#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADCY4	196883	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	24802167	24802167	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr14:24802167T>C	ENST00000310677.4	-	3	300	c.187A>G	c.(187-189)Acc>Gcc	p.T63A	ADCY4_ENST00000396747.3_5'UTR|ADCY4_ENST00000554068.2_Missense_Mutation_p.T63A|RP11-934B9.3_ENST00000555591.1_Missense_Mutation_p.D129G|ADCY4_ENST00000558563.1_5'UTR|ADCY4_ENST00000418030.2_Missense_Mutation_p.T63A	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	63					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		AGCACAGTGGTCAGGAAGCTC	0.637											OREG0022624	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T63A		.											.	ADCY4	93	0			c.A187G						.						28.0	37.0	34.0					14																	24802167		2203	4300	6503	SO:0001583	missense	196883	exon3			CAGTGGTCAGGAA	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.187A>G	14.37:g.24802167T>C	ENSP00000312126:p.Thr63Ala	174.0	0.0	774	63.0	12.0	NM_001198592	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	ENST00000310677.4	37	CCDS9627.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.53|17.53	3.412633|3.412633	0.62511|0.62511	.|.	.|.	ENSG00000258973|ENSG00000129467	ENST00000555591|ENST00000310677;ENST00000554068;ENST00000418030	.|T;T;T	.|0.74842	.|-0.88;-0.88;-0.88	5.66|5.66	-1.06|-1.06	0.10002|0.10002	.|.	.|0.706766	.|0.12860	.|N	.|0.433237	T|T	0.39937|0.39937	0.1097|0.1097	N|N	0.02011|0.02011	-0.69|-0.69	0.80722|0.80722	D|D	1|1	.|B;B	.|0.14805	.|0.011;0.0	.|B;B	.|0.14023	.|0.01;0.001	T|T	0.14924|0.14924	-1.0455|-1.0455	5|10	.|0.13470	.|T	.|0.59	.|.	5.3003|5.3003	0.15773|0.15773	0.1456:0.4096:0.0:0.4448|0.1456:0.4096:0.0:0.4448	.|.	.|63;63	.|G3V258;Q8NFM4	.|.;ADCY4_HUMAN	G|A	129|63	.|ENSP00000312126:T63A;ENSP00000452250:T63A;ENSP00000393177:T63A	.|ENSP00000312126:T63A	D|T	-|-	2|1	0|0	RP11-934B9.3|ADCY4	23872007|23872007	0.429000|0.429000	0.25530|0.25530	0.998000|0.998000	0.56505|0.56505	0.988000|0.988000	0.76386|0.76386	-0.503000|-0.503000	0.06383|0.06383	0.112000|0.112000	0.17975|0.17975	0.454000|0.454000	0.30748|0.30748	GAC|ACC	.		0.637	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073200.4		
ANKRD30B	374860	ucsc.edu;bcgsc.ca	37	18	14752857	14752857	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr18:14752857A>G	ENST00000358984.4	+	3	536	c.356A>G	c.(355-357)gAg>gGg	p.E119G	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Missense_Mutation_p.E119G	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	119										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TGCGAGAGGGAGGCTTGTGCA	0.368																																					p.E119G		.											.	ANKRD30B	24	0			c.A356G						.						108.0	90.0	95.0					18																	14752857		692	1591	2283	SO:0001583	missense	374860	exon3			AGAGGGAGGCTTG	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.356A>G	18.37:g.14752857A>G	ENSP00000351875:p.Glu119Gly	58.0	0.0		43.0	5.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	37	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	N	13.75	2.331107	0.41297	.	.	ENSG00000180777	ENST00000358984;ENST00000447268	T;T	0.53640	0.61;0.61	1.61	1.61	0.23674	.	.	.	.	.	T	0.53270	0.1786	L	0.42529	1.33	0.32364	N	0.556719	D	0.69078	0.997	D	0.70487	0.969	T	0.58607	-0.7607	9	0.56958	D	0.05	.	5.3452	0.16006	1.0:0.0:0.0:0.0	.	119	F8WAG3	.	G	119	ENSP00000351875:E119G;ENSP00000399031:E119G	ENSP00000351875:E119G	E	+	2	0	ANKRD30B	14742857	1.000000	0.71417	0.089000	0.20774	0.012000	0.07955	3.415000	0.52700	1.008000	0.39264	0.249000	0.18162	GAG	.		0.368	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21249790	21249790	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr2:21249790A>G	ENST00000233242.1	-	15	2241	c.2114T>C	c.(2113-2115)tTt>tCt	p.F705S	APOB_ENST00000399256.4_Missense_Mutation_p.F705S	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	705					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGCTTCCCAAAAAGAGCTTC	0.418																																					p.F705S		.											.	APOB	175	0			c.T2114C						.						95.0	94.0	94.0					2																	21249790		2203	4300	6503	SO:0001583	missense	338	exon15			TTCCCAAAAAGAG	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2114T>C	2.37:g.21249790A>G	ENSP00000233242:p.Phe705Ser	239.0	0.0		140.0	22.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.892049	0.91889	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.25414	1.8;1.8	5.7	5.7	0.88788	Lipid transport protein, beta-sheet shell (1);Vitellinogen, open beta-sheet (1);	0.000000	0.85682	D	0.000000	T	0.55909	0.1950	M	0.82923	2.615	0.54753	D	0.999986	D	0.89917	1.0	D	0.97110	1.0	T	0.62072	-0.6931	10	0.87932	D	0	.	16.2838	0.82709	1.0:0.0:0.0:0.0	.	705	P04114	APOB_HUMAN	S	705	ENSP00000233242:F705S;ENSP00000382200:F705S	ENSP00000233242:F705S	F	-	2	0	APOB	21103295	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.896000	0.92521	2.308000	0.77769	0.533000	0.62120	TTT	.		0.418	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARL5B	221079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	18964121	18964121	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr10:18964121G>A	ENST00000377275.3	+	6	749	c.516G>A	c.(514-516)atG>atA	p.M172I		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	172					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						TAGAGTGGATGACCTCCCGGA	0.338																																					p.M172I		.											.	ARL5B	228	0			c.G516A						.						159.0	153.0	155.0					10																	18964121		2203	4300	6503	SO:0001583	missense	221079	exon6			GTGGATGACCTCC	AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.516G>A	10.37:g.18964121G>A	ENSP00000366487:p.Met172Ile	172.0	0.0		109.0	22.0	NM_178815		Missense_Mutation	SNP	ENST00000377275.3	37	CCDS7131.1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359737	0.41801	.	.	ENSG00000165997	ENST00000377275	T	0.79554	-1.28	6.16	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.63745	0.2537	N	0.03050	-0.425	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.61505	-0.7049	10	0.87932	D	0	-29.7788	16.8211	0.85746	0.0:0.0:0.8703:0.1297	.	172	Q96KC2	ARL5B_HUMAN	I	172	ENSP00000366487:M172I	ENSP00000366487:M172I	M	+	3	0	ARL5B	19004127	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.018000	0.88722	1.580000	0.49851	0.650000	0.86243	ATG	.		0.338	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047078.1	NM_178815	
CD2AP	23607	ucsc.edu;bcgsc.ca	37	6	47576858	47576858	+	Splice_Site	SNP	G	G	A			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr6:47576858G>A	ENST00000359314.5	+	16	2088		c.e16-1		CD2AP_ENST00000486693.1_Splice_Site	NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein						mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			taCGTTTTCAGCCATCTGTGT	0.303																																					.		.											.	CD2AP	92	0			c.1633-1G>A						.						37.0	36.0	36.0					6																	47576858		2203	4299	6502	SO:0001630	splice_region_variant	23607	exon16			TTTTCAGCCATCT	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1633-1G>A	6.37:g.47576858G>A		55.0	0.0		43.0	4.0	NM_012120	A6NL34|Q5VYA3|Q9UG97	Splice_Site	SNP	ENST00000359314.5	37	CCDS34472.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701200	0.68501	.	.	ENSG00000198087	ENST00000359314	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4512	0.83991	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD2AP	47684817	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.718000	0.68455	2.668000	0.90789	0.655000	0.94253	.	.		0.303	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040817.2		Intron
CNTN5	53942	ucsc.edu;bcgsc.ca	37	11	100170074	100170074	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr11:100170074A>G	ENST00000524871.1	+	20	2856	c.2566A>G	c.(2566-2568)Aat>Gat	p.N856D	CNTN5_ENST00000279463.3_Missense_Mutation_p.N856D|CNTN5_ENST00000527185.1_Missense_Mutation_p.N856D|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000528682.1_Missense_Mutation_p.N856D|CNTN5_ENST00000418526.2_Missense_Mutation_p.N782D	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	856	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CGTTTATAACAATAAAGGAGA	0.353																																					p.N856D		.											.	CNTN5	366	0			c.A2566G						.						97.0	94.0	95.0					11																	100170074		1838	4081	5919	SO:0001583	missense	53942	exon19			TATAACAATAAAG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2566A>G	11.37:g.100170074A>G	ENSP00000435637:p.Asn856Asp	53.0	0.0		36.0	4.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013375	0.75161	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	5.62	5.62	0.85841	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.63977	0.2557	L	0.37897	1.145	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.83275	0.994;0.996	T	0.66089	-0.6010	10	0.59425	D	0.04	.	15.0047	0.71501	1.0:0.0:0.0:0.0	.	782;856	O94779-2;O94779	.;CNTN5_HUMAN	D	856;856;856;782;856	ENSP00000433575:N856D;ENSP00000436185:N856D;ENSP00000435637:N856D;ENSP00000393229:N782D;ENSP00000279463:N856D	ENSP00000279463:N856D	N	+	1	0	CNTN5	99675284	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.218000	0.77991	2.149000	0.67028	0.528000	0.53228	AAT	.		0.353	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
CR1	1378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207787833	207787833	+	Splice_Site	SNP	A	A	C			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr1:207787833A>C	ENST00000367049.4	+	40	6660	c.6660A>C	c.(6658-6660)gaA>gaC	p.E2220D	CR1_ENST00000400960.2_Splice_Site_p.E1770D|CR1_ENST00000367053.1_Splice_Site_p.E1770D|CR1_ENST00000367052.1_Splice_Site_p.E1770D|CR1_ENST00000367051.1_Splice_Site_p.E1770D	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1770					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CAGTGTGTGAACGTGAGTAGA	0.403																																					p.E2220D		.											.	CR1	93	0			c.A6660C						.						129.0	121.0	123.0					1																	207787833		1888	4127	6015	SO:0001630	splice_region_variant	1378	exon40			GTGTGAACGTGAG	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6661+1A>C	1.37:g.207787833A>C		201.0	0.0		143.0	27.0	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	A	16.87	3.243171	0.58995	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	4.29	1.95	0.26073	Complement control module (2);Sushi/SCR/CCP (1);	.	.	.	.	T	0.43897	0.1268	M	0.81497	2.545	0.21473	N	0.999673	D;D	0.76494	0.999;0.997	D;D	0.75020	0.985;0.977	T	0.34925	-0.9809	9	0.14656	T	0.56	.	6.0899	0.19989	0.7817:0.0:0.2183:0.0	.	1770;2220	P17927;E9PDY4	CR1_HUMAN;.	D	1770;1770;1770;1770;2220	ENSP00000356019:E1770D;ENSP00000356018:E1770D;ENSP00000356020:E1770D;ENSP00000383744:E1770D;ENSP00000356016:E2220D	ENSP00000356016:E2220D	E	+	3	2	CR1	205854456	0.989000	0.36119	0.998000	0.56505	0.893000	0.52053	0.675000	0.25232	0.274000	0.22072	0.358000	0.22013	GAA	.		0.403	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	Missense_Mutation
CYP17A1	1586	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	104597036	104597036	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr10:104597036G>T	ENST00000369887.3	-	1	254	c.83C>A	c.(82-84)cCc>cAc	p.P28H	CYP17A1-AS1_ENST00000369884.4_RNA|CYP17A1_ENST00000489268.1_5'UTR	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	28					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	GAGGCTCTTGGGGTACTTGGC	0.567																																					p.P28H		.											.	CYP17A1	90	0			c.C83A						.						77.0	78.0	78.0					10																	104597036		2203	4300	6503	SO:0001583	missense	1586	exon1			CTCTTGGGGTACT	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.83C>A	10.37:g.104597036G>T	ENSP00000358903:p.Pro28His	107.0	1.0		58.0	15.0	NM_000102	Q5TZV7	Missense_Mutation	SNP	ENST00000369887.3	37	CCDS7541.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635705	0.67130	.	.	ENSG00000148795	ENST00000369887	D	0.83914	-1.78	5.37	4.45	0.53987	.	0.302657	0.37715	N	0.001968	D	0.90556	0.7040	M	0.81942	2.565	0.58432	D	0.999996	D	0.89917	1.0	D	0.81914	0.995	D	0.91443	0.5175	10	0.87932	D	0	.	13.9629	0.64193	0.0796:0.0:0.9204:0.0	.	28	P05093	CP17A_HUMAN	H	28	ENSP00000358903:P28H	ENSP00000358903:P28H	P	-	2	0	CYP17A1	104587026	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	2.915000	0.48805	2.670000	0.90874	0.462000	0.41574	CCC	.		0.567	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1	NM_000102	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84972221	84972221	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr2:84972221A>G	ENST00000237449.6	+	62	10368	c.10360A>G	c.(10360-10362)Att>Gtt	p.I3454V	DNAH6_ENST00000389394.3_Missense_Mutation_p.I3454V			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3454					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TGAGACTTATATTAACCCACA	0.313																																					p.I3454V		.											.	DNAH6	69	0			c.A10360G						.						79.0	70.0	73.0					2																	84972221		692	1591	2283	SO:0001583	missense	1768	exon63			ACTTATATTAACC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.10360A>G	2.37:g.84972221A>G	ENSP00000237449:p.Ile3454Val	122.0	0.0		79.0	22.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	8.787	0.929599	0.18131	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.68624	-0.34;-0.34	5.51	4.34	0.51931	Dynein heavy chain (1);	0.358848	0.26828	N	0.022300	T	0.45875	0.1364	N	0.16903	0.455	0.80722	D	1	B;B	0.22003	0.063;0.003	B;B	0.19666	0.026;0.02	T	0.23583	-1.0184	10	0.12430	T	0.62	.	9.6915	0.40131	0.8253:0.1747:0.0:0.0	.	3454;213	Q9C0G6;Q9C0G6-2	DYH6_HUMAN;.	V	3454	ENSP00000374045:I3454V;ENSP00000237449:I3454V	ENSP00000237449:I3454V	I	+	1	0	DNAH6	84825732	0.990000	0.36364	0.944000	0.38274	0.923000	0.55619	3.218000	0.51192	0.923000	0.37045	0.460000	0.39030	ATT	.		0.313	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
ESCO1	114799	ucsc.edu;bcgsc.ca	37	18	19147982	19147982	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr18:19147982A>G	ENST00000269214.5	-	5	2541	c.1604T>C	c.(1603-1605)cTc>cCc	p.L535P		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	535					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TGCTTGACTGAGCAGAGTCGA	0.328																																					p.L535P		.											.	ESCO1	90	0			c.T1604C						.						106.0	106.0	106.0					18																	19147982		2203	4300	6503	SO:0001583	missense	114799	exon5			TGACTGAGCAGAG	AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.1604T>C	18.37:g.19147982A>G	ENSP00000269214:p.Leu535Pro	76.0	0.0		35.0	4.0	NM_052911	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	ENST00000269214.5	37	CCDS32800.1	.	.	.	.	.	.	.	.	.	.	A	10.27	1.303098	0.23736	.	.	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.60299	0.2;1.76	5.45	1.79	0.24919	.	0.349225	0.25025	N	0.033738	T	0.44973	0.1319	L	0.48362	1.52	0.21527	N	0.999652	B	0.12630	0.006	B	0.09377	0.004	T	0.36792	-0.9733	10	0.48119	T	0.1	-14.0018	6.5079	0.22206	0.6334:0.0:0.3666:0.0	.	535	Q5FWF5	ESCO1_HUMAN	P	535	ENSP00000269214:L535P;ENSP00000372763:L535P	ENSP00000269214:L535P	L	-	2	0	ESCO1	17401980	0.927000	0.31430	0.089000	0.20774	0.857000	0.48899	0.743000	0.26231	0.460000	0.27045	0.528000	0.53228	CTC	.		0.328	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443942.1	NM_052911	
GRIN3B	116444	ucsc.edu;bcgsc.ca	37	19	1004833	1004833	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr19:1004833T>C	ENST00000234389.3	+	3	1352	c.1333T>C	c.(1333-1335)Tgc>Cgc	p.C445R	AC004528.4_ENST00000588380.1_RNA|GRIN3B_ENST00000588335.1_3'UTR	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	445					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGGGCAGCTGTGCCTGGACCC	0.667																																					p.C445R		.											.	GRIN3B	90	0			c.T1333C						.						51.0	50.0	50.0					19																	1004833		2203	4296	6499	SO:0001583	missense	116444	exon3			CAGCTGTGCCTGG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1333T>C	19.37:g.1004833T>C	ENSP00000234389:p.Cys445Arg	76.0	0.0		32.0	4.0	NM_138690	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.693847	0.48202	.	.	ENSG00000116032	ENST00000234389	T	0.18657	2.2	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.47229	0.1434	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.49735	-0.8908	10	0.49607	T	0.09	.	12.8619	0.57918	0.0:0.0:0.0:1.0	.	445	O60391	NMD3B_HUMAN	R	445	ENSP00000234389:C445R	ENSP00000234389:C445R	C	+	1	0	GRIN3B	955833	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	7.362000	0.79507	1.741000	0.51731	0.397000	0.26171	TGC	.		0.667	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
FBN3	84467	broad.mit.edu;bcgsc.ca	37	19	8201395	8201395	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr19:8201395T>C	ENST00000600128.1	-	11	1636	c.1222A>G	c.(1222-1224)Acc>Gcc	p.T408A	FBN3_ENST00000270509.2_Missense_Mutation_p.T408A|FBN3_ENST00000601739.1_Missense_Mutation_p.T408A			Q75N90	FBN3_HUMAN	fibrillin 3	408	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ATGTCAATGGTCTGGTTCAGG	0.637																																					p.T408A		.											.	FBN3	100	0			c.A1222G						.						119.0	101.0	107.0					19																	8201395		2203	4300	6503	SO:0001583	missense	84467	exon10			CAATGGTCTGGTT		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.1222A>G	19.37:g.8201395T>C	ENSP00000470498:p.Thr408Ala	212.0	0.0		121.0	8.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	t	13.65	2.300316	0.40694	.	.	ENSG00000142449	ENST00000270509	D	0.87179	-2.22	4.21	4.21	0.49690	Matrix fibril-associated (1);Epidermal growth factor-like, type 3 (1);	0.068616	0.56097	U	0.000031	T	0.73598	0.3607	N	0.11201	0.11	0.38711	D	0.953216	P	0.49253	0.921	B	0.38616	0.277	T	0.77122	-0.2704	10	0.35671	T	0.21	.	13.267	0.60139	0.0:0.0:0.0:1.0	.	408	Q75N90	FBN3_HUMAN	A	408	ENSP00000270509:T408A	ENSP00000270509:T408A	T	-	1	0	FBN3	8107395	1.000000	0.71417	0.963000	0.40424	0.303000	0.27691	2.854000	0.48325	1.537000	0.49254	0.379000	0.24179	ACC	.		0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
ITPR2	3709	ucsc.edu;bcgsc.ca	37	12	26808682	26808682	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr12:26808682A>G	ENST00000381340.3	-	20	2964	c.2548T>C	c.(2548-2550)Ttt>Ctt	p.F850L		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	850					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CCAAAAGGAAAGGGCTGGTTT	0.338																																					p.F850L		.											.	ITPR2	542	0			c.T2548C						.						97.0	96.0	96.0					12																	26808682		1796	4063	5859	SO:0001583	missense	3709	exon20			AAGGAAAGGGCTG	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.2548T>C	12.37:g.26808682A>G	ENSP00000370744:p.Phe850Leu	31.0	0.0		45.0	4.0	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	A	14.29	2.491244	0.44249	.	.	ENSG00000123104	ENST00000381340	D	0.90900	-2.75	5.48	5.48	0.80851	.	0.148491	0.64402	N	0.000008	D	0.82962	0.5151	N	0.21448	0.665	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.77864	-0.2429	10	0.08837	T	0.75	.	15.5707	0.76333	1.0:0.0:0.0:0.0	.	850	Q14571	ITPR2_HUMAN	L	850	ENSP00000370744:F850L	ENSP00000370744:F850L	F	-	1	0	ITPR2	26699949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.828000	0.62730	2.074000	0.62210	0.533000	0.62120	TTT	.		0.338	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
KDM6B	23135	ucsc.edu;bcgsc.ca	37	17	7752833	7752833	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr17:7752833A>G	ENST00000448097.2	+	11	3558	c.3227A>G	c.(3226-3228)gAg>gGg	p.E1076G	KDM6B_ENST00000254846.5_Missense_Mutation_p.E1076G			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1076	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						AAGGCTCGGGAGGAAGCCCCA	0.657																																					p.E1076G		.											.	KDM6B	205	0			c.A3227G						.						14.0	17.0	16.0					17																	7752833		2200	4290	6490	SO:0001583	missense	23135	exon11			CTCGGGAGGAAGC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.3227A>G	17.37:g.7752833A>G	ENSP00000412513:p.Glu1076Gly	81.0	0.0		68.0	6.0	NM_001080424	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	A	8.787	0.929663	0.18131	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.35048	1.33;1.34	4.49	4.49	0.54785	.	0.615793	0.14309	N	0.327809	T	0.33000	0.0848	N	0.14661	0.345	0.25093	N	0.990845	P;D	0.61697	0.948;0.99	B;P	0.56127	0.431;0.792	T	0.09164	-1.0687	10	0.66056	D	0.02	-11.636	7.0534	0.25085	0.8955:0.0:0.1045:0.0	.	1076;1076	O15054;O15054-1	KDM6B_HUMAN;.	G	1076	ENSP00000254846:E1076G;ENSP00000412513:E1076G	ENSP00000254846:E1076G	E	+	2	0	KDM6B	7693558	1.000000	0.71417	0.987000	0.45799	0.868000	0.49771	1.853000	0.39358	1.808000	0.52836	0.379000	0.24179	GAG	.		0.657	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
NCEH1	57552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	172365871	172365871	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr3:172365871G>A	ENST00000475381.1	-	2	405	c.172C>T	c.(172-174)Cac>Tac	p.H58Y	NCEH1_ENST00000538775.1_Missense_Mutation_p.H90Y|NCEH1_ENST00000543711.1_Intron|NCEH1_ENST00000273512.3_Missense_Mutation_p.H90Y			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	58				H -> R (in Ref. 2; BAH13028). {ECO:0000305}.	lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						GCCAGCAGGTGATGGCTCAGT	0.522																																					p.H90Y		.											.	NCEH1	90	0			c.C268T						.						68.0	69.0	69.0					3																	172365871		2203	4300	6503	SO:0001583	missense	57552	exon2			GCAGGTGATGGCT	AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.172C>T	3.37:g.172365871G>A	ENSP00000418571:p.His58Tyr	149.0	0.0		81.0	16.0	NM_020792	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	ENST00000475381.1	37		.	.	.	.	.	.	.	.	.	.	G	9.731	1.162359	0.21538	.	.	ENSG00000144959	ENST00000475381;ENST00000538775;ENST00000273512	T;T;T	0.04234	3.68;3.69;3.67	5.96	5.96	0.96718	.	0.350311	0.34507	N	0.003917	T	0.05273	0.0140	L	0.31926	0.97	0.80722	D	1	B;B	0.12630	0.006;0.002	B;B	0.15052	0.012;0.005	T	0.26643	-1.0097	10	0.02654	T	1	-22.2593	20.422	0.99049	0.0:0.0:1.0:0.0	.	90;58	F5H7K4;Q6PIU2	.;NCEH1_HUMAN	Y	58;90;90	ENSP00000418571:H58Y;ENSP00000442464:H90Y;ENSP00000273512:H90Y	ENSP00000273512:H90Y	H	-	1	0	NCEH1	173848565	1.000000	0.71417	0.993000	0.49108	0.961000	0.63080	5.955000	0.70306	2.832000	0.97577	0.655000	0.94253	CAC	.		0.522	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000346367.3	NM_020792	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	152466364	152466364	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr2:152466364C>G	ENST00000172853.10	-	77	11707	c.11560G>C	c.(11560-11562)Gac>Cac	p.D3854H	NEB_ENST00000427231.2_Missense_Mutation_p.D4097H|NEB_ENST00000397345.3_Missense_Mutation_p.D4097H|NEB_ENST00000409198.1_Missense_Mutation_p.D3854H|NEB_ENST00000603639.1_Missense_Mutation_p.D4097H|NEB_ENST00000604864.1_Missense_Mutation_p.D4097H			P20929	NEBU_HUMAN	nebulin	3854					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGATAATGTCGTTTTGATCC	0.433																																					p.D4097H		.											.	NEB	145	0			c.G12289C						.						223.0	208.0	213.0					2																	152466364		1960	4149	6109	SO:0001583	missense	4703	exon81			TAATGTCGTTTTG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11560G>C	2.37:g.152466364C>G	ENSP00000172853:p.Asp3854His	132.0	0.0		111.0	9.0	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	24.0	4.481740	0.84747	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.55	5.55	0.83447	.	0.043254	0.85682	D	0.000000	T	0.75932	0.3917	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.79329	-0.1848	10	0.56958	D	0.05	.	19.8667	0.96806	0.0:1.0:0.0:0.0	.	3854	P20929	NEBU_HUMAN	H	3854;4097;4097;3854	ENSP00000386259:D3854H;ENSP00000380505:D4097H;ENSP00000416578:D4097H;ENSP00000172853:D3854H	ENSP00000172853:D3854H	D	-	1	0	NEB	152174610	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	4.802000	0.62539	2.773000	0.95371	0.655000	0.94253	GAC	.		0.433	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NUP214	8021	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	134053778	134053778	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr9:134053778A>G	ENST00000359428.5	+	24	3544	c.3400A>G	c.(3400-3402)Acc>Gcc	p.T1134A	NUP214_ENST00000411637.2_Missense_Mutation_p.T1124A|NUP214_ENST00000451030.1_Missense_Mutation_p.T1135A			P35658	NU214_HUMAN	nucleoporin 214kDa	1134	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TAACCCTGCAACCCCTTCTAC	0.483			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""						OREG0019558	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T1134A	Pancreas(4;24 48 25510 30394 32571)	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	1131	0			c.A3400G						.						112.0	95.0	101.0					9																	134053778		2203	4300	6503	SO:0001583	missense	8021	exon24			CCTGCAACCCCTT	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.3400A>G	9.37:g.134053778A>G	ENSP00000352400:p.Thr1134Ala	88.0	0.0	1607	53.0	18.0	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	37	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	A	0.638	-0.814402	0.02798	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605	T;T;T	0.29917	1.55;1.55;1.55	5.51	-5.68	0.02436	.	0.990981	0.08185	N	0.984862	T	0.09158	0.0226	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.001	T	0.33240	-0.9876	10	0.02654	T	1	-0.348	2.6701	0.05065	0.4094:0.3081:0.1836:0.0989	.	1123;728;1124;1134	P35658-2;Q5JUP9;P35658-4;P35658	.;.;.;NU214_HUMAN	A	1134;1124;1135;1123;728;563	ENSP00000352400:T1134A;ENSP00000396576:T1124A;ENSP00000405014:T1135A	ENSP00000352400:T1134A	T	+	1	0	NUP214	133043599	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	-0.851000	0.04313	-0.942000	0.03695	-0.379000	0.06801	ACC	.		0.483	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
OR1E2	8388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	3336389	3336389	+	Silent	SNP	A	A	T			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr17:3336389A>T	ENST00000248384.1	-	1	746	c.747T>A	c.(745-747)acT>acA	p.T249T		NM_003554.1	NP_003545.1	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E, member 2	249					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			endometrium(3)|large_intestine(3)|lung(3)	9						GGGAGCCACAAGTAGAGAAGG	0.473																																					p.T249T		.											.	OR1E2	131	0			c.T747A						.						68.0	67.0	67.0					17																	3336389		2203	4300	6503	SO:0001819	synonymous_variant	8388	exon1			GCCACAAGTAGAG	U04686	CCDS11026.1	17p13.3	2012-08-09			ENSG00000127780	ENSG00000127780		"""GPCR / Class A : Olfactory receptors"""	8190	protein-coding gene	gene with protein product				OR1E4		8004088, 9500546	Standard	NM_003554		Approved	OR17-93, OR17-135	uc010vre.2	P47887	OTTHUMG00000090651	ENST00000248384.1:c.747T>A	17.37:g.3336389A>T		178.0	0.0		119.0	23.0	NM_003554	O43877|O95632|Q0VAD5|Q0VAD6|Q9UL13	Silent	SNP	ENST00000248384.1	37	CCDS11026.1																																																																																			.		0.473	OR1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207311.1		
PKD1	5310	ucsc.edu;bcgsc.ca	37	16	2162836	2162836	+	Silent	SNP	T	T	C			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr16:2162836T>C	ENST00000262304.4	-	13	3322	c.3114A>G	c.(3112-3114)gcA>gcG	p.A1038A	PKD1_ENST00000423118.1_Silent_p.A1038A|RP11-304L19.4_ENST00000568795.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1038	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCGCCGTCAGTGCTAGCGTGG	0.657																																					p.A1038A		.											.	PKD1	91	0			c.A3114G						.						85.0	81.0	82.0					16																	2162836		2197	4300	6497	SO:0001819	synonymous_variant	5310	exon13			CGTCAGTGCTAGC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3114A>G	16.37:g.2162836T>C		45.0	0.0		23.0	4.0	NM_000296	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			.		0.657	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PPAP2B	8613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	56989987	56989987	+	Silent	SNP	G	G	A			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr1:56989987G>A	ENST00000371250.3	-	3	1088	c.537C>T	c.(535-537)taC>taT	p.Y179Y		NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	179					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						CTCTGCATCTGTAGTTCTGAA	0.532																																					p.Y179Y		.											.	PPAP2B	91	0			c.C537T						.						138.0	134.0	136.0					1																	56989987		2203	4300	6503	SO:0001819	synonymous_variant	8613	exon3			GCATCTGTAGTTC	AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.537C>T	1.37:g.56989987G>A		232.0	0.0		118.0	23.0	NM_003713	B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Silent	SNP	ENST00000371250.3	37	CCDS604.1																																																																																			.		0.532	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022334.2	NM_003713	
SLC22A12	116085	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	64367214	64367214	+	Silent	SNP	C	C	T			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr11:64367214C>T	ENST00000377574.1	+	7	1884	c.1137C>T	c.(1135-1137)ttC>ttT	p.F379F	SLC22A12_ENST00000336464.7_Silent_p.F345F|SLC22A12_ENST00000473690.1_Silent_p.F158F|SLC22A12_ENST00000377572.1_Silent_p.F271F|SLC22A12_ENST00000377567.2_Silent_p.F271F	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	379					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	GCAACATCTTCCTGCTCCAAA	0.662																																					p.F379F		.											.	SLC22A12	91	0			c.C1137T						.						53.0	49.0	50.0					11																	64367214		2201	4297	6498	SO:0001819	synonymous_variant	116085	exon7			CATCTTCCTGCTC	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.1137C>T	11.37:g.64367214C>T		304.0	0.0		120.0	27.0	NM_144585	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Silent	SNP	ENST00000377574.1	37	CCDS8075.1																																																																																			.		0.662	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585	
SLIT3	6586	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	168189663	168189663	+	Silent	SNP	G	G	A	rs187066924		TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr5:168189663G>A	ENST00000519560.1	-	15	1910	c.1491C>T	c.(1489-1491)agC>agT	p.S497S	SLIT3_ENST00000332966.8_Silent_p.S497S|SLIT3_ENST00000404867.3_Silent_p.S497S	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	497	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAAGCACTCGCTGCTGAACC	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		18887	0.0		0.001	False		,,,				2504	0.0				p.S497S	Ovarian(29;311 847 10864 17279 24903)	.											.	SLIT3	95	0			c.C1491T						.	G		0,4406		0,0,2203	128.0	128.0	128.0		1491	-4.4	0.7	5		128	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLIT3	NM_003062.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		497/1524	168189663	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6586	exon15			GCACTCGCTGCTG	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1491C>T	5.37:g.168189663G>A		120.0	1.0		56.0	10.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	37	CCDS4369.1																																																																																			G|0.999;A|0.000		0.627	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SMOC1	64093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	70490056	70490056	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr14:70490056G>A	ENST00000381280.4	+	11	1436	c.1183G>A	c.(1183-1185)Gcc>Acc	p.A395T	SMOC1_ENST00000361956.3_Missense_Mutation_p.A395T	NM_001034852.2|NM_022137.5	NP_001030024.1|NP_071420.1	Q9H4F8	SMOC1_HUMAN	SPARC related modular calcium binding 1	395					cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|eye development (GO:0001654)|limb development (GO:0060173)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of osteoblast differentiation (GO:0045667)|signal transduction (GO:0007165)	basement membrane (GO:0005604)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	21				all cancers(60;0.00417)|BRCA - Breast invasive adenocarcinoma(234;0.0119)|OV - Ovarian serous cystadenocarcinoma(108;0.028)		GAAGAAGAAAGCCAAGCCCAA	0.527																																					p.A395T		.											.	SMOC1	92	0			c.G1183A						.						167.0	152.0	157.0					14																	70490056		2203	4300	6503	SO:0001583	missense	64093	exon11			AAGAAAGCCAAGC	AJ249900	CCDS9798.1, CCDS32110.1	14q24.1	2010-08-05			ENSG00000198732	ENSG00000198732			20318	protein-coding gene	gene with protein product		608488				12130637	Standard	NM_001034852		Approved		uc001xlt.2	Q9H4F8		ENST00000381280.4:c.1183G>A	14.37:g.70490056G>A	ENSP00000370680:p.Ala395Thr	195.0	0.0		100.0	19.0	NM_001034852	A8K1S3|B2R7P5|Q96F78	Missense_Mutation	SNP	ENST00000381280.4	37	CCDS9798.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054462	0.75960	.	.	ENSG00000198732	ENST00000361956;ENST00000381280	T;T	0.57107	0.42;0.42	5.34	4.44	0.53790	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.54902	0.1887	N	0.22421	0.69	0.58432	D	0.999996	D;P	0.58970	0.984;0.626	P;B	0.61201	0.885;0.393	T	0.51293	-0.8724	10	0.23891	T	0.37	-22.3305	15.7082	0.77602	0.0:0.0:0.862:0.138	.	395;395	Q9H4F8-2;Q9H4F8	.;SMOC1_HUMAN	T	395	ENSP00000355110:A395T;ENSP00000370680:A395T	ENSP00000355110:A395T	A	+	1	0	SMOC1	69559809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.540000	0.73861	1.352000	0.45808	0.655000	0.94253	GCC	.		0.527	SMOC1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000412467.1		
TRPM2	7226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45833800	45833800	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr21:45833800A>T	ENST00000397928.1	+	20	3434	c.2989A>T	c.(2989-2991)Agc>Tgc	p.S997C	TRPM2_ENST00000300482.5_Missense_Mutation_p.S997C|TRPM2_ENST00000300481.9_Missense_Mutation_p.S977C|TRPM2_ENST00000397932.2_Missense_Mutation_p.S997C|AP001065.2_ENST00000456880.1_RNA|AP001065.2_ENST00000423310.1_RNA|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	997					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						GGAGCACTGCAGCCCCAATGG	0.632																																					p.S997C		.											.	TRPM2	92	0			c.A2989T						.						172.0	178.0	176.0					21																	45833800		2203	4300	6503	SO:0001583	missense	7226	exon20			CACTGCAGCCCCA	AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2989A>T	21.37:g.45833800A>T	ENSP00000381023:p.Ser997Cys	163.0	0.0		83.0	16.0	NM_003307	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	ENST00000397928.1	37	CCDS13710.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.764643	0.89932	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	4.78	4.78	0.61160	Ion transport (1);	0.000000	0.85682	D	0.000000	T	0.80571	0.4648	M	0.84846	2.72	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.995;0.995	D	0.84254	0.0479	10	0.72032	D	0.01	-34.9615	14.6241	0.68608	1.0:0.0:0.0:0.0	.	997;783;997	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	C	997;997;977;997	ENSP00000300482:S997C;ENSP00000381023:S997C;ENSP00000300481:S977C;ENSP00000381026:S997C	ENSP00000300481:S977C	S	+	1	0	TRPM2	44658228	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.645000	0.91049	1.923000	0.55706	0.482000	0.46254	AGC	.		0.632	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098086.1	NM_003307	
USP29	57663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57640050	57640050	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A3CI-01A-11D-A20W-10	TCGA-G3-A3CI-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	03de17c7-1318-460c-966a-477083e6fbc1	4a2e4e6a-8fef-4c74-968b-c0e269634c4f	g.chr19:57640050T>A	ENST00000254181.4	+	4	461	c.7T>A	c.(7-9)Tct>Act	p.S3T	USP29_ENST00000598197.1_Missense_Mutation_p.S3T	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	3					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGGATGATATCTCTAAAGGT	0.333																																					p.S3T		.											.	USP29	661	0			c.T7A						.						40.0	41.0	41.0					19																	57640050		2203	4300	6503	SO:0001583	missense	57663	exon4			ATGATATCTCTAA		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.7T>A	19.37:g.57640050T>A	ENSP00000254181:p.Ser3Thr	173.0	0.0		75.0	17.0	NM_020903		Missense_Mutation	SNP	ENST00000254181.4	37	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	T	4.596	0.110769	0.08780	.	.	ENSG00000131864	ENST00000254181	T	0.47869	0.83	2.55	-1.61	0.08399	.	1.298900	0.05959	U	0.640204	T	0.23014	0.0556	N	0.11427	0.14	0.09310	N	1	B	0.27229	0.172	B	0.16289	0.015	T	0.12863	-1.0531	10	0.18276	T	0.48	-0.9375	5.6961	0.17857	0.0:0.4567:0.0:0.5433	.	3	Q9HBJ7	UBP29_HUMAN	T	3	ENSP00000254181:S3T	ENSP00000254181:S3T	S	+	1	0	USP29	62331862	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-0.245000	0.08890	-0.275000	0.09219	-0.326000	0.08463	TCT	.		0.333	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
