#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADRB2	154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	148207094	148207094	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:148207094G>C	ENST00000305988.4	+	1	939	c.700G>C	c.(700-702)Gac>Cac	p.D234H		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	234					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	CCAGAAGATTGACAAATCTGA	0.547																																					p.D234H		.											.	ADRB2	523	0			c.G700C						.						107.0	101.0	103.0					5																	148207094		2203	4300	6503	SO:0001583	missense	154	exon1			AAGATTGACAAAT	AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.700G>C	5.37:g.148207094G>C	ENSP00000305372:p.Asp234His	80.0	0.0		106.0	40.0	NM_000024	B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Missense_Mutation	SNP	ENST00000305988.4	37	CCDS4292.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446533	0.63178	.	.	ENSG00000169252	ENST00000305988	T	0.36520	1.25	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.097714	0.64402	D	0.000002	T	0.52240	0.1722	L	0.39898	1.24	0.54753	D	0.999989	D	0.67145	0.996	D	0.65010	0.931	T	0.51694	-0.8673	10	0.87932	D	0	.	19.4568	0.94895	0.0:0.0:1.0:0.0	.	234	P07550	ADRB2_HUMAN	H	234	ENSP00000305372:D234H	ENSP00000305372:D234H	D	+	1	0	ADRB2	148187287	1.000000	0.71417	0.997000	0.53966	0.722000	0.41435	6.600000	0.74132	2.832000	0.97577	0.655000	0.94253	GAC	.		0.547	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252189.1	NM_000024	
AMOT	154796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	112022293	112022293	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:112022293C>G	ENST00000524145.1	-	11	3163	c.3089G>C	c.(3088-3090)aGt>aCt	p.S1030T	AMOT_ENST00000304758.1_Missense_Mutation_p.S621T|AMOT_ENST00000371959.3_Missense_Mutation_p.S1030T|MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000371962.1_Missense_Mutation_p.S798T			Q4VCS5	AMOT_HUMAN	angiomotin	1030					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.S621N(1)|p.S1030N(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						GGTAGCTGGACTTGCAGGAAC	0.527																																					p.S1030T		.											.	AMOT	131	2	Substitution - Missense(2)	skin(2)	c.G3089C						.						115.0	107.0	109.0					X																	112022293		2203	4300	6503	SO:0001583	missense	154796	exon10			GCTGGACTTGCAG	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.3089G>C	X.37:g.112022293C>G	ENSP00000429013:p.Ser1030Thr	259.0	0.0		252.0	43.0	NM_001113490	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831304	0.32329	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145	T;T;T;T	0.46063	0.88;2.28;2.54;2.28	4.28	0.247	0.15521	.	0.705051	0.13947	N	0.351777	T	0.19644	0.0472	N	0.19112	0.55	0.20196	N	0.999923	B	0.02656	0.0	B	0.04013	0.001	T	0.30937	-0.9961	10	0.02654	T	1	0.0862	6.2461	0.20818	0.0:0.3096:0.4931:0.1973	.	1030	Q4VCS5	AMOT_HUMAN	T	621;1030;798;1030	ENSP00000305557:S621T;ENSP00000361027:S1030T;ENSP00000361030:S798T;ENSP00000429013:S1030T	ENSP00000305557:S621T	S	-	2	0	AMOT	111908949	0.818000	0.29161	0.980000	0.43619	0.980000	0.70556	-0.107000	0.10873	-0.083000	0.12618	0.529000	0.55759	AGT	.		0.527	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
MARCH1	55016	ucsc.edu;mdanderson.org	37	4	165118830	165118830	+	Intron	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr4:165118830G>A	ENST00000503008.1	-	2	864				MARCH1_ENST00000508725.1_Intron|MARCH1_ENST00000514618.1_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GCCCTGTTCCGCAGCTCTGAA	0.527																																					p.R12W		.											.	ANP32C	90	0			c.C34T						.						112.0	115.0	114.0					4																	165118830		2203	4300	6503	SO:0001627	intron_variant	23520	exon1			TGTTCCGCAGCTC	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.113-86016C>T	4.37:g.165118830G>A		99.0	2.0		113.0	37.0	NM_012403	D3DP29|Q9NWR0	Missense_Mutation	SNP	ENST00000503008.1	37	CCDS54814.1																																																																																			.		0.527	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364493.2	NM_017923	
ARHGEF3	50650	broad.mit.edu;ucsc.edu	37	3	56835759	56835759	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:56835759G>C	ENST00000296315.3	-	1	236	c.68C>G	c.(67-69)cCg>cGg	p.P23R	ARHGEF3_ENST00000338458.4_Intron|ARHGEF3_ENST00000496106.1_Intron|ARHGEF3_ENST00000495373.1_Missense_Mutation_p.P23R|ARHGEF3_ENST00000498517.1_Intron	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	23					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		ACCGCTGGCCGGGGGTAGCTC	0.647																																					p.P23R		.											.	ARHGEF3	228	0			c.C68G						.						34.0	30.0	32.0					3																	56835759		2197	4283	6480	SO:0001583	missense	50650	exon1			CTGGCCGGGGGTA	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.68C>G	3.37:g.56835759G>C	ENSP00000296315:p.Pro23Arg	89.0	1.0		81.0	12.0	NM_019555	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	37	CCDS2878.1	.	.	.	.	.	.	.	.	.	.	G	9.510	1.105606	0.20632	.	.	ENSG00000163947	ENST00000296315;ENST00000495373	T;T	0.20200	2.09;2.09	4.94	3.05	0.35203	.	.	.	.	.	T	0.09423	0.0232	N	0.08118	0	0.21652	N	0.999609	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39210	-0.9625	9	0.15066	T	0.55	.	7.2292	0.26033	0.0966:0.1725:0.7309:0.0	.	23;23	C9J586;Q9NR81	.;ARHG3_HUMAN	R	23	ENSP00000296315:P23R;ENSP00000417986:P23R	ENSP00000296315:P23R	P	-	2	0	ARHGEF3	56810799	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.194000	0.51005	0.548000	0.28955	0.491000	0.48974	CCG	.		0.647	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
ARL5A	26225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152670806	152670806	+	Silent	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:152670806T>C	ENST00000295087.8	-	3	443	c.132A>G	c.(130-132)acA>acG	p.T44T	ARL5A_ENST00000428992.2_Silent_p.T7T	NM_001037174.1|NM_012097.3	NP_001032251.1|NP_036229.1	Q9Y689	ARL5A_HUMAN	ADP-ribosylation factor-like 5A	44					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			breast(1)|large_intestine(2)|liver(1)|lung(2)	6				BRCA - Breast invasive adenocarcinoma(221;0.153)		TTGTAGGAGATGTATGTACAA	0.338																																					p.T44T		.											.	ARL5A	227	0			c.A132G						.						97.0	101.0	100.0					2																	152670806		2203	4294	6497	SO:0001819	synonymous_variant	26225	exon3			AGGAGATGTATGT	AF100740	CCDS2195.1, CCDS46425.1	2q23.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000162980	ENSG00000162980		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	696	protein-coding gene	gene with protein product		608960	"""ADP-ribosylation factor-like 5"""	ARL5			Standard	NM_012097		Approved		uc002txx.1	Q9Y689	OTTHUMG00000131887	ENST00000295087.8:c.132A>G	2.37:g.152670806T>C		195.0	0.0		196.0	48.0	NM_012097	Q580I5	Silent	SNP	ENST00000295087.8	37	CCDS2195.1																																																																																			.		0.338	ARL5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254837.1		
ARR3	407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	69501565	69501565	+	Silent	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:69501565C>T	ENST00000307959.8	+	17	1167	c.1116C>T	c.(1114-1116)ggC>ggT	p.G372G	RAB41_ENST00000276066.4_5'Flank|RAB41_ENST00000374473.2_5'Flank	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	372					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						CGCGGAAAGGCGAGGAGGAGA	0.582																																					p.G372G		.											.	ARR3	156	0			c.C1116T						.						77.0	52.0	60.0					X																	69501565		2195	4292	6487	SO:0001819	synonymous_variant	407	exon17			GAAAGGCGAGGAG		CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.1116C>T	X.37:g.69501565C>T		89.0	0.0		100.0	25.0	NM_004312	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Silent	SNP	ENST00000307959.8	37	CCDS14399.1																																																																																			.		0.582	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057055.2	NM_004312	
ATP8A1	10396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	42553255	42553255	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr4:42553255A>G	ENST00000381668.5	-	18	1793	c.1562T>C	c.(1561-1563)gTt>gCt	p.V521A	ATP8A1_ENST00000264449.10_Missense_Mutation_p.V506A	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	521					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TCCAGTGAAAACAAAATTCAA	0.338																																					p.V521A		.											.	ATP8A1	92	0			c.T1562C						.						123.0	126.0	125.0					4																	42553255		2203	4300	6503	SO:0001583	missense	10396	exon18			GTGAAAACAAAAT	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1562T>C	4.37:g.42553255A>G	ENSP00000371084:p.Val521Ala	147.0	0.0		152.0	41.0	NM_006095	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.598513	0.66332	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.65732	-0.17;-0.17	5.49	5.49	0.81192	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.067148	0.64402	D	0.000014	T	0.76140	0.3946	M	0.70108	2.13	0.80722	D	1	D;P;D	0.55605	0.963;0.813;0.972	D;P;P	0.68621	0.959;0.714;0.826	T	0.73288	-0.4030	10	0.22109	T	0.4	.	15.5992	0.76611	1.0:0.0:0.0:0.0	.	506;506;521	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	A	521;506	ENSP00000371084:V521A;ENSP00000264449:V506A	ENSP00000264449:V506A	V	-	2	0	ATP8A1	42248012	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.521000	0.73778	2.080000	0.62538	0.477000	0.44152	GTT	.		0.338	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
BHLHB9	80823	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	102004068	102004068	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:102004068G>A	ENST00000372735.1	+	4	730	c.145G>A	c.(145-147)Ggg>Agg	p.G49R	BHLHB9_ENST00000448867.1_Missense_Mutation_p.G49R|BHLHB9_ENST00000361229.4_Missense_Mutation_p.G49R|BHLHB9_ENST00000457056.1_Missense_Mutation_p.G49R|BHLHB9_ENST00000447531.1_Missense_Mutation_p.G49R			Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class B, 9	49					learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neurogenesis (GO:0050769)|positive regulation of synapse assembly (GO:0051965)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						AGCCAAGACAGGGTCTAAGAC	0.502																																					p.G49R		.											.	BHLHB9	132	0			c.G145A						.						124.0	104.0	111.0					X																	102004068		2203	4300	6503	SO:0001583	missense	80823	exon2			AAGACAGGGTCTA	AB051488	CCDS14502.1	Xq23	2014-03-21			ENSG00000198908	ENSG00000198908		"""Basic helix-loop-helix proteins"", ""Armadillo repeat containing"""	29353	protein-coding gene	gene with protein product		300921				11214970, 15034937, 16221301	Standard	NM_030639		Approved	p60TRP, KIAA1701, GASP3	uc011mrv.2	Q6PI77	OTTHUMG00000022060	ENST00000372735.1:c.145G>A	X.37:g.102004068G>A	ENSP00000361820:p.Gly49Arg	368.0	0.0		376.0	108.0	NM_001142530	Q9C0G2	Missense_Mutation	SNP	ENST00000372735.1	37	CCDS14502.1	.	.	.	.	.	.	.	.	.	.	G	1.823	-0.471646	0.04445	.	.	ENSG00000198908	ENST00000457056;ENST00000361229;ENST00000447531;ENST00000448867;ENST00000372735	T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73	4.28	-3.31	0.04988	.	1.568470	0.04744	N	0.423386	T	0.06371	0.0164	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32877	-0.9890	9	.	.	.	-6.4705	1.6255	0.02722	0.428:0.2486:0.1954:0.1279	.	49	Q6PI77	BHLH9_HUMAN	R	49	ENSP00000403226:G49R;ENSP00000354675:G49R;ENSP00000405893:G49R;ENSP00000391722:G49R;ENSP00000361820:G49R	.	G	+	1	0	BHLHB9	101890724	0.012000	0.17670	0.000000	0.03702	0.145000	0.21501	0.668000	0.25127	-1.017000	0.03367	-0.494000	0.04653	GGG	.		0.502	BHLHB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057630.1	NM_030639	
BMP1	649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	22052004	22052004	+	Silent	SNP	G	G	A	rs199778498		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:22052004G>A	ENST00000306385.5	+	11	2014	c.1344G>A	c.(1342-1344)tcG>tcA	p.S448S	BMP1_ENST00000397814.3_Silent_p.S448S|BMP1_ENST00000354870.5_3'UTR|BMP1_ENST00000306349.8_Silent_p.S448S|BMP1_ENST00000397816.3_Silent_p.S448S	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	448	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		ACATTCAATCGCCCAACTACC	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18059	0.0		0.0	False		,,,				2504	0.0				p.S448S		.											.	BMP1	155	0			c.G1344A						.						123.0	112.0	116.0					8																	22052004		2203	4300	6503	SO:0001819	synonymous_variant	649	exon11			TCAATCGCCCAAC		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.1344G>A	8.37:g.22052004G>A		131.0	0.0		120.0	51.0	NM_001199	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Silent	SNP	ENST00000306385.5	37	CCDS6026.1																																																																																			G|0.999;A|0.000		0.582	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214995.2	NM_006132	
BRIX1	55299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	34925045	34925045	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:34925045T>G	ENST00000336767.5	+	9	1120	c.757T>G	c.(757-759)Tta>Gta	p.L253V	BRIX1_ENST00000506023.1_3'UTR	NM_018321.3	NP_060791.3	Q8TDN6	BRX1_HUMAN	BRX1, biogenesis of ribosomes, homolog (S. cerevisiae)	253					ribosome biogenesis (GO:0042254)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|large_intestine(2)|lung(1)	4						AGGACCAACTTTATATGAAAA	0.383																																					p.L253V		.											.	BRIX1	90	0			c.T757G						.						63.0	62.0	62.0					5																	34925045		2203	4300	6503	SO:0001583	missense	55299	exon9			CCAACTTTATATG		CCDS34143.1	5p13.2	2009-09-25	2009-09-25	2009-09-25	ENSG00000113460	ENSG00000113460			24170	protein-coding gene	gene with protein product			"""brix domain containing 2"""	BXDC2		12477932	Standard	NM_018321		Approved	BRIX, FLJ11100	uc003jja.3	Q8TDN6	OTTHUMG00000162021	ENST00000336767.5:c.757T>G	5.37:g.34925045T>G	ENSP00000338862:p.Leu253Val	24.0	0.0		33.0	7.0	NM_018321	A8K0P5|Q3ZTT4|Q8N453|Q96DH1	Missense_Mutation	SNP	ENST00000336767.5	37	CCDS34143.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.995448	0.74703	.	.	ENSG00000113460	ENST00000336767	T	0.57107	0.42	5.82	3.47	0.39725	.	0.000000	0.85682	D	0.000000	T	0.61211	0.2329	L	0.56396	1.775	0.50813	D	0.999896	D	0.65815	0.995	P	0.61722	0.893	T	0.60031	-0.7342	10	0.46703	T	0.11	-10.5824	8.4913	0.33102	0.0:0.2767:0.0:0.7233	.	253	Q8TDN6	BRX1_HUMAN	V	253	ENSP00000338862:L253V	ENSP00000338862:L253V	L	+	1	2	BRIX1	34960802	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.744000	0.47450	1.035000	0.39972	0.533000	0.62120	TTA	.		0.383	BRIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366826.2	NM_018321	
TBC1D32	221322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	121625734	121625734	+	Silent	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:121625734A>G	ENST00000398212.2	-	7	856	c.807T>C	c.(805-807)aaT>aaC	p.N269N	TBC1D32_ENST00000275159.6_Silent_p.N269N	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	269					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TAGGAATATGATTTTCCCTAG	0.284																																					p.N269N		.											.	C6orf170	92	0			c.T807C						.						62.0	60.0	61.0					6																	121625734		1812	4067	5879	SO:0001819	synonymous_variant	221322	exon7			AATATGATTTTCC	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.807T>C	6.37:g.121625734A>G		76.0	0.0		60.0	10.0	NM_152730	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	37	CCDS43501.1																																																																																			.		0.284	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
CACNG2	10369	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	36960731	36960731	+	Silent	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr22:36960731G>A	ENST00000300105.6	-	4	1620	c.639C>T	c.(637-639)cgC>cgT	p.R213R	RP5-1119A7.17_ENST00000562756.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	213					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.R213R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						AGTCCGTGGCGCGGGCCGTGG	0.677																																					p.R213R		.											.	CACNG2	90	1	Substitution - coding silent(1)	large_intestine(1)	c.C639T						.						78.0	93.0	88.0					22																	36960731		2203	4298	6501	SO:0001819	synonymous_variant	10369	exon4			CGTGGCGCGGGCC	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.639C>T	22.37:g.36960731G>A		20.0	0.0		22.0	10.0	NM_006078	Q2M1M1|Q5TGT3|Q9UGZ7	Silent	SNP	ENST00000300105.6	37	CCDS13931.1																																																																																			.		0.677	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
CAPZB	832	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	19746233	19746233	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr1:19746233C>G	ENST00000375142.1	-	2	61	c.15G>C	c.(13-15)caG>caC	p.Q5H	CAPZB_ENST00000375144.1_5'UTR|CAPZB_ENST00000433834.1_Missense_Mutation_p.Q34H|CAPZB_ENST00000401084.2_Missense_Mutation_p.Q5H|CAPZB_ENST00000264202.6_Missense_Mutation_p.Q5H|CAPZB_ENST00000482808.1_5'UTR|CAPZB_ENST00000264203.3_Missense_Mutation_p.Q31H	NM_001206540.1	NP_001193469.1	P47756	CAPZB_HUMAN	capping protein (actin filament) muscle Z-line, beta	5					actin cytoskeleton organization (GO:0030036)|barbed-end actin filament capping (GO:0051016)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|muscle fiber development (GO:0048747)|negative regulation of microtubule polymerization (GO:0031115)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)|regulation of protein kinase C signaling (GO:0090036)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|membrane (GO:0016020)|WASH complex (GO:0071203)|Z disc (GO:0030018)	actin binding (GO:0003779)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		CACAGTCCAGCTGCTGATCAC	0.493																																					p.Q5H		.											.	CAPZB	90	0			c.G15C						.						62.0	62.0	62.0					1																	19746233		2044	4211	6255	SO:0001583	missense	832	exon2			GTCCAGCTGCTGA	U03271	CCDS41277.1, CCDS55579.1, CCDS72717.1, CCDS72718.1	1p36.1	2014-05-09			ENSG00000077549	ENSG00000077549			1491	protein-coding gene	gene with protein product		601572					Standard	NM_004930		Approved		uc021ohr.1	P47756	OTTHUMG00000002556	ENST00000375142.1:c.15G>C	1.37:g.19746233C>G	ENSP00000364284:p.Gln5His	90.0	0.0		95.0	5.0	NM_004930	Q32Q68|Q5U0L4|Q8TB49|Q9NUC4	Missense_Mutation	SNP	ENST00000375142.1	37	CCDS55579.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.318273	0.81469	.	.	ENSG00000077549	ENST00000401084;ENST00000264203;ENST00000375142;ENST00000433834;ENST00000375145;ENST00000264202	.	.	.	5.96	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.84474	0.5480	M	0.91872	3.25	0.80722	D	1	D;D;D	0.89917	1.0;0.989;1.0	D;D;D	0.97110	1.0;0.992;0.979	D	0.87323	0.2319	9	0.62326	D	0.03	-11.5398	12.8466	0.57833	0.0:0.9215:0.0:0.0785	.	34;31;5	B1AK88;B1AK85;P47756-2	.;.;.	H	5;31;5;34;67;5	.	ENSP00000264202:Q5H	Q	-	3	2	CAPZB	19618820	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.306000	0.59117	1.522000	0.49001	0.655000	0.94253	CAG	.		0.493	CAPZB-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007260.1		
DRC1	92749	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	26676331	26676331	+	Silent	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:26676331G>A	ENST00000288710.2	+	14	1907	c.1833G>A	c.(1831-1833)gaG>gaA	p.E611E		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	611	Glu-rich.				axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											aagaagaggaggagACCCCAC	0.582																																					p.E611E		.											.	CCDC164	92	0			c.G1833A						.						95.0	83.0	87.0					2																	26676331		2203	4300	6503	SO:0001819	synonymous_variant	92749	exon14			AGAGGAGGAGACC	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.1833G>A	2.37:g.26676331G>A		100.0	2.0		109.0	25.0	NM_145038	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Silent	SNP	ENST00000288710.2	37	CCDS1723.1																																																																																			.		0.582	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038	
CDK5RAP2	55755	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	123298712	123298712	+	Silent	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr9:123298712T>C	ENST00000349780.4	-	7	779	c.600A>G	c.(598-600)tcA>tcG	p.S200S	CDK5RAP2_ENST00000359309.3_Silent_p.S200S|CDK5RAP2_ENST00000360190.4_Silent_p.S200S|CDK5RAP2_ENST00000360822.3_Silent_p.S200S	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	200					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TCTTCATCTCTGAAAGCTTGC	0.537																																					p.S200S		.											.	CDK5RAP2	229	0			c.A600G						.						140.0	119.0	126.0					9																	123298712		2203	4300	6503	SO:0001819	synonymous_variant	55755	exon7			CATCTCTGAAAGC	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.600A>G	9.37:g.123298712T>C		72.0	0.0		82.0	29.0	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	37	CCDS6823.1																																																																																			.		0.537	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
CEP85L	387119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	118832526	118832526	+	Missense_Mutation	SNP	G	G	A	rs138089888		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:118832526G>A	ENST00000368491.3	-	5	1813	c.1192C>T	c.(1192-1194)Cgg>Tgg	p.R398W	CEP85L_ENST00000360290.3_Missense_Mutation_p.R296W|CEP85L_ENST00000419517.2_Missense_Mutation_p.R398W|CEP85L_ENST00000392500.3_Missense_Mutation_p.R401W|CEP85L_ENST00000368488.5_Missense_Mutation_p.R401W	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	398						centrosome (GO:0005813)|cytoplasm (GO:0005737)											TGTTGAGCCCGTAATTCATTA	0.353													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18575	0.0		0.0	False		,,,				2504	0.0				p.R401W		.											.	.	.	0			c.C1201T						.	G	TRP/ARG,TRP/ARG,TRP/ARG	4,4402	8.1+/-20.4	0,4,2199	148.0	136.0	140.0		1192,1201,1192	4.8	1.0	6	dbSNP_134	140	0,8600		0,0,4300	yes	missense,missense,missense	C6orf204	NM_001042475.2,NM_001178035.1,NM_206921.2	101,101,101	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	probably-damaging,probably-damaging,probably-damaging	398/806,401/809,398/497	118832526	4,13002	2203	4300	6503	SO:0001583	missense	387119	exon6			GAGCCCGTAATTC	AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.1192C>T	6.37:g.118832526G>A	ENSP00000357477:p.Arg398Trp	93.0	0.0		115.0	30.0	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.19	2.759901	0.49468	9.08E-4	0.0	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604;ENST00000392500;ENST00000360290;ENST00000419517	T;T;T;T;T;T	0.30981	2.64;2.64;2.64;1.84;1.51;1.85	5.62	4.76	0.60689	.	0.060307	0.64402	D	0.000005	T	0.13670	0.0331	L	0.51422	1.61	0.42964	D	0.994414	B;B;P;P	0.38110	0.257;0.12;0.618;0.618	B;B;B;B	0.29440	0.067;0.042;0.102;0.102	T	0.04090	-1.0978	10	0.62326	D	0.03	-18.7243	11.9804	0.53117	0.0818:0.0:0.9182:0.0	.	401;398;401;398	Q5SZL2-2;G3V0H3;F8W6J2;Q5SZL2	.;.;.;CF204_HUMAN	W	398;401;401;401;296;398	ENSP00000357477:R398W;ENSP00000357474:R401W;ENSP00000392131:R401W;ENSP00000376288:R401W;ENSP00000353434:R296W;ENSP00000393317:R398W	ENSP00000353434:R296W	R	-	1	2	C6orf204	118939219	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.667000	0.46808	1.374000	0.46228	-0.143000	0.13931	CGG	G|1.000;A|0.000		0.353	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
CHD2	1106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	93499777	93499777	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr15:93499777T>C	ENST00000394196.4	+	16	2966	c.1898T>C	c.(1897-1899)cTg>cCg	p.L633P	CHD2_ENST00000557381.1_Missense_Mutation_p.L633P	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	633	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TATAAAACTCTGATTGATTTC	0.448																																					p.L633P		.											.	CHD2	229	0			c.T1898C						.						113.0	113.0	113.0					15																	93499777		2197	4297	6494	SO:0001583	missense	1106	exon16			AAACTCTGATTGA	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1898T>C	15.37:g.93499777T>C	ENSP00000377747:p.Leu633Pro	51.0	0.0		46.0	12.0	NM_001271	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	T	26.5	4.747868	0.89663	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.94650	-3.48;-3.48	5.51	5.51	0.81932	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.27710	U	0.018167	D	0.98507	0.9502	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.81914	0.995;0.995	D	0.99802	1.1036	10	0.87932	D	0	-10.3973	15.6322	0.76920	0.0:0.0:0.0:1.0	.	633;633	O14647;O14647-2	CHD2_HUMAN;.	P	633	ENSP00000377747:L633P;ENSP00000451366:L633P	ENSP00000377747:L633P	L	+	2	0	CHD2	91300781	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.097000	0.63578	0.455000	0.32223	CTG	.		0.448	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
CHIC1	53344	hgsc.bcm.edu;broad.mit.edu	37	X	72783227	72783227	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:72783227C>A	ENST00000373502.5	+	1	184	c.107C>A	c.(106-108)tCg>tAg	p.S36*	MAP2K4P1_ENST00000602584.1_RNA|CHIC1_ENST00000373504.6_Nonsense_Mutation_p.S36*	NM_001039840.2	NP_001034929.2	Q5VXU3	CHIC1_HUMAN	cysteine-rich hydrophobic domain 1	36	Ser-rich.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(2)	4	Renal(35;0.156)					tcgtcgtcgtcgtcgGTATCT	0.607																																					p.S36X		.											.	CHIC1	130	0			c.C107A						.						21.0	12.0	15.0					X																	72783227		2115	4120	6235	SO:0001587	stop_gained	53344	exon1			CGTCGTCGTCGGT	Y11897	CCDS35335.2, CCDS75993.1	Xq13.2	2008-05-14			ENSG00000204116	ENSG00000204116			1934	protein-coding gene	gene with protein product		300922				9321471, 11257495	Standard	NM_001039840		Approved	BRX	uc004ebk.4	Q5VXU3	OTTHUMG00000021835	ENST00000373502.5:c.107C>A	X.37:g.72783227C>A	ENSP00000362601:p.Ser36*	107.0	0.0		136.0	9.0	NM_001039840	A0PJZ2|B0QZ87|B9EGS5|Q5CZ84	Nonsense_Mutation	SNP	ENST00000373502.5	37	CCDS35335.2	.	.	.	.	.	.	.	.	.	.	C	37	6.154708	0.97329	.	.	ENSG00000204116	ENST00000373502;ENST00000373504	.	.	.	3.76	3.76	0.43208	.	0.000000	0.33980	N	0.004379	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.6976	10.2822	0.43545	0.0:1.0:0.0:0.0	.	.	.	.	X	36	.	ENSP00000362601:S36X	S	+	2	0	CHIC1	72699952	1.000000	0.71417	0.978000	0.43139	0.845000	0.48019	3.058000	0.49939	1.886000	0.54624	0.422000	0.28245	TCG	.		0.607	CHIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057233.3		
CLASP1	23332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	122216520	122216520	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:122216520C>T	ENST00000263710.4	-	13	1599	c.1210G>A	c.(1210-1212)Gac>Aac	p.D404N	CLASP1_ENST00000541859.1_Missense_Mutation_p.D173N|CLASP1_ENST00000409078.3_Missense_Mutation_p.D404N|CLASP1_ENST00000430234.1_5'UTR|CLASP1_ENST00000455322.2_Missense_Mutation_p.D404N|CLASP1_ENST00000545861.1_Missense_Mutation_p.D172N|CLASP1_ENST00000397587.3_Missense_Mutation_p.D404N|CLASP1_ENST00000541377.1_Missense_Mutation_p.D404N	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	404					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					GCTCCATGGTCAAACTTATTC	0.358																																					p.D404N		.											.	CLASP1	91	0			c.G1210A						.						145.0	140.0	141.0					2																	122216520		1846	4096	5942	SO:0001583	missense	23332	exon13			CATGGTCAAACTT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.1210G>A	2.37:g.122216520C>T	ENSP00000263710:p.Asp404Asn	61.0	0.0		103.0	22.0	NM_001207051	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	C	35	5.554197	0.96501	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.45	5.45	0.79879	Armadillo-type fold (1);CLASP N-terminal domain (1);	0.086182	0.85682	D	0.000000	T	0.59500	0.2198	L	0.46670	1.46	0.80722	D	1	D;D;D;B	0.57571	0.975;0.969;0.98;0.306	P;P;P;P	0.57244	0.762;0.649;0.816;0.521	T	0.56214	-0.8016	10	0.44086	T	0.13	.	19.6233	0.95669	0.0:1.0:0.0:0.0	.	404;404;404;404	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	N	404;404;404;404;173;404;172	ENSP00000263710:D404N;ENSP00000389372:D404N;ENSP00000380717:D404N;ENSP00000441625:D404N;ENSP00000441770:D173N;ENSP00000386442:D404N;ENSP00000438620:D172N	ENSP00000263710:D404N	D	-	1	0	CLASP1	121932990	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.782000	0.85680	2.714000	0.92807	0.655000	0.94253	GAC	.		0.358	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
COL6A3	1293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238245049	238245049	+	Silent	SNP	A	A	G	rs537384335		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:238245049A>G	ENST00000295550.4	-	40	9146	c.8694T>C	c.(8692-8694)acT>acC	p.T2898T	COL6A3_ENST00000347401.3_Silent_p.T2697T|COL6A3_ENST00000353578.4_Silent_p.T2692T|COL6A3_ENST00000346358.4_Silent_p.T2698T|COL6A3_ENST00000409809.1_Silent_p.T2692T|COL6A3_ENST00000472056.1_Silent_p.T2291T	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2898	Nonhelical region.|Thr-rich.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GATTTATAATAGTCACAGGCT	0.552													A|||	1	0.000199681	0.0	0.0	5008	,	,		16037	0.001		0.0	False		,,,				2504	0.0				p.T2898T		.											.	COL6A3	526	0			c.T8694C						.						146.0	150.0	149.0					2																	238245049		2203	4300	6503	SO:0001819	synonymous_variant	1293	exon40			TATAATAGTCACA	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8694T>C	2.37:g.238245049A>G		86.0	0.0		123.0	23.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																			.		0.552	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CTCFL	140690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	56073609	56073609	+	Silent	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr20:56073609C>T	ENST00000608263.1	-	10	2650	c.1989G>A	c.(1987-1989)aaG>aaA	p.K663K	CTCFL_ENST00000423479.3_Splice_Site|CTCFL_ENST00000609232.1_Silent_p.K663K|CTCFL_ENST00000371196.2_Silent_p.K663K|CTCFL_ENST00000429804.3_Silent_p.K613K|CTCFL_ENST00000243914.3_Silent_p.K663K	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	663					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			ATCCCTCTCACTTATCCATCG	0.473																																					p.K663K		.											.	CTCFL	292	0			c.G1989A						.						178.0	148.0	158.0					20																	56073609		2203	4300	6503	SO:0001819	synonymous_variant	140690	exon10			CTCTCACTTATCC		CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1989G>A	20.37:g.56073609C>T		111.0	0.0		158.0	40.0	NM_001269041	A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Silent	SNP	ENST00000608263.1	37	CCDS13459.1	.	.	.	.	.	.	.	.	.	.	C	7.543	0.661041	0.14645	.	.	ENSG00000124092	ENST00000423479	.	.	.	3.85	2.9	0.33743	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3667	0.38228	0.0:0.7825:0.2175:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CTCFL	55507015	0.141000	0.22595	0.097000	0.21041	0.181000	0.23173	0.604000	0.24164	0.822000	0.34565	0.491000	0.48974	.	.		0.473	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472040.1	NM_080618	
CUX1	1523	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	101877505	101877505	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr7:101877505C>T	ENST00000292535.7	+	22	3645	c.3607C>T	c.(3607-3609)Cgg>Tgg	p.R1203W	CUX1_ENST00000556210.1_Missense_Mutation_p.R1045W|CUX1_ENST00000546411.2_Missense_Mutation_p.R1101W|CUX1_ENST00000550008.2_Missense_Mutation_p.R1147W|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.R1214W|CUX1_ENST00000549414.2_Missense_Mutation_p.R1181W|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000560541.1_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1203					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GGACATGAAACGGATGGAGAA	0.547																																					p.R1214W		.											.	CUX1	160	0			c.C3640T						.						64.0	57.0	59.0					7																	101877505		2203	4300	6503	SO:0001583	missense	1523	exon22			ATGAAACGGATGG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.3607C>T	7.37:g.101877505C>T	ENSP00000292535:p.Arg1203Trp	41.0	0.0		35.0	8.0	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339571	0.81911	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.61158	0.15;0.14;0.14;0.13;0.14;0.13	5.32	3.42	0.39159	Homeodomain protein CUT (1);Lambda repressor-like, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.57198	0.2037	N	0.08118	0	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.64820	-0.6317	10	0.87932	D	0	-25.5597	14.0221	0.64563	0.2755:0.7245:0.0:0.0	.	1203;1214	P39880;P39880-3	CUX1_HUMAN;.	W	1214;1203;1181;1147;1101;1045	ENSP00000353401:R1214W;ENSP00000292535:R1203W;ENSP00000446630:R1181W;ENSP00000447373:R1147W;ENSP00000450125:R1101W;ENSP00000451558:R1045W	ENSP00000292535:R1203W	R	+	1	2	CUX1	101664225	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	3.966000	0.56795	0.542000	0.28846	0.655000	0.94253	CGG	.		0.547	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
CXorf58	254158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	23953337	23953337	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:23953337C>A	ENST00000379211.3	+	7	1129	c.580C>A	c.(580-582)Cct>Act	p.P194T		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	194										breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						CGATGAGGCCCCTGCATTTTC	0.428																																					p.P194T		.											.	CXorf58	130	0			c.C580A						.						106.0	111.0	109.0					X																	23953337		2203	4300	6503	SO:0001583	missense	254158	exon7			GAGGCCCCTGCAT	AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.580C>A	X.37:g.23953337C>A	ENSP00000368511:p.Pro194Thr	37.0	0.0		26.0	8.0	NM_152761		Missense_Mutation	SNP	ENST00000379211.3	37	CCDS14209.1	.	.	.	.	.	.	.	.	.	.	c	14.66	2.603234	0.46423	.	.	ENSG00000165182	ENST00000379211	T	0.28255	1.62	5.91	5.05	0.67936	.	0.083612	0.50627	D	0.000117	T	0.53786	0.1818	M	0.72894	2.215	0.40526	D	0.980881	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.58651	-0.7599	10	0.66056	D	0.02	-19.7543	13.0656	0.59032	0.0:0.9199:0.0:0.0801	.	194;194	B7ZLS7;Q96LI9	.;CX058_HUMAN	T	194	ENSP00000368511:P194T	ENSP00000368511:P194T	P	+	1	0	CXorf58	23863258	0.996000	0.38824	0.835000	0.33067	0.025000	0.11179	4.603000	0.61105	1.254000	0.44035	0.417000	0.27973	CCT	.		0.428	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	
CXorf30	645090	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	36319234	36319234	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:36319234A>T	ENST00000378657.4	+	7	896	c.248A>T	c.(247-249)aAg>aTg	p.K83M		NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	83										breast(1)|lung(2)|stomach(1)	4						TATTTACTGAAGTTAACTATT	0.343																																					p.K83M		.											.	CXorf30	62	0			c.A248T						.						149.0	120.0	129.0					X																	36319234		692	1591	2283	SO:0001583	missense	645090	exon8			TACTGAAGTTAAC		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.248A>T	X.37:g.36319234A>T	ENSP00000367926:p.Lys83Met	251.0	0.0		284.0	16.0	NM_001098843		Missense_Mutation	SNP	ENST00000378657.4	37	CCDS55396.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.666096	0.47677	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.25579	1.79;1.8	5.83	-2.74	0.05932	.	.	.	.	.	T	0.14141	0.0342	N	0.14661	0.345	0.09310	N	1	P	0.51537	0.946	P	0.44561	0.453	T	0.14952	-1.0454	9	0.56958	D	0.05	.	5.8305	0.18579	0.4671:0.0:0.4016:0.1313	.	83	A6PW82	CX030_HUMAN	M	368;83	ENSP00000367922:K368M;ENSP00000367926:K83M	ENSP00000367922:K368M	K	+	2	0	CXorf30	36229155	0.426000	0.25506	0.000000	0.03702	0.003000	0.03518	0.221000	0.17680	-0.993000	0.03467	-1.033000	0.02402	AAG	.		0.343	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NP_001092313	
DCHS1	8642	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6655134	6655134	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr11:6655134T>C	ENST00000299441.3	-	4	2515	c.2104A>G	c.(2104-2106)Aca>Gca	p.T702A	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	702	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCACAGCTGTGCCTGGTGGA	0.542																																					p.T702A		.											.	DCHS1	73	0			c.A2104G						.						77.0	79.0	79.0					11																	6655134		2201	4296	6497	SO:0001583	missense	8642	exon4			CAGCTGTGCCTGG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.2104A>G	11.37:g.6655134T>C	ENSP00000299441:p.Thr702Ala	107.0	1.0		125.0	36.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.050244	0.75846	.	.	ENSG00000166341	ENST00000299441	T	0.57107	0.42	4.38	4.38	0.52667	Cadherin (3);Cadherin-like (1);	0.000000	0.43416	D	0.000570	T	0.67335	0.2882	M	0.73372	2.23	0.49389	D	0.999788	D	0.63046	0.992	D	0.76071	0.987	T	0.65063	-0.6259	10	0.25106	T	0.35	.	11.458	0.50193	0.0:0.0:0.0:1.0	.	702	Q96JQ0	PCD16_HUMAN	A	702	ENSP00000299441:T702A	ENSP00000299441:T702A	T	-	1	0	DCHS1	6611710	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.265000	0.65519	1.839000	0.53478	0.459000	0.35465	ACA	.		0.542	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DECR1	1666	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	91031397	91031397	+	Silent	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:91031397T>C	ENST00000220764.2	+	4	502	c.414T>C	c.(412-414)ccT>ccC	p.P138P	DECR1_ENST00000519007.1_3'UTR|DECR1_ENST00000522161.1_Silent_p.P129P	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	138					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			CAGGACATCCTAATGTAAGTG	0.373																																					p.P138P		.											.	DECR1	90	0			c.T414C						.						126.0	106.0	113.0					8																	91031397		2203	4300	6503	SO:0001819	synonymous_variant	1666	exon4			ACATCCTAATGTA	L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.414T>C	8.37:g.91031397T>C		78.0	0.0		106.0	37.0	NM_001359	B7Z6B8|Q2M304|Q93085	Silent	SNP	ENST00000220764.2	37	CCDS6250.1																																																																																			.		0.373	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375822.1		
DMD	1756	hgsc.bcm.edu;broad.mit.edu	37	X	31165436	31165436	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:31165436G>A	ENST00000357033.4	-	75	10959	c.10753C>T	c.(10753-10755)Cag>Tag	p.Q3585*	DMD_ENST00000343523.2_Nonsense_Mutation_p.Q1015*|DMD_ENST00000474231.1_Nonsense_Mutation_p.Q1125*|DMD_ENST00000378707.3_Nonsense_Mutation_p.Q1125*|DMD_ENST00000359836.1_Nonsense_Mutation_p.Q1112*|DMD_ENST00000378702.4_Nonsense_Mutation_p.Q517*|DMD_ENST00000378723.3_Nonsense_Mutation_p.Q517*|DMD_ENST00000378677.2_Nonsense_Mutation_p.Q3581*|DMD_ENST00000361471.4_Nonsense_Mutation_p.Q504*|DMD_ENST00000541735.1_Nonsense_Mutation_p.Q1015*|DMD_ENST00000378680.2_Nonsense_Mutation_p.Q407*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3585					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GACTCCAGCTGTTTATTGTGG	0.493																																					p.Q3585X		.											.	DMD	265	0			c.C10753T						.						90.0	81.0	84.0					X																	31165436		2202	4300	6502	SO:0001587	stop_gained	1756	exon75			CCAGCTGTTTATT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10753C>T	X.37:g.31165436G>A	ENSP00000354923:p.Gln3585*	154.0	0.0		165.0	10.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	53|53	21.192109|21.192109	0.99938|0.99938	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680|ENST00000465285	.|.	.|.	.|.	4.62|4.62	4.62|4.62	0.57501|0.57501	.|.	0.000000|.	0.33515|.	U|.	0.004830|.	.|T	.|0.71668	.|0.3367	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74856	.|-0.3522	.|3	0.22706|.	T|.	0.39|.	.|.	16.7086|16.7086	0.85379|0.85379	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	3577;2244;2241;517;1268;3581;3585;1112;1015;3585;3462;1125;1015;517;1125;504;407|1313	.|.	ENSP00000340057:Q1015X|.	Q|T	-|-	1|2	0|0	DMD|DMD	31075357|31075357	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.657000|9.657000	0.98554|0.98554	2.118000|2.118000	0.64928|0.64928	0.513000|0.513000	0.50165|0.50165	CAG|ACA	.		0.493	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	13820597	13820597	+	Silent	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:13820597A>G	ENST00000265104.4	-	41	6803	c.6699T>C	c.(6697-6699)gcT>gcC	p.A2233A		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2233	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGATTAAACCAGCTTCTTCAA	0.502									Kartagener syndrome																												p.A2233A		.											.	DNAH5	182	0			c.T6699C						.						86.0	80.0	82.0					5																	13820597		2203	4300	6503	SO:0001819	synonymous_variant	1767	exon41	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TAAACCAGCTTCT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6699T>C	5.37:g.13820597A>G		76.0	0.0		116.0	26.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	37	CCDS3882.1																																																																																			.		0.502	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DOK3	79930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176931755	176931755	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:176931755C>T	ENST00000357198.4	-	5	806	c.802G>A	c.(802-804)Ggc>Agc	p.G268S	RP11-1334A24.6_ENST00000506025.1_RNA|DOK3_ENST00000377112.4_Missense_Mutation_p.G110S|DOK3_ENST00000501403.2_Missense_Mutation_p.G212S|DOK3_ENST00000312943.6_Missense_Mutation_p.G212S	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	268	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TTGTCGGAGCCGAACTTGCGC	0.682																																					p.G268S		.											.	DOK3	226	0			c.G802A						.						50.0	56.0	54.0					5																	176931755		2202	4299	6501	SO:0001583	missense	79930	exon5			CGGAGCCGAACTT	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.802G>A	5.37:g.176931755C>T	ENSP00000349727:p.Gly268Ser	101.0	0.0		135.0	28.0	NM_024872	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	ENST00000357198.4	37	CCDS4426.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644690	0.87859	.	.	ENSG00000146094	ENST00000312943;ENST00000377112;ENST00000357198;ENST00000501403;ENST00000510380	D;D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28;-3.28	4.83	4.83	0.62350	Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (3);	0.000000	0.64402	D	0.000014	D	0.97170	0.9075	M	0.90542	3.125	0.52099	D	0.999947	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.98104	1.0416	10	0.87932	D	0	-8.5005	15.681	0.77367	0.0:1.0:0.0:0.0	.	268;110;212;98	Q7L591;E9PAT0;Q7L591-3;Q7L591-2	DOK3_HUMAN;.;.;.	S	212;110;268;212;212	ENSP00000325174:G212S;ENSP00000366316:G110S;ENSP00000349727:G268S;ENSP00000421688:G212S;ENSP00000422395:G212S	ENSP00000325174:G212S	G	-	1	0	DOK3	176864361	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	6.198000	0.72106	2.216000	0.71823	0.491000	0.48974	GGC	.		0.682	DOK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253420.4	NM_024872	
EVC2	132884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	5633629	5633629	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr4:5633629C>T	ENST00000344408.5	-	11	1654	c.1601G>A	c.(1600-1602)aGa>aAa	p.R534K	EVC2_ENST00000344938.1_Missense_Mutation_p.R534K|EVC2_ENST00000310917.2_Missense_Mutation_p.R454K	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	534					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CAGTTCATTTCTCTGGAAAAC	0.433																																					p.R534K		.											.	EVC2	155	0			c.G1601A						.						107.0	110.0	109.0					4																	5633629		2203	4300	6503	SO:0001583	missense	132884	exon11			TCATTTCTCTGGA	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1601G>A	4.37:g.5633629C>T	ENSP00000342144:p.Arg534Lys	71.0	0.0		73.0	12.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028483	0.54790	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	D;D;D	0.86865	-2.18;-2.18;-2.18	4.79	4.79	0.61399	.	0.125045	0.52532	D	0.000064	D	0.92704	0.7681	M	0.70275	2.135	0.37810	D	0.928021	D	0.89917	1.0	D	0.87578	0.998	D	0.93501	0.6844	10	0.44086	T	0.13	-20.5355	17.2176	0.86948	0.0:1.0:0.0:0.0	.	534	Q86UK5	LBN_HUMAN	K	534;454;534	ENSP00000339954:R534K;ENSP00000311683:R454K;ENSP00000342144:R534K	ENSP00000311683:R454K	R	-	2	0	EVC2	5684530	0.996000	0.38824	0.847000	0.33407	0.040000	0.13550	4.481000	0.60250	2.353000	0.79882	0.505000	0.49811	AGA	.		0.433	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
FADD	8772	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	70049591	70049591	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr11:70049591A>G	ENST00000301838.4	+	1	323	c.26A>G	c.(25-27)cAc>cGc	p.H9R	RP11-805J14.5_ENST00000526174.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	9	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)			endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GTGCTGCTGCACTCGGTGTCG	0.721																																					p.H9R		.											.	FADD	660	0			c.A26G						.						10.0	8.0	9.0					11																	70049591		2162	4215	6377	SO:0001583	missense	8772	exon1			TGCTGCACTCGGT	U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.26A>G	11.37:g.70049591A>G	ENSP00000301838:p.His9Arg	53.0	0.0		56.0	10.0	NM_003824	Q14866|Q6IBR4	Missense_Mutation	SNP	ENST00000301838.4	37	CCDS8196.1	.	.	.	.	.	.	.	.	.	.	A	9.187	1.025171	0.19433	.	.	ENSG00000168040	ENST00000301838	D	0.82255	-1.59	4.39	4.39	0.52855	DEATH-like (2);Death effector (3);	0.135643	0.49305	D	0.000156	D	0.85318	0.5669	M	0.68317	2.08	0.34444	D	0.699976	D	0.76494	0.999	D	0.63488	0.915	D	0.84295	0.0502	10	0.09590	T	0.72	-39.3521	7.5388	0.27727	0.8087:0.0:0.0:0.1913	.	9	Q13158	FADD_HUMAN	R	9	ENSP00000301838:H9R	ENSP00000301838:H9R	H	+	2	0	FADD	69727239	0.836000	0.29430	0.996000	0.52242	0.931000	0.56810	1.406000	0.34646	1.752000	0.51891	0.402000	0.26972	CAC	.		0.721	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393902.1	NM_003824	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	127686699	127686699	+	Splice_Site	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:127686699T>C	ENST00000508053.1	-	27	3649		c.e27-2		FBN2_ENST00000262464.4_Splice_Site|FBN2_ENST00000508989.1_Splice_Site			P35556	FBN2_HUMAN	fibrillin 2						anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCAGGCTGTCTGAAAAGGAAC	0.453																																					.		.											.	FBN2	146	0			c.2675-2A>G						.						62.0	65.0	64.0					5																	127686699		2203	4300	6503	SO:0001630	splice_region_variant	2201	exon22			GCTGTCTGAAAAG	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2675-2A>G	5.37:g.127686699T>C		51.0	0.0		94.0	6.0	NM_001999	B4DU01|Q59ES6	Splice_Site	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002478	0.74932	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8805	0.63680	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FBN2	127714598	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.779000	0.85648	2.014000	0.59158	0.460000	0.39030	.	.		0.453	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	Intron
FAT2	2196	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150948274	150948274	+	Silent	SNP	G	G	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:150948274G>T	ENST00000261800.5	-	1	231	c.219C>A	c.(217-219)atC>atA	p.I73I		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCCAGAGATGATCCGGTACC	0.488																																					p.I73I		.											.	FAT2	96	0			c.C219A						.						195.0	200.0	198.0					5																	150948274		2203	4300	6503	SO:0001819	synonymous_variant	2196	exon1			AGAGATGATCCGG	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.219C>A	5.37:g.150948274G>T		159.0	1.0		212.0	45.0	NM_001447	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1																																																																																			.		0.488	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FHAD1	114827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	15675645	15675645	+	Splice_Site	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr1:15675645G>C	ENST00000375998.4	+	17	2388	c.2388G>C	c.(2386-2388)gaG>gaC	p.E796D	FHAD1_ENST00000314740.8_Intron|FHAD1_ENST00000358897.4_Splice_Site_p.E796D|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000375999.3_Splice_Site_p.E796D|FHAD1_ENST00000417793.1_Intron			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	796										skin(1)|stomach(1)	2						AACAGAAGGAGGTATGAGCAG	0.478																																					p.E796D		.											.	FHAD1	69	0			c.G2388C						.						100.0	97.0	98.0					1																	15675645		692	1591	2283	SO:0001630	splice_region_variant	114827	exon18			GAAGGAGGTATGA	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.2388+1G>C	1.37:g.15675645G>C		65.0	0.0		56.0	14.0	NM_052929	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	37		.	.	.	.	.	.	.	.	.	.	g	15.87	2.959350	0.53400	.	.	ENSG00000142621	ENST00000358897;ENST00000375999;ENST00000375998	T;T;T	0.50001	0.76;0.76;0.76	4.51	4.51	0.55191	.	.	.	.	.	T	0.44787	0.1310	M	0.72353	2.195	0.80722	D	1	P	0.34522	0.455	B	0.28553	0.091	T	0.47674	-0.9099	9	0.40728	T	0.16	-18.1096	12.9178	0.58214	0.0:0.0:1.0:0.0	.	796	B1AJZ9	FHAD1_HUMAN	D	796	ENSP00000351770:E796D;ENSP00000365167:E796D;ENSP00000365166:E796D	ENSP00000351770:E796D	E	+	3	2	FHAD1	15548232	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.216000	0.58540	2.495000	0.84180	0.558000	0.71614	GAG	.		0.478	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	Missense_Mutation
FIZ1	84922	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56104976	56104976	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:56104976C>T	ENST00000221665.3	-	3	420	c.331G>A	c.(331-333)Gtc>Atc	p.V111I	FIZ1_ENST00000592585.1_Intron	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	111					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		AGCTCGCAGACCAGGCAGCAG	0.667																																					p.V111I		.											.	FIZ1	90	0			c.G331A						.						12.0	17.0	15.0					19																	56104976		1893	3702	5595	SO:0001583	missense	84922	exon3			CGCAGACCAGGCA	AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.331G>A	19.37:g.56104976C>T	ENSP00000221665:p.Val111Ile	108.0	0.0		127.0	27.0	NM_032836	A2RU72|Q6ZMJ7	Missense_Mutation	SNP	ENST00000221665.3	37	CCDS12928.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837455	0.32513	.	.	ENSG00000179943	ENST00000221665	T	0.18016	2.24	3.63	2.59	0.31030	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12732	0.0309	N	0.20304	0.555	0.80722	D	1	B	0.24618	0.107	B	0.33690	0.168	T	0.12477	-1.0546	9	0.72032	D	0.01	-17.0241	8.6145	0.33822	0.0:0.8818:0.0:0.1182	.	111	Q96SL8	FIZ1_HUMAN	I	111	ENSP00000221665:V111I	ENSP00000221665:V111I	V	-	1	0	FIZ1	60796788	0.000000	0.05858	1.000000	0.80357	0.987000	0.75469	1.225000	0.32551	2.028000	0.59812	0.561000	0.74099	GTC	.		0.667	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453350.1	NM_032836	
FLNA	2316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153586830	153586830	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:153586830A>T	ENST00000369850.3	-	27	4817	c.4581T>A	c.(4579-4581)gaT>gaA	p.D1527E	FLNA_ENST00000360319.4_Missense_Mutation_p.D1527E|FLNA_ENST00000344736.4_Missense_Mutation_p.D1527E|FLNA_ENST00000422373.1_Missense_Mutation_p.D1527E|FLNA_ENST00000369856.3_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1527	Interaction with furin. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTACCTCTTCATCTCCATACA	0.587																																					p.D1527E		.											.	FLNA	599	0			c.T4581A						.						76.0	76.0	76.0					X																	153586830		2127	4231	6358	SO:0001583	missense	2316	exon27			CTCTTCATCTCCA	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.4581T>A	X.37:g.153586830A>T	ENSP00000358866:p.Asp1527Glu	154.0	0.0		164.0	29.0	NM_001456	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	A	11.54	1.670550	0.29693	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91	5.47	-10.9	0.00192	Immunoglobulin E-set (2);Immunoglobulin-like fold (1);	0.267031	0.32918	N	0.005497	T	0.80813	0.4695	L	0.39514	1.22	0.54753	D	0.999982	B;B	0.19073	0.033;0.019	B;B	0.25291	0.059;0.029	T	0.61783	-0.6992	10	0.25106	T	0.35	.	4.4855	0.11788	0.5713:0.1392:0.2026:0.0869	.	1527;1527	P21333-2;P21333	.;FLNA_HUMAN	E	1527;1500;1527;1527;1527	ENSP00000353467:D1527E;ENSP00000416926:D1527E;ENSP00000358866:D1527E;ENSP00000358863:D1527E	ENSP00000358863:D1527E	D	-	3	2	FLNA	153240024	0.000000	0.05858	0.145000	0.22337	0.767000	0.43475	-4.369000	0.00245	-2.879000	0.00320	-0.577000	0.04142	GAT	.		0.587	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
GAS2L3	283431	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	101017478	101017478	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr12:101017478G>T	ENST00000539410.1	+	9	1281	c.895G>T	c.(895-897)Gtt>Ttt	p.V299F	GAS2L3_ENST00000547754.1_Missense_Mutation_p.V299F|GAS2L3_ENST00000537247.1_Missense_Mutation_p.V195F|GAS2L3_ENST00000266754.5_Missense_Mutation_p.V299F			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	299					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						TCAAAAAGGAGTTTCTAATGA	0.368																																					p.V299F		.											.	GAS2L3	227	0			c.G895T						.						65.0	68.0	67.0					12																	101017478		2203	4299	6502	SO:0001583	missense	283431	exon10			AAAGGAGTTTCTA	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.895G>T	12.37:g.101017478G>T	ENSP00000439672:p.Val299Phe	77.0	1.0		67.0	14.0	NM_174942	B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	37	CCDS9079.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577466	0.45902	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.25912	1.79;1.79;1.77;1.79	5.71	2.55	0.30701	.	0.421069	0.25964	N	0.027174	T	0.22781	0.0550	L	0.55481	1.735	0.27503	N	0.951937	P	0.41597	0.756	B	0.39419	0.299	T	0.08554	-1.0716	10	0.24483	T	0.36	-11.1873	10.8917	0.47000	0.2637:0.0:0.7363:0.0	.	299	Q86XJ1	GA2L3_HUMAN	F	299;299;195;299	ENSP00000266754:V299F;ENSP00000448955:V299F;ENSP00000442406:V195F;ENSP00000439672:V299F	ENSP00000266754:V299F	V	+	1	0	GAS2L3	99541609	0.625000	0.27111	1.000000	0.80357	0.946000	0.59487	0.984000	0.29565	0.783000	0.33636	-0.140000	0.14226	GTT	.		0.368	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942	
GIN1	54826	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	102433403	102433403	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:102433403C>T	ENST00000399004.2	-	5	816	c.722G>A	c.(721-723)aGt>aAt	p.S241N	GIN1_ENST00000508629.1_Intron	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	241	Integrase catalytic. {ECO:0000255|PROSITE-ProRule:PRU00457}.				DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		GTTAGGTGTACTTTCCGTTGG	0.368																																					p.S241N		.											.	GIN1	92	0			c.G722A						.						228.0	206.0	213.0					5																	102433403		1896	4125	6021	SO:0001583	missense	54826	exon5			GGTGTACTTTCCG	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.722G>A	5.37:g.102433403C>T	ENSP00000381970:p.Ser241Asn	91.0	0.0		127.0	7.0	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	37	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	C	4.471	0.087301	0.08583	.	.	ENSG00000145723	ENST00000399004	T	0.45276	0.9	5.66	3.87	0.44632	Integrase, catalytic core (1);Ribonuclease H-like (1);	0.293446	0.29002	N	0.013459	T	0.25419	0.0618	N	0.12182	0.205	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.02450	-1.1157	10	0.33141	T	0.24	-1.3883	12.3179	0.54969	0.0:0.8084:0.1218:0.0698	.	241	Q9NXP7	GIN1_HUMAN	N	241	ENSP00000381970:S241N	ENSP00000381970:S241N	S	-	2	0	GIN1	102461302	0.996000	0.38824	0.431000	0.26735	0.005000	0.04900	0.690000	0.25451	0.320000	0.23234	-0.810000	0.03169	AGT	.		0.368	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
GLI3	2737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	42262748	42262748	+	Silent	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr7:42262748G>A	ENST00000395925.3	-	2	189	c.105C>T	c.(103-105)gcC>gcT	p.A35A	GLI3_ENST00000437480.1_Silent_p.A35A	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	35					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TGGTGCTGGAGGCAACGGCTT	0.507									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.A35A		.											.	GLI3	1149	0			c.C105T						.						215.0	200.0	205.0					7																	42262748		2203	4300	6503	SO:0001819	synonymous_variant	2737	exon2	Familial Cancer Database	;	GCTGGAGGCAACG		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.105C>T	7.37:g.42262748G>A		96.0	0.0		81.0	23.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	37	CCDS5465.1																																																																																			.		0.507	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
GOLT1B	51026	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21665265	21665265	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr12:21665265A>T	ENST00000229314.5	+	4	442	c.333A>T	c.(331-333)agA>agT	p.R111S	GOLT1B_ENST00000535593.1_3'UTR|GOLT1B_ENST00000542038.1_Missense_Mutation_p.R47S|GOLT1B_ENST00000540141.1_Missense_Mutation_p.R111S	NM_016072.4	NP_057156.1	Q9Y3E0	GOT1B_HUMAN	golgi transport 1B	111					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	signal transducer activity (GO:0004871)			large_intestine(2)|lung(3)	5						TTATTAGAAGAGTGCCAGTCC	0.338																																					p.R111S		.											.	GOLT1B	90	0			c.A333T						.						157.0	157.0	157.0					12																	21665265		2203	4300	6503	SO:0001583	missense	51026	exon4			TAGAAGAGTGCCA	AB097020	CCDS8689.1	12p13.1	2010-06-24	2010-06-24		ENSG00000111711	ENSG00000111711			20175	protein-coding gene	gene with protein product		615078	"""golgi transport 1 homolog B (S. cerevisiae)"""			12414650, 10810093	Standard	NM_016072		Approved	CGI-141, YMR292W, GOT1	uc001rez.2	Q9Y3E0	OTTHUMG00000169133	ENST00000229314.5:c.333A>T	12.37:g.21665265A>T	ENSP00000229314:p.Arg111Ser	54.0	1.0		89.0	34.0	NM_016072	B2R4R4|Q54A40|Q6I9W6|Q9P1R9	Missense_Mutation	SNP	ENST00000229314.5	37	CCDS8689.1	.	.	.	.	.	.	.	.	.	.	A	17.23	3.337896	0.60963	.	.	ENSG00000111711	ENST00000542038;ENST00000540141;ENST00000229314	T;T;T	0.34667	1.35;1.35;1.35	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	L	0.41492	1.28	0.80722	D	1	B	0.30361	0.277	B	0.40329	0.326	T	0.34453	-0.9828	10	0.59425	D	0.04	-8.5938	15.7762	0.78220	1.0:0.0:0.0:0.0	.	111	Q9Y3E0	GOT1B_HUMAN	S	47;111;111	ENSP00000446231:R47S;ENSP00000437351:R111S;ENSP00000229314:R111S	ENSP00000229314:R111S	R	+	3	2	GOLT1B	21556532	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.082000	0.64450	2.128000	0.65567	0.533000	0.62120	AGA	.		0.338	GOLT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402384.2	NM_016072	
GPR173	54328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53106558	53106558	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:53106558G>A	ENST00000332582.4	+	2	1246	c.755G>A	c.(754-756)gGg>gAg	p.G252E		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	252					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						TTTGGCCGTGGGCCCATGCCA	0.657																																					p.G252E		.											.	GPR173	130	0			c.G755A						.						30.0	25.0	27.0					X																	53106558		2193	4292	6485	SO:0001583	missense	54328	exon2			GCCGTGGGCCCAT	AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.755G>A	X.37:g.53106558G>A	ENSP00000331600:p.Gly252Glu	40.0	0.0		49.0	10.0	NM_018969	B1B0A5	Missense_Mutation	SNP	ENST00000332582.4	37	CCDS14349.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769867	0.69992	.	.	ENSG00000184194	ENST00000332582	T	0.47177	0.85	5.03	5.03	0.67393	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.66626	0.2808	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64601	-0.6369	10	0.23891	T	0.37	-6.4962	14.8667	0.70422	0.0:0.0:1.0:0.0	.	252	Q9NS66	GP173_HUMAN	E	252	ENSP00000331600:G252E	ENSP00000331600:G252E	G	+	2	0	GPR173	53123283	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.094000	0.63399	0.529000	0.55759	GGG	.		0.657	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056717.2	NM_018969	
GPR82	27197	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	41586979	41586979	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:41586979T>A	ENST00000302548.4	+	3	940	c.700T>A	c.(700-702)Tgt>Agt	p.C234S	CASK_ENST00000378163.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000378154.1_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000442742.2_Intron	NM_080817.4	NP_543007.1	Q96P67	GPR82_HUMAN	G protein-coupled receptor 82	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	10						AATAAGAACCTGTACGTCCAT	0.343																																					p.C234S		.											.	GPR82	110	0			c.T700A						.						77.0	71.0	73.0					X																	41586979		2203	4300	6503	SO:0001583	missense	27197	exon3			AGAACCTGTACGT	AF411111	CCDS14259.1	Xp11.4	2012-08-21			ENSG00000171657	ENSG00000171657		"""GPCR / Class A : Orphans"""	4533	protein-coding gene	gene with protein product		300748				11574155	Standard	NM_080817		Approved		uc004dft.3	Q96P67	OTTHUMG00000021373	ENST00000302548.4:c.700T>A	X.37:g.41586979T>A	ENSP00000303549:p.Cys234Ser	188.0	2.0		193.0	58.0	NM_080817	Q5VT13	Missense_Mutation	SNP	ENST00000302548.4	37	CCDS14259.1	.	.	.	.	.	.	.	.	.	.	T	0.731	-0.779827	0.02929	.	.	ENSG00000171657	ENST00000302548	T	0.70164	-0.46	5.82	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.179382	0.35040	N	0.003485	T	0.39989	0.1099	N	0.16478	0.41	0.21950	N	0.999453	B	0.11235	0.004	B	0.16289	0.015	T	0.13899	-1.0492	10	0.09084	T	0.74	-11.788	3.5183	0.07732	0.3096:0.1047:0.0:0.5858	.	234	Q96P67	GPR82_HUMAN	S	234	ENSP00000303549:C234S	ENSP00000303549:C234S	C	+	1	0	GPR82	41471923	0.994000	0.37717	0.995000	0.50966	0.952000	0.60782	2.268000	0.43338	1.957000	0.56846	0.486000	0.48141	TGT	.		0.343	GPR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056261.1	NM_080817	
GPR174	84636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	78426850	78426850	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:78426850C>G	ENST00000276077.1	+	1	382	c.346C>G	c.(346-348)Cga>Gga	p.R116G		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						CAGTGTGCGACGATTTTGGTT	0.473										HNSCC(63;0.18)																											p.R116G		.											.	GPR174	130	0			c.C346G						.						215.0	189.0	198.0					X																	78426850		2203	4300	6503	SO:0001583	missense	84636	exon1			GTGCGACGATTTT	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.346C>G	X.37:g.78426850C>G	ENSP00000276077:p.Arg116Gly	445.0	0.0		491.0	124.0	NM_032553	Q2M3F7	Missense_Mutation	SNP	ENST00000276077.1	37	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	c	14.69	2.610026	0.46527	.	.	ENSG00000147138	ENST00000276077	D	0.97161	-4.27	5.13	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98658	0.9550	M	0.93854	3.465	0.45704	D	0.998618	D	0.89917	1.0	D	0.97110	1.0	D	0.98771	1.0728	10	0.87932	D	0	.	13.4568	0.61204	0.7035:0.2965:0.0:0.0	.	116	Q9BXC1	GP174_HUMAN	G	116	ENSP00000276077:R116G	ENSP00000276077:R116G	R	+	1	2	GPR174	78313506	0.071000	0.21146	0.962000	0.40283	0.977000	0.68977	0.530000	0.23036	0.010000	0.14839	0.534000	0.68092	CGA	.		0.473	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553	
GRAMD2	196996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	72455767	72455767	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr15:72455767G>A	ENST00000309731.7	-	10	809	c.796C>T	c.(796-798)Ccc>Tcc	p.P266S	GRAMD2_ENST00000564184.1_5'UTR	NM_001012642.2	NP_001012660.1	Q8IUY3	GRAM2_HUMAN	GRAM domain containing 2	266						integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	13						CCTGGCATGGGCCATGCCCAC	0.532																																					p.P266S		.											.	GRAMD2	90	0			c.C796T						.						100.0	105.0	103.0					15																	72455767		2199	4297	6496	SO:0001583	missense	196996	exon10			GCATGGGCCATGC	AK002016	CCDS32283.1	15q23	2006-11-29	2005-11-03	2005-11-03					27287	protein-coding gene	gene with protein product						12477932	Standard	NM_001012642		Approved		uc002atq.3	Q8IUY3		ENST00000309731.7:c.796C>T	15.37:g.72455767G>A	ENSP00000311657:p.Pro266Ser	71.0	0.0		110.0	36.0	NM_001012642	B3KT68	Missense_Mutation	SNP	ENST00000309731.7	37	CCDS32283.1	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.363682	0.01235	.	.	ENSG00000175318	ENST00000309731	T	0.28069	1.63	3.07	2.1	0.27182	.	7.794120	0.00166	N	0.000001	T	0.20210	0.0486	N	0.22421	0.69	0.09310	N	1	B	0.22276	0.067	B	0.18561	0.022	T	0.20306	-1.0279	10	0.06891	T	0.86	.	7.2428	0.26106	0.1437:0.0:0.8563:0.0	.	266	Q8IUY3	GRAM2_HUMAN	S	266	ENSP00000311657:P266S	ENSP00000311657:P266S	P	-	1	0	GRAMD2	70242821	0.000000	0.05858	0.030000	0.17652	0.067000	0.16453	0.213000	0.17521	0.817000	0.34445	0.655000	0.94253	CCC	.		0.532	GRAMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420040.1	NM_001012642	
GRIA1	2890	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	153085452	153085460	+	In_Frame_Del	DEL	GTGAGTGTT	GTGAGTGTT	-			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	GTGAGTGTT	GTGAGTGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:153085452_153085460delGTGAGTGTT	ENST00000285900.5	+	11	1991_1999	c.1648_1656delGTGAGTGTT	c.(1648-1656)gtgagtgttdel	p.VSV550del	GRIA1_ENST00000448073.4_In_Frame_Del_p.VSV560del|GRIA1_ENST00000521843.2_In_Frame_Del_p.VSV481del|GRIA1_ENST00000518783.1_In_Frame_Del_p.VSV560del|GRIA1_ENST00000340592.5_In_Frame_Del_p.VSV550del|GRIA1_ENST00000518142.1_In_Frame_Del_p.VSV470del	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	550					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CTACATTGGAGTGAGTGTTGTCCTCTTCC	0.469																																					p.560_562del		.											.	GRIA1	96	0			c.1678_1686del						.																																			SO:0001651	inframe_deletion	2890	exon11			ATTGGAGTGAGTG		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1648_1656delGTGAGTGTT	5.37:g.153085452_153085460delGTGAGTGTT	ENSP00000285900:p.Val550_Val552del	271.0	0.0		379.0	34.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	In_Frame_Del	DEL	ENST00000285900.5	37	CCDS4322.1																																																																																			.		0.469	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
HAGHL	84264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	777559	777559	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr16:777559T>G	ENST00000341413.4	+	2	331	c.50T>G	c.(49-51)gTc>gGc	p.V17G	HAGHL_ENST00000561546.1_Missense_Mutation_p.V17G|HAGHL_ENST00000564537.1_Missense_Mutation_p.V17G|CCDC78_ENST00000293889.6_5'Flank|NARFL_ENST00000562862.1_5'Flank|HAGHL_ENST00000549114.1_Missense_Mutation_p.V17G|HAGHL_ENST00000564545.1_Missense_Mutation_p.V17G|HAGHL_ENST00000389703.3_Missense_Mutation_p.V17G			Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like	17							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			lung(3)	3		Hepatocellular(780;0.00335)				ATGTACCTGGTCATCGAGGAG	0.692																																					p.V17G	Pancreas(46;538 1326 12403 32360)	.											.	HAGHL	90	0			c.T50G						.						68.0	51.0	57.0					16																	777559		2189	4295	6484	SO:0001583	missense	84264	exon1			ACCTGGTCATCGA	AK054841	CCDS32354.1	16p13.3	2008-02-05	2003-11-04						14177	protein-coding gene	gene with protein product			"""hydroxyacyl glutathione hydrolase-like"""			12477932	Standard	XM_005255629		Approved	MGC2605	uc002cjo.1	Q6PII5		ENST00000341413.4:c.50T>G	16.37:g.777559T>G	ENSP00000341952:p.Val17Gly	95.0	0.0		130.0	27.0	NM_032304	A6NCC4|D3DU64|Q59FX8|Q96BZ3|Q96NR5|Q96S11|Q9BT45	Missense_Mutation	SNP	ENST00000341413.4	37		.	.	.	.	.	.	.	.	.	.	T	23.8	4.460644	0.84317	.	.	ENSG00000103253	ENST00000549114;ENST00000341413;ENST00000389701;ENST00000389703	D;D;D	0.85339	-1.97;-1.97;-1.97	3.43	3.43	0.39272	Beta-lactamase-like (2);	0.185073	0.33834	N	0.004506	D	0.92625	0.7657	M	0.90650	3.135	0.58432	D	0.999998	D;D;D;D	0.89917	0.996;0.998;0.999;1.0	D;D;D;D	0.91635	0.995;0.995;0.996;0.999	D	0.93250	0.6634	10	0.87932	D	0	-14.7484	10.8824	0.46946	0.0:0.0:0.0:1.0	.	17;17;17;17	B4DED4;Q6PII5-2;Q6PII5-3;Q6PII5	.;.;.;HAGHL_HUMAN	G	17	ENSP00000447170:V17G;ENSP00000341952:V17G;ENSP00000374353:V17G	ENSP00000341952:V17G	V	+	2	0	HAGHL	717560	1.000000	0.71417	0.565000	0.28409	0.790000	0.44656	4.243000	0.58721	1.431000	0.47355	0.459000	0.35465	GTC	.		0.692	HAGHL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409607.1	NM_032304	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	4693825	4693829	+	Frame_Shift_Del	DEL	TGTCG	TGTCG	-	rs377049416		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	TGTCG	TGTCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:4693825_4693829delTGTCG	ENST00000443694.2	+	9	874_878	c.874_878delTGTCG	c.(874-879)tgtcggfs	p.CR292fs	ITPR1_ENST00000357086.4_Frame_Shift_Del_p.CR292fs|ITPR1_ENST00000423119.2_Frame_Shift_Del_p.CR292fs|ITPR1_ENST00000354582.6_Frame_Shift_Del_p.CR292fs|ITPR1_ENST00000544951.1_Frame_Shift_Del_p.CR292fs|ITPR1_ENST00000302640.8_Frame_Shift_Del_p.CR292fs|ITPR1_ENST00000456211.2_Frame_Shift_Del_p.CR292fs			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	292					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GCATGACCCATGTCGGGGCGGAGCA	0.493																																					p.292_293del		.											.	ITPR1	710	0			c.874_878del						.																																			SO:0001589	frameshift_variant	3708	exon11			GACCCATGTCGGG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.874_878delTGTCG	3.37:g.4693825_4693829delTGTCG	ENSP00000401671:p.Cys292fs	118.0	0.0		158.0	35.0	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Frame_Shift_Del	DEL	ENST00000443694.2	37	CCDS54551.1																																																																																			.		0.493	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
ITIH4	3700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52863215	52863215	+	Silent	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:52863215C>T	ENST00000266041.4	-	2	267	c.171G>A	c.(169-171)gtG>gtA	p.V57V	ITIH4_ENST00000346281.5_Silent_p.V57V|ITIH4_ENST00000485816.1_Silent_p.V57V|ITIH4_ENST00000434759.3_Intron|ITIH4_ENST00000406595.1_Silent_p.V57V|RP5-966M1.6_ENST00000513520.1_5'Flank|RP5-966M1.6_ENST00000468472.1_3'UTR	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	57	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CCCTATTGACCACTCGGCTGG	0.562																																					p.V57V		.											.	ITIH4	46	0			c.G171A						.						163.0	135.0	145.0					3																	52863215		2203	4300	6503	SO:0001819	synonymous_variant	3700	exon2			ATTGACCACTCGG	D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.171G>A	3.37:g.52863215C>T		105.0	0.0		127.0	37.0	NM_001166449	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Silent	SNP	ENST00000266041.4	37	CCDS2865.1																																																																																			.		0.562	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218	
KCNK16	83795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	39285579	39285579	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:39285579G>T	ENST00000373229.5	-	3	491	c.478C>A	c.(478-480)Cgt>Agt	p.R160S	KCNK16_ENST00000425054.2_Missense_Mutation_p.R160S|KCNK16_ENST00000507712.1_Missense_Mutation_p.R95S|KCNK16_ENST00000373227.4_Missense_Mutation_p.R160S|KCNK16_ENST00000437525.2_Missense_Mutation_p.R160S	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	160					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						CGCCTGGGACGGTCCTCCCAT	0.592																																					p.R160S		.											.	KCNK16	229	0			c.C478A						.						34.0	33.0	33.0					6																	39285579		2203	4299	6502	SO:0001583	missense	83795	exon3			TGGGACGGTCCTC	AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.478C>A	6.37:g.39285579G>T	ENSP00000362326:p.Arg160Ser	66.0	0.0		103.0	30.0	NM_001135106	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	ENST00000373229.5	37	CCDS4843.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533589	0.27387	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000507712;ENST00000373227;ENST00000437525	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.35	3.54	0.40534	.	0.993224	0.08190	N	0.983964	T	0.09555	0.0235	N	0.10733	0.035	0.09310	N	1	B;B;B;B	0.18610	0.002;0.029;0.001;0.001	B;B;B;B	0.15484	0.001;0.013;0.003;0.001	T	0.35126	-0.9801	10	0.46703	T	0.11	.	8.1516	0.31143	0.0763:0.0:0.5902:0.3334	.	160;160;160;160	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	S	160;160;95;160;160	ENSP00000362326:R160S;ENSP00000391498:R160S;ENSP00000423842:R95S;ENSP00000362324:R160S;ENSP00000415375:R160S	ENSP00000362324:R160S	R	-	1	0	KCNK16	39393557	0.935000	0.31712	0.997000	0.53966	0.856000	0.48823	1.792000	0.38754	0.617000	0.30160	0.561000	0.74099	CGT	.		0.592	KCNK16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040452.2	NM_032115	
KIAA1244	57221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138640960	138640960	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:138640960C>T	ENST00000251691.4	+	28	4761	c.4595C>T	c.(4594-4596)gCt>gTt	p.A1532V		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TTCAAGCACGCTATTGGTCTG	0.502																																					p.A1532V		.											.	KIAA1244	228	0			c.C4595T						.						146.0	138.0	140.0					6																	138640960		2203	4300	6503	SO:0001583	missense	57221	exon28			AGCACGCTATTGG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.4595C>T	6.37:g.138640960C>T	ENSP00000251691:p.Ala1532Val	168.0	0.0		182.0	61.0	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907619	0.92107	.	.	ENSG00000112379	ENST00000251691	T	0.21031	2.03	5.4	5.4	0.78164	.	0.053335	0.85682	D	0.000000	T	0.36524	0.0970	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.05989	-1.0852	10	0.59425	D	0.04	-30.519	19.5504	0.95315	0.0:1.0:0.0:0.0	.	1532	Q5TH69	BIG3_HUMAN	V	1532	ENSP00000251691:A1532V	ENSP00000251691:A1532V	A	+	2	0	KIAA1244	138682653	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	7.600000	0.82769	2.688000	0.91661	0.655000	0.94253	GCT	.		0.502	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
KIF13B	23303	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	28950346	28950346	+	Silent	SNP	C	C	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:28950346C>G	ENST00000524189.1	-	37	4412	c.4374G>C	c.(4372-4374)gtG>gtC	p.V1458V	KIF13B_ENST00000404075.3_5'UTR	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1458					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GCATTTGCGGCACGAAGGATT	0.488																																					p.V1458V		.											.	KIF13B	22	0			c.G4374C						.						66.0	68.0	67.0					8																	28950346		1937	4137	6074	SO:0001819	synonymous_variant	23303	exon37			TTGCGGCACGAAG	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.4374G>C	8.37:g.28950346C>G		94.0	2.0		63.0	20.0	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	ENST00000524189.1	37	CCDS55217.1																																																																																			.		0.488	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
KRT79	338785	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	53225247	53225247	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr12:53225247C>T	ENST00000330553.5	-	2	675	c.641G>A	c.(640-642)gGg>gAg	p.G214E		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	214	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTCCAGCCTCCCCCGCTCGCT	0.617																																					p.G214E		.											.	KRT79	72	0			c.G641A						.						114.0	114.0	114.0					12																	53225247		2203	4300	6503	SO:0001583	missense	338785	exon2			AGCCTCCCCCGCT	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.641G>A	12.37:g.53225247C>T	ENSP00000328358:p.Gly214Glu	96.0	0.0		105.0	7.0	NM_175834	Q6P465|Q7Z793	Missense_Mutation	SNP	ENST00000330553.5	37	CCDS8839.1	.	.	.	.	.	.	.	.	.	.	C	7.898	0.733846	0.15574	.	.	ENSG00000185640	ENST00000330553	T	0.73789	-0.78	4.29	3.4	0.38934	Filament (1);	0.000000	0.50627	D	0.000117	T	0.67581	0.2908	M	0.64404	1.975	0.23010	N	0.99843	B	0.25007	0.116	B	0.30572	0.117	T	0.56171	-0.8023	10	0.31617	T	0.26	.	5.7978	0.18397	0.2856:0.6186:0.0:0.0958	.	214	Q5XKE5	K2C79_HUMAN	E	214	ENSP00000328358:G214E	ENSP00000328358:G214E	G	-	2	0	KRT79	51511514	0.000000	0.05858	0.953000	0.39169	0.650000	0.38633	-0.892000	0.04131	1.410000	0.46936	0.561000	0.74099	GGG	.		0.617	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
KRTAP5-7	440050	hgsc.bcm.edu;broad.mit.edu	37	11	71238736	71238762	+	In_Frame_Del	DEL	CTGCTGTTCCTCAGGCTGTGGGTCATC	CTGCTGTTCCTCAGGCTGTGGGTCATC	-	rs533945918|rs79842834	byFrequency	TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	CTGCTGTTCCTCAGGCTGTGGGTCATC	CTGCTGTTCCTCAGGCTGTGGGTCATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr11:71238736_71238762delCTGCTGTTCCTCAGGCTGTGGGTCATC	ENST00000398536.4	+	1	424_450	c.390_416delCTGCTGTTCCTCAGGCTGTGGGTCATC	c.(388-417)tgctgctgttcctcaggctgtgggtcatcc>tgc	p.CCSSGCGSS131del		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	131	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G137W(1)		breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						gtaagccctgctgctgttcctcaggctgtgggtcatcctgctgccag	0.604																																					p.130_139del		.											.	KRTAP5-7	68	1	Substitution - Missense(1)	lung(1)	c.390_416del						.																																			SO:0001651	inframe_deletion	440050	exon1			GCCCTGCTGCTGT	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.390_416delCTGCTGTTCCTCAGGCTGTGGGTCATC	11.37:g.71238736_71238762delCTGCTGTTCCTCAGGCTGTGGGTCATC	ENSP00000417330:p.Cys131_Ser139del	160.0	0.0		183.0	23.0	NM_001012503	B2RNM3|Q701N5	In_Frame_Del	DEL	ENST00000398536.4	37	CCDS41682.1																																																																																			.		0.604	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1		
LAMP5	24141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9510307	9510307	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr20:9510307A>G	ENST00000246070.2	+	6	1175	c.683A>G	c.(682-684)gAt>gGt	p.D228G	LAMP5_ENST00000427562.2_Missense_Mutation_p.D184G	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	228						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											TGCCCAGTGGATGAGCGGGAG	0.468																																					p.D228G		.											.	.	.	0			c.A683G						.						94.0	78.0	83.0					20																	9510307		2203	4300	6503	SO:0001583	missense	24141	exon6			CAGTGGATGAGCG	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.683A>G	20.37:g.9510307A>G	ENSP00000246070:p.Asp228Gly	105.0	0.0		153.0	25.0	NM_012261	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	37	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.043371	0.75732	.	.	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.43294	0.95;0.95	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.51346	0.1669	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.47484	-0.9114	9	.	.	.	-18.7431	16.8061	0.85666	1.0:0.0:0.0:0.0	.	184;228	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	G	228;184	ENSP00000246070:D228G;ENSP00000406360:D184G	.	D	+	2	0	C20orf103	9458307	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.451000	0.90343	2.367000	0.80283	0.528000	0.53228	GAT	.		0.468	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261	
LBP	3929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36983752	36983752	+	Silent	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr20:36983752G>A	ENST00000217407.2	+	5	692	c.531G>A	c.(529-531)ctG>ctA	p.L177L		NM_004139.3	NP_004130.2	P18428	LBP_HUMAN	lipopolysaccharide binding protein	177					acute-phase response (GO:0006953)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of molecule of bacterial origin (GO:0032490)|innate immune response (GO:0045087)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of tumor necrosis factor production (GO:0032720)|opsonization (GO:0008228)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage activation (GO:0043032)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(1)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				CCAGGTGGCTGTTGAACCTCT	0.597																																					p.L177L		.											.	LBP	91	0			c.G531A						.						105.0	84.0	91.0					20																	36983752		2203	4299	6502	SO:0001819	synonymous_variant	3929	exon5			GTGGCTGTTGAAC		CCDS13304.1	20q11.23	2011-08-16	2001-11-28		ENSG00000129988	ENSG00000129988		"""BPI fold containing"""	6517	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 2"""	151990	"""lipopolysaccharide-binding protein"""			8432532	Standard	NM_004139		Approved	BPIFD2	uc002xic.2	P18428	OTTHUMG00000032447	ENST00000217407.2:c.531G>A	20.37:g.36983752G>A		92.0	0.0		102.0	39.0	NM_004139	B2R938|O43438|Q92672|Q9H403|Q9UD66	Silent	SNP	ENST00000217407.2	37	CCDS13304.1																																																																																			.		0.597	LBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079174.2	NM_004139	
LEPR	3953	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	66102511	66102511	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr1:66102511T>A	ENST00000349533.6	+	20	3496	c.3311T>A	c.(3310-3312)tTc>tAc	p.F1104Y	LEPR_ENST00000406510.3_Missense_Mutation_p.F171Y	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		TCGTGCCCATTCCCAGCCCCC	0.398																																					p.F1104Y		.											.	LEPR	91	0			c.T3311A						.						71.0	69.0	70.0					1																	66102511		2203	4300	6503	SO:0001583	missense	3953	exon20			GCCCATTCCCAGC	U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.3311T>A	1.37:g.66102511T>A	ENSP00000330393:p.Phe1104Tyr	157.0	0.0		135.0	7.0	NM_002303	Q6FHL5	Missense_Mutation	SNP	ENST00000349533.6	37	CCDS631.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.480913	0.44044	.	.	ENSG00000116678	ENST00000349533;ENST00000406510	T	0.59224	0.28	5.64	3.14	0.36123	.	0.557233	0.20745	N	0.086474	T	0.58075	0.2097	M	0.69823	2.125	0.30912	N	0.728979	D	0.76494	0.999	D	0.64687	0.928	T	0.55952	-0.8059	10	0.52906	T	0.07	-10.0424	8.5838	0.33646	0.1289:0.0:0.135:0.7361	.	1104	P48357	LEPR_HUMAN	Y	1104;171	ENSP00000330393:F1104Y	ENSP00000330393:F1104Y	F	+	2	0	LEPR	65875099	0.841000	0.29509	0.805000	0.32314	0.025000	0.11179	3.803000	0.55560	0.936000	0.37367	0.477000	0.44152	TTC	.		0.398	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025275.1	NM_002303	
LILRB1	10859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55143640	55143640	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:55143640C>T	ENST00000396331.1	+	6	970	c.613C>T	c.(613-615)Ccc>Tcc	p.P205S	LILRB1_ENST00000396321.2_Missense_Mutation_p.P205S|AC009892.1_ENST00000578908.1_RNA|LILRB1_ENST00000396317.1_Missense_Mutation_p.P205S|LILRB1_ENST00000448689.1_Missense_Mutation_p.P205S|LILRB1_ENST00000324602.7_Missense_Mutation_p.P205S|LILRB1_ENST00000396327.3_Missense_Mutation_p.P205S|LILRB1_ENST00000396332.4_Missense_Mutation_p.P205S|LILRB1_ENST00000427581.2_Missense_Mutation_p.P241S|LILRB1_ENST00000418536.2_Missense_Mutation_p.P205S|LILRB1_ENST00000396315.1_Missense_Mutation_p.P205S|LILRB1_ENST00000434867.2_Missense_Mutation_p.P205S	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	205	Ig-like C2-type 2.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.P205T(2)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CTCGAACTCTCCCTATGAGTG	0.607										HNSCC(37;0.09)																											p.P205S		.											.	LILRB1	137	2	Substitution - Missense(2)	lung(2)	c.C613T						.						157.0	155.0	156.0					19																	55143640		2203	4300	6503	SO:0001583	missense	10859	exon5			AACTCTCCCTATG	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.613C>T	19.37:g.55143640C>T	ENSP00000379622:p.Pro205Ser	280.0	0.0		290.0	69.0	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	C	5.476	0.272920	0.10349	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94;1.94	1.49	0.396	0.16309	Immunoglobulin-like fold (1);	0.431079	0.19689	N	0.108302	T	0.21881	0.0527	M	0.64630	1.985	0.09310	N	1	D;P;P;P;B	0.55172	0.97;0.662;0.92;0.637;0.327	P;B;B;B;B	0.47470	0.548;0.096;0.186;0.082;0.044	T	0.10847	-1.0612	10	0.56958	D	0.05	.	3.6471	0.08189	0.0:0.7403:0.0:0.2597	.	205;205;205;205;205	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	S	205;205;205;205;205;205;205;205;241;205;205	ENSP00000379614:P205S;ENSP00000391514:P205S;ENSP00000409968:P205S;ENSP00000379622:P205S;ENSP00000379618:P205S;ENSP00000315997:P205S;ENSP00000405243:P205S;ENSP00000379623:P205S;ENSP00000395004:P241S;ENSP00000379610:P205S;ENSP00000379608:P205S	ENSP00000315997:P205S	P	+	1	0	LILRB1	59835452	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	-0.125000	0.10579	0.181000	0.19994	0.184000	0.17185	CCC	.		0.607	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
MAGEL2	54551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	23889752	23889752	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr15:23889752C>A	ENST00000532292.1	-	1	1423	c.1329G>T	c.(1327-1329)atG>atT	p.M443I		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	326	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TGACTTTCACCATCTCCGAGC	0.488																																					p.M1046I		.											.	.	.	0			c.G3138T						.						60.0	59.0	59.0					15																	23889752		1998	4184	6182	SO:0001583	missense	54551	exon1			TTTCACCATCTCC	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1329G>T	15.37:g.23889752C>A	ENSP00000433433:p.Met443Ile	190.0	0.0		188.0	39.0	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	37		.	.	.	.	.	.	.	.	.	.	C	13.89	2.370795	0.42003	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.78	3.79	0.43588	.	.	.	.	.	T	0.39332	0.1074	L	0.39566	1.225	0.25990	N	0.982256	.	.	.	.	.	.	T	0.16158	-1.0412	5	.	.	.	.	9.7898	0.40699	0.205:0.795:0.0:0.0	.	.	.	.	L	475	.	.	W	-	2	0	MAGEL2	21440845	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	1.889000	0.39718	2.644000	0.89710	0.591000	0.81541	TGG	.		0.488	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
MICA	100507436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31378413	31378413	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:31378413C>T	ENST00000449934.2	+	2	218	c.164C>T	c.(163-165)cCc>cTc	p.P55L	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				GATGGTCAGCCCTTCCTGCGC	0.557																																					p.P55L		.											.	.	.	0			c.C164T						.						33.0	36.0	35.0					6																	31378413		692	1591	2283	SO:0001583	missense	100507436	exon2			GTCAGCCCTTCCT	L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.164C>T	6.37:g.31378413C>T	ENSP00000413079:p.Pro55Leu	217.0	0.0		235.0	56.0	NM_001177519		Missense_Mutation	SNP	ENST00000449934.2	37	CCDS56412.1	.	.	.	.	.	.	.	.	.	.	N	1.771	-0.484375	0.04383	.	.	ENSG00000204520	ENST00000364810;ENST00000399172;ENST00000449934;ENST00000421350	T;T	0.00675	5.88;5.88	2.89	-3.87	0.04218	.	2.158990	0.02591	N	0.099933	T	0.00178	0.0005	N	0.05230	-0.09	0.09310	N	1	B	0.24533	0.105	B	0.21708	0.036	T	0.44772	-0.9306	10	0.66056	D	0.02	.	3.6447	0.08180	0.1773:0.4171:0.0:0.4056	.	55	Q96QC4	.	L	55;55;55;42	ENSP00000413079:P55L;ENSP00000402410:P42L	ENSP00000365394:P55L	P	+	2	0	MICA	31486392	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-2.758000	0.00787	-0.905000	0.03871	-0.818000	0.03119	CCC	.		0.557	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076101.7	NM_001177519	
TRPM1	4308	ucsc.edu;mdanderson.org	37	15	31357301	31357301	+	Intron	SNP	C	C	A	rs187960998		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr15:31357301C>A	ENST00000256552.6	-	7	938				TRPM1_ENST00000542188.1_Intron|TRPM1_ENST00000397795.2_Intron|MIR211_ENST00000384969.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GAGCCCTAGGCGAAGGATGAC	0.502																																					.		.											.	.	.	0			.						.						167.0	151.0	156.0					15																	31357301		1567	3582	5149	SO:0001627	intron_variant	406993	.			CCTAGGCGAAGGA	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.790+977G>T	15.37:g.31357301C>A		46.0	0.0		62.0	23.0	.		RNA	SNP	ENST00000256552.6	37	CCDS58346.1																																																																																			C|0.999;T|0.000		0.502	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
GULP1	51454	ucsc.edu;mdanderson.org	37	2	189162265	189162265	+	Intron	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:189162265C>T	ENST00000409580.1	+	2	543				GULP1_ENST00000479019.1_Intron|GULP1_ENST00000409609.1_Intron|GULP1_ENST00000359135.3_Intron|GULP1_ENST00000409830.1_Intron|GULP1_ENST00000409637.3_Intron|GULP1_ENST00000409843.1_Intron|GULP1_ENST00000409805.1_Intron|GULP1_ENST00000410051.1_Intron|MIR561_ENST00000385216.1_RNA			Q9UBP9	GULP1_HUMAN	GULP, engulfment adaptor PTB domain containing 1						apoptotic process (GO:0006915)|lipid transport (GO:0006869)|phagocytosis, engulfment (GO:0006911)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)			TAAACTTTGCCAGAGCTACAA	0.408																																					.	Pancreas(178;563 2065 20199 42378 52815)	.											.	.	.	0			.						.						31.0	27.0	28.0					2																	189162265		1549	3539	5088	SO:0001627	intron_variant	693146	.			CTTTGCCAGAGCT	AF191771	CCDS2295.1, CCDS58742.1, CCDS58743.1	2q32.3-q33	2008-02-05			ENSG00000144366	ENSG00000144366			18649	protein-coding gene	gene with protein product		608165				11729193	Standard	NM_001252668		Approved	CED6, CED-6, GULP	uc010fru.3	Q9UBP9	OTTHUMG00000132647	ENST00000409580.1:c.-172+3145C>T	2.37:g.189162265C>T		79.0	0.0		106.0	43.0	.	B2RB51|B4DQ40|B8ZZ72|D3DPH1|E9PB86|Q53PC1|Q53RF3|Q9BVL3	RNA	SNP	ENST00000409580.1	37	CCDS2295.1																																																																																			.		0.408	GULP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335722.1	NM_016315	
STRBP	55342	ucsc.edu;mdanderson.org	37	9	125876416	125876416	+	Intron	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr9:125876416G>A	ENST00000530364.1	-	2	31				MIR600HG_ENST00000385007.1_RNA			Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein						cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						AAGGCTGACAGGATCCGTGTC	0.552																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	81571	.			CTGACAGGATCCG	AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000530364.1:c.255-4384C>T	9.37:g.125876416G>A		73.0	0.0		76.0	19.0	.	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	RNA	SNP	ENST00000530364.1	37																																																																																				.		0.552	STRBP-009	PUTATIVE	basic	processed_transcript	protein_coding	OTTHUMT00000392598.1		
KMT2E	55904	broad.mit.edu;mdanderson.org	37	7	104741930	104741930	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr7:104741930G>A	ENST00000311117.3	+	16	2326	c.1781G>A	c.(1780-1782)aGa>aAa	p.R594K	KMT2E_ENST00000334877.4_Missense_Mutation_p.R594K|KMT2E_ENST00000257745.4_Missense_Mutation_p.R594K|KMT2E_ENST00000334914.7_5'UTR|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	594				R -> K (in Ref. 7; AK000940). {ECO:0000305}.	cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CTTGAAAAGAGAGAGAAAAGA	0.333																																					p.R594K		.											.	MLL5	93	0			c.G1781A						.						78.0	78.0	78.0					7																	104741930		2203	4300	6503	SO:0001583	missense	55904	exon15			AAAAGAGAGAGAA	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1781G>A	7.37:g.104741930G>A	ENSP00000312379:p.Arg594Lys	9.0	0.0		12.0	3.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181170	0.78677	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.91686	-2.89;-2.51;-2.89	5.42	5.42	0.78866	.	0.046484	0.85682	D	0.000000	D	0.95771	0.8624	M	0.77103	2.36	0.80722	D	1	D	0.58268	0.982	D	0.67548	0.952	D	0.94493	0.7703	10	0.33141	T	0.24	.	19.2374	0.93866	0.0:0.0:1.0:0.0	.	594	Q8IZD2	MLL5_HUMAN	K	594;594;594;514;594	ENSP00000312379:R594K;ENSP00000335599:R594K;ENSP00000257745:R594K	ENSP00000257745:R594K	R	+	2	0	MLL5	104529166	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.335000	0.90031	2.551000	0.86045	0.561000	0.74099	AGA	.		0.333	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	108147461	108147461	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:108147461C>G	ENST00000273353.3	-	28	3696	c.3640G>C	c.(3640-3642)Gag>Cag	p.E1214Q		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1214						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1214Q(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CCCTCGAGCTCAGCCAGGCTG	0.493																																					p.E1214Q		.											.	MYH15	73	1	Substitution - Missense(1)	lung(1)	c.G3640C						.						141.0	132.0	135.0					3																	108147461		1933	4148	6081	SO:0001583	missense	22989	exon28			CGAGCTCAGCCAG	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3640G>C	3.37:g.108147461C>G	ENSP00000273353:p.Glu1214Gln	228.0	0.0		297.0	12.0	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.103060	0.37145	.	.	ENSG00000144821	ENST00000273353	D	0.83419	-1.72	5.37	2.64	0.31445	Myosin tail (1);	.	.	.	.	D	0.90442	0.7007	M	0.86343	2.81	0.42253	D	0.99198	D	0.63880	0.993	D	0.69654	0.965	D	0.89990	0.4107	9	0.87932	D	0	.	10.5166	0.44894	0.0:0.791:0.0:0.209	.	1214	Q9Y2K3	MYH15_HUMAN	Q	1214	ENSP00000273353:E1214Q	ENSP00000273353:E1214Q	E	-	1	0	MYH15	109630151	0.953000	0.32496	0.000000	0.03702	0.018000	0.09664	2.188000	0.42612	0.358000	0.24211	-0.142000	0.14014	GAG	.		0.493	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
MYOF	26509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	95161196	95161196	+	Nonsense_Mutation	SNP	G	G	A	rs199504349		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr10:95161196G>A	ENST00000359263.4	-	12	1095	c.1096C>T	c.(1096-1098)Cga>Tga	p.R366*	MYOF_ENST00000371501.4_Nonsense_Mutation_p.R366*|MYOF_ENST00000358334.5_Nonsense_Mutation_p.R366*|MYOF_ENST00000371502.4_Nonsense_Mutation_p.R366*|MYOF_ENST00000371489.1_Nonsense_Mutation_p.R366*	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	366	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TCCTCAGCTCGGTAGATTTTC	0.423																																					p.R366X		.											.	MYOF	93	0			c.C1096T						.						115.0	111.0	113.0					10																	95161196		1918	4134	6052	SO:0001587	stop_gained	26509	exon12			CAGCTCGGTAGAT	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.1096C>T	10.37:g.95161196G>A	ENSP00000352208:p.Arg366*	56.0	0.0		98.0	28.0	NM_133337	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Nonsense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	G	38	6.761573	0.97821	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502;ENST00000371489	.	.	.	5.64	3.63	0.41609	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.56	12.5443	0.56190	0.0:0.0:0.4562:0.5438	.	.	.	.	X	366	.	ENSP00000351094:R366X	R	-	1	2	MYOF	95151186	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.585000	0.23879	1.571000	0.49722	0.650000	0.86243	CGA	.		0.423	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
NCOA6	23054	hgsc.bcm.edu;broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																					p.Q269Q		.											.	NCOA6	292	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)	c.G807A						.						64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	23054	exon7			CTGCTGCTGTTGT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		121.0	0.0		122.0	5.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	ENST00000374796.2	37	CCDS13241.1																																																																																			.		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
NETO2	81831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	47117548	47117548	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr16:47117548C>G	ENST00000562435.1	-	9	1546	c.1162G>C	c.(1162-1164)Ggg>Cgg	p.G388R	NETO2_ENST00000303155.5_Missense_Mutation_p.G381R	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	388					regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)				breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				TCTTGGAACCCGGTTTTATTA	0.403										HNSCC(25;0.065)																											p.G388R		.											.	NETO2	90	0			c.G1162C						.						82.0	87.0	86.0					16																	47117548		2203	4300	6503	SO:0001583	missense	81831	exon9			GGAACCCGGTTTT	AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.1162G>C	16.37:g.47117548C>G	ENSP00000455169:p.Gly388Arg	83.0	0.0		57.0	23.0	NM_018092	J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	ENST00000562435.1	37	CCDS10727.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.294527	0.81025	.	.	ENSG00000171208	ENST00000303155	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.74030	0.3663	L	0.47716	1.5	0.80722	D	1	P;D;D	0.71674	0.864;0.986;0.998	P;P;D	0.69142	0.62;0.842;0.962	T	0.68606	-0.5364	9	0.30854	T	0.27	.	20.0124	0.97464	0.0:1.0:0.0:0.0	.	245;388;64	B7Z4I7;Q8NC67;Q8NC67-2	.;NETO2_HUMAN;.	R	388	.	ENSP00000306726:G388R	G	-	1	0	NETO2	45675049	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	4.804000	0.62554	2.749000	0.94314	0.655000	0.94253	GGG	.		0.403	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256766.2	NM_018092	
OPRM1	4988	broad.mit.edu;bcgsc.ca	37	6	154360342	154360342	+	5'Flank	SNP	A	A	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:154360342A>T	ENST00000330432.7	+	0	0				OPRM1_ENST00000452687.2_5'Flank|OPRM1_ENST00000337049.4_5'Flank|OPRM1_ENST00000414028.2_5'Flank|OPRM1_ENST00000434900.2_Missense_Mutation_p.D16V|OPRM1_ENST00000428397.2_5'Flank|OPRM1_ENST00000229768.5_5'Flank|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000524163.1_5'Flank|OPRM1_ENST00000419506.2_5'Flank|OPRM1_ENST00000360422.4_5'Flank|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000435918.2_5'Flank	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TACTCCTTGGATCGCTTTGCG	0.572																																					p.D16V		.											.	OPRM1	69	0			c.A47T						.						229.0	203.0	211.0					6																	154360342		692	1591	2283	SO:0001631	upstream_gene_variant	4988	exon2			CCTTGGATCGCTT	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870		6.37:g.154360342A>T	Exception_encountered	111.0	1.0		142.0	10.0	NM_001145279	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	37	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	A	13.59	2.283622	0.40394	.	.	ENSG00000112038	ENST00000434900	T	0.74002	-0.8	5.44	1.37	0.22104	.	.	.	.	.	T	0.27454	0.0674	N	0.08118	0	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.21484	-1.0244	9	0.87932	D	0	.	1.4941	0.02463	0.4607:0.1559:0.0831:0.3003	.	16	P35372-10	.	V	16	ENSP00000394624:D16V	ENSP00000394624:D16V	D	+	2	0	OPRM1	154402035	0.003000	0.15002	0.095000	0.20976	0.973000	0.67179	0.638000	0.24674	-0.003000	0.14444	0.528000	0.53228	GAT	.		0.572	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
OVOL2	58495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	18005322	18005322	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr20:18005322G>C	ENST00000278780.6	-	4	1028	c.786C>G	c.(784-786)caC>caG	p.H262Q	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	262					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						TATTCTCCTGGTGTGCGGATG	0.532																																					p.H262Q		.											.	OVOL2	68	0			c.C786G						.						99.0	81.0	87.0					20																	18005322		2203	4300	6503	SO:0001583	missense	58495	exon4			CTCCTGGTGTGCG	AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.786C>G	20.37:g.18005322G>C	ENSP00000278780:p.His262Gln	237.0	0.0		293.0	21.0	NM_021220	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Missense_Mutation	SNP	ENST00000278780.6	37	CCDS13132.1	.	.	.	.	.	.	.	.	.	.	G	7.012	0.556918	0.13436	.	.	ENSG00000125850	ENST00000278780	T	0.07327	3.2	5.0	1.56	0.23342	.	0.670225	0.14280	N	0.329599	T	0.04137	0.0115	N	0.08118	0	0.21064	N	0.999797	B	0.21381	0.055	B	0.14023	0.01	T	0.44360	-0.9333	10	0.14656	T	0.56	-10.0163	11.7714	0.51960	0.086:0.6517:0.2622:0.0	.	262	Q9BRP0	OVOL2_HUMAN	Q	262	ENSP00000278780:H262Q	ENSP00000278780:H262Q	H	-	3	2	OVOL2	17953322	0.708000	0.27876	0.229000	0.23960	0.108000	0.19459	0.180000	0.16860	0.463000	0.27118	0.467000	0.42956	CAC	.		0.532	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078148.5	NM_021220	
PAX4	5078	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	127255087	127255087	+	Silent	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr7:127255087T>C	ENST00000341640.2	-	2	388	c.183A>G	c.(181-183)ccA>ccG	p.P61P	PAX4_ENST00000463946.1_Silent_p.P59P|PAX4_ENST00000338516.3_Silent_p.P69P|PAX4_ENST00000378740.2_Silent_p.P61P	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	69	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CAATGCCCTTTGGCTCCAAGA	0.572																																					p.P61P	Ovarian(113;737 1605 7858 27720 34092)	.											.	PAX4	227	0			c.A183G						.						100.0	93.0	95.0					7																	127255087		2203	4300	6503	SO:0001819	synonymous_variant	5078	exon2			GCCCTTTGGCTCC		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.183A>G	7.37:g.127255087T>C		70.0	0.0		86.0	6.0	NM_006193	O95161|Q6B0H0	Silent	SNP	ENST00000341640.2	37	CCDS5797.1																																																																																			.		0.572	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349165.1		
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	56129002	56129002	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr10:56129002C>G	ENST00000320301.6	-	5	746	c.352G>C	c.(352-354)Gtc>Ctc	p.V118L	PCDH15_ENST00000395438.1_Missense_Mutation_p.V118L|PCDH15_ENST00000395445.1_Missense_Mutation_p.V118L|PCDH15_ENST00000373965.2_Missense_Mutation_p.V118L|PCDH15_ENST00000395442.1_Missense_Mutation_p.V118L|PCDH15_ENST00000395430.1_Missense_Mutation_p.V118L|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.V118L|PCDH15_ENST00000395446.1_Missense_Mutation_p.V118L|PCDH15_ENST00000437009.1_Missense_Mutation_p.V118L|PCDH15_ENST00000395432.2_Missense_Mutation_p.V118L|PCDH15_ENST00000395433.1_Missense_Mutation_p.V96L|PCDH15_ENST00000373957.3_Missense_Mutation_p.V96L|PCDH15_ENST00000373955.1_Missense_Mutation_p.V118L|PCDH15_ENST00000414778.1_Missense_Mutation_p.V123L|PCDH15_ENST00000395440.1_Missense_Mutation_p.V118L	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	118	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ATGCACTGGACCTGCACCACA	0.403										HNSCC(58;0.16)																											p.V123L		.											.	PCDH15	193	0			c.G367C						.						129.0	103.0	112.0					10																	56129002		2203	4300	6503	SO:0001583	missense	65217	exon6			ACTGGACCTGCAC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.352G>C	10.37:g.56129002C>G	ENSP00000322604:p.Val118Leu	89.0	0.0		76.0	22.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052838	0.55218	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58060	0.54;0.64;0.58;0.51;0.43;0.66;0.56;0.41;0.42;0.49;0.36;0.42;0.42;0.53;0.63	5.52	5.52	0.82312	Cadherin (1);	.	.	.	.	T	0.63307	0.2500	L	0.29908	0.895	0.42086	D	0.991277	D;P;P;P;P;P;D;P;P;B;P;P;D;P;P	0.63046	0.992;0.876;0.719;0.719;0.947;0.876;0.992;0.908;0.719;0.376;0.908;0.949;0.97;0.949;0.719	D;P;B;B;P;P;D;P;B;B;B;P;P;P;B	0.77004	0.989;0.464;0.349;0.349;0.78;0.464;0.989;0.53;0.349;0.264;0.411;0.53;0.779;0.53;0.349	T	0.61936	-0.6960	9	0.39692	T	0.17	.	19.0325	0.92963	0.0:1.0:0.0:0.0	.	96;118;118;123;118;118;118;118;118;118;118;123;118;96;118	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	L	118;123;118;118;118;118;118;118;118;118;96;96;118;118;123;118;118	ENSP00000363076:V118L;ENSP00000410304:V123L;ENSP00000378826:V118L;ENSP00000378832:V118L;ENSP00000378833:V118L;ENSP00000378829:V118L;ENSP00000378827:V118L;ENSP00000378820:V118L;ENSP00000354950:V118L;ENSP00000378821:V96L;ENSP00000363068:V96L;ENSP00000322604:V118L;ENSP00000378818:V118L;ENSP00000412628:V118L;ENSP00000363066:V118L	ENSP00000322604:V118L	V	-	1	0	PCDH15	55799008	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.918000	0.63376	2.590000	0.87494	0.585000	0.79938	GTC	.		0.403	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
PCDHA5	56143	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140203594	140203594	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:140203594G>T	ENST00000529859.1	+	1	2234	c.2234G>T	c.(2233-2235)gGg>gTg	p.G745V	PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.G745V|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.G745V|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	745					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCGCGGTGGGGAGCTGGTCG	0.652																																					p.G745V		.											.	PCDHA5	137	0			c.G2234T						.						66.0	61.0	63.0					5																	140203594		2203	4300	6503	SO:0001583	missense	56143	exon1			CGGTGGGGAGCTG	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.2234G>T	5.37:g.140203594G>T	ENSP00000436557:p.Gly745Val	88.0	0.0		129.0	16.0	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	37	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208401	0.58343	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.26518	1.73;1.73;1.73	3.92	3.05	0.35203	.	.	.	.	.	T	0.58308	0.2113	M	0.93375	3.41	0.47094	D	0.999312	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.78314	0.98;0.991;0.982	T	0.67650	-0.5616	9	0.87932	D	0	.	11.7041	0.51587	0.0887:0.0:0.9113:0.0	.	745;745;745	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	V	745	ENSP00000433416:G745V;ENSP00000436557:G745V;ENSP00000367366:G745V	ENSP00000367366:G745V	G	+	2	0	PCDHA5	140183778	0.999000	0.42202	1.000000	0.80357	0.744000	0.42396	2.866000	0.48420	0.761000	0.33130	0.491000	0.48974	GGG	.		0.652	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
PCDHAC1	56135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140307840	140307840	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:140307840G>C	ENST00000253807.2	+	1	1363	c.1363G>C	c.(1363-1365)Gct>Cct	p.A455P	PCDHA13_ENST00000409494.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.A455P|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	455	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTTTCGTTGCTGAAAACAA	0.517																																					p.A455P		.											.	PCDHAC1	28	0			c.G1363C						.						64.0	69.0	67.0					5																	140307840		2203	4300	6503	SO:0001583	missense	56135	exon1			TTCGTTGCTGAAA	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1363G>C	5.37:g.140307840G>C	ENSP00000253807:p.Ala455Pro	34.0	0.0		57.0	6.0	NM_031882	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	37	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014065	0.19277	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.03330	3.97;3.97	5.54	5.54	0.83059	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01940	0.0061	N	0.01438	-0.865	0.23464	N	0.997621	B;B	0.06786	0.001;0.0	B;B	0.12156	0.007;0.004	T	0.49513	-0.8932	9	0.22109	T	0.4	.	13.7462	0.62876	0.0735:0.0:0.9265:0.0	.	455;455	Q9H158;Q9H158-2	PCDC1_HUMAN;.	P	455	ENSP00000386356:A455P;ENSP00000253807:A455P	ENSP00000253807:A455P	A	+	1	0	PCDHAC1	140288024	0.003000	0.15002	1.000000	0.80357	0.934000	0.57294	0.556000	0.23438	2.599000	0.87857	0.462000	0.41574	GCT	.		0.517	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
PEG3	5178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57327699	57327699	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:57327699T>A	ENST00000326441.9	-	10	2474	c.2111A>T	c.(2110-2112)cAg>cTg	p.Q704L	ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.Q704L|PEG3_ENST00000593695.1_Missense_Mutation_p.Q578L|PEG3_ENST00000598410.1_Missense_Mutation_p.Q580L|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	704					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ATGAATTTTCTGATGCTCACT	0.428																																					p.Q704L		.											.	PEG3	164	0			c.A2111T						.						70.0	68.0	69.0					19																	57327699		2203	4300	6503	SO:0001583	missense	5178	exon9			ATTTTCTGATGCT	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2111A>T	19.37:g.57327699T>A	ENSP00000326581:p.Gln704Leu	100.0	0.0		101.0	20.0	NM_001146184	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	ENST00000326441.9	37	CCDS12948.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.092830	0.36952	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.15256	2.44;2.44	4.05	-1.05	0.10036	.	0.925177	0.08914	N	0.875485	T	0.21227	0.0511	M	0.85462	2.755	.	.	.	B;B;B	0.26672	0.006;0.072;0.156	B;B;B	0.21360	0.003;0.021;0.034	T	0.29488	-1.0010	9	0.72032	D	0.01	-8.765	4.9444	0.13982	0.3408:0.0:0.2755:0.3837	.	580;704;639	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	L	704	ENSP00000326581:Q704L;ENSP00000403051:Q704L	ENSP00000326581:Q704L	Q	-	2	0	ZIM2	62019511	0.000000	0.05858	0.179000	0.23059	0.984000	0.73092	-0.672000	0.05244	-0.324000	0.08589	0.477000	0.44152	CAG	.		0.428	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
PFKFB1	5207	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54989780	54989780	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:54989780C>T	ENST00000375006.3	-	2	203	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	PFKFB1_ENST00000545676.1_Intron|PFKFB1_ENST00000374992.2_Missense_Mutation_p.V45M	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	45	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						ACCATGATCACCATTGTGGGG	0.443																																					p.V45M		.											.	PFKFB1	131	0			c.G133A						.						151.0	126.0	134.0					X																	54989780		2203	4300	6503	SO:0001583	missense	5207	exon2			TGATCACCATTGT		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.133G>A	X.37:g.54989780C>T	ENSP00000364145:p.Val45Met	172.0	0.0		159.0	50.0	NM_001271804	B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	37	CCDS14364.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052740	0.55218	.	.	ENSG00000158571	ENST00000375006;ENST00000374992	T	0.51817	0.69	5.51	5.51	0.81932	6-phosphofructo-2-kinase (1);	0.054916	0.64402	D	0.000001	T	0.70527	0.3234	M	0.88377	2.95	0.29349	N	0.865493	P;D	0.65815	0.922;0.995	P;D	0.69479	0.776;0.964	T	0.72054	-0.4406	10	0.72032	D	0.01	-15.1306	10.9929	0.47559	0.0:0.9104:0.0:0.0896	.	45;45	Q4VBA9;P16118	.;F261_HUMAN	M	45	ENSP00000364131:V45M	ENSP00000364131:V45M	V	-	1	0	PFKFB1	55006505	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.753000	0.38359	2.454000	0.82982	0.600000	0.82982	GTG	.		0.443	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1		
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110417294	110417294	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:110417294C>T	ENST00000378402.5	+	16	1708	c.1604C>T	c.(1603-1605)cCa>cTa	p.P535L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	535					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTAACCAGCCCATGTGTGGAA	0.299										HNSCC(38;0.096)																											p.P535L		.											.	PKHD1L1	145	0			c.C1604T						.						31.0	30.0	30.0					8																	110417294		1810	4066	5876	SO:0001583	missense	93035	exon16			CCAGCCCATGTGT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1604C>T	8.37:g.110417294C>T	ENSP00000367655:p.Pro535Leu	97.0	0.0		99.0	24.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.600458	0.46423	.	.	ENSG00000205038	ENST00000378402	D	0.84800	-1.9	5.8	5.8	0.92144	.	0.278061	0.36519	N	0.002559	D	0.83027	0.5165	M	0.70595	2.14	0.35090	D	0.764237	B	0.22480	0.07	B	0.15484	0.013	D	0.83584	0.0119	10	0.49607	T	0.09	.	10.9095	0.47099	0.0:0.9151:0.0:0.0849	.	535	Q86WI1	PKHL1_HUMAN	L	535	ENSP00000367655:P535L	ENSP00000367655:P535L	P	+	2	0	PKHD1L1	110486470	0.878000	0.30173	0.972000	0.41901	0.974000	0.67602	3.024000	0.49674	2.752000	0.94435	0.650000	0.86243	CCA	.		0.299	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	110539189	110539189	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:110539189G>T	ENST00000378402.5	+	77	12765	c.12661G>T	c.(12661-12663)Gga>Tga	p.G4221*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4221					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTGTCTGGTTGGAAGAATGTG	0.403										HNSCC(38;0.096)																											p.G4221X		.											.	PKHD1L1	145	0			c.G12661T						.						89.0	94.0	92.0					8																	110539189		1987	4190	6177	SO:0001587	stop_gained	93035	exon77			CTGGTTGGAAGAA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12661G>T	8.37:g.110539189G>T	ENSP00000367655:p.Gly4221*	123.0	0.0		127.0	28.0	NM_177531	Q567P2|Q9UF27	Nonsense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	32	5.153435	0.94645	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	.	.	.	5.64	4.75	0.60458	.	0.510568	0.17727	N	0.164015	.	.	.	.	.	.	0.58432	A	0.999992	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.5101	0.56002	0.0:0.1676:0.8324:0.0	.	.	.	.	X	4221;1149	.	ENSP00000367655:G4221X	G	+	1	0	PKHD1L1	110608365	0.998000	0.40836	0.333000	0.25482	0.227000	0.25037	3.285000	0.51716	1.338000	0.45544	0.650000	0.86243	GGA	.		0.403	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLCE1	51196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	96084287	96084287	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr10:96084287C>A	ENST00000371380.3	+	30	6918	c.6683C>A	c.(6682-6684)gCa>gAa	p.A2228E	PLCE1_ENST00000260766.3_Missense_Mutation_p.A2228E|NOC3L_ENST00000543788.1_Intron|PLCE1_ENST00000371375.1_Missense_Mutation_p.A1920E|PLCE1_ENST00000371385.3_Missense_Mutation_p.A1920E			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	2228	Ras-associating 2. {ECO:0000255|PROSITE- ProRule:PRU00166}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TGGAAAGGTGCAGGAAAATTC	0.423																																					p.A2228E		.											.	PLCE1	229	0			c.C6683A						.						138.0	137.0	137.0					10																	96084287		1879	4109	5988	SO:0001583	missense	51196	exon31			AAGGTGCAGGAAA		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.6683C>A	10.37:g.96084287C>A	ENSP00000360431:p.Ala2228Glu	59.0	0.0		56.0	24.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	37	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685569	0.88639	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.59	5.59	0.84812	Ras-association (3);	0.126776	0.52532	D	0.000068	T	0.35508	0.0934	L	0.39633	1.23	0.80722	D	1	D;D;D	0.71674	0.998;0.995;0.998	D;D;D	0.74348	0.983;0.922;0.983	T	0.01961	-1.1239	10	0.54805	T	0.06	.	19.2024	0.93715	0.0:1.0:0.0:0.0	.	2212;1920;2228	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	E	2228;2228;1920;1920	ENSP00000260766:A2228E;ENSP00000360431:A2228E;ENSP00000360438:A1920E;ENSP00000360426:A1920E	ENSP00000260766:A2228E	A	+	2	0	PLCE1	96074277	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	5.731000	0.68554	2.628000	0.89032	0.655000	0.94253	GCA	.		0.423	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
PLEC	5339	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	144995161	144995161	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:144995161C>T	ENST00000322810.4	-	32	9408	c.9239G>A	c.(9238-9240)cGg>cAg	p.R3080Q	PLEC_ENST00000398774.2_Missense_Mutation_p.R2911Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R2921Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R2947Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R2943Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R2970Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R2943Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R2966Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R2929Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3080	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCGGAACTGCCGCAGCAGGTC	0.597																																					p.R3080Q		.											.	PLEC	141	0			c.G9239A						.						39.0	46.0	43.0					8																	144995161		2152	4248	6400	SO:0001583	missense	5339	exon32			AACTGCCGCAGCA	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9239G>A	8.37:g.144995161C>T	ENSP00000323856:p.Arg3080Gln	49.0	0.0		39.0	4.0	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.279686	0.40294	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.75821	-0.93;-0.93;-0.97;-0.97;-0.95;-0.93;-0.93;-0.94;-0.93	4.82	2.99	0.34606	.	0.092502	0.43416	N	0.000564	T	0.67097	0.2857	M	0.65320	2	0.40794	D	0.983284	B;B;B;B;B;B;B;B	0.11235	0.004;0.004;0.004;0.002;0.004;0.004;0.004;0.004	B;B;B;B;B;B;B;B	0.09377	0.004;0.004;0.004;0.002;0.004;0.004;0.004;0.004	T	0.58825	-0.7568	10	0.16896	T	0.51	.	10.7299	0.46089	0.0:0.836:0.0:0.164	.	2970;2929;2921;3080;2911;2943;2947;2943	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	2943;2947;2943;2911;3080;2921;2929;2970;2966	ENSP00000344848:R2943Q;ENSP00000350277:R2947Q;ENSP00000346602:R2943Q;ENSP00000381756:R2911Q;ENSP00000323856:R3080Q;ENSP00000347044:R2921Q;ENSP00000348702:R2929Q;ENSP00000388180:R2970Q;ENSP00000434583:R2966Q	ENSP00000323856:R3080Q	R	-	2	0	PLEC	145067149	0.970000	0.33590	1.000000	0.80357	0.975000	0.68041	2.446000	0.44908	0.546000	0.28920	0.448000	0.29417	CGG	.		0.597	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PPP5C	5536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46850460	46850460	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:46850460A>G	ENST00000012443.4	+	1	210	c.107A>G	c.(106-108)aAt>aGt	p.N36S	PPP5C_ENST00000391919.1_5'UTR	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	36					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		ACTCAGGCCAATGACTACTTC	0.677											OREG0025570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N36S		.											.	PPP5C	227	0			c.A107G						.						25.0	22.0	23.0					19																	46850460		2197	4297	6494	SO:0001583	missense	5536	exon1			AGGCCAATGACTA		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.107A>G	19.37:g.46850460A>G	ENSP00000012443:p.Asn36Ser	37.0	0.0	942	53.0	9.0	NM_006247	Q16722|Q53XV2	Missense_Mutation	SNP	ENST00000012443.4	37	CCDS12684.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.044402	0.75732	.	.	ENSG00000011485	ENST00000012443;ENST00000451918	T	0.65178	-0.14	3.43	3.43	0.39272	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	U	0.000002	D	0.82921	0.5142	H	0.95151	3.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	D	0.86187	0.1610	10	0.87932	D	0	-21.7574	10.1632	0.42864	1.0:0.0:0.0:0.0	.	36;36	B2R6R6;P53041	.;PPP5_HUMAN	S	36	ENSP00000012443:N36S	ENSP00000012443:N36S	N	+	2	0	PPP5C	51542300	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.523000	0.67099	1.552000	0.49463	0.379000	0.24179	AAT	.		0.677	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
PRDM9	56979	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	23527194	23527194	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:23527194G>A	ENST00000296682.3	+	11	2179	c.1997G>A	c.(1996-1998)tGc>tAc	p.C666Y		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	666					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CCCTATGTCTGCAGGGAGTGT	0.617										HNSCC(3;0.000094)																											p.C666Y		.											.	PRDM9	139	0			c.G1997A						.						15.0	15.0	15.0					5																	23527194		1338	3032	4370	SO:0001583	missense	56979	exon11			ATGTCTGCAGGGA	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1997G>A	5.37:g.23527194G>A	ENSP00000296682:p.Cys666Tyr	122.0	0.0		190.0	28.0	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906694	0.33628	.	.	ENSG00000164256	ENST00000296682	D	0.85088	-1.94	2.31	2.31	0.28768	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39834	N	0.001254	D	0.93556	0.7943	H	0.95114	3.625	0.51012	D	0.999907	D	0.89917	1.0	D	0.91635	0.999	D	0.94067	0.7332	10	0.87932	D	0	-9.0778	10.7009	0.45926	0.0:0.0:1.0:0.0	.	666	Q9NQV7	PRDM9_HUMAN	Y	666	ENSP00000296682:C666Y	ENSP00000296682:C666Y	C	+	2	0	PRDM9	23562951	1.000000	0.71417	0.989000	0.46669	0.126000	0.20510	7.015000	0.76387	1.596000	0.50062	0.455000	0.32223	TGC	.		0.617	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
PRSS16	10279	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	27220730	27220730	+	Splice_Site	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:27220730T>C	ENST00000230582.3	+	9	1165		c.e9+2		PRSS16_ENST00000377456.2_Intron|PRSS16_ENST00000421826.2_Splice_Site	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)						protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						TCGGCTTCTGTAAGTGACTGG	0.512																																					.	NSCLC(178;1118 2105 17078 23587 44429)	.											.	PRSS16	94	0			c.1150+2T>C						.						199.0	170.0	180.0					6																	27220730		2203	4300	6503	SO:0001630	splice_region_variant	10279	exon9			CTTCTGTAAGTGA	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1150+2T>C	6.37:g.27220730T>C		133.0	0.0		166.0	12.0	NM_005865	O75416	Splice_Site	SNP	ENST00000230582.3	37	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	T	16.52	3.146248	0.57044	.	.	ENSG00000112812	ENST00000421826;ENST00000230582;ENST00000343467;ENST00000485993;ENST00000475106	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6381	0.51215	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRSS16	27328709	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.912000	0.56386	1.927000	0.55829	0.460000	0.39030	.	.		0.512	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		Intron
PSMD13	5719	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	251919	251919	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr11:251919G>C	ENST00000532097.1	+	12	1522	c.1018G>C	c.(1018-1020)Gtg>Ctg	p.V340L	PSMD13_ENST00000352303.5_Missense_Mutation_p.V313L|PSMD13_ENST00000431206.2_Missense_Mutation_p.V342L|PSMD13_ENST00000532025.1_3'UTR	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13	340					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		GCAGCCCCGAGTGTTGGATTT	0.502																																					p.V342L		.											.	PSMD13	515	0			c.G1024C						.						161.0	162.0	162.0					11																	251919		2203	4300	6503	SO:0001583	missense	5719	exon10			CCCCGAGTGTTGG	AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.1018G>C	11.37:g.251919G>C	ENSP00000436186:p.Val340Leu	124.0	0.0		196.0	10.0	NM_175932	B3KT15|O75831|Q53XU2|Q9UNV3	Missense_Mutation	SNP	ENST00000532097.1	37	CCDS7692.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997097	0.74818	.	.	ENSG00000185627	ENST00000532097;ENST00000538343;ENST00000431206;ENST00000352303	T;T;T	0.26373	1.87;1.82;1.74	5.07	5.07	0.68467	Proteasome component (PCI) domain (1);	0.000000	0.85682	D	0.000000	T	0.60663	0.2286	M	0.91038	3.17	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.87578	0.998;0.993;0.949;0.949	T	0.69289	-0.5184	10	0.62326	D	0.03	.	17.2159	0.86944	0.0:0.0:1.0:0.0	.	342;275;340;340	Q9UNM6-2;B4DJ66;B2RBM7;Q9UNM6	.;.;.;PSD13_HUMAN	L	340;275;342;313	ENSP00000436186:V340L;ENSP00000396937:V342L;ENSP00000333811:V313L	ENSP00000333811:V313L	V	+	1	0	PSMD13	241919	1.000000	0.71417	0.991000	0.47740	0.314000	0.28054	9.086000	0.94088	2.643000	0.89663	0.563000	0.77884	GTG	.		0.502	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817	
RANBP10	57610	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	67839340	67839340	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr16:67839340delC	ENST00000317506.3	-	2	453	c.338delG	c.(337-339)ggafs	p.G113fs	RANBP10_ENST00000411657.2_Intron|RANBP10_ENST00000602887.1_5'UTR|RANBP10_ENST00000425512.2_5'UTR|RANBP10_ENST00000536251.1_5'UTR|TSNAXIP1_ENST00000415766.3_5'Flank|TSNAXIP1_ENST00000561639.1_5'Flank|RANBP10_ENST00000602677.1_Frame_Shift_Del_p.G113fs|TSNAXIP1_ENST00000388833.3_5'Flank|RANBP10_ENST00000448631.2_Frame_Shift_Del_p.G113fs	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	113	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		CCCATCTCTTCCTTTGCTGAC	0.507																																					p.G113fs		.											.	RANBP10	227	0			c.338delG						.						74.0	69.0	71.0					16																	67839340		2198	4300	6498	SO:0001589	frameshift_variant	57610	exon2			TCTCTTCCTTTGC	AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.338delG	16.37:g.67839340delC	ENSP00000316589:p.Gly113fs	65.0	0.0		91.0	33.0	NM_020850	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Frame_Shift_Del	DEL	ENST00000317506.3	37	CCDS32469.1																																																																																			.		0.507	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1	NM_020850	
RGS22	26166	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	100994297	100994297	+	Silent	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:100994297A>G	ENST00000360863.6	-	22	3422	c.3228T>C	c.(3226-3228)atT>atC	p.I1076I	RGS22_ENST00000523437.1_Silent_p.I1064I|RGS22_ENST00000523287.1_Silent_p.I895I	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1076	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TAATAGTTGTAATCTTCTTCT	0.373																																					p.I1076I		.											.	RGS22	140	0			c.T3228C						.						120.0	114.0	116.0					8																	100994297		1863	4100	5963	SO:0001819	synonymous_variant	26166	exon22			AGTTGTAATCTTC	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3228T>C	8.37:g.100994297A>G		83.0	0.0		95.0	31.0	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	ENST00000360863.6	37	CCDS43758.1																																																																																			.		0.373	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
RMDN1	51115	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	87492510	87492511	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:87492510_87492511insA	ENST00000406452.3	-	6	795_796	c.636_637insT	c.(634-639)ggtattfs	p.I213fs	RMDN1_ENST00000523911.1_Frame_Shift_Ins_p.I169fs|RMDN1_ENST00000519966.1_Frame_Shift_Ins_p.I183fs|RMDN1_ENST00000430676.2_Frame_Shift_Ins_p.I183fs	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	213						microtubule (GO:0005874)|mitochondrion (GO:0005739)											TCTTACCAAATACCCATAAGGT	0.238																																					p.I213fs		.											.	.	.	0			c.637_638insT						.																																			SO:0001589	frameshift_variant	51115	exon6			ACCAAATACCCAT	AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.637dupT	8.37:g.87492511_87492511dupA	ENSP00000385927:p.Ile213fs	112.0	0.0		111.0	34.0	NM_016033	A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Frame_Shift_Ins	INS	ENST00000406452.3	37	CCDS34918.1																																																																																			.		0.238	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033	
RIMS2	9699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	104930679	104930679	+	Silent	SNP	C	C	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:104930679C>A	ENST00000436393.2	+	7	1622	c.1381C>A	c.(1381-1383)Cga>Aga	p.R461R	RIMS2_ENST00000406091.3_Silent_p.R683R|RIMS2_ENST00000262231.10_Silent_p.R538R|RIMS2_ENST00000507740.1_Silent_p.R491R			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	761					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGATATACCGCGAATACCTGA	0.299										HNSCC(12;0.0054)																											p.R683R		.											.	RIMS2	279	0			c.C2047A						.						96.0	94.0	95.0					8																	104930679		1808	4085	5893	SO:0001819	synonymous_variant	9699	exon9			ATACCGCGAATAC	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1381C>A	8.37:g.104930679C>A		121.0	0.0		121.0	25.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000436393.2	37																																																																																				.		0.299	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
SBNO1	55206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123782650	123782650	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr12:123782650T>A	ENST00000602398.1	-	31	4041	c.3914A>T	c.(3913-3915)tAt>tTt	p.Y1305F	SBNO1_ENST00000602750.1_Missense_Mutation_p.Y1304F|SBNO1_ENST00000267176.4_Missense_Mutation_p.Y1304F|SBNO1_ENST00000420886.2_Missense_Mutation_p.Y1305F			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1305					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		ACATAATACATAATATGTACG	0.433																																					p.Y1305F		.											.	SBNO1	292	0			c.A3914T						.						143.0	126.0	132.0					12																	123782650		2203	4300	6503	SO:0001583	missense	55206	exon30			AATACATAATATG	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3914A>T	12.37:g.123782650T>A	ENSP00000473665:p.Tyr1305Phe	100.0	0.0		138.0	42.0	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	T	13.25	2.181519	0.38511	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	D;D	0.82711	-1.64;-1.64	6.03	6.03	0.97812	.	0.239229	0.35525	N	0.003153	T	0.71863	0.3390	N	0.16201	0.385	0.33421	D	0.579876	B;B	0.09022	0.001;0.002	B;B	0.09377	0.002;0.004	T	0.71813	-0.4479	10	0.27785	T	0.31	-4.6331	16.6126	0.84892	0.0:0.0:0.0:1.0	.	1305;1304	A3KN83;A3KN83-2	SBNO1_HUMAN;.	F	1305;1304	ENSP00000387361:Y1305F;ENSP00000267176:Y1304F	ENSP00000267176:Y1304F	Y	-	2	0	SBNO1	122348603	1.000000	0.71417	0.881000	0.34555	0.991000	0.79684	2.571000	0.45990	2.322000	0.78497	0.529000	0.55759	TAT	.		0.433	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
SCG3	29106	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	51975586	51975586	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr15:51975586G>A	ENST00000220478.3	+	4	755	c.352G>A	c.(352-354)Gat>Aat	p.D118N	SCG3_ENST00000542355.2_De_novo_Start_OutOfFrame	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	118					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)	p.D118N(1)		breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		AAAACTGATCGATGATTATGA	0.323																																					p.D118N		.											.	SCG3	91	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G352A						.						108.0	114.0	112.0					15																	51975586		2195	4293	6488	SO:0001583	missense	29106	exon4			CTGATCGATGATT	AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.352G>A	15.37:g.51975586G>A	ENSP00000220478:p.Asp118Asn	25.0	0.0		34.0	4.0	NM_013243	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	ENST00000220478.3	37	CCDS10142.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.642686	0.67244	.	.	ENSG00000104112	ENST00000220478	T	0.27256	1.68	6.07	5.17	0.71159	.	0.351936	0.35739	N	0.003004	T	0.23727	0.0574	L	0.27053	0.805	0.80722	D	1	P	0.49253	0.921	B	0.44108	0.441	T	0.02917	-1.1094	10	0.87932	D	0	-37.4805	15.3604	0.74469	0.0664:0.0:0.9336:0.0	.	118	Q8WXD2	SCG3_HUMAN	N	118	ENSP00000220478:D118N	ENSP00000220478:D118N	D	+	1	0	SCG3	49762878	1.000000	0.71417	0.936000	0.37596	0.668000	0.39293	8.797000	0.91882	1.586000	0.49944	0.655000	0.94253	GAT	.		0.323	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254670.2	NM_013243	
SCN5A	6331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38645342	38645342	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:38645342C>T	ENST00000333535.4	-	12	1900	c.1751G>A	c.(1750-1752)gGc>gAc	p.G584D	SCN5A_ENST00000455624.2_Missense_Mutation_p.G584D|SCN5A_ENST00000423572.2_Missense_Mutation_p.G584D|SCN5A_ENST00000425664.1_Missense_Mutation_p.G584D|SCN5A_ENST00000414099.2_Missense_Mutation_p.G584D|SCN5A_ENST00000450102.2_Missense_Mutation_p.G584D|SCN5A_ENST00000451551.2_Missense_Mutation_p.G584D|SCN5A_ENST00000449557.2_Missense_Mutation_p.G584D|SCN5A_ENST00000443581.1_Missense_Mutation_p.G584D|SCN5A_ENST00000413689.1_Missense_Mutation_p.G584D			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	584					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GAGGGCGTGGCCAGGAGCCGA	0.667																																					p.G584D		.											.	SCN5A	98	0			c.G1751A						.						75.0	82.0	80.0					3																	38645342		2007	4170	6177	SO:0001583	missense	6331	exon12			GCGTGGCCAGGAG	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1751G>A	3.37:g.38645342C>T	ENSP00000328968:p.Gly584Asp	48.0	0.0		64.0	13.0	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	7.277	0.608360	0.14002	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74	4.02	3.11	0.35812	Domain of unknown function DUF3451 (1);	0.678658	0.12881	N	0.431419	D	0.87116	0.6097	L	0.50333	1.59	0.29187	N	0.876133	B;B;B;B;B;B;B	0.25351	0.095;0.124;0.032;0.011;0.052;0.029;0.042	B;B;B;B;B;B;B	0.33121	0.099;0.158;0.022;0.038;0.112;0.049;0.084	T	0.78792	-0.2065	10	0.28530	T	0.3	.	7.8391	0.29387	0.0:0.7761:0.0:0.2239	.	584;584;584;584;584;584;584	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	D	584	ENSP00000398962:G584D;ENSP00000398266:G584D;ENSP00000410257:G584D;ENSP00000388797:G584D;ENSP00000397915:G584D;ENSP00000416634:G584D;ENSP00000328968:G584D;ENSP00000399524:G584D;ENSP00000403355:G584D;ENSP00000413996:G584D	ENSP00000328968:G584D	G	-	2	0	SCN5A	38620346	0.128000	0.22383	0.541000	0.28102	0.890000	0.51754	0.777000	0.26718	2.067000	0.61834	0.561000	0.74099	GGC	.		0.667	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
IQCJ-SCHIP1	100505385	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	158991644	158991644	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:158991644A>T	ENST00000337808.6	+	1	612	c.35A>T	c.(34-36)gAc>gTc	p.D12V	IQCJ-SCHIP1_ENST00000467442.1_Intron|IQCJ-SCHIP1_ENST00000485419.1_Intron|IQCJ-SCHIP1_ENST00000412423.2_Missense_Mutation_p.D12V|IQCJ-SCHIP1_ENST00000476809.1_Intron|IQCJ-SCHIP1_ENST00000527095.1_Missense_Mutation_p.D12V	NM_001197107.1|NM_014575.3	NP_001184036.1|NP_055390.1			IQCJ-SCHIP1 readthrough											central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(7)	12						ACAACGTGGGACTGTGACCAG	0.413																																					p.D12V		.											.	SCHIP1	92	0			c.A35T						.						120.0	117.0	118.0					3																	158991644		2203	4300	6503	SO:0001583	missense	29970	exon1			CGTGGGACTGTGA		CCDS56289.1, CCDS56291.1	3q25.33	2011-03-24			ENSG00000250588	ENSG00000250588			38842	other	readthrough							Standard	NM_001197113		Approved		uc003fcq.2		OTTHUMG00000162426	ENST00000337808.6:c.35A>T	3.37:g.158991644A>T	ENSP00000337239:p.Asp12Val	103.0	1.0		121.0	33.0	NM_014575		Missense_Mutation	SNP	ENST00000337808.6	37	CCDS3186.1	.	.	.	.	.	.	.	.	.	.	A	12.57	1.977453	0.34848	.	.	ENSG00000250588	ENST00000337808;ENST00000412423;ENST00000527095	T;T;T	0.57907	1.52;1.54;0.37	5.34	4.2	0.49525	.	0.214137	0.23523	N	0.047272	T	0.38241	0.1033	.	.	.	0.80722	D	1	P;P	0.40476	0.718;0.596	B;B	0.32533	0.147;0.094	T	0.32322	-0.9911	9	0.87932	D	0	.	6.765	0.23562	0.8833:0.0:0.1167:0.0	.	12;12	Q9P0W5-2;Q9P0W5	.;SCHI1_HUMAN	V	12	ENSP00000337239:D12V;ENSP00000400942:D12V;ENSP00000436076:D12V	ENSP00000337239:D12V	D	+	2	0	IQCJ-SCHIP1	160474338	1.000000	0.71417	0.972000	0.41901	0.992000	0.81027	1.461000	0.35255	0.958000	0.37956	0.528000	0.53228	GAC	.		0.413	IQCJ-SCHIP1-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352557.1	NM_001197113	
SGOL2	151246	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	201399836	201399838	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:201399836_201399838delAAG	ENST00000357799.4	+	3	349_351	c.251_253delAAG	c.(250-255)aaagaa>aaa	p.E85del	SGOL2_ENST00000409203.3_In_Frame_Del_p.E85del	NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	85					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)		p.E85Q(1)		NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						CTATTGCAAAAAGAAGTAGAGAA	0.3																																					p.84_85del		.											.	SGOL2	94	1	Substitution - Missense(1)	lung(1)	c.251_253del						.																																			SO:0001651	inframe_deletion	151246	exon3			TGCAAAAAGAAGT	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.251_253delAAG	2.37:g.201399839_201399841delAAG	ENSP00000350447:p.Glu85del	40.0	0.0		81.0	16.0	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	In_Frame_Del	DEL	ENST00000357799.4	37	CCDS42796.1																																																																																			.		0.300	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
SLC27A6	28965	broad.mit.edu;bcgsc.ca	37	5	128365345	128365345	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr5:128365345A>G	ENST00000262462.4	+	9	2638	c.1628A>G	c.(1627-1629)gAa>gGa	p.E543G	SLC27A6_ENST00000395266.1_Missense_Mutation_p.E543G|SLC27A6_ENST00000506176.1_Missense_Mutation_p.E543G			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	543					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		AAAGTTTATGAACAAGTTGTA	0.308																																					p.E543G		.											.	SLC27A6	90	0			c.A1628G						.						63.0	64.0	64.0					5																	128365345		2201	4298	6499	SO:0001583	missense	28965	exon9			TTTATGAACAAGT	AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.1628A>G	5.37:g.128365345A>G	ENSP00000262462:p.Glu543Gly	70.0	1.0		102.0	5.0	NM_001017372	Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	ENST00000262462.4	37	CCDS4145.1	.	.	.	.	.	.	.	.	.	.	A	7.556	0.663672	0.14710	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.59638	0.25;0.25;0.25	4.53	0.592	0.17471	.	0.526964	0.22065	N	0.065105	T	0.46600	0.1401	M	0.65975	2.015	0.21740	N	0.999562	B	0.06786	0.001	B	0.06405	0.002	T	0.31668	-0.9935	9	.	.	.	-7.0798	3.7526	0.08572	0.6616:0.1297:0.0728:0.1359	.	543	Q9Y2P4	S27A6_HUMAN	G	543	ENSP00000262462:E543G;ENSP00000378684:E543G;ENSP00000421024:E543G	.	E	+	2	0	SLC27A6	128393244	0.967000	0.33354	0.170000	0.22879	0.097000	0.18754	3.138000	0.50570	0.102000	0.17638	0.454000	0.30748	GAA	.		0.308	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250980.1	NM_014031	
SLC7A13	157724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87235302	87235302	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:87235302G>A	ENST00000297524.3	-	2	819	c.716C>T	c.(715-717)cCc>cTc	p.P239L	SLC7A13_ENST00000520624.1_5'UTR|SLC7A13_ENST00000419776.2_Missense_Mutation_p.P230L	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	239						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						TATGCATTTGGGAATTGTTGT	0.353																																					p.P239L		.											.	SLC7A13	90	0			c.C716T						.						144.0	149.0	147.0					8																	87235302		2203	4300	6503	SO:0001583	missense	157724	exon2			CATTTGGGAATTG	AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.716C>T	8.37:g.87235302G>A	ENSP00000297524:p.Pro239Leu	63.0	0.0		87.0	22.0	NM_138817	Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	ENST00000297524.3	37	CCDS34917.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109520	0.56398	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.91740	-2.9;-2.9	4.23	0.0393	0.14204	Amino acid permease domain (1);	0.337202	0.25596	N	0.029592	D	0.94706	0.8292	M	0.86178	2.8	0.22728	N	0.998808	P;D	0.67145	0.808;0.996	P;D	0.67382	0.517;0.951	D	0.88177	0.2868	10	0.66056	D	0.02	.	8.1044	0.30877	0.3936:0.0:0.6064:0.0	.	230;239	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	L	239;230	ENSP00000297524:P239L;ENSP00000410982:P230L	ENSP00000297524:P239L	P	-	2	0	SLC7A13	87304418	0.868000	0.29978	0.003000	0.11579	0.501000	0.33797	1.038000	0.30254	0.053000	0.16036	0.557000	0.71058	CCC	.		0.353	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374704.1	NM_138817	
SLC9A6	10479	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	135067806	135067806	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:135067806G>A	ENST00000370698.3	+	1	180	c.145G>A	c.(145-147)Gag>Aag	p.E49K	SLC9A6_ENST00000370695.4_Missense_Mutation_p.E49K|SLC9A6_ENST00000370701.1_5'UTR	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	49					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CGGCGGCGGAGAGGCTAGAGC	0.667																																					p.E49K		.											.	SLC9A6	131	0			c.G145A						.						56.0	56.0	56.0					X																	135067806		2203	4299	6502	SO:0001583	missense	10479	exon1			GGCGGAGAGGCTA	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.145G>A	X.37:g.135067806G>A	ENSP00000359732:p.Glu49Lys	69.0	0.0		60.0	15.0	NM_006359	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	ENST00000370698.3	37	CCDS14654.1	.	.	.	.	.	.	.	.	.	.	g	11.88	1.771441	0.31320	.	.	ENSG00000198689	ENST00000370698;ENST00000370695	T;T	0.55413	0.52;0.53	4.71	3.57	0.40892	.	0.686932	0.14603	N	0.309493	T	0.33411	0.0862	L	0.29908	0.895	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.001	T	0.28235	-1.0050	10	0.07644	T	0.81	.	6.4153	0.21714	0.1867:0.0:0.8133:0.0	.	49;49	Q92581-2;Q92581	.;SL9A6_HUMAN	K	49	ENSP00000359732:E49K;ENSP00000359729:E49K	ENSP00000359729:E49K	E	+	1	0	SLC9A6	134895472	0.800000	0.28916	0.002000	0.10522	0.807000	0.45602	4.606000	0.61126	0.514000	0.28300	0.373000	0.22412	GAG	.		0.667	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
SLITRK2	84631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	144903985	144903985	+	Silent	SNP	C	C	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:144903985C>A	ENST00000370490.1	+	1	4297	c.42C>A	c.(40-42)gcC>gcA	p.A14A	SLITRK2_ENST00000447897.2_Silent_p.A14A|SLITRK2_ENST00000434188.2_Silent_p.A14A|SLITRK2_ENST00000428560.2_Silent_p.A14A|SLITRK2_ENST00000413937.2_Silent_p.A14A			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	14					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TAACCGTGGCCGGGATCTTAC	0.502																																					p.A14A		.											.	SLITRK2	136	0			c.C42A						.						62.0	58.0	60.0					X																	144903985		2203	4300	6503	SO:0001819	synonymous_variant	84631	exon5			CGTGGCCGGGATC	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.42C>A	X.37:g.144903985C>A		167.0	0.0		199.0	37.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	ENST00000370490.1	37	CCDS14680.1																																																																																			.		0.502	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
SPECC1	92521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	20109082	20109082	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr17:20109082A>G	ENST00000261503.5	+	4	1771	c.1720A>G	c.(1720-1722)Acg>Gcg	p.T574A	AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395530.2_Missense_Mutation_p.T493A|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395522.2_Missense_Mutation_p.T493A|SPECC1_ENST00000395529.3_Missense_Mutation_p.T574A|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395527.4_Missense_Mutation_p.T574A|SPECC1_ENST00000395525.3_Missense_Mutation_p.T493A	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	574					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		TGTGGAGCAGACGGCAGAGAG	0.458																																					p.T574A		.											.	SPECC1	639	0			c.A1720G						.						68.0	71.0	70.0					17																	20109082		2203	4300	6503	SO:0001583	missense	92521	exon4			GAGCAGACGGCAG	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.1720A>G	17.37:g.20109082A>G	ENSP00000261503:p.Thr574Ala	63.0	0.0		66.0	21.0	NM_001033553	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	37	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.970897	0.00457	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.61040	0.14;3.11;3.12;3.12	5.59	0.284	0.15701	.	0.776014	0.13105	N	0.413497	T	0.29458	0.0734	N	0.17474	0.49	0.09310	N	0.999998	B;B;B;B;B	0.09022	0.0;0.002;0.001;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.001;0.001;0.001;0.0	T	0.25467	-1.0131	10	0.02654	T	1	-0.2262	4.116	0.10081	0.42:0.0:0.4083:0.1718	.	574;493;493;574;574	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	A	574;574;574;493;493;493	ENSP00000261503:T574A;ENSP00000378900:T574A;ENSP00000378893:T493A;ENSP00000378896:T493A	ENSP00000261503:T574A	T	+	1	0	SPECC1	20049674	0.039000	0.19947	0.000000	0.03702	0.001000	0.01503	2.753000	0.47524	0.394000	0.25230	0.533000	0.62120	ACG	.		0.458	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228882436	228882436	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:228882436T>G	ENST00000392056.3	-	7	3180	c.3134A>C	c.(3133-3135)aAg>aCg	p.K1045T	SPHKAP_ENST00000344657.5_Missense_Mutation_p.K1045T	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1045						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GTTCATGATCTTGGCTGCCAC	0.517																																					p.K1045T		.											.	SPHKAP	167	0			c.A3134C						.						84.0	79.0	81.0					2																	228882436		2203	4300	6503	SO:0001583	missense	80309	exon7			ATGATCTTGGCTG		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3134A>C	2.37:g.228882436T>G	ENSP00000375909:p.Lys1045Thr	84.0	0.0		98.0	24.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	37	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	18.17	3.565446	0.65651	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.18960	2.18;2.19	6.08	4.93	0.64822	.	0.086238	0.85682	D	0.000000	T	0.33000	0.0848	L	0.29908	0.895	0.49582	D	0.999805	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.83275	0.962;0.928;0.996	T	0.06954	-1.0798	10	0.72032	D	0.01	.	11.239	0.48958	0.0:0.0706:0.0:0.9294	.	76;1045;1045	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	T	1045	ENSP00000375909:K1045T;ENSP00000339886:K1045T	ENSP00000339886:K1045T	K	-	2	0	SPHKAP	228590680	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.291000	0.59025	1.134000	0.42165	0.533000	0.62120	AAG	.		0.517	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
SRRM4	84530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	119563215	119563215	+	Missense_Mutation	SNP	G	G	A	rs550204730		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr12:119563215G>A	ENST00000267260.4	+	7	933	c.545G>A	c.(544-546)cGc>cAc	p.R182H	SRRM4_ENST00000537597.1_3'UTR	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	182	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)	p.R182H(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						AAGTCTCACCGCCACCGCCAT	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		15184	0.0		0.0	False		,,,				2504	0.001				p.R182H		.											.	SRRM4	2	1	Substitution - Missense(1)	large_intestine(1)	c.G545A						.						38.0	49.0	45.0					12																	119563215		2004	4161	6165	SO:0001583	missense	84530	exon7			CTCACCGCCACCG	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.545G>A	12.37:g.119563215G>A	ENSP00000267260:p.Arg182His	70.0	0.0		72.0	23.0	NM_194286	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679542	0.68042	.	.	ENSG00000139767	ENST00000267260	T	0.32515	1.45	5.66	5.66	0.87406	.	0.068529	0.64402	D	0.000014	T	0.50326	0.1609	L	0.53249	1.67	0.42620	D	0.993344	D	0.89917	1.0	D	0.85130	0.997	T	0.36578	-0.9742	10	0.36615	T	0.2	-20.2207	15.2504	0.73539	0.0:0.0:1.0:0.0	.	182	A7MD48	SRRM4_HUMAN	H	182	ENSP00000267260:R182H	ENSP00000267260:R182H	R	+	2	0	SRRM4	118047598	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.257000	0.51500	2.648000	0.89879	0.655000	0.94253	CGC	.		0.602	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
SSR3	6747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	156266720	156266720	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:156266720C>A	ENST00000265044.2	-	3	427	c.333G>T	c.(331-333)aaG>aaT	p.K111N	SSR3_ENST00000467789.1_Missense_Mutation_p.K111N|SSR3_ENST00000478842.1_5'UTR|SSR3_ENST00000476217.1_Missense_Mutation_p.K111N|SSR3_ENST00000496050.1_Missense_Mutation_p.K59N|SSR3_ENST00000463503.1_Missense_Mutation_p.K59N	NM_007107.3	NP_009038.1	Q9UNL2	SSRG_HUMAN	signal sequence receptor, gamma (translocon-associated protein gamma)	111					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	integral component of endoplasmic reticulum membrane (GO:0030176)|Sec61 translocon complex (GO:0005784)				endometrium(1)|prostate(2)	3			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TCCGAGACATCTTTCTATTAT	0.358																																					p.K111N		.											.	SSR3	90	0			c.G333T						.						91.0	90.0	90.0					3																	156266720		2203	4300	6503	SO:0001583	missense	6747	exon3			AGACATCTTTCTA	BC017203	CCDS3176.1	3q25.31	2004-02-27			ENSG00000114850	ENSG00000114850			11325	protein-coding gene	gene with protein product		606213					Standard	NM_007107		Approved	TRAPG	uc003fau.3	Q9UNL2	OTTHUMG00000158632	ENST00000265044.2:c.333G>T	3.37:g.156266720C>A	ENSP00000265044:p.Lys111Asn	60.0	0.0		71.0	19.0	NM_007107	B2R7D0|B4E2P2|D3DNK5|Q549M4	Missense_Mutation	SNP	ENST00000265044.2	37	CCDS3176.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712930	0.89112	.	.	ENSG00000114850	ENST00000265044;ENST00000467789;ENST00000476217;ENST00000463503;ENST00000496050	.	.	.	5.41	5.41	0.78517	.	0.046835	0.85682	D	0.000000	D	0.85923	0.5810	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.91635	0.954;0.999	D	0.88349	0.2980	9	0.87932	D	0	-20.4262	19.5475	0.95305	0.0:1.0:0.0:0.0	.	111;111	B4E2P2;Q9UNL2	.;SSRG_HUMAN	N	111;111;111;59;59	.	ENSP00000265044:K111N	K	-	3	2	SSR3	157749414	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.174000	0.50847	2.680000	0.91292	0.650000	0.86243	AAG	.		0.358	SSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351521.1	NM_007107	
ST7-OT4	338069	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	116596768	116596768	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr7:116596768A>G	ENST00000397750.3	+	4	902	c.361A>G	c.(361-363)Ata>Gta	p.I121V	ST7_ENST00000323984.3_Intron|ST7_ENST00000393451.3_Intron|ST7_ENST00000393449.1_Intron|ST7-AS1_ENST00000456775.1_RNA|ST7_ENST00000393446.2_Intron|ST7-OT4_ENST00000466018.1_Intron|ST7_ENST00000265437.5_Intron|ST7-OT4_ENST00000397751.1_Missense_Mutation_p.I121V					ST7 overlapping transcript 4																		TCATTTGATCATATTTTATGG	0.318																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	338069	.			TTGATCATATTTT	BM413623		7q31.2	2013-03-06	2013-03-06	2011-08-19	ENSG00000214188	ENSG00000214188		"""Long non-coding RNAs"", ""-"""	18835	other	unknown	"""non-protein coding RNA 42"""		"""ST7 overlapping transcript 4 (non-protein coding)"""	ST7OT4		12213198	Standard	NR_002329		Approved	NCRNA00042	uc003vip.1		OTTHUMG00000063631	ENST00000397750.3:c.361A>G	7.37:g.116596768A>G	ENSP00000380858:p.Ile121Val	60.0	0.0		65.0	21.0	.		RNA	SNP	ENST00000397750.3	37		.	.	.	.	.	.	.	.	.	.	A	8.760	0.923261	0.18056	.	.	ENSG00000214188	ENST00000397750;ENST00000397751	.	.	.	3.13	-3.35	0.04928	.	.	.	.	.	T	0.25121	0.0610	.	.	.	0.09310	N	1	B	0.20988	0.05	B	0.23574	0.047	T	0.34229	-0.9837	7	0.87932	D	0	.	0.5356	0.00636	0.3553:0.1795:0.1145:0.3507	.	121	A8MTU0	.	V	121	.	ENSP00000380858:I121V	I	+	1	0	ST7OT4	116384004	0.000000	0.05858	0.000000	0.03702	0.648000	0.38561	-0.276000	0.08514	-0.635000	0.05531	0.482000	0.46254	ATA	.		0.318	ST7-OT4-001	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000137763.3	NR_002329	
STAB2	55576	broad.mit.edu;bcgsc.ca	37	12	104060114	104060114	+	Missense_Mutation	SNP	G	G	A	rs147674384		TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr12:104060114G>A	ENST00000388887.2	+	19	2272	c.2068G>A	c.(2068-2070)Gct>Act	p.A690T	RP11-341G23.3_ENST00000550175.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CAGATGTCCTGCTAACTCTGA	0.542																																					p.A690T		.											.	STAB2	104	0			c.G2068A						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	153.0	117.0	129.0		2068	2.2	0.0	12	dbSNP_134	129	0,8600		0,0,4300	no	missense	STAB2	NM_017564.9	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	690/2552	104060114	1,13005	2203	4300	6503	SO:0001583	missense	55576	exon19			TGTCCTGCTAACT	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.2068G>A	12.37:g.104060114G>A	ENSP00000373539:p.Ala690Thr	122.0	1.0		142.0	7.0	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	1.367	-0.587234	0.03799	2.27E-4	0.0	ENSG00000136011	ENST00000388887	T	0.62941	-0.01	5.11	2.19	0.27852	.	0.433757	0.22445	N	0.059964	T	0.45135	0.1327	L	0.37750	1.13	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.25187	-1.0139	10	0.13108	T	0.6	.	7.7809	0.29064	0.0876:0.2907:0.6217:0.0	.	690	Q8WWQ8	STAB2_HUMAN	T	690	ENSP00000373539:A690T	ENSP00000373539:A690T	A	+	1	0	STAB2	102584244	0.085000	0.21516	0.044000	0.18714	0.067000	0.16453	1.825000	0.39081	0.156000	0.19299	-1.217000	0.01609	GCT	G|1.000;A|0.000		0.542	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
STIM2	57620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	27024472	27024472	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr4:27024472T>G	ENST00000467087.1	+	12	2623	c.2095T>G	c.(2095-2097)Tcc>Gcc	p.S699A	STIM2_ENST00000382009.3_Missense_Mutation_p.S794A|STIM2_ENST00000465503.1_Missense_Mutation_p.S707A|STIM2_ENST00000237364.5_Missense_Mutation_p.S786A|STIM2_ENST00000412829.2_3'UTR|STIM2_ENST00000467011.1_3'UTR			Q9P246	STIM2_HUMAN	stromal interaction molecule 2	699					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				CACATCATGTTCCTCAGCTGG	0.483																																					p.S707A		.											.	STIM2	91	0			c.T2119G						.						99.0	91.0	94.0					4																	27024472		2203	4300	6503	SO:0001583	missense	57620	exon13			TCATGTTCCTCAG	AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467087.1:c.2095T>G	4.37:g.27024472T>G	ENSP00000419073:p.Ser699Ala	103.0	0.0		118.0	23.0	NM_001169118	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	ENST00000467087.1	37	CCDS3440.2	.	.	.	.	.	.	.	.	.	.	T	13.25	2.180558	0.38511	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000465503	T;T;T;T	0.78126	-1.12;-1.15;-1.15;-1.13	5.87	5.87	0.94306	.	0.113494	0.64402	D	0.000009	T	0.71978	0.3404	L	0.27053	0.805	0.80722	D	1	P;P	0.46859	0.817;0.885	B;P	0.48304	0.369;0.573	T	0.75202	-0.3401	10	0.66056	D	0.02	.	10.8542	0.46789	0.0:0.0701:0.0:0.9299	.	794;786	E9PGD0;F5GXJ4	.;.	A	699;794;786;707	ENSP00000419073:S699A;ENSP00000371439:S794A;ENSP00000237364:S786A;ENSP00000417569:S707A	ENSP00000237364:S786A	S	+	1	0	STIM2	26633570	0.997000	0.39634	0.940000	0.37924	0.939000	0.58152	3.157000	0.50716	2.371000	0.80710	0.533000	0.62120	TCC	.		0.483	STIM2-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215063.2	NM_020860	
TRGC1	6966	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	38305036	38305036	+	RNA	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr7:38305036A>G	ENST00000443402.2	-	0	243					NM_001003799.1|NM_001003806.1	NP_001003799.1|NP_001003806.1	P0CF51	TRGC1_HUMAN	T cell receptor gamma constant 1							integral component of membrane (GO:0016021)											TTCTTTGTCCAGTGACTTTTC	0.408																																					p.L20P		.											.	.	.	0			c.T59C						.						192.0	180.0	184.0					7																	38305036		1844	4101	5945			0	exon2			TTGTCCAGTGACT	M14996		7p14	2012-02-07			ENSG00000211689	ENSG00000211689		"""T cell receptors / TRG locus"""	12275	other	T cell receptor gene	"""T-cell receptor, gamma, constant region C1"""	186970		TCRGC1		2879283	Standard	NG_001336		Approved	C1		P0CF51	OTTHUMG00000155219		7.37:g.38305036A>G		181.0	0.0		240.0	65.0	NM_001003806		Missense_Mutation	SNP	ENST00000443402.2	37																																																																																				.		0.408	TRGC1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TR_C_gene	OTTHUMT00000338825.3	NG_001336	
TAS1R1	80835	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	6635364	6635364	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr1:6635364G>A	ENST00000333172.6	+	3	1365	c.1172G>A	c.(1171-1173)cGg>cAg	p.R391Q	TAS1R1_ENST00000328191.4_Missense_Mutation_p.R391Q|TAS1R1_ENST00000351136.3_Intron	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	391					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		AACGCATACCGGGCTGTGTAT	0.592																																					p.R391Q		.											.	TAS1R1	516	0			c.G1172A						.						52.0	45.0	47.0					1																	6635364		2196	4288	6484	SO:0001583	missense	80835	exon3			CATACCGGGCTGT		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1172G>A	1.37:g.6635364G>A	ENSP00000331867:p.Arg391Gln	117.0	1.0		104.0	30.0	NM_138697	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	ENST00000333172.6	37	CCDS81.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.17|11.17	1.559898|1.559898	0.27827|0.27827	.|.	.|.	ENSG00000173662|ENSG00000173662	ENST00000411823|ENST00000333172;ENST00000328191	.|D;D	.|0.82344	.|-1.6;-1.6	5.39|5.39	-10.8|-10.8	0.00216|0.00216	.|Extracellular ligand-binding receptor (1);	.|1.042410	.|0.07523	.|N	.|0.910958	T|T	0.58148|0.58148	0.2102|0.2102	N|N	0.04355|0.04355	-0.22|-0.22	0.09310|0.09310	N|N	1|1	.|B;B	.|0.15473	.|0.013;0.001	.|B;B	.|0.08055	.|0.003;0.003	T|T	0.48927|0.48927	-0.8991|-0.8991	5|10	.|0.20519	.|T	.|0.43	.|.	12.7742|12.7742	0.57437|0.57437	0.1853:0.1712:0.6435:0.0|0.1853:0.1712:0.6435:0.0	.|.	.|391;391	.|Q7RTX1-3;Q7RTX1	.|.;TS1R1_HUMAN	R|Q	317|391	.|ENSP00000331867:R391Q;ENSP00000327705:R391Q	.|ENSP00000327705:R391Q	G|R	+|+	1|2	0|0	TAS1R1|TAS1R1	6557951|6557951	0.000000|0.000000	0.05858|0.05858	0.010000|0.010000	0.14722|0.14722	0.432000|0.432000	0.31715|0.31715	-0.292000|-0.292000	0.08332|0.08332	-1.775000|-1.775000	0.01287|0.01287	-0.423000|-0.423000	0.05987|0.05987	GGG|CGG	.		0.592	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
TET3	200424	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	74275063	74275063	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr2:74275063G>C	ENST00000409262.3	+	1	1614	c.1614G>C	c.(1612-1614)agG>agC	p.R538S		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	538					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GTCCCTCCAGGGACAGCCTGC	0.647																																					p.R538S		.											.	.	.	0			c.G1614C						.						24.0	26.0	25.0					2																	74275063		1969	4152	6121	SO:0001583	missense	200424	exon1			CTCCAGGGACAGC		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.1614G>C	2.37:g.74275063G>C	ENSP00000386869:p.Arg538Ser	101.0	0.0		135.0	7.0	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	37	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	G	7.786	0.710455	0.15239	.	.	ENSG00000187605	ENST00000305799;ENST00000409262;ENST00000233310	T;T	0.21361	2.01;2.81	5.29	5.29	0.74685	.	.	.	.	.	T	0.11665	0.0284	N	0.08118	0	0.26247	N	0.978788	B	0.06786	0.001	B	0.06405	0.002	T	0.10382	-1.0632	9	0.09338	T	0.73	.	15.9628	0.79945	0.0:0.0:1.0:0.0	.	538	O43151	TET3_HUMAN	S	580;538;538	ENSP00000307803:R580S;ENSP00000386869:R538S	ENSP00000233310:R538S	R	+	3	2	TET3	74128571	0.862000	0.29867	1.000000	0.80357	0.993000	0.82548	2.284000	0.43478	2.746000	0.94184	0.591000	0.81541	AGG	.		0.647	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
TG	7038	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133953779	133953779	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:133953779T>C	ENST00000220616.4	+	26	5265	c.5225T>C	c.(5224-5226)gTt>gCt	p.V1742A	TG_ENST00000542445.1_Intron|TG_ENST00000377869.1_Missense_Mutation_p.V1685A	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1742					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CTCACACAGGTTCAAGGAGGT	0.557																																					p.V1742A		.											.	TG	145	0			c.T5225C						.						123.0	98.0	107.0					8																	133953779		2203	4300	6503	SO:0001583	missense	7038	exon26			CACAGGTTCAAGG	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.5225T>C	8.37:g.133953779T>C	ENSP00000220616:p.Val1742Ala	233.0	1.0		286.0	78.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	T	11.95	1.791056	0.31685	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	T;T	0.70282	-0.47;-0.47	5.61	5.61	0.85477	.	1.168690	0.06284	N	0.698043	T	0.70281	0.3206	M	0.63428	1.95	0.09310	N	1	B	0.31026	0.304	B	0.24394	0.053	T	0.61633	-0.7023	10	0.87932	D	0	.	12.1945	0.54290	0.0:0.0:0.0:1.0	.	1742	P01266	THYG_HUMAN	A	1685;548;1742	ENSP00000367100:V1685A;ENSP00000220616:V1742A	ENSP00000220616:V1742A	V	+	2	0	TG	134022961	0.253000	0.23982	0.037000	0.18230	0.418000	0.31294	2.280000	0.43443	2.142000	0.66516	0.379000	0.24179	GTT	.		0.557	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TLE1	7088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	84208092	84208092	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr9:84208092G>A	ENST00000376499.3	-	15	2493	c.1429C>T	c.(1429-1431)Cag>Tag	p.Q477*		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	477					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GTGTTGATCTGGCGAGCATGC	0.617																																					p.Q477X	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	.											.	TLE1	92	0			c.C1429T						.						121.0	114.0	116.0					9																	84208092		2203	4300	6503	SO:0001587	stop_gained	7088	exon15			TGATCTGGCGAGC		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1429C>T	9.37:g.84208092G>A	ENSP00000365682:p.Gln477*	129.0	0.0		154.0	56.0	NM_005077	A8K495|Q5T3G4|Q969V9	Nonsense_Mutation	SNP	ENST00000376499.3	37	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	g	49	14.973096	0.99817	.	.	ENSG00000196781	ENST00000376499	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.5744	20.422	0.99049	0.0:0.0:1.0:0.0	.	.	.	.	X	477	.	ENSP00000365682:Q477X	Q	-	1	0	TLE1	83397912	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.832000	0.97577	0.655000	0.94253	CAG	.		0.617	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	
TRAPPC8	22878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	29419280	29419280	+	Silent	SNP	T	T	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr18:29419280T>C	ENST00000283351.4	-	27	4313	c.3978A>G	c.(3976-3978)caA>caG	p.Q1326Q	TRAPPC8_ENST00000582539.1_Silent_p.Q1272Q	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1326					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAAACCTTTTTTGATGAAATG	0.338																																					p.Q1326Q		.											.	TRAPPC8	159	0			c.A3978G						.						92.0	96.0	95.0					18																	29419280		2203	4300	6503	SO:0001819	synonymous_variant	22878	exon27			CCTTTTTTGATGA	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3978A>G	18.37:g.29419280T>C		41.0	0.0		50.0	19.0	NM_014939	A0JP15|B3KME5|Q9H0L2	Silent	SNP	ENST00000283351.4	37	CCDS11901.1																																																																																			.		0.338	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
UBA1	7317	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	47072228	47072228	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chrX:47072228A>G	ENST00000335972.6	+	22	2795	c.2612A>G	c.(2611-2613)gAa>gGa	p.E871G	UBA1_ENST00000377351.4_Missense_Mutation_p.E871G|UBA1_ENST00000377269.3_Missense_Mutation_p.E319G	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	871					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTCCGGGCAGAAAACTATGAC	0.512																																					p.E871G		.											.	UBA1	227	0			c.A2612G						.						84.0	68.0	74.0					X																	47072228		2203	4300	6503	SO:0001583	missense	7317	exon22			GGGCAGAAAACTA	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.2612A>G	X.37:g.47072228A>G	ENSP00000338413:p.Glu871Gly	316.0	1.0		376.0	95.0	NM_153280	Q5JRR8|Q96E13	Missense_Mutation	SNP	ENST00000335972.6	37	CCDS14275.1	.	.	.	.	.	.	.	.	.	.	A	15.90	2.969331	0.53614	.	.	ENSG00000130985	ENST00000377351;ENST00000335972;ENST00000377269	T;T;T	0.47528	0.84;0.84;0.84	4.97	4.97	0.65823	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.000000	0.85682	D	0.000000	T	0.53594	0.1806	M	0.87682	2.9	0.58432	D	0.999999	B;B	0.30605	0.287;0.096	B;B	0.31191	0.125;0.049	T	0.56679	-0.7939	10	0.37606	T	0.19	-21.5123	12.9244	0.58252	1.0:0.0:0.0:0.0	.	319;871	Q5JRR6;P22314	.;UBA1_HUMAN	G	871;871;319	ENSP00000366568:E871G;ENSP00000338413:E871G;ENSP00000366481:E319G	ENSP00000338413:E871G	E	+	2	0	UBA1	46957172	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.930000	0.92872	1.760000	0.52011	0.425000	0.28330	GAA	.		0.512	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334	
UGT2B4	7363	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	70360887	70360889	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr4:70360887_70360889delCTT	ENST00000305107.6	-	1	737_739	c.691_693delAAG	c.(691-693)aagdel	p.K231del	UGT2B4_ENST00000512583.1_In_Frame_Del_p.K231del|UGT2B4_ENST00000506580.1_Intron|UGT2B4_ENST00000381096.3_In_Frame_Del_p.K95del	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	231					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	ACTGATCCCACTTCTTCATGTCA	0.32																																					p.231_231del		.											.	UGT2B4	92	0			c.691_693del						.																																			SO:0001651	inframe_deletion	7363	exon1			ATCCCACTTCTTC	BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.691_693delAAG	4.37:g.70360890_70360892delCTT	ENSP00000305221:p.Lys231del	105.0	0.0		99.0	15.0	NM_021139	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	In_Frame_Del	DEL	ENST00000305107.6	37	CCDS43234.1																																																																																			.		0.320	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365526.1	NM_021139	
USP1	7398	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	62913095	62913095	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr1:62913095A>G	ENST00000339950.4	+	7	2148	c.1333A>G	c.(1333-1335)Agt>Ggt	p.S445G	USP1_ENST00000371146.1_Missense_Mutation_p.S445G	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	445	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		GGAATGTGAAAGTTTAACAGA	0.368																																					p.S445G	Ovarian(122;1846 2315 3982 19504)	.											.	USP1	659	0			c.A1333G						.						128.0	128.0	128.0					1																	62913095		2203	4300	6503	SO:0001583	missense	7398	exon7			TGTGAAAGTTTAA		CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.1333A>G	1.37:g.62913095A>G	ENSP00000343526:p.Ser445Gly	94.0	0.0		103.0	9.0	NM_001017415	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	ENST00000339950.4	37	CCDS621.1	.	.	.	.	.	.	.	.	.	.	A	18.79	3.699753	0.68501	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.30981	1.51;1.51	5.79	4.6	0.57074	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.137895	0.64402	D	0.000003	T	0.31040	0.0784	N	0.25890	0.77	0.35654	D	0.812016	D	0.54964	0.969	P	0.56163	0.793	T	0.24977	-1.0145	10	0.27082	T	0.32	-13.7836	9.0434	0.36331	0.6765:0.0:0.0:0.3235	.	445	O94782	UBP1_HUMAN	G	445	ENSP00000360188:S445G;ENSP00000343526:S445G	ENSP00000343526:S445G	S	+	1	0	USP1	62685683	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.157000	0.58144	2.215000	0.71742	0.528000	0.53228	AGT	.		0.368	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024881.1	NM_001017415	
USP42	84132	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	6194392	6194392	+	Silent	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr7:6194392C>T	ENST00000306177.5	+	15	3365	c.3207C>T	c.(3205-3207)taC>taT	p.Y1069Y		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	1069	Arg-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		ACGCCCTGTACGCTGCCCGGG	0.711																																					p.Y1069Y		.											.	USP42	659	0			c.C3207T						.						7.0	9.0	9.0					7																	6194392		1986	4093	6079	SO:0001819	synonymous_variant	84132	exon15			CCTGTACGCTGCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.3207C>T	7.37:g.6194392C>T		21.0	0.0		14.0	4.0	NM_032172	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	ENST00000306177.5	37	CCDS47535.1																																																																																			.		0.711	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
VEZT	55591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	95676231	95676231	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr12:95676231G>T	ENST00000436874.1	+	8	1244	c.1139G>T	c.(1138-1140)gGt>gTt	p.G380V	VEZT_ENST00000261219.6_Missense_Mutation_p.G332V|VEZT_ENST00000356859.4_3'UTR	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	380					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						GTGACTCAAGGTCTACCTCAT	0.468																																					p.G380V		.											.	VEZT	23	0			c.G1139T						.						185.0	175.0	178.0					12																	95676231		1978	4179	6157	SO:0001583	missense	55591	exon8			CTCAAGGTCTACC	AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.1139G>T	12.37:g.95676231G>T	ENSP00000410083:p.Gly380Val	107.0	1.0		148.0	32.0	NM_017599	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	ENST00000436874.1	37	CCDS44954.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754918	0.69648	.	.	ENSG00000028203	ENST00000436874;ENST00000261219;ENST00000397792;ENST00000397796	T;T;T	0.14893	2.47;2.47;2.47	5.7	5.7	0.88788	.	0.167807	0.53938	D	0.000041	T	0.32194	0.0821	L	0.51422	1.61	0.80722	D	1	D	0.69078	0.997	D	0.67900	0.954	T	0.00802	-1.1560	10	0.25751	T	0.34	-27.629	13.078	0.59097	0.0732:0.0:0.9268:0.0	.	380	Q9HBM0	VEZA_HUMAN	V	380;332;336;380	ENSP00000410083:G380V;ENSP00000261219:G332V;ENSP00000380894:G336V	ENSP00000261219:G332V	G	+	2	0	VEZT	94200362	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.342000	0.59341	2.680000	0.91292	0.561000	0.74099	GGT	.		0.468	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407804.2	NM_017599	
YIPF3	25844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43480544	43480544	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr6:43480544G>C	ENST00000372422.2	-	7	917	c.735C>G	c.(733-735)ttC>ttG	p.F245L	YIPF3_ENST00000506469.1_Missense_Mutation_p.F251L|LRRC73_ENST00000372441.1_5'Flank	NM_015388.3	NP_056203.2	Q9GZM5	YIPF3_HUMAN	Yip1 domain family, member 3	245					cell differentiation (GO:0030154)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			AGAAGAGGTAGAAGAGGGCGT	0.557																																					p.F245L		.											.	YIPF3	90	0			c.C735G						.						101.0	86.0	91.0					6																	43480544		2203	4300	6503	SO:0001583	missense	25844	exon7			GAGGTAGAAGAGG	AK000946	CCDS4899.1	6p21.1	2009-10-06	2005-07-04	2005-07-04	ENSG00000137207	ENSG00000137207		"""Yip1 domain family"""	21023	protein-coding gene	gene with protein product		609775	"""chromosome 6 open reading frame 109"""	C6orf109			Standard	NM_015388		Approved	DKFZp566C243, KLIP1, dJ337H4.3, FinGER3	uc003ovl.2	Q9GZM5	OTTHUMG00000014738	ENST00000372422.2:c.735C>G	6.37:g.43480544G>C	ENSP00000361499:p.Phe245Leu	155.0	0.0		190.0	37.0	NM_015388	Q5JTD2|Q6FI85|Q8NI57|Q9NWE3|Q9Y3U9	Missense_Mutation	SNP	ENST00000372422.2	37	CCDS4899.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027438	0.75390	.	.	ENSG00000137207	ENST00000372422;ENST00000506469;ENST00000503972	T;T;T	0.48836	0.81;0.8;1.02	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.59649	0.2209	M	0.73962	2.25	0.80722	D	1	D;D;D	0.56035	0.974;0.974;0.974	D;D;D	0.70487	0.969;0.953;0.969	T	0.64702	-0.6345	10	0.87932	D	0	-16.1626	11.9234	0.52806	0.1263:0.0:0.8737:0.0	.	251;210;245	E7EQR8;Q5JTD5;Q9GZM5	.;.;YIPF3_HUMAN	L	245;251;211	ENSP00000361499:F245L;ENSP00000425494:F251L;ENSP00000421461:F211L	ENSP00000361499:F245L	F	-	3	2	YIPF3	43588522	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.644000	0.61397	2.467000	0.83353	0.563000	0.77884	TTC	.		0.557	YIPF3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040639.2	NM_015388	
ZAR1L	646799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	32878064	32878064	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr13:32878064G>C	ENST00000533490.2	-	6	1336	c.918C>G	c.(916-918)gaC>gaG	p.D306E	ZAR1L_ENST00000345108.6_Missense_Mutation_p.D306E			A6NP61	ZAR1L_HUMAN	zygote arrest 1-like	306						cytoplasm (GO:0005737)				NS(1)|kidney(1)	2						AGAATCTCTTGTCTTTGCAGC	0.428																																					p.D306E		.											.	ZAR1L	68	0			c.C918G						.						131.0	105.0	113.0					13																	32878064		692	1591	2283	SO:0001583	missense	646799	exon4			TCTCTTGTCTTTG		CCDS45023.1	13q13.1	2014-02-20			ENSG00000189167	ENSG00000189167			37116	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 7"""					18442940	Standard	NM_001136571		Approved	Z3CXXC7	uc010abc.1	A6NP61	OTTHUMG00000016694	ENST00000533490.2:c.918C>G	13.37:g.32878064G>C	ENSP00000437289:p.Asp306Glu	108.0	0.0		89.0	7.0	NM_001136571	B2RV03|B7ZBU2	Missense_Mutation	SNP	ENST00000533490.2	37	CCDS45023.1	.	.	.	.	.	.	.	.	.	.	G	16.99	3.274874	0.59649	.	.	ENSG00000189167	ENST00000345108	T	0.21361	2.01	5.61	3.77	0.43336	.	0.211497	0.40222	N	0.001153	T	0.28200	0.0696	L	0.40543	1.245	0.26185	N	0.979676	D	0.54964	0.969	P	0.56278	0.795	T	0.03545	-1.1026	10	0.40728	T	0.16	-24.6654	10.6721	0.45764	0.0715:0.1329:0.7956:0.0	.	306	A6NP61	ZAR1L_HUMAN	E	306	ENSP00000344616:D306E	ENSP00000344616:D306E	D	-	3	2	ZAR1L	31776064	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.752000	0.38349	1.378000	0.46305	0.563000	0.77884	GAC	.		0.428	ZAR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044403.5		
ZCCHC2	54877	broad.mit.edu;ucsc.edu;mdanderson.org	37	18	60225965	60225965	+	Nonsense_Mutation	SNP	T	T	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr18:60225965T>G	ENST00000269499.5	+	7	1872	c.1454T>G	c.(1453-1455)tTa>tGa	p.L485*	ZCCHC2_ENST00000586834.1_Nonsense_Mutation_p.L164*	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	485						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						TTAGAACACTTAAAAGAAGAC	0.328																																					p.L485X		.											.	ZCCHC2	432	0			c.T1454G						.						35.0	32.0	33.0					18																	60225965		1783	4028	5811	SO:0001587	stop_gained	54877	exon7			AACACTTAAAAGA	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.1454T>G	18.37:g.60225965T>G	ENSP00000269499:p.Leu485*	131.0	2.0		133.0	46.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Nonsense_Mutation	SNP	ENST00000269499.5	37	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	T	38	6.772366	0.97829	.	.	ENSG00000141664	ENST00000269499	.	.	.	5.85	5.85	0.93711	.	0.387780	0.21894	N	0.067547	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6887	15.2201	0.73306	0.0:0.0:0.0:1.0	.	.	.	.	X	485	.	ENSP00000269499:L485X	L	+	2	0	ZCCHC2	58376945	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.887000	0.63156	2.222000	0.72286	0.533000	0.62120	TTA	.		0.328	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
ZIC1	7545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	147128637	147128637	+	Silent	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr3:147128637C>T	ENST00000282928.4	+	1	1467	c.738C>T	c.(736-738)ttC>ttT	p.F246F		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	246					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						ACAAAACTTTCAGCACCATGC	0.572																																					p.F246F		.											.	ZIC1	91	0			c.C738T						.						93.0	86.0	89.0					3																	147128637		2203	4300	6503	SO:0001819	synonymous_variant	7545	exon1			AACTTTCAGCACC	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.738C>T	3.37:g.147128637C>T		153.0	0.0		184.0	46.0	NM_003412	Q2M3N1	Silent	SNP	ENST00000282928.4	37	CCDS3136.1																																																																																			.		0.572	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
ZMAT4	79698	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	40532341	40532341	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr8:40532341C>T	ENST00000297737.6	-	5	605	c.459G>A	c.(457-459)tgG>tgA	p.W153*	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	153						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			GGTTATTAAACCAGGCTGCAC	0.502																																					p.W153X		.											.	ZMAT4	92	0			c.G459A						.						202.0	198.0	199.0					8																	40532341		2203	4300	6503	SO:0001587	stop_gained	79698	exon5			ATTAAACCAGGCT	AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.459G>A	8.37:g.40532341C>T	ENSP00000297737:p.Trp153*	104.0	1.0		128.0	27.0	NM_024645	Q8WUT8	Nonsense_Mutation	SNP	ENST00000297737.6	37	CCDS34885.1	.	.	.	.	.	.	.	.	.	.	C	36	5.850350	0.97023	.	.	ENSG00000165061	ENST00000297737;ENST00000519406	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-17.0863	18.9244	0.92538	0.0:1.0:0.0:0.0	.	.	.	.	X	153	.	ENSP00000297737:W153X	W	-	3	0	ZMAT4	40651498	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	7.376000	0.79658	2.817000	0.96982	0.557000	0.71058	TGG	.		0.502	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376950.1	NM_024645	
ZNF141	7700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	366775	366775	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr4:366775T>A	ENST00000240499.7	+	4	698	c.549T>A	c.(547-549)ttT>ttA	p.F183L	ZNF141_ENST00000512994.1_Missense_Mutation_p.F183L|ZNF141_ENST00000505939.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	183					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						TTCAGAAGTTTTCACACCTAA	0.333																																					p.F183L		.											.	ZNF141	90	0			c.T549A						.						70.0	74.0	73.0					4																	366775		2203	4300	6503	SO:0001583	missense	7700	exon4			GAAGTTTTCACAC	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.549T>A	4.37:g.366775T>A	ENSP00000240499:p.Phe183Leu	64.0	0.0		85.0	20.0	NM_003441	Q6DK07	Missense_Mutation	SNP	ENST00000240499.7	37	CCDS33931.1	.	.	.	.	.	.	.	.	.	.	T	0.635	-0.815479	0.02776	.	.	ENSG00000131127	ENST00000512994;ENST00000240499	T;T	0.26660	7.3;1.72	1.23	-2.46	0.06461	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08935	0.0221	N	0.10760	0.04	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.33701	-0.9858	9	0.10902	T	0.67	.	3.277	0.06902	0.2426:0.5471:0.0:0.2104	.	183;183	D6RIY0;Q15928	.;ZN141_HUMAN	L	183	ENSP00000425799:F183L;ENSP00000240499:F183L	ENSP00000240499:F183L	F	+	3	2	ZNF141	356775	.	.	0.001000	0.08648	0.014000	0.08584	.	.	-1.419000	0.02012	-0.756000	0.03474	TTT	.		0.333	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
ZNF441	126068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11892231	11892231	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:11892231A>G	ENST00000357901.4	+	4	1694	c.1592A>G	c.(1591-1593)tAt>tGt	p.Y531C	ZNF441_ENST00000454339.2_Missense_Mutation_p.Y464C	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GAGAGACCCTATAAGTGTAAA	0.418																																					p.Y531C		.											.	ZNF441	69	0			c.A1592G						.						50.0	52.0	51.0					19																	11892231		2203	4299	6502	SO:0001583	missense	126068	exon4			GACCCTATAAGTG	AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.1592A>G	19.37:g.11892231A>G	ENSP00000350576:p.Tyr531Cys	38.0	0.0		42.0	10.0	NM_152355		Missense_Mutation	SNP	ENST00000357901.4	37	CCDS12266.2	.	.	.	.	.	.	.	.	.	.	-	14.46	2.540618	0.45280	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	T;T	0.25414	1.8;1.8	1.22	0.153	0.14897	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26340	0.0643	M	0.75085	2.285	0.09310	N	1	P	0.46220	0.874	B	0.42738	0.396	T	0.23368	-1.0190	9	0.87932	D	0	.	2.1633	0.03830	0.3523:0.0:0.3807:0.2669	.	531	Q8N8Z8	ZN441_HUMAN	C	487;531;464	ENSP00000350576:Y531C;ENSP00000403738:Y464C	ENSP00000350576:Y531C	Y	+	2	0	ZNF441	11753231	0.001000	0.12720	0.015000	0.15790	0.883000	0.51084	0.225000	0.17757	-0.012000	0.14223	0.254000	0.18369	TAT	.		0.418	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335273.3	NM_152355	
ZNF430	80264	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	21240807	21240807	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:21240807A>G	ENST00000261560.5	+	5	1874	c.1693A>G	c.(1693-1695)Aga>Gga	p.R565G	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	565					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						TTCATACTGGAGAGAAACCCT	0.388																																					p.R565G		.											.	ZNF430	516	0			c.A1693G						.						29.0	32.0	31.0					19																	21240807		2157	4271	6428	SO:0001583	missense	80264	exon5			TACTGGAGAGAAA	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.1693A>G	19.37:g.21240807A>G	ENSP00000261560:p.Arg565Gly	25.0	0.0		19.0	11.0	NM_025189	Q86V70	Missense_Mutation	SNP	ENST00000261560.5	37	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	8.708	0.911376	0.17833	.	.	ENSG00000118620	ENST00000261560	T	0.05580	3.42	0.381	0.381	0.16228	.	.	.	.	.	T	0.01320	0.0043	N	0.00500	-1.43	0.27793	N	0.942753	B;B	0.17038	0.02;0.0	B;B	0.04013	0.001;0.0	T	0.46665	-0.9175	9	0.02654	T	1	.	4.4892	0.11805	0.6706:0.3294:0.0:0.0	.	564;565	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	G	565	ENSP00000261560:R565G	ENSP00000261560:R565G	R	+	1	2	ZNF430	21032647	0.109000	0.22037	0.594000	0.28785	0.566000	0.35808	-1.489000	0.02306	0.378000	0.24764	0.369000	0.22263	AGA	.		0.388	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
ZNF536	9745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	31038889	31038889	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:31038889G>A	ENST00000355537.3	+	4	2510	c.2363G>A	c.(2362-2364)gGc>gAc	p.G788D		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	788					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GACTATGCCGGCACGCAGTCA	0.507																																					p.G788D		.											.	ZNF536	144	0			c.G2363A						.						65.0	69.0	68.0					19																	31038889		2203	4300	6503	SO:0001583	missense	9745	exon4			ATGCCGGCACGCA		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2363G>A	19.37:g.31038889G>A	ENSP00000347730:p.Gly788Asp	85.0	0.0		79.0	14.0	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072364	0.76415	.	.	ENSG00000198597	ENST00000355537	T	0.18338	2.22	6.08	6.08	0.98989	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.35158	0.0922	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00998	-1.1486	10	0.51188	T	0.08	-33.1648	20.6721	0.99693	0.0:0.0:1.0:0.0	.	788;788	A7E228;O15090	.;ZN536_HUMAN	D	788	ENSP00000347730:G788D	ENSP00000347730:G788D	G	+	2	0	ZNF536	35730729	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.467000	0.97671	2.894000	0.99253	0.591000	0.81541	GGC	.		0.507	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ZNF175	7728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52090484	52090484	+	Silent	SNP	T	T	A			TCGA-FV-A495-01A-11D-A25V-10	TCGA-FV-A495-10A-01D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	84fe77b4-f6cc-49bf-a6b9-1621ec9394f8	88a0f90d-e075-45da-b4bf-8dfc9fd6b6a8	g.chr19:52090484T>A	ENST00000262259.2	+	5	1258	c.900T>A	c.(898-900)atT>atA	p.I300I	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	300					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		AACAGAGAATTCATAGTGTAG	0.423																																					p.I300I		.											.	ZNF175	90	0			c.T900A						.						97.0	100.0	99.0					19																	52090484		2203	4299	6502	SO:0001819	synonymous_variant	7728	exon5			GAGAATTCATAGT	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.900T>A	19.37:g.52090484T>A		102.0	0.0		131.0	33.0	NM_007147	A8K9H2	Silent	SNP	ENST00000262259.2	37	CCDS12837.1																																																																																			.		0.423	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396205.1	NM_007147	
