUMAN	syntaxin 4						blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|neurotransmitter transport (GO:0006836)|platelet activation (GO:0030168)|post-Golgi vesicle-mediated transport (GO:0006892)|SNARE complex assembly (GO:0035493)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|membrane (GO:0016020)|myelin sheath adaxonal region (GO:0035749)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|trans-Golgi network (GO:0005802)|vacuole (GO:0005773)				NS(2)|breast(1)|large_intestine(3)|lung(3)	9						TCAGCCCTCTCGGTCACCCTC	0.582																																					p.L37L		.											.	STX4	90	0			c.C111T						.						116.0	120.0	118.0					16																	31045531		2197	4300	6497	SO:0001627	intron_variant	6810	exon4			CCCTCTCGGTCAC	AF026007	CCDS10700.1, CCDS61916.1	16p11.2	2008-02-05	2006-04-25	2006-04-25	ENSG00000103496	ENSG00000103496			11439	protein-coding gene	gene with protein product		186591	"""syntaxin 4A (placental)"""	STX4A		8206394, 16339081	Standard	NM_001272095		Approved	p35-2	uc002eak.4	Q12846	OTTHUMG00000132404	ENST00000313843.3:c.133-16C>T	16.37:g.31045531C>T		75.0	0.0		60.0	32.0	NM_001272096	A8MXY0|Q15525|Q6FHE8	Silent	SNP	ENST00000313843.3	37	CCDS10700.1																																																																																			.		0.582	STX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255538.3	NM_004604	
SUV420H1	51111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67925241	67925241	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr11:67925241A>C	ENST00000304363.4	-	11	2925	c.2572T>G	c.(2572-2574)Ttg>Gtg	p.L858V		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	858					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						ATTAACCTCAAGCGCTTAGCT	0.398																																					p.L858V		.											.	SUV420H1	228	0			c.T2572G						.						64.0	65.0	65.0					11																	67925241		2200	4294	6494	SO:0001583	missense	51111	exon11			ACCTCAAGCGCTT	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.2572T>G	11.37:g.67925241A>C	ENSP00000305899:p.Leu858Val	135.0	0.0		178.0	101.0	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	37	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.769480	0.49680	.	.	ENSG00000110066	ENST00000304363	T	0.63096	-0.02	5.71	-5.41	0.02648	.	0.000000	0.85682	D	0.000000	T	0.66137	0.2759	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.68221	-0.5466	10	0.87932	D	0	-13.6599	17.731	0.88377	0.7574:0.0:0.2426:0.0	.	858	Q4FZB7	SV421_HUMAN	V	858	ENSP00000305899:L858V	ENSP00000305899:L858V	L	-	1	2	SUV420H1	67681817	0.025000	0.19082	0.001000	0.08648	0.981000	0.71138	0.170000	0.16663	-1.557000	0.01692	0.402000	0.26972	TTG	.		0.398	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
TACC2	10579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123843951	123843951	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr10:123843951G>T	ENST00000369005.1	+	4	2276	c.1936G>T	c.(1936-1938)Ggg>Tgg	p.G646W	TACC2_ENST00000515603.1_Missense_Mutation_p.G646W|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Missense_Mutation_p.G646W|TACC2_ENST00000334433.3_Missense_Mutation_p.G646W|TACC2_ENST00000515273.1_Missense_Mutation_p.G646W	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	646					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GCACACGGACGGGCCCCACTC	0.612																																					p.G646W		.											.	TACC2	296	0			c.G1936T						.						36.0	34.0	34.0					10																	123843951		2203	4300	6503	SO:0001583	missense	10579	exon4			ACGGACGGGCCCC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.1936G>T	10.37:g.123843951G>T	ENSP00000358001:p.Gly646Trp	32.0	0.0		30.0	16.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	37	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863732	0.51482	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.04317	3.69;3.65;3.65;3.69;3.65	5.21	-8.51	0.00923	.	1.128570	0.06872	N	0.800925	T	0.05960	0.0155	N	0.14661	0.345	0.09310	N	1	D;D;D	0.63880	0.993;0.993;0.993	P;P;P	0.60609	0.877;0.877;0.877	T	0.32824	-0.9892	10	0.72032	D	0.01	4.0547	8.3674	0.32395	0.2891:0.22:0.4909:0.0	.	646;646;646	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	W	646;646;646;646;646;636	ENSP00000358001:G646W;ENSP00000424467:G646W;ENSP00000427618:G646W;ENSP00000334280:G646W;ENSP00000395048:G646W	ENSP00000334280:G646W	G	+	1	0	TACC2	123833941	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.239000	0.02916	-1.296000	0.02353	-0.258000	0.10820	GGG	.		0.612	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
TCEA3	6920	ucsc.edu;bcgsc.ca	37	1	23710871	23710871	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:23710871C>T	ENST00000450454.2	-	10	1112	c.1006G>A	c.(1006-1008)Gtc>Atc	p.V336I		NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	336					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		TTGCATAAGACAAAGGTAGTC	0.502																																					p.V336I		.											.	.	.	0			c.G1006A						.						179.0	180.0	180.0					1																	23710871		2157	4284	6441	SO:0001583	missense	6920	exon10			ATAAGACAAAGGT	AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.1006G>A	1.37:g.23710871C>T	ENSP00000406293:p.Val336Ile	43.0	0.0		42.0	4.0	NM_003196	A8K2K7|Q5DR83	Missense_Mutation	SNP	ENST00000450454.2	37	CCDS44086.1	.	.	.	.	.	.	.	.	.	.	C	35	5.454843	0.96223	.	.	ENSG00000204219	ENST00000450454	.	.	.	5.37	5.37	0.77165	Zinc finger, TFIIS-type (4);	0.000000	0.85682	D	0.000000	D	0.84347	0.5452	M	0.86864	2.845	0.80722	D	1	D	0.64830	0.994	D	0.74023	0.982	D	0.86721	0.1942	9	0.87932	D	0	-10.6854	18.0828	0.89447	0.0:1.0:0.0:0.0	.	336	O75764	TCEA3_HUMAN	I	336	.	ENSP00000406293:V336I	V	-	1	0	TCEA3	23583458	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.798000	0.85924	2.711000	0.92665	0.561000	0.74099	GTC	.		0.502	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008911.2	NM_003196	
TCEB3	6924	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	24078281	24078281	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:24078281A>G	ENST00000418390.2	+	4	1535	c.1264A>G	c.(1264-1266)Atg>Gtg	p.M422V	TCEB3_ENST00000609199.1_Missense_Mutation_p.M396V	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	422					gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GGAGACAGATATGGAGGATGA	0.438											OREG0013232	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M422V		.											.	TCEB3	91	0			c.A1264G						.						115.0	132.0	126.0					1																	24078281		2203	4300	6503	SO:0001583	missense	6924	exon4			ACAGATATGGAGG	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1264A>G	1.37:g.24078281A>G	ENSP00000395574:p.Met422Val	62.0	0.0	768	43.0	31.0	NM_003198	B2R7Q8|Q8IXH1	Missense_Mutation	SNP	ENST00000418390.2	37	CCDS239.2	.	.	.	.	.	.	.	.	.	.	A	0.255	-1.003992	0.02112	.	.	ENSG00000011007	ENST00000418390	T	0.06218	3.33	5.96	-11.9	0.00025	.	1.279420	0.04833	N	0.439085	T	0.03477	0.0100	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32561	-0.9902	10	0.37606	T	0.19	-0.1601	8.4188	0.32687	0.2075:0.1641:0.547:0.0815	.	422	Q14241	ELOA1_HUMAN	V	422	ENSP00000395574:M422V	ENSP00000395574:M422V	M	+	1	0	TCEB3	23950868	.	.	0.000000	0.03702	0.194000	0.23727	.	.	-2.721000	0.00389	-0.290000	0.09829	ATG	.		0.438	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198	
TGFBRAP1	9392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	105885897	105885897	+	Silent	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:105885897G>A	ENST00000393359.2	-	11	2664	c.2238C>T	c.(2236-2238)acC>acT	p.T746T	TGFBRAP1_ENST00000258449.1_Silent_p.T746T			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	746					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						CATCAAATTCGGTGGCGTGGC	0.627																																					p.T746T	Esophageal Squamous(183;794 2019 9730 21801 48859)	.											.	TGFBRAP1	91	0			c.C2238T						.						28.0	30.0	29.0					2																	105885897		2203	4300	6503	SO:0001819	synonymous_variant	9392	exon11			AAATTCGGTGGCG	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.2238C>T	2.37:g.105885897G>A		90.0	0.0		110.0	40.0	NM_004257	A8K5R7|D3DVJ8|O60466	Silent	SNP	ENST00000393359.2	37	CCDS2067.1																																																																																			.		0.627	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
TGM3	7053	broad.mit.edu;bcgsc.ca	37	20	2315852	2315852	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr20:2315852T>C	ENST00000381458.5	+	11	1796	c.1733T>C	c.(1732-1734)gTc>gCc	p.V578A		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	578					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	GTGTGCAAGGTCCCAGATGAG	0.552																																					p.V578A		.											.	TGM3	139	0			c.T1733C						.						171.0	136.0	148.0					20																	2315852		2203	4300	6503	SO:0001583	missense	7053	exon11			GCAAGGTCCCAGA	L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1733T>C	20.37:g.2315852T>C	ENSP00000370867:p.Val578Ala	97.0	0.0		114.0	5.0	NM_003245	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	ENST00000381458.5	37	CCDS33435.1	.	.	.	.	.	.	.	.	.	.	T	9.102	1.004271	0.19199	.	.	ENSG00000125780	ENST00000381458	T	0.78246	-1.16	5.13	5.13	0.70059	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.186293	0.46145	D	0.000301	T	0.76104	0.3941	M	0.66939	2.045	0.38752	D	0.954126	B	0.19817	0.039	B	0.27608	0.081	T	0.74121	-0.3767	10	0.33141	T	0.24	-0.1984	12.8871	0.58051	0.0:0.0:0.0:1.0	.	578	Q08188	TGM3_HUMAN	A	578	ENSP00000370867:V578A	ENSP00000370867:V578A	V	+	2	0	TGM3	2263852	1.000000	0.71417	0.796000	0.32109	0.252000	0.25951	2.626000	0.46460	1.914000	0.55421	0.459000	0.35465	GTC	.		0.552	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077579.2	NM_003245	
THADA	63892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	43458154	43458154	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr2:43458154A>C	ENST00000405006.4	-	38	6146	c.5795T>G	c.(5794-5796)cTc>cGc	p.L1932R	THADA_ENST00000330266.7_Intron|AC010883.5_ENST00000423354.1_RNA|THADA_ENST00000415080.2_Missense_Mutation_p.L1613R|THADA_ENST00000405975.2_Missense_Mutation_p.L1932R	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1932										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CCAAACACTGAGAACTAGGGT	0.488																																					p.L1932R		.											.	THADA	228	0			c.T5795G						.						68.0	66.0	67.0					2																	43458154		1922	4135	6057	SO:0001583	missense	63892	exon38			ACACTGAGAACTA	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.5795T>G	2.37:g.43458154A>C	ENSP00000385995:p.Leu1932Arg	104.0	0.0		132.0	65.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.787|9.787	1.176942|1.176942	0.21787|0.21787	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006|ENST00000407351	T;T;T|.	0.15718|.	2.62;2.4;2.62|.	4.37|4.37	0.111|0.111	0.14619|0.14619	.|.	0.265855|.	0.22804|.	N|.	0.055439|.	T|T	0.38665|0.38665	0.1049|0.1049	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	N|N	1|1	B;B|.	0.09022|.	0.002;0.002|.	B;B|.	0.10450|.	0.005;0.005|.	T|T	0.36744|0.36744	-0.9735|-0.9735	10|5	0.87932|.	D|.	0|.	.|.	1.6077|1.6077	0.02687|0.02687	0.5019:0.143:0.0861:0.269|0.5019:0.143:0.0861:0.269	.|.	1859;1932|.	B6ZDQ0;Q6YHU6|.	.;THADA_HUMAN|.	R|A	1932;1859;1613;1932|1172	ENSP00000386088:L1932R;ENSP00000416048:L1613R;ENSP00000385995:L1932R|.	ENSP00000349464:L1859R|.	L|S	-|-	2|1	0|0	THADA|THADA	43311658|43311658	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.007000|0.007000	0.05969|0.05969	-0.050000|-0.050000	0.11904|0.11904	0.181000|0.181000	0.19994|0.19994	0.533000|0.533000	0.62120|0.62120	CTC|TCA	.		0.488	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
TRIP4	9325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	64698610	64698610	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr15:64698610A>G	ENST00000261884.3	+	6	839	c.779A>G	c.(778-780)gAg>gGg	p.E260G	TRIP4_ENST00000559565.1_Intron	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	260					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						TCTGGTCTGGAGAAGGCTATC	0.383																																					p.E260G		.											.	TRIP4	188	0			c.A779G						.						95.0	92.0	93.0					15																	64698610		2203	4300	6503	SO:0001583	missense	9325	exon6			GTCTGGAGAAGGC	L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.779A>G	15.37:g.64698610A>G	ENSP00000261884:p.Glu260Gly	98.0	0.0		113.0	24.0	NM_016213	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	ENST00000261884.3	37	CCDS10194.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.955375	0.92726	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.66218	0.2767	M	0.79123	2.44	0.80722	D	1	P	0.41420	0.749	B	0.40477	0.33	T	0.68716	-0.5335	9	0.39692	T	0.17	0.0375	16.3265	0.82983	1.0:0.0:0.0:0.0	.	260	Q15650	TRIP4_HUMAN	G	260	.	ENSP00000261884:E260G	E	+	2	0	TRIP4	62485663	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.553000	0.90686	2.313000	0.78055	0.455000	0.32223	GAG	.		0.383	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
TTBK1	84630	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	43226802	43226802	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr6:43226802G>C	ENST00000259750.4	+	11	1126	c.1043G>C	c.(1042-1044)gGg>gCg	p.G348A	TTBK1_ENST00000304139.5_Missense_Mutation_p.G297A	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	348					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CCAGTGCCTGGGGACCTGCTC	0.652																																					p.G348A		.											.	TTBK1	353	0			c.G1043C						.						50.0	55.0	53.0					6																	43226802		2203	4300	6503	SO:0001583	missense	84630	exon11			TGCCTGGGGACCT	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1043G>C	6.37:g.43226802G>C	ENSP00000259750:p.Gly348Ala	70.0	0.0		116.0	11.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246690	0.80024	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.64803	-0.12	5.15	5.15	0.70609	.	0.058934	0.64402	D	0.000002	T	0.61912	0.2385	L	0.54323	1.7	0.58432	D	0.999997	P	0.47604	0.898	P	0.51582	0.674	T	0.66388	-0.5936	10	0.62326	D	0.03	.	17.3912	0.87431	0.0:0.0:1.0:0.0	.	348	Q5TCY1	TTBK1_HUMAN	A	297;348;297	ENSP00000259750:G348A	ENSP00000259750:G348A	G	+	2	0	TTBK1	43334780	1.000000	0.71417	0.916000	0.36221	0.689000	0.40095	9.869000	0.99810	2.401000	0.81631	0.561000	0.74099	GGG	.		0.652	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
UBE2S	27338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55918294	55918294	+	Missense_Mutation	SNP	G	G	A	rs374069290		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:55918294G>A	ENST00000264552.9	-	2	227	c.40C>T	c.(40-42)Cgc>Tgc	p.R14C	UBE2S_ENST00000592570.1_5'Flank|UBE2S_ENST00000589978.1_Missense_Mutation_p.R14C	NM_014501.2	NP_055316.2	Q16763	UBE2S_HUMAN	ubiquitin-conjugating enzyme E2S	14					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular protein modification process (GO:0006464)|exit from mitosis (GO:0010458)|free ubiquitin chain polymerization (GO:0010994)|protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)	anaphase-promoting complex (GO:0005680)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			lung(1)	1	Breast(117;0.155)		LUSC - Lung squamous cell carcinoma(43;0.13)|BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.11)		TACACCAGGCGGATGATGTGC	0.602																																					p.R14C		.											.	UBE2S	226	0			c.C40T						.	G	CYS/ARG	0,4406		0,0,2203	117.0	101.0	106.0		40	4.0	1.0	19		106	1,8599	1.2+/-3.3	0,1,4299	no	missense	UBE2S	NM_014501.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	14/223	55918294	1,13005	2203	4300	6503	SO:0001583	missense	27338	exon2			CCAGGCGGATGAT	BC004236	CCDS33114.1	19q13.43	2008-02-05				ENSG00000108106		"""Ubiquitin-conjugating enzymes E2"""	17895	protein-coding gene	gene with protein product	"""ubiquitin carrier protein"", ""ubiquitin-conjugating enzyme E2-24 kD"", ""ubiquitin-protein ligase"""	610309				1379239	Standard	NM_014501		Approved	E2-EPF	uc002qkx.1	Q16763		ENST00000264552.9:c.40C>T	19.37:g.55918294G>A	ENSP00000264552:p.Arg14Cys	76.0	0.0		86.0	16.0	NM_014501	Q9BTC1	Missense_Mutation	SNP	ENST00000264552.9	37	CCDS33114.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.498229	0.85069	0.0	1.16E-4	ENSG00000108106	ENST00000264552	T	0.73469	-0.75	3.98	3.98	0.46160	Ubiquitin-conjugating enzyme, E2 (1);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	D	0.85062	0.5611	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.63703	0.917	D	0.87771	0.2605	10	0.87932	D	0	-29.1933	13.9369	0.64029	0.0:0.0:1.0:0.0	.	14	Q16763	UBE2S_HUMAN	C	14	ENSP00000264552:R14C	ENSP00000264552:R14C	R	-	1	0	UBE2S	60610106	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	6.459000	0.73513	2.226000	0.72624	0.455000	0.32223	CGC	.		0.602	UBE2S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453088.1	NM_014501	
UBXN7	26043	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	196089289	196089289	+	Silent	SNP	C	C	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr3:196089289C>T	ENST00000296328.4	-	9	1178	c.1104G>A	c.(1102-1104)gaG>gaA	p.E368E	UBXN7_ENST00000428095.1_Silent_p.E206E|UBXN7_ENST00000535858.1_Silent_p.E220E	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	368						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TGACTGGTGGCTCAGTCAGCG	0.488																																					p.E368E		.											.	UBXN7	71	0			c.G1104A						.						113.0	103.0	106.0					3																	196089289		1885	4115	6000	SO:0001819	synonymous_variant	26043	exon9			TGGTGGCTCAGTC	AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.1104G>A	3.37:g.196089289C>T		80.0	0.0		70.0	39.0	NM_015562	D3DXB3|Q6ZP77|Q86X20|Q8N327	Silent	SNP	ENST00000296328.4	37	CCDS43191.1																																																																																			.		0.488	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353	
UFL1	23376	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	96986605	96986605	+	Silent	SNP	C	C	T	rs199861765		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr6:96986605C>T	ENST00000369278.4	+	10	1143	c.1077C>T	c.(1075-1077)agC>agT	p.S359S		NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1	359					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										TAGTCTTTAGCGACACTGTTG	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		16043	0.001		0.0	False		,,,				2504	0.0				p.S359S		.											.	.	.	0			c.C1077T						.						82.0	77.0	79.0					6																	96986605		2203	4300	6503	SO:0001819	synonymous_variant	23376	exon10			CTTTAGCGACACT	BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.1077C>T	6.37:g.96986605C>T		136.0	0.0		81.0	17.0	NM_015323	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Silent	SNP	ENST00000369278.4	37	CCDS5034.1																																																																																			C|0.999;T|0.000		0.428	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041557.1	NM_015323	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	215932017	215932017	+	Nonsense_Mutation	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:215932017G>C	ENST00000307340.3	-	58	11695	c.11309C>G	c.(11308-11310)tCa>tGa	p.S3770*	USH2A_ENST00000366943.2_Nonsense_Mutation_p.S3770*	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3770	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCTGGTGTTGACATAGGTGT	0.333										HNSCC(13;0.011)																											p.S3770X		.											.	USH2A	115	0			c.C11309G						.						176.0	174.0	175.0					1																	215932017		2203	4300	6503	SO:0001587	stop_gained	7399	exon58			GGTGTTGACATAG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11309C>G	1.37:g.215932017G>C	ENSP00000305941:p.Ser3770*	94.0	0.0		82.0	12.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Nonsense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	52	19.742314	0.99923	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	.	.	.	5.68	-7.82	0.01205	.	1.983460	0.03128	N	0.164734	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	15.1906	0.73041	0.1031:0.4361:0.4607:0.0	.	.	.	.	X	3770	.	ENSP00000305941:S3770X	S	-	2	0	USH2A	213998640	0.000000	0.05858	0.000000	0.03702	0.286000	0.27126	-0.264000	0.08658	-1.017000	0.03367	-0.353000	0.07706	TCA	.		0.333	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216495239	216495239	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr1:216495239T>C	ENST00000307340.3	-	9	2016	c.1630A>G	c.(1630-1632)Act>Gct	p.T544A	USH2A_ENST00000366943.2_Missense_Mutation_p.T544A|USH2A_ENST00000366942.3_Missense_Mutation_p.T544A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	544	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTCCTTCAGTGAAGCTCTCC	0.413										HNSCC(13;0.011)																											p.T544A		.											.	USH2A	115	0			c.A1630G						.						153.0	141.0	145.0					1																	216495239		2203	4300	6503	SO:0001583	missense	7399	exon9			CTTCAGTGAAGCT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1630A>G	1.37:g.216495239T>C	ENSP00000305941:p.Thr544Ala	172.0	0.0		121.0	92.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	19.37	3.815269	0.70912	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.63580	-0.05;-0.05;-0.05	5.65	4.49	0.54785	EGF-like, laminin (3);	0.000000	0.43579	U	0.000554	D	0.83229	0.5209	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	D	0.86437	0.1764	10	0.87932	D	0	.	12.6812	0.56922	0.0:0.0:0.1379:0.8621	.	544;544	O75445-2;O75445	.;USH2A_HUMAN	A	544	ENSP00000305941:T544A;ENSP00000355910:T544A;ENSP00000355909:T544A	ENSP00000305941:T544A	T	-	1	0	USH2A	214561862	1.000000	0.71417	0.960000	0.40013	0.643000	0.38383	4.814000	0.62627	0.911000	0.36747	0.455000	0.32223	ACT	.		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
UTP20	27340	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	101736252	101736253	+	Frame_Shift_Ins	INS	-	-	AC			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr12:101736252_101736253insAC	ENST00000261637.4	+	33	4304_4305	c.4130_4131insAC	c.(4129-4134)gtacaafs	p.Q1378fs		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1378					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CTGGTGACAGTACAAAACTTGT	0.312																																					p.V1377fs		.											.	UTP20	155	0			c.4130_4131insAC						.																																			SO:0001589	frameshift_variant	27340	exon33			TGACAGTACAAAA	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.4131_4132dupAC	12.37:g.101736253_101736254dupAC	ENSP00000261637:p.Gln1378fs	81.0	0.0		110.0	51.0	NM_014503	Q9H3H4	Frame_Shift_Ins	INS	ENST00000261637.4	37	CCDS9081.1																																																																																			.		0.312	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
WNK2	65268	broad.mit.edu;ucsc.edu;mdanderson.org	37	9	96051838	96051838	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr9:96051838A>G	ENST00000297954.4	+	20	4913	c.4913A>G	c.(4912-4914)gAc>gGc	p.D1638G	WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000349097.3_Missense_Mutation_p.D1250G|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000427277.2_Missense_Mutation_p.D1213G|WNK2_ENST00000395477.2_Missense_Mutation_p.D1601G	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	1638					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						TGCGGGGGGGACCTGGCCCTG	0.687																																					p.D1601G		.											.	WNK2	765	0			c.A4802G						.						9.0	12.0	11.0					9																	96051838		2189	4284	6473	SO:0001583	missense	65268	exon19			GGGGGGACCTGGC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.4913A>G	9.37:g.96051838A>G	ENSP00000297954:p.Asp1638Gly	19.0	0.0		15.0	7.0	NM_006648	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.01|11.01	1.513879|1.513879	0.27123|0.27123	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277|ENST00000432730;ENST00000448251;ENST00000453718	T;T;T;T|.	0.22945|.	1.93;1.93;1.93;1.93|.	2.86|2.86	-2.06|-2.06	0.07298|0.07298	.|.	2.030890|.	0.03019|.	N|.	0.150514|.	T|T	0.13756|0.13756	0.0333|0.0333	N|N	0.08118|0.08118	0|0	0.21473|0.21473	N|N	0.999674|0.999674	B;B;B;B;B|.	0.30068|.	0.018;0.267;0.131;0.206;0.131|.	B;B;B;B;B|.	0.25291|.	0.015;0.059;0.026;0.04;0.026|.	T|T	0.24440|0.24440	-1.0160|-1.0160	10|5	0.22706|.	T|.	0.39|.	.|.	3.5399|3.5399	0.07807|0.07807	0.5318:0.0:0.1046:0.3637|0.5318:0.0:0.1046:0.3637	.|.	1601;1596;1204;1601;1638|.	Q9Y3S1-2;A6PVR3;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;.;WNK2_HUMAN|.	G|A	1638;1601;1250;1213|1597;398;124	ENSP00000297954:D1638G;ENSP00000378860:D1601G;ENSP00000297876:D1250G;ENSP00000411181:D1213G|.	ENSP00000297954:D1638G|.	D|T	+|+	2|1	0|0	WNK2|WNK2	95091659|95091659	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.726000|0.726000	0.41606|0.41606	-0.118000|-0.118000	0.10692|0.10692	-0.553000|-0.553000	0.06158|0.06158	0.459000|0.459000	0.35465|0.35465	GAC|ACC	.		0.687	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
ZNF121	7675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9677428	9677428	+	Missense_Mutation	SNP	A	A	G	rs144655023		TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:9677428A>G	ENST00000586602.1	-	6	777	c.361T>C	c.(361-363)Tgt>Cgt	p.C121R	ZNF121_ENST00000320451.6_Missense_Mutation_p.C121R			P58317	ZN121_HUMAN	zinc finger protein 121	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						GCTCTCCCACATTGCTTCTGT	0.393																																					p.C121R		.											.	ZNF121	91	0			c.T361C						.	A	ARG/CYS	0,4406		0,0,2203	107.0	86.0	93.0		361	-1.1	0.0	19	dbSNP_134	93	3,8597	3.0+/-9.4	0,3,4297	yes	missense	ZNF121	NM_001008727.2	180	0,3,6500	GG,GA,AA		0.0349,0.0,0.0231	probably-damaging	121/391	9677428	3,13003	2203	4300	6503	SO:0001583	missense	7675	exon4			TCCCACATTGCTT	M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.361T>C	19.37:g.9677428A>G	ENSP00000468643:p.Cys121Arg	148.0	0.0		162.0	93.0	NM_001008727		Missense_Mutation	SNP	ENST00000586602.1	37		.	.	.	.	.	.	.	.	.	.	A	7.908	0.735831	0.15574	0.0	3.49E-4	ENSG00000197961	ENST00000538300;ENST00000320451	T	0.29655	1.56	1.47	-1.06	0.10002	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.55816	0.1944	H	0.95004	3.61	0.41503	D	0.988298	D	0.76494	0.999	D	0.72982	0.979	T	0.53739	-0.8396	9	0.87932	D	0	.	2.4452	0.04504	0.5935:0.0:0.1704:0.2361	.	121	P58317	ZN121_HUMAN	R	121	ENSP00000326967:C121R	ENSP00000326967:C121R	C	-	1	0	ZNF121	9538428	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	1.509000	0.35780	-0.415000	0.07484	-0.604000	0.04097	TGT	A|1.000;G|0.000		0.393	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000449910.1	NM_001008727	
ZIM3	114026	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	57646911	57646911	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:57646911G>C	ENST00000269834.1	-	5	1179	c.794C>G	c.(793-795)tCc>tGc	p.S265C	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATTAATGCAGGATGATTTCCA	0.358																																					p.S265C		.											.	ZIM3	92	0			c.C794G						.						120.0	117.0	118.0					19																	57646911		2203	4300	6503	SO:0001583	missense	114026	exon5			ATGCAGGATGATT	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.794C>G	19.37:g.57646911G>C	ENSP00000269834:p.Ser265Cys	181.0	1.0		224.0	31.0	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.390922	0.25118	.	.	ENSG00000141946	ENST00000269834	T	0.16073	2.37	2.53	-1.12	0.09808	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13415	0.0325	L	0.45744	1.44	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.31194	-0.9952	9	0.49607	T	0.09	.	5.1386	0.14947	0.1453:0.3671:0.4876:0.0	.	265	Q96PE6	ZIM3_HUMAN	C	265	ENSP00000269834:S265C	ENSP00000269834:S265C	S	-	2	0	ZIM3	62338723	0.000000	0.05858	0.122000	0.21767	0.619000	0.37552	-3.324000	0.00512	0.017000	0.15025	0.313000	0.20887	TCC	.		0.358	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
ZNF578	147660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53014990	53014990	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:53014990G>T	ENST00000421239.2	+	6	1600	c.1356G>T	c.(1354-1356)gaG>gaT	p.E452D	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		ATACTGGAGAGAAATCTTACA	0.378																																					p.E452D		.											.	.	.	0			c.G1356T						.						57.0	62.0	61.0					19																	53014990		2198	4299	6497	SO:0001583	missense	147660	exon6			TGGAGAGAAATCT	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1356G>T	19.37:g.53014990G>T	ENSP00000459216:p.Glu452Asp	89.0	0.0		128.0	41.0	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	9.737	1.163935	0.21538	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	1.48	0.22813	.	.	.	.	.	T	0.32734	0.0839	M	0.64080	1.96	0.20196	N	0.999921	P	0.35272	0.493	B	0.27796	0.083	T	0.16808	-1.0390	7	.	.	.	.	5.7898	0.18353	0.1891:0.0:0.8109:0.0	.	452	G3V4F6	.	D	452	.	.	E	+	3	2	ZNF578	57706802	0.966000	0.33281	0.306000	0.25113	0.059000	0.15707	0.768000	0.26590	0.835000	0.34877	0.297000	0.19635	GAG	.		0.378	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
ZNF551	90233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58199625	58199625	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:58199625A>G	ENST00000282296.5	+	3	2167	c.1982A>G	c.(1981-1983)cAt>cGt	p.H661R	ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.H645R			Q7Z340	ZN551_HUMAN	zinc finger protein 551	661					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTCATTCGACATCGGAGAGTT	0.428																																					p.H661R		.											.	ZNF551	91	0			c.A1982G						.						87.0	85.0	86.0					19																	58199625		2203	4300	6503	SO:0001583	missense	90233	exon3			TTCGACATCGGAG	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1982A>G	19.37:g.58199625A>G	ENSP00000282296:p.His661Arg	50.0	0.0		71.0	14.0	NM_138347	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	37	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	A	15.22	2.768991	0.49680	.	.	ENSG00000204519	ENST00000356715;ENST00000282296	.	.	.	2.42	2.42	0.29668	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.77458	0.4133	M	0.94142	3.5	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65294	-0.6203	8	0.87932	D	0	.	9.4987	0.39004	1.0:0.0:0.0:0.0	.	661	Q7Z340	ZN551_HUMAN	R	661;645	.	ENSP00000282296:H645R	H	+	2	0	ZNF551	62891437	0.033000	0.19621	0.001000	0.08648	0.008000	0.06430	1.870000	0.39529	1.118000	0.41863	0.379000	0.24179	CAT	.		0.428	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
ZNF777	27153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149152627	149152627	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr7:149152627C>G	ENST00000247930.4	-	2	810	c.487G>C	c.(487-489)Gac>Cac	p.D163H		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			AAAGGGGTGTCCTTTTGGGAA	0.602																																					p.D163H		.											.	ZNF777	136	0			c.G487C						.						85.0	95.0	92.0					7																	149152627		1975	4159	6134	SO:0001583	missense	27153	exon2			GGGTGTCCTTTTG	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.487G>C	7.37:g.149152627C>G	ENSP00000247930:p.Asp163His	60.0	0.0		72.0	31.0	NM_015694	Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	37	CCDS43675.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109725	0.56398	.	.	ENSG00000196453	ENST00000247930	T	0.05717	3.4	4.27	4.27	0.50696	.	0.288428	0.24808	N	0.035429	T	0.08714	0.0216	N	0.24115	0.695	0.36565	D	0.872672	P	0.48503	0.911	P	0.51016	0.656	T	0.23368	-1.0190	10	0.59425	D	0.04	-30.4442	12.0974	0.53763	0.0:1.0:0.0:0.0	.	163	Q9ULD5-2	.	H	163	ENSP00000247930:D163H	ENSP00000247930:D163H	D	-	1	0	ZNF777	148783560	0.006000	0.16342	1.000000	0.80357	0.923000	0.55619	0.355000	0.20163	2.217000	0.71921	0.563000	0.77884	GAC	.		0.602	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
ZNF841	284371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52570784	52570784	+	Start_Codon_SNP	SNP	C	C	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:52570784C>A	ENST00000426391.2	-	5	554	c.3G>T	c.(1-3)atG>atT	p.M1I	ZNF841_ENST00000359973.2_Start_Codon_SNP_p.M1I|ZNF432_ENST00000598446.1_Intron|ZNF841_ENST00000594295.1_Missense_Mutation_p.M117I|ZNF841_ENST00000389534.4_Missense_Mutation_p.M117I			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						GTCCTTCCAACATCACTGCTT	0.358																																					p.M117I		.											.	.	.	0			c.G351T						.						129.0	99.0	108.0					19																	52570784		692	1591	2283	SO:0001582	initiator_codon_variant	284371	exon7			TTCCAACATCACT	AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.3G>T	19.37:g.52570784C>A	ENSP00000415453:p.Met1Ile	235.0	0.0		273.0	40.0	NM_001136499	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	ENST00000426391.2	37		.	.	.	.	.	.	.	.	.	.	C	8.373	0.835721	0.16820	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	T;T;T	0.08102	3.64;3.37;3.13	2.3	-0.0951	0.13642	.	.	.	.	.	T	0.03011	0.0089	.	.	.	0.80722	D	1	B;B;B	0.25169	0.119;0.018;0.01	B;B;B	0.19391	0.025;0.006;0.002	T	0.44726	-0.9309	8	0.08381	T	0.77	.	2.9041	0.05715	0.0:0.4506:0.2438:0.3056	.	117;1;1	Q6ZN19-3;Q6ZN19-2;Q6ZN19	.;.;ZN841_HUMAN	I	117;1;1	ENSP00000374185:M117I;ENSP00000415453:M1I;ENSP00000353060:M1I	ENSP00000353060:M1I	M	-	3	0	ZNF841	57262596	0.000000	0.05858	0.005000	0.12908	0.158000	0.22134	-3.406000	0.00482	-0.077000	0.12752	0.313000	0.20887	ATG	.		0.358	ZNF841-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000462435.1	XM_209155	Missense_Mutation
ZSCAN4	201516	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58187569	58187569	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I0-01A-11D-A22F-10	TCGA-FV-A3I0-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5df489bc-6178-49e4-8a42-506f70300dff	741183d6-2363-4cbf-b5f9-4548e1cab32b	g.chr19:58187569G>A	ENST00000318203.5	+	3	753	c.56G>A	c.(55-57)gGa>gAa	p.G19E		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	19					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AATAATCTTGGATCAGAAAAT	0.383																																					p.G19E		.											.	ZSCAN4	91	0			c.G56A						.						68.0	66.0	67.0					19																	58187569		2203	4300	6503	SO:0001583	missense	201516	exon3			ATCTTGGATCAGA	AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.56G>A	19.37:g.58187569G>A	ENSP00000321963:p.Gly19Glu	109.0	0.0		158.0	88.0	NM_152677	Q3MIQ2	Missense_Mutation	SNP	ENST00000318203.5	37	CCDS12958.1	.	.	.	.	.	.	.	.	.	.	G	6.895	0.534679	0.13188	.	.	ENSG00000180532	ENST00000318203	T	0.06371	3.31	4.15	-5.94	0.02247	.	1.438360	0.04789	N	0.431291	T	0.03390	0.0098	N	0.20986	0.625	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.43458	-0.9390	10	0.17832	T	0.49	0.1698	2.6352	0.04956	0.5529:0.1327:0.1803:0.1341	.	19	Q8NAM6	ZSCA4_HUMAN	E	19	ENSP00000321963:G19E	ENSP00000321963:G19E	G	+	2	0	ZSCAN4	62879381	0.000000	0.05858	0.000000	0.03702	0.406000	0.30931	0.020000	0.13466	-1.125000	0.02932	0.655000	0.94253	GGA	.		0.383	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677	
