#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CASP9	842	hgsc.bcm.edu	37	1	15820444	15820444	+	Silent	SNP	C	C	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:15820444C>A	ENST00000333868.5	-	8	1195	c.1101G>T	c.(1099-1101)ctG>ctT	p.L367L	CASP9_ENST00000348549.5_Silent_p.L217L|CASP9_ENST00000375890.4_Silent_p.L284L|CASP9_ENST00000546424.1_Silent_p.L367L	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	367					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		AGATGTCGTCCAGGGTCTCAA	0.597																																					p.L367L		Atlas-SNP	.											.	CASP9	40	.	0			c.G1101T						.						71.0	52.0	59.0					1																	15820444		2203	4300	6503	SO:0001819	synonymous_variant	842	exon8			GTCGTCCAGGGTC	U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.1101G>T	chr1.hg19:g.15820444C>A		23.0	0.0		27.0	11.0	NM_001229	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Silent	SNP	ENST00000333868.5	hg19	CCDS158.1	.	.	.	.	.	.	.	.	.	.	C	1.412	-0.575360	0.03882	.	.	ENSG00000132906	ENST00000424908	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7195	0.46032	0.0:0.914:0.0:0.086	.	.	.	.	X	149	.	.	G	-	1	0	CASP9	15693031	1.000000	0.71417	1.000000	0.80357	0.194000	0.23727	4.088000	0.57678	2.703000	0.92315	0.655000	0.94253	GGA	.	.		0.597	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006438.1	NM_032996	
SH3D21	79729	hgsc.bcm.edu	37	1	36786280	36786280	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:36786280C>T	ENST00000426732.2	+	13	1953	c.1668C>T	c.(1666-1668)ctC>ctT	p.L556L	SH3D21_ENST00000453908.2_Silent_p.L672L|SH3D21_ENST00000474766.1_3'UTR|SH3D21_ENST00000505871.1_Silent_p.L561L|EVA1B_ENST00000490466.1_5'Flank|SH3D21_ENST00000312808.4_Silent_p.L318L			A4FU49	SH321_HUMAN	SH3 domain containing 21	556						extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						CGCTCGCGCTCCCCTCGCTGG	0.567																																					p.L672L		Atlas-SNP	.											.	SH3D21	73	.	0			c.C2016T						.						49.0	52.0	51.0					1																	36786280		2201	4298	6499	SO:0001819	synonymous_variant	79729	exon14			CGCGCTCCCCTCG	AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.1668C>T	chr1.hg19:g.36786280C>T		231.0	0.0		229.0	42.0	NM_001162530	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Silent	SNP	ENST00000426732.2	hg19																																																																																				.	.		0.567	SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676	
FHL3	2275	hgsc.bcm.edu	37	1	38463418	38463418	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:38463418C>T	ENST00000373016.3	-	5	794	c.626G>A	c.(625-627)tGt>tAt	p.C209Y	FHL3_ENST00000485803.1_5'UTR	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	209	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ACAGGCCACACAGTAGGGATC	0.582																																					p.C209Y		Atlas-SNP	.											.	FHL3	9	.	0			c.G626A						.						76.0	75.0	75.0					1																	38463418		2203	4300	6503	SO:0001583	missense	2275	exon5			GCCACACAGTAGG	BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.626G>A	chr1.hg19:g.38463418C>T	ENSP00000362107:p.Cys209Tyr	141.0	0.0		129.0	31.0	NM_004468	D3DPT6|Q6I9T0|Q9BVA2	Missense_Mutation	SNP	ENST00000373016.3	hg19	CCDS30678.1	.	.	.	.	.	.	.	.	.	.	C	18.90	3.722473	0.68959	.	.	ENSG00000183386	ENST00000373016	D	0.99319	-5.74	5.18	4.2	0.49525	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.99711	0.9889	H	0.99697	4.71	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.70487	0.969;0.948	D	0.96840	0.9617	10	0.87932	D	0	.	15.1367	0.72572	0.0:0.8582:0.1418:0.0	.	101;209	Q96C98;Q13643	.;FHL3_HUMAN	Y	209	ENSP00000362107:C209Y	ENSP00000362107:C209Y	C	-	2	0	FHL3	38236005	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	6.041000	0.70988	2.426000	0.82243	0.313000	0.20887	TGT	.	.		0.582	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012958.1	NM_004468	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144857701	144857701	+	Missense_Mutation	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:144857701T>C	ENST00000369354.3	-	39	6542	c.6353A>G	c.(6352-6354)gAt>gGt	p.D2118G	PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.D2012G|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.D2203G|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.D2118G|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.D2254G			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	2118					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CATACCAACATCCCGGACTGG	0.522			T	PDGFRB	MPD																																p.D2118G		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.A6353G						.						140.0	155.0	150.0					1																	144857701		2203	4296	6499	SO:0001583	missense	9659	exon39			CCAACATCCCGGA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6353A>G	chr1.hg19:g.144857701T>C	ENSP00000358360:p.Asp2118Gly	111.0	0.0		128.0	12.0	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	19.55|19.55	3.848492|3.848492	0.71603|0.71603	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359|ENST00000530130	T;T;T;T;T|.	0.02067|.	4.47;4.5;4.5;4.56;4.51|.	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	.|.	.|.	.|.	.|.	T|T	0.68109|0.68109	0.2965|0.2965	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.998|.	D;D|.	0.87578|.	0.998;0.992|.	T|T	0.71600|0.71600	-0.4544|-0.4544	9|5	0.72032|.	D|.	0.01|.	.|.	12.746|12.746	0.57281|0.57281	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2012;2118|.	Q5VU43-3;Q5VU43|.	.;MYOME_HUMAN|.	G|V	2012;2118;2118;2203;2254|195	ENSP00000327209:D2012G;ENSP00000358360:D2118G;ENSP00000358363:D2118G;ENSP00000435654:D2203G;ENSP00000358366:D2254G|.	ENSP00000327209:D2012G|.	D|M	-|-	2|1	0|0	PDE4DIP|PDE4DIP	143569058|143569058	1.000000|1.000000	0.71417|0.71417	0.949000|0.949000	0.38748|0.38748	0.551000|0.551000	0.35334|0.35334	5.010000|5.010000	0.64004|0.64004	1.966000|1.966000	0.57179|0.57179	0.454000|0.454000	0.30748|0.30748	GAT|ATG	.	.		0.522	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
SYT11	23208	hgsc.bcm.edu	37	1	155851003	155851003	+	Missense_Mutation	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:155851003G>T	ENST00000368324.4	+	4	1253	c.1000G>T	c.(1000-1002)Gtg>Ttg	p.V334L	SYT11_ENST00000539162.1_Missense_Mutation_p.V27L	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	334	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			TTATGTCAAGGTGAACGTCTA	0.438																																					p.V334L		Atlas-SNP	.											.	SYT11	55	.	0			c.G1000T						.						191.0	203.0	199.0					1																	155851003		2203	4300	6503	SO:0001583	missense	23208	exon4			GTCAAGGTGAACG	D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.1000G>T	chr1.hg19:g.155851003G>T	ENSP00000357307:p.Val334Leu	243.0	1.0		317.0	141.0	NM_152280	Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	ENST00000368324.4	hg19	CCDS1122.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703944	0.48412	.	.	ENSG00000132718	ENST00000368324;ENST00000539162	T;T	0.71579	-0.58;-0.58	5.17	4.18	0.49190	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.139246	0.49305	D	0.000152	T	0.41719	0.1171	N	0.16656	0.425	0.54753	D	0.999989	B	0.02656	0.0	B	0.06405	0.002	T	0.42413	-0.9453	10	0.48119	T	0.1	.	13.9537	0.64135	0.0856:0.0:0.9144:0.0	.	334	Q9BT88	SYT11_HUMAN	L	334;27	ENSP00000357307:V334L;ENSP00000441657:V27L	ENSP00000357307:V334L	V	+	1	0	SYT11	154117627	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.387000	0.73191	2.691000	0.91804	0.655000	0.94253	GTG	.	.		0.438	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039597.1	NM_152280	
KIAA0907	22889	hgsc.bcm.edu	37	1	155891652	155891652	+	Splice_Site	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:155891652C>T	ENST00000368321.3	-	9	1035	c.1012G>A	c.(1012-1014)Ggc>Agc	p.G338S	KIAA0907_ENST00000368319.3_Splice_Site_p.A338T|KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368320.3_Splice_Site_p.G338S|SNORA42_ENST00000384744.1_RNA	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	338	Pro-rich.						RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			ATGTACACACCTGGTAAAGGT	0.383																																					p.G338S		Atlas-SNP	.											.	KIAA0907	58	.	0			c.G1012A						.						86.0	86.0	86.0					1																	155891652		2203	4300	6503	SO:0001630	splice_region_variant	22889	exon9			ACACACCTGGTAA	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.1012+1G>A	chr1.hg19:g.155891652C>T		465.0	0.0		623.0	91.0	NM_014949	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	ENST00000368321.3	hg19	CCDS30885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.6|24.6	4.544143|4.544143	0.86022|0.86022	.|.	.|.	ENSG00000132680|ENSG00000132680	ENST00000368319|ENST00000368321;ENST00000368320	.|.	.|.	.|.	5.94|5.94	5.94|5.94	0.96194|0.96194	.|.	.|0.160586	.|0.56097	.|D	.|0.000031	T|T	0.36276|0.36276	0.0961|0.0961	L|L	0.29908|0.29908	0.895|0.895	0.20975|0.20975	N|N	0.999814|0.999814	D|P;P	0.60575|0.47962	0.988|0.844;0.903	P|P;P	0.62885|0.56398	0.908|0.797;0.795	T|T	0.21109|0.21109	-1.0255|-1.0255	7|8	.|.	.|.	.|.	-7.9971|-7.9971	18.1253|18.1253	0.89584|0.89584	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	338|338;338	Q7Z7F0-3|Q7Z7F0-2;Q7Z7F0	.|.;K0907_HUMAN	T|S	338|338	.|.	.|.	A|G	-|-	1|1	0|0	KIAA0907|KIAA0907	154158276|154158276	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.652000|5.652000	0.67959|0.67959	2.821000|2.821000	0.97095|0.97095	0.484000|0.484000	0.47621|0.47621	GCA|GGC	.	.		0.383	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039583.1	NM_014949	Missense_Mutation
UBQLN4	56893	hgsc.bcm.edu	37	1	156021615	156021615	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:156021615G>A	ENST00000368309.3	-	2	234	c.142C>T	c.(142-144)Cag>Tag	p.Q48*	LAMTOR2_ENST00000368305.4_5'Flank|LAMTOR2_ENST00000368304.5_5'Flank|UBQLN4_ENST00000472638.1_5'UTR	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	48	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					TGATCCTGCTGAGCCTTAAAC	0.562																																					p.Q48X		Atlas-SNP	.											.	UBQLN4	47	.	0			c.C142T						.						82.0	70.0	74.0					1																	156021615		2203	4300	6503	SO:0001587	stop_gained	56893	exon2			CCTGCTGAGCCTT	BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.142C>T	chr1.hg19:g.156021615G>A	ENSP00000357292:p.Gln48*	67.0	0.0		151.0	15.0	NM_020131	A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Nonsense_Mutation	SNP	ENST00000368309.3	hg19	CCDS1127.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218699	0.79464	.	.	ENSG00000160803	ENST00000368309;ENST00000368307	.	.	.	5.04	5.04	0.67666	.	0.053007	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-14.3825	10.8654	0.46851	0.0:0.0:0.7145:0.2855	.	.	.	.	X	48	.	ENSP00000357290:Q48X	Q	-	1	0	UBQLN4	154288239	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.558000	0.60789	2.618000	0.88619	0.561000	0.74099	CAG	.	.		0.562	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046193.1	NM_020131	
FCRL5	83416	hgsc.bcm.edu	37	1	157497415	157497415	+	Missense_Mutation	SNP	C	C	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:157497415C>A	ENST00000361835.3	-	9	2109	c.1952G>T	c.(1951-1953)aGt>aTt	p.S651I	FCRL5_ENST00000368190.3_Missense_Mutation_p.S651I|FCRL5_ENST00000368191.3_Missense_Mutation_p.S566I|FCRL5_ENST00000356953.4_Missense_Mutation_p.S651I	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	651	Ig-like C2-type 6.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ACCTATAACACTGAGTGATAT	0.443																																					p.S651I		Atlas-SNP	.											.	FCRL5	177	.	0			c.G1952T						.						105.0	103.0	104.0					1																	157497415		2203	4300	6503	SO:0001583	missense	83416	exon9			ATAACACTGAGTG	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1952G>T	chr1.hg19:g.157497415C>A	ENSP00000354691:p.Ser651Ile	95.0	0.0		154.0	28.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	hg19	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	C	14.06	2.424059	0.43020	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03212	4.01;4.01;4.01;4.01	3.53	-4.6	0.03390	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06872	0.0175	M	0.90483	3.12	0.09310	N	1	D;D;P;D	0.67145	0.996;0.976;0.768;0.981	D;D;B;P	0.67725	0.953;0.912;0.253;0.827	T	0.02424	-1.1161	9	0.48119	T	0.1	.	5.3737	0.16154	0.0:0.2293:0.4445:0.3261	.	566;651;651;651	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	I	651;651;651;566	ENSP00000354691:S651I;ENSP00000349434:S651I;ENSP00000357173:S651I;ENSP00000357174:S566I	ENSP00000349434:S651I	S	-	2	0	FCRL5	155764039	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-1.347000	0.02632	-0.713000	0.04981	0.650000	0.86243	AGT	.	.		0.443	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
FCRL1	115350	hgsc.bcm.edu	37	1	157765893	157765893	+	Missense_Mutation	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:157765893A>G	ENST00000368176.3	-	11	1353	c.1286T>C	c.(1285-1287)aTg>aCg	p.M429T	FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000358292.3_3'UTR|FCRL1_ENST00000491942.1_Missense_Mutation_p.M428T	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	429						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATAACCTTACATAGCATCTTC	0.443																																					p.M429T	GBM(54;482 1003 11223 30131 35730)	Atlas-SNP	.											.	FCRL1	164	.	0			c.T1286C						.						191.0	162.0	172.0					1																	157765893		2203	4300	6503	SO:0001583	missense	115350	exon11			CCTTACATAGCAT	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.1286T>C	chr1.hg19:g.157765893A>G	ENSP00000357158:p.Met429Thr	126.0	0.0		205.0	19.0	NM_052938	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	hg19	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	A	8.914	0.959393	0.18507	.	.	ENSG00000163534	ENST00000368176;ENST00000491942	T;T	0.39056	1.1;1.1	4.37	2.1	0.27182	.	1.292250	0.05210	N	0.506600	T	0.18964	0.0455	L	0.51422	1.61	0.09310	N	1	B;B	0.26547	0.152;0.003	B;B	0.25140	0.058;0.002	T	0.36866	-0.9730	10	0.87932	D	0	.	5.3852	0.16215	0.7755:0.0:0.2245:0.0	.	428;429	Q96LA6-2;Q96LA6	.;FCRL1_HUMAN	T	429;428	ENSP00000357158:M429T;ENSP00000418130:M428T	ENSP00000357158:M429T	M	-	2	0	FCRL1	156032517	0.309000	0.24518	0.040000	0.18447	0.047000	0.14425	1.434000	0.34958	0.835000	0.34877	0.454000	0.30748	ATG	.	.		0.443	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
NR1I3	9970	hgsc.bcm.edu	37	1	161200931	161200931	+	Missense_Mutation	SNP	C	C	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:161200931C>G	ENST00000367982.4	-	7	954	c.799G>C	c.(799-801)Gct>Cct	p.A267P	NR1I3_ENST00000508740.1_Missense_Mutation_p.A234P|NR1I3_ENST00000515621.1_Missense_Mutation_p.A188P|NR1I3_ENST00000502985.1_Intron|NR1I3_ENST00000511676.1_Missense_Mutation_p.A234P|NR1I3_ENST00000412844.2_Missense_Mutation_p.A238P|NR1I3_ENST00000442691.2_Missense_Mutation_p.A267P|NR1I3_ENST00000367985.3_Intron|NR1I3_ENST00000505005.1_Intron|NR1I3_ENST00000367980.2_Missense_Mutation_p.A267P|NR1I3_ENST00000504010.1_Intron|NR1I3_ENST00000428574.2_Missense_Mutation_p.A263P|NR1I3_ENST00000506209.1_Missense_Mutation_p.A234P|NR1I3_ENST00000367984.4_Intron|NR1I3_ENST00000479324.1_5'UTR|NR1I3_ENST00000511944.1_Intron|NR1I3_ENST00000367981.3_Missense_Mutation_p.A234P|NR1I3_ENST00000512372.1_Intron|NR1I3_ENST00000367979.2_Missense_Mutation_p.A267P|NR1I3_ENST00000437437.2_Missense_Mutation_p.A234P|NR1I3_ENST00000511748.1_Intron|NR1I3_ENST00000367983.4_Missense_Mutation_p.A263P|NR1I3_ENST00000508387.1_Intron			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3	267					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GCCATGGCAGCCAAGAGCACA	0.537																																					p.A267P		Atlas-SNP	.											.	NR1I3	74	.	0			c.G799C						.						53.0	55.0	54.0					1																	161200931		2203	4300	6503	SO:0001583	missense	9970	exon7			TGGCAGCCAAGAG	Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347	ENST00000367982.4:c.799G>C	chr1.hg19:g.161200931C>G	ENSP00000356961:p.Ala267Pro	134.0	0.0		177.0	23.0	NM_001077478	E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Missense_Mutation	SNP	ENST00000367982.4	hg19	CCDS41430.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685655	0.68157	.	.	ENSG00000143257	ENST00000367983;ENST00000367980;ENST00000437437;ENST00000442691;ENST00000412844;ENST00000428574;ENST00000508740;ENST00000367982;ENST00000511676;ENST00000367981;ENST00000515621;ENST00000367979;ENST00000506209	D;D;D;D;D;D;D;D;D;D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13	5.38	5.38	0.77491	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.264976	0.37530	N	0.002052	D	0.97430	0.9159	M	0.71036	2.16	0.37677	D	0.923342	D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.99;0.999;0.986;0.986;0.999;0.986;0.993;0.968;0.995;0.998;0.999;0.999	D;D;D;D;D;D;D;D;D;D;D;D	0.74674	0.95;0.984;0.965;0.928;0.982;0.928;0.952;0.928;0.95;0.937;0.935;0.982	D	0.97199	0.9863	9	0.46703	T	0.11	.	16.633	0.85039	0.0:1.0:0.0:0.0	.	234;238;263;267;267;267;188;234;234;234;234;263	E9PCF2;E9PHN4;F1D8Q1;Q14994;E9PC13;Q4U0F0;D6REZ7;Q6GZ68;E9PH10;Q6GZ84;E9PGH6;E9PB75	.;.;.;NR1I3_HUMAN;.;.;.;.;.;.;.;.	P	263;267;234;267;238;263;234;267;234;234;188;267;234	ENSP00000356962:A263P;ENSP00000356959:A267P;ENSP00000407446:A234P;ENSP00000406493:A267P;ENSP00000399361:A238P;ENSP00000412672:A263P;ENSP00000423666:A234P;ENSP00000356961:A267P;ENSP00000427175:A234P;ENSP00000356960:A234P;ENSP00000421588:A188P;ENSP00000356958:A267P;ENSP00000423089:A234P	ENSP00000356958:A267P	A	-	1	0	NR1I3	159467555	0.826000	0.29277	1.000000	0.80357	0.990000	0.78478	0.682000	0.25335	2.512000	0.84698	0.561000	0.74099	GCT	.	.		0.537	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083048.2		
RFWD2	64326	hgsc.bcm.edu	37	1	175958611	175958611	+	Missense_Mutation	SNP	G	G	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:175958611G>C	ENST00000367669.3	-	16	2248	c.1734C>G	c.(1732-1734)caC>caG	p.H578Q	RFWD2_ENST00000308769.8_Missense_Mutation_p.H554Q	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	578					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AGTGGACACAGTGATCTAAAA	0.333																																					p.H578Q	Ovarian(134;1413 1765 5706 35534 51541)	Atlas-SNP	.											RFWD2,NS,carcinoma,0,1	RFWD2	67	.	0			c.C1734G						.						94.0	84.0	88.0					1																	175958611		2203	4300	6503	SO:0001583	missense	64326	exon16			GACACAGTGATCT	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1734C>G	chr1.hg19:g.175958611G>C	ENSP00000356641:p.His578Gln	93.0	0.0		113.0	16.0	NM_022457	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	hg19	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038117	0.75617	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	T;T;T	0.70282	-0.47;-0.47;-0.47	5.79	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82719	0.5098	M	0.73319	2.225	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.845;1.0;0.968;0.968	D;P;D;D;D	0.97110	1.0;0.855;0.999;0.978;0.967	D	0.84490	0.0610	10	0.62326	D	0.03	-12.7373	14.4669	0.67490	0.0714:0.0:0.9286:0.0	.	353;338;554;578;578	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	Q	353;578;413;554	ENSP00000356641:H578Q;ENSP00000356638:H413Q;ENSP00000310943:H554Q	ENSP00000310943:H554Q	H	-	3	2	RFWD2	174225234	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.723000	0.84788	1.460000	0.47911	-0.136000	0.14681	CAC	.	.		0.333	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	
IGFN1	91156	hgsc.bcm.edu	37	1	201195085	201195085	+	Silent	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:201195085G>T	ENST00000335211.4	+	22	10750	c.10620G>T	c.(10618-10620)gcG>gcT	p.A3540A	RP11-567E21.3_ENST00000453155.1_RNA|IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1083						nucleus (GO:0005634)|Z disc (GO:0030018)		p.A3540A(1)|p.A700A(1)		autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GCTCCTCAGCGCACGGTCCCT	0.667																																					p.A3540A		Atlas-SNP	.											.	IGFN1	220	.	2	Substitution - coding silent(2)	lung(2)	c.G10620T						.						79.0	63.0	68.0					1																	201195085		2203	4300	6503	SO:0001819	synonymous_variant	91156	exon22			CTCAGCGCACGGT	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10620G>T	chr1.hg19:g.201195085G>T		146.0	0.0		148.0	37.0	NM_001164586	F8WAI1|Q9NT72	Silent	SNP	ENST00000335211.4	hg19	CCDS53455.1	.	.	.	.	.	.	.	.	.	.	G	0.054	-1.240670	0.01493	.	.	ENSG00000163395	ENST00000412892	T	0.55588	0.51	5.0	-10.0	0.00425	.	1.450430	0.03910	N	0.281704	T	0.19765	0.0475	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.08493	-1.0719	7	0.05351	T	0.99	.	6.5254	0.22299	0.084:0.3982:0.3879:0.1299	.	.	.	.	S	958	ENSP00000387975:A958S	ENSP00000387975:A958S	A	+	1	0	IGFN1	199461708	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.499000	0.02285	-4.425000	0.00050	-2.516000	0.00186	GCA	.	.		0.667	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
C4BPB	725	hgsc.bcm.edu	37	1	207262708	207262708	+	Splice_Site	SNP	T	T	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:207262708T>G	ENST00000391923.1	+	1	79		c.e1+2		C4BPB_ENST00000367078.3_Intron|C4BPB_ENST00000367076.3_5'UTR|C4BPB_ENST00000243611.5_5'UTR|C4BPB_ENST00000451804.2_5'Flank	NM_001017367.1	NP_001017367.1	P20851	C4BPB_HUMAN	complement component 4 binding protein, beta						blood coagulation (GO:0007596)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)				breast(2)|lung(1)|ovary(1)	4						TTTCCTGTCGTAAGATTTTTT	0.398																																					.		Atlas-SNP	.											.	C4BPB	19	.	0			.						.																																			SO:0001630	splice_region_variant	725	.			CTGTCGTAAGATT	L11245	CCDS1476.1, CCDS31005.1	1q32	2008-07-18	2001-11-28		ENSG00000123843	ENSG00000123843			1328	protein-coding gene	gene with protein product	"""complement component 4 binding protein, beta chain"", ""C4b binding protein, beta chain"""	120831	"""complement component 4-binding protein, beta"""	C4BP		2300577, 8325877	Standard	XM_005273255		Approved		uc001hfj.3	P20851	OTTHUMG00000036035	ENST00000391923.1:c.-51+2T>G	chr1.hg19:g.207262708T>G		26.0	0.0		45.0	10.0	.	A5JYP8|D3DT81|Q5VVR0|Q9BS25	Splice_Site	SNP	ENST00000391923.1	hg19	CCDS1476.1																																																																																			.	.		0.398	C4BPB-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087846.4	NM_000716	Intron
RYR2	6262	hgsc.bcm.edu	37	1	237754162	237754162	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:237754162G>A	ENST00000366574.2	+	31	4347	c.4030G>A	c.(4030-4032)Gag>Aag	p.E1344K	RYR2_ENST00000360064.6_Missense_Mutation_p.E1342K|RYR2_ENST00000542537.1_Missense_Mutation_p.E1328K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1344	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTCTGACTTTGAGGTTCTGAT	0.493																																					p.E1344K		Atlas-SNP	.											.	RYR2	1273	.	0			c.G4030A						.						83.0	80.0	81.0					1																	237754162		1927	4142	6069	SO:0001583	missense	6262	exon31			GACTTTGAGGTTC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4030G>A	chr1.hg19:g.237754162G>A	ENSP00000355533:p.Glu1344Lys	143.0	0.0		184.0	24.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	g	24.2	4.499794	0.85176	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97186	-4.28;-4.25;-4.27	5.87	5.87	0.94306	B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000016	D	0.98046	0.9356	L	0.59436	1.845	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	D	0.97650	1.0154	10	0.46703	T	0.11	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	1344	Q92736	RYR2_HUMAN	K	1344;1342;1328	ENSP00000355533:E1344K;ENSP00000353174:E1342K;ENSP00000443798:E1328K	ENSP00000353174:E1342K	E	+	1	0	RYR2	235820785	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.534000	0.98061	2.941000	0.99782	0.655000	0.94253	GAG	.	.		0.493	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
FMN2	56776	hgsc.bcm.edu	37	1	240370837	240370837	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:240370837C>T	ENST00000319653.9	+	5	2955	c.2725C>T	c.(2725-2727)Cca>Tca	p.P909S		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	909	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGAAATGCTGCCACCCCCTCC	0.662																																					p.P909S		Atlas-SNP	.											FMN2,right_upper_lobe,carcinoma,0,1	FMN2	451	.	0			c.C2725T						.						49.0	52.0	51.0					1																	240370837		2203	4299	6502	SO:0001583	missense	56776	exon5			ATGCTGCCACCCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2725C>T	chr1.hg19:g.240370837C>T	ENSP00000318884:p.Pro909Ser	141.0	0.0		136.0	22.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	C	8.718	0.913558	0.17907	.	.	ENSG00000155816	ENST00000319653	T	0.25579	1.79	4.05	3.13	0.36017	Actin-binding FH2/DRF autoregulatory (1);	0.221828	0.31246	N	0.007990	T	0.17534	0.0421	L	0.43152	1.355	0.80722	D	1	B	0.27498	0.18	B	0.23150	0.044	T	0.04752	-1.0929	9	.	.	.	.	6.9284	0.24428	0.0:0.7473:0.0:0.2527	.	909	Q9NZ56	FMN2_HUMAN	S	909	ENSP00000318884:P909S	.	P	+	1	0	FMN2	238437460	0.007000	0.16637	0.874000	0.34290	0.429000	0.31625	1.218000	0.32467	2.256000	0.74724	0.484000	0.47621	CCA	.	.		0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
SDCCAG8	10806	hgsc.bcm.edu	37	1	243589807	243589807	+	Missense_Mutation	SNP	A	A	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:243589807A>C	ENST00000366541.3	+	16	2050	c.1932A>C	c.(1930-1932)gaA>gaC	p.E644D	SDCCAG8_ENST00000355875.4_Missense_Mutation_p.E601D|SDCCAG8_ENST00000343783.6_Missense_Mutation_p.E499D	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	644	Gln-rich.|Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GAAATGAAGAATTGGAGGAAC	0.373																																					p.E644D		Atlas-SNP	.											.	SDCCAG8	73	.	0			c.A1932C						.						141.0	125.0	130.0					1																	243589807		2203	4300	6503	SO:0001583	missense	10806	exon16			TGAAGAATTGGAG	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.1932A>C	chr1.hg19:g.243589807A>C	ENSP00000355499:p.Glu644Asp	614.0	1.0		871.0	156.0	NM_006642	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	hg19	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.479405	0.44044	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T	0.53423	0.9;0.85;0.87;0.62	6.17	-0.274	0.12910	.	0.386686	0.28538	N	0.014994	T	0.27278	0.0669	L	0.29908	0.895	0.36156	D	0.847776	B;B	0.29115	0.096;0.233	B;B	0.26202	0.039;0.067	T	0.11817	-1.0572	10	0.20519	T	0.43	-9.2946	6.4011	0.21638	0.6307:0.1177:0.2517:0.0	.	601;644	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	D	601;644;499;345	ENSP00000348137:E601D;ENSP00000355499:E644D;ENSP00000341260:E499D;ENSP00000410200:E345D	ENSP00000341260:E499D	E	+	3	2	SDCCAG8	241656430	0.997000	0.39634	0.579000	0.28588	0.213000	0.24496	1.070000	0.30653	-0.012000	0.14223	-0.250000	0.11733	GAA	.	.		0.373	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642	
KIF26B	55083	hgsc.bcm.edu	37	1	245775173	245775173	+	Missense_Mutation	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:245775173A>G	ENST00000407071.2	+	9	2433	c.1993A>G	c.(1993-1995)Agg>Ggg	p.R665G	KIF26B_ENST00000366518.4_Missense_Mutation_p.R284G|RP11-522M21.2_ENST00000418402.1_RNA	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	665	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TGCCTCCCGCAGGAGCCACCA	0.592																																					p.R665G		Atlas-SNP	.											.	KIF26B	343	.	0			c.A1993G						.						45.0	52.0	50.0					1																	245775173		2025	4174	6199	SO:0001583	missense	55083	exon9			TCCCGCAGGAGCC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1993A>G	chr1.hg19:g.245775173A>G	ENSP00000385545:p.Arg665Gly	102.0	0.0		134.0	22.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	A	13.63	2.294550	0.40594	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.75704	-0.96;-0.96	5.12	3.18	0.36537	Kinesin, motor domain (4);	.	.	.	.	T	0.77110	0.4082	L	0.49699	1.58	0.37717	D	0.924762	P;D	0.53619	0.813;0.961	P;P	0.55713	0.782;0.687	T	0.76756	-0.2842	9	0.35671	T	0.21	.	12.8117	0.57643	0.4486:0.5514:0.0:0.0	.	284;665	B7WPD9;Q2KJY2	.;KI26B_HUMAN	G	665;284;281	ENSP00000385545:R665G;ENSP00000355475:R284G	ENSP00000355475:R284G	R	+	1	2	KIF26B	243841796	0.291000	0.24352	0.548000	0.28192	0.989000	0.77384	0.863000	0.27913	0.506000	0.28125	-0.213000	0.12676	AGG	.	.		0.592	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
TPO	7173	hgsc.bcm.edu	37	2	1481106	1481106	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:1481106C>T	ENST00000345913.4	+	8	1159	c.1068C>T	c.(1066-1068)ctC>ctT	p.L356L	TPO_ENST00000346956.3_Silent_p.L356L|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000329066.4_Silent_p.L356L|TPO_ENST00000382201.3_Silent_p.L356L|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Silent_p.L356L	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	356					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ACGCGCGCCTCCGGGACTCCG	0.751																																					p.L356L		Atlas-SNP	.											.	TPO	224	.	0			c.C1068T						.						6.0	6.0	6.0					2																	1481106		2099	4130	6229	SO:0001819	synonymous_variant	7173	exon8			GCGCCTCCGGGAC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1068C>T	chr2.hg19:g.1481106C>T		983.0	0.0		957.0	221.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	ENST00000345913.4	hg19	CCDS1643.1																																																																																			.	.		0.751	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
SOS1	6654	hgsc.bcm.edu	37	2	39250230	39250230	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:39250230C>T	ENST00000426016.1	-	11	1425	c.1339G>A	c.(1339-1341)Gaa>Aaa	p.E447K	SOS1_ENST00000472480.1_5'UTR|SOS1_ENST00000395038.2_Missense_Mutation_p.E447K|SOS1_ENST00000402219.2_Missense_Mutation_p.E447K			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	447	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				AGAGTTCCTTCCATTATAAAT	0.388									Noonan syndrome																												p.E447K		Atlas-SNP	.											.	SOS1	134	.	0			c.G1339A						.						121.0	113.0	116.0					2																	39250230		2203	4300	6503	SO:0001583	missense	6654	exon10	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TTCCTTCCATTAT	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.1339G>A	chr2.hg19:g.39250230C>T	ENSP00000387784:p.Glu447Lys	105.0	0.0		112.0	16.0	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	hg19	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.694414	0.88830	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	D;D;D	0.89810	-2.57;-2.57;-2.57	5.52	5.52	0.82312	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.92008	0.7468	M	0.84082	2.675	0.80722	D	1	B;P	0.35107	0.08;0.484	B;B	0.40677	0.19;0.337	D	0.92194	0.5762	10	0.87932	D	0	.	19.8	0.96502	0.0:1.0:0.0:0.0	.	179;447	F5GX06;Q07889	.;SOS1_HUMAN	K	447;447;179;447;447	ENSP00000387784:E447K;ENSP00000384675:E447K;ENSP00000378479:E447K	ENSP00000263879:E447K	E	-	1	0	SOS1	39103734	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.666000	0.83877	2.753000	0.94483	0.557000	0.71058	GAA	.	.		0.388	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
EPB41L5	57669	hgsc.bcm.edu	37	2	120922447	120922447	+	Silent	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:120922447T>C	ENST00000263713.5	+	22	2137	c.1923T>C	c.(1921-1923)tcT>tcC	p.S641S	EPB41L5_ENST00000488691.1_3'UTR|EPB41L5_ENST00000452780.1_Silent_p.S641S|EPB41L5_ENST00000443902.2_Silent_p.S641S	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	641					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TGCTTGCATCTCTAACTGAGA	0.348																																					p.S641S		Atlas-SNP	.											.	EPB41L5	98	.	0			c.T1923C						.						120.0	114.0	116.0					2																	120922447		2203	4300	6503	SO:0001819	synonymous_variant	57669	exon22			TGCATCTCTAACT	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1923T>C	chr2.hg19:g.120922447T>C		272.0	0.0		284.0	78.0	NM_020909	Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	ENST00000263713.5	hg19	CCDS2130.1																																																																																			.	.		0.348	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
SCRN3	79634	hgsc.bcm.edu	37	2	175287757	175287757	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:175287757G>A	ENST00000272732.6	+	6	981	c.899G>A	c.(898-900)gGg>gAg	p.G300E	SCRN3_ENST00000409673.3_Missense_Mutation_p.G293E|SCRN3_ENST00000548921.1_3'UTR	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	300							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			TTCTTTACAGGGACTCCTGAT	0.433																																					p.G300E		Atlas-SNP	.											.	SCRN3	76	.	0			c.G899A						.						87.0	86.0	86.0					2																	175287757		2203	4300	6503	SO:0001583	missense	79634	exon6			TTACAGGGACTCC	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.899G>A	chr2.hg19:g.175287757G>A	ENSP00000272732:p.Gly300Glu	217.0	0.0		211.0	49.0	NM_024583	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	hg19	CCDS2258.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405641	0.42715	.	.	ENSG00000144306	ENST00000409673;ENST00000272732	T;T	0.11821	2.74;2.74	5.16	3.31	0.37934	.	0.224693	0.45361	D	0.000364	T	0.14614	0.0353	L	0.50333	1.59	0.43133	D	0.994879	B;B	0.34329	0.449;0.256	B;B	0.30495	0.116;0.055	T	0.02821	-1.1106	10	0.52906	T	0.07	-4.5348	15.4901	0.75600	0.0:0.2617:0.7383:0.0	.	293;300	B4DI11;Q0VDG4	.;SCRN3_HUMAN	E	293;300	ENSP00000387142:G293E;ENSP00000272732:G300E	ENSP00000272732:G300E	G	+	2	0	SCRN3	174996003	1.000000	0.71417	0.987000	0.45799	0.975000	0.68041	3.346000	0.52190	0.537000	0.28751	0.561000	0.74099	GGG	.	.		0.433	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583	
PDE11A	50940	hgsc.bcm.edu	37	2	178936399	178936399	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:178936399T>A	ENST00000286063.6	-	1	1083	c.766A>T	c.(766-768)Aaa>Taa	p.K256*	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	256	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	TCAAAGAATTTGGAGACCAAG	0.517									Primary Pigmented Nodular Adrenocortical Disease, Familial																												p.K256X		Atlas-SNP	.											.	PDE11A	283	.	0			c.A766T						.						70.0	67.0	68.0					2																	178936399		2203	4300	6503	SO:0001587	stop_gained	50940	exon1	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AGAATTTGGAGAC	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.766A>T	chr2.hg19:g.178936399T>A	ENSP00000286063:p.Lys256*	56.0	0.0		66.0	24.0	NM_016953	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Nonsense_Mutation	SNP	ENST00000286063.6	hg19	CCDS33334.1	.	.	.	.	.	.	.	.	.	.	T	42	9.294755	0.99128	.	.	ENSG00000128655	ENST00000286063	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8099	0.69985	0.0:0.0:0.0:1.0	.	.	.	.	X	256	.	ENSP00000286063:K256X	K	-	1	0	PDE11A	178644645	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.093000	0.63338	0.533000	0.62120	AAA	.	.		0.517	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		
PRKRA	8575	hgsc.bcm.edu	37	2	179315144	179315144	+	Intron	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:179315144A>G	ENST00000325748.4	-	2	266				DFNB59_ENST00000375129.4_5'Flank|DFNB59_ENST00000409117.3_5'Flank|PRKRA_ENST00000487082.1_Intron|PRKRA_ENST00000432031.2_Silent_p.F9F|PRKRA_ENST00000438687.3_Intron|PRKRA_ENST00000470200.1_Intron	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator						cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			CCAAACTGCAAAAACCACAAA	0.478																																					p.F9F	Melanoma(200;68 3001 23825 48764)	Atlas-SNP	.											.	PRKRA	56	.	0			c.T27C						.						143.0	151.0	148.0					2																	179315144		2203	4300	6503	SO:0001627	intron_variant	8575	exon1			ACTGCAAAAACCA	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.66-6T>C	chr2.hg19:g.179315144A>G		151.0	0.0		151.0	9.0	NM_001139517	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Silent	SNP	ENST00000325748.4	hg19	CCDS2279.1																																																																																			.	.		0.478	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	
TTN	7273	hgsc.bcm.edu	37	2	179479398	179479398	+	Silent	SNP	G	G	A	rs547682223		TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:179479398G>A	ENST00000591111.1	-	211	44144	c.43920C>T	c.(43918-43920)acC>acT	p.T14640T	TTN_ENST00000342992.6_Silent_p.T13713T|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Silent_p.T7341T|TTN_ENST00000460472.2_Silent_p.T7216T|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.T7408T|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.T16281T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14640	Ig-like 96.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCCGGTTACGGTGGCAGGAA	0.423													g|||	1	0.000199681	0.0	0.0	5008	,	,		19341	0.001		0.0	False		,,,				2504	0.0				p.T16281T		Atlas-SNP	.											.	TTN	18412	.	0			c.C48843T						.						90.0	81.0	84.0					2																	179479398		1865	4103	5968	SO:0001819	synonymous_variant	7273	exon261			GGTTACGGTGGCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.43920C>T	chr2.hg19:g.179479398G>A		133.0	0.0		135.0	43.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179574397	179574397	+	Missense_Mutation	SNP	A	A	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:179574397A>T	ENST00000591111.1	-	97	27922	c.27698T>A	c.(27697-27699)gTg>gAg	p.V9233E	TTN_ENST00000342992.6_Missense_Mutation_p.V8306E|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.V9550E|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13356	Ig-like 75.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTTGCAGCACTAACGTGTT	0.438																																					p.V9550E		Atlas-SNP	.											.	TTN	18412	.	0			c.T28649A						.						190.0	192.0	191.0					2																	179574397		2025	4179	6204	SO:0001583	missense	7273	exon99			TGCAGCACTAACG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27698T>A	chr2.hg19:g.179574397A>T	ENSP00000465570:p.Val9233Glu	121.0	0.0		131.0	28.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.99	1.508527	0.27036	.	.	ENSG00000155657	ENST00000342992	T	0.65549	-0.16	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62780	0.2456	L	0.56124	1.755	0.80722	D	1	B	0.21381	0.055	B	0.29440	0.102	T	0.61893	-0.6969	9	0.87932	D	0	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	9233	Q8WZ42	TITIN_HUMAN	E	8306	ENSP00000343764:V8306E	ENSP00000343764:V8306E	V	-	2	0	TTN	179282642	0.993000	0.37304	0.953000	0.39169	0.103000	0.19146	4.213000	0.58520	2.254000	0.74563	0.533000	0.62120	GTG	.	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PDE1A	5136	hgsc.bcm.edu	37	2	183129032	183129032	+	Missense_Mutation	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:183129032T>C	ENST00000410103.1	-	3	294	c.211A>G	c.(211-213)Aca>Gca	p.T71A	PDE1A_ENST00000435564.1_Missense_Mutation_p.T71A|PDE1A_ENST00000358139.2_Missense_Mutation_p.T71A|PDE1A_ENST00000409365.1_Missense_Mutation_p.T55A|PDE1A_ENST00000351439.5_Missense_Mutation_p.T55A|PDE1A_ENST00000456212.1_Missense_Mutation_p.T71A|PDE1A_ENST00000331935.6_Missense_Mutation_p.T71A|PDE1A_ENST00000536095.1_5'UTR	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent	71					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	ACTTACCTTGTTTCATCGATA	0.388																																					p.T75A		Atlas-SNP	.											.	PDE1A	184	.	0			c.A223G						.						105.0	100.0	102.0					2																	183129032		2202	4300	6502	SO:0001583	missense	5136	exon3			ACCTTGTTTCATC		CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.211A>G	chr2.hg19:g.183129032T>C	ENSP00000387037:p.Thr71Ala	219.0	0.0		262.0	36.0	NM_001258312	D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Missense_Mutation	SNP	ENST00000410103.1	hg19	CCDS33344.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336046	0.60963	.	.	ENSG00000115252	ENST00000435564;ENST00000409365;ENST00000331935;ENST00000351439;ENST00000410103;ENST00000358139;ENST00000456212	T;T;T;T;T;T;T	0.71103	-0.54;-0.51;-0.54;-0.51;-0.53;-0.53;-0.53	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	L	0.50333	1.59	0.80722	D	1	B;B;B	0.25521	0.052;0.128;0.086	B;B;B	0.30782	0.023;0.12;0.075	T	0.61917	-0.6964	10	0.22109	T	0.4	.	15.1461	0.72653	0.0:0.0:0.0:1.0	.	71;55;71	P54750;P54750-2;P54750-4	PDE1A_HUMAN;.;.	A	71;55;71;55;71;71;71	ENSP00000410309:T71A;ENSP00000386767:T55A;ENSP00000331574:T71A;ENSP00000309269:T55A;ENSP00000387037:T71A;ENSP00000350858:T71A;ENSP00000408874:T71A	ENSP00000331574:T71A	T	-	1	0	PDE1A	182837277	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.372000	0.79612	2.308000	0.77769	0.533000	0.62120	ACA	.	.		0.388	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334356.1		
STAT1	6772	hgsc.bcm.edu	37	2	191859857	191859857	+	Missense_Mutation	SNP	C	C	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:191859857C>G	ENST00000361099.3	-	10	1261	c.874G>C	c.(874-876)Gac>Cac	p.D292H	STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Missense_Mutation_p.D292H|STAT1_ENST00000392323.2_Missense_Mutation_p.D294H|STAT1_ENST00000392322.3_Missense_Mutation_p.D292H	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	292					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			GTGATAGGGTCATGTTCGTAG	0.443																																					p.D292H		Atlas-SNP	.											.	STAT1	93	.	0			c.G874C						.						158.0	137.0	144.0					2																	191859857		2203	4300	6503	SO:0001583	missense	6772	exon10			TAGGGTCATGTTC		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.874G>C	chr2.hg19:g.191859857C>G	ENSP00000354394:p.Asp292His	68.0	0.0		65.0	21.0	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	hg19	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661128	0.88154	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.66	5.66	0.87406	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.000000	0.85682	D	0.000000	D	0.84257	0.5432	M	0.85462	2.755	0.80722	D	1	D;D	0.76494	0.999;0.981	D;P	0.71870	0.975;0.891	D	0.86021	0.1507	10	0.72032	D	0.01	-25.2597	19.7589	0.96306	0.0:1.0:0.0:0.0	.	292;292	P42224-2;P42224	.;STAT1_HUMAN	H	292;292;292;294	ENSP00000354394:D292H;ENSP00000386244:D292H;ENSP00000376136:D292H;ENSP00000376137:D294H	ENSP00000354394:D292H	D	-	1	0	STAT1	191568102	1.000000	0.71417	0.952000	0.39060	0.722000	0.41435	7.696000	0.84270	2.662000	0.90505	0.557000	0.71058	GAC	.	.		0.443	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
ANKZF1	55139	hgsc.bcm.edu	37	2	220099637	220099637	+	Missense_Mutation	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:220099637G>T	ENST00000323348.5	+	10	1468	c.1294G>T	c.(1294-1296)Gta>Tta	p.V432L	ANKZF1_ENST00000409849.1_Missense_Mutation_p.V222L|ANKZF1_ENST00000410034.3_Missense_Mutation_p.V432L|GLB1L_ENST00000497855.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	432						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGAGTCTGAAGTATTGCCCAA	0.507																																					p.V432L		Atlas-SNP	.											.	ANKZF1	45	.	0			c.G1294T						.						61.0	69.0	66.0					2																	220099637		2138	4259	6397	SO:0001583	missense	55139	exon10			TCTGAAGTATTGC	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1294G>T	chr2.hg19:g.220099637G>T	ENSP00000321617:p.Val432Leu	129.0	0.0		150.0	35.0	NM_001042410	Q9NVZ4	Missense_Mutation	SNP	ENST00000323348.5	hg19	CCDS42821.1	.	.	.	.	.	.	.	.	.	.	G	8.035	0.762632	0.15914	.	.	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.27104	1.69;1.89;1.69	5.41	2.37	0.29283	.	0.114147	0.64402	D	0.000016	T	0.21631	0.0521	L	0.53249	1.67	0.40514	D	0.98076	B	0.14012	0.009	B	0.12156	0.007	T	0.05971	-1.0853	10	0.32370	T	0.25	-5.8995	8.1423	0.31091	0.0792:0.0:0.6294:0.2915	.	432	Q9H8Y5	ANKZ1_HUMAN	L	432;222;432	ENSP00000321617:V432L;ENSP00000386815:V222L;ENSP00000386337:V432L	ENSP00000321617:V432L	V	+	1	0	ANKZF1	219807881	0.984000	0.35163	0.708000	0.30435	0.601000	0.36947	2.031000	0.41117	0.825000	0.34637	0.591000	0.81541	GTA	.	.		0.507	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
ANO7	50636	hgsc.bcm.edu	37	2	242135166	242135166	+	Missense_Mutation	SNP	A	A	G	rs199644599		TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr2:242135166A>G	ENST00000274979.8	+	4	480	c.377A>G	c.(376-378)cAg>cGg	p.Q126R	ANO7_ENST00000402530.3_Missense_Mutation_p.Q125R|ANO7_ENST00000402430.3_Missense_Mutation_p.Q125R	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	126					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GACAGGCAGCAGGACAGTGCC	0.607																																					p.Q126R		Atlas-SNP	.											.	ANO7	136	.	0			c.A377G						.	A	ARG/GLN,ARG/GLN	0,4406		0,0,2203	88.0	77.0	81.0		377,374	-1.9	0.0	2		81	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ANO7	NM_001001891.3,NM_001001666.3	43,43	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign	126/934,125/180	242135166	1,13005	2203	4300	6503	SO:0001583	missense	50636	exon4			GGCAGCAGGACAG	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.377A>G	chr2.hg19:g.242135166A>G	ENSP00000274979:p.Gln126Arg	115.0	0.0		99.0	29.0	NM_001001891	Q6IWH6	Missense_Mutation	SNP	ENST00000274979.8	hg19	CCDS33423.1	.	.	.	.	.	.	.	.	.	.	A	8.261	0.811176	0.16537	0.0	1.16E-4	ENSG00000146205	ENST00000274979;ENST00000402530;ENST00000402430	T;T;T	0.70164	-0.25;0.89;-0.46	2.98	-1.91	0.07641	.	.	.	.	.	T	0.42108	0.1188	L	0.29908	0.895	0.09310	N	1	B;B	0.27656	0.001;0.184	B;B	0.19666	0.001;0.026	T	0.19451	-1.0305	9	0.17369	T	0.5	.	1.2421	0.01965	0.5301:0.1729:0.1123:0.1847	.	126;125	Q6IWH7;Q6IWH7-2	ANO7_HUMAN;.	R	126;125;125	ENSP00000274979:Q126R;ENSP00000383985:Q125R;ENSP00000385418:Q125R	ENSP00000274979:Q126R	Q	+	2	0	ANO7	241783839	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	0.310000	0.19356	-0.499000	0.06623	0.383000	0.25322	CAG	.	.		0.607	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323509.1	NM_001001891	
SLC6A6	6533	hgsc.bcm.edu	37	3	14487226	14487226	+	Splice_Site	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr3:14487226T>C	ENST00000454876.2	+	4	560	c.231T>C	c.(229-231)ggT>ggC	p.G77G	SLC6A6_ENST00000360861.3_Splice_Site_p.G77G|SLC6A6_ENST00000484191.1_3'UTR|SLC6A6_ENST00000416216.2_Splice_Site_p.G77G			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	77					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						TCTCTGCAGGTGCGTTTCTCA	0.542																																					p.G77G		Atlas-SNP	.											.	SLC6A6	58	.	0			c.T231C						.						170.0	152.0	158.0					3																	14487226		2203	4300	6503	SO:0001630	splice_region_variant	6533	exon4			TGCAGGTGCGTTT		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.230-1T>C	chr3.hg19:g.14487226T>C		96.0	0.0		73.0	20.0	NM_003043	B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	ENST00000454876.2	hg19	CCDS33705.1																																																																																			.	.		0.542	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	Silent
BSN	8927	hgsc.bcm.edu	37	3	49700756	49700756	+	Missense_Mutation	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr3:49700756A>G	ENST00000296452.4	+	7	11279	c.11165A>G	c.(11164-11166)aAg>aGg	p.K3722R		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3722					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TCTGACAGCAAGAAGGGCTCC	0.632																																					p.K3722R		Atlas-SNP	.											.	BSN	272	.	0			c.A11165G						.						82.0	82.0	82.0					3																	49700756		2203	4300	6503	SO:0001583	missense	8927	exon7			ACAGCAAGAAGGG	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.11165A>G	chr3.hg19:g.49700756A>G	ENSP00000296452:p.Lys3722Arg	80.0	0.0		77.0	15.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	hg19	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.309986	0.40895	.	.	ENSG00000164061	ENST00000296452	T	0.18016	2.24	4.99	4.99	0.66335	.	0.396353	0.25601	N	0.029541	T	0.12347	0.0300	L	0.40543	1.245	0.33399	D	0.577052	P	0.44734	0.842	B	0.35114	0.196	T	0.22521	-1.0214	10	0.25751	T	0.34	-19.339	11.2828	0.49206	0.8476:0.1524:0.0:0.0	.	3722	Q9UPA5	BSN_HUMAN	R	3722	ENSP00000296452:K3722R	ENSP00000296452:K3722R	K	+	2	0	BSN	49675760	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.919000	0.40015	1.861000	0.53984	0.260000	0.18958	AAG	.	.		0.632	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
ROBO1	6091	hgsc.bcm.edu	37	3	78706316	78706316	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr3:78706316C>T	ENST00000464233.1	-	18	2659	c.2546G>A	c.(2545-2547)aGt>aAt	p.S849N	ROBO1_ENST00000467549.1_Missense_Mutation_p.S813N|ROBO1_ENST00000495273.1_Missense_Mutation_p.S813N|ROBO1_ENST00000436010.2_Missense_Mutation_p.S810N	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	849	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CACTTCCACACTGTATCGGAT	0.512																																					p.S849N		Atlas-SNP	.											.	ROBO1	833	.	0			c.G2546A						.						54.0	58.0	56.0					3																	78706316		1983	4173	6156	SO:0001583	missense	6091	exon18			TCCACACTGTATC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2546G>A	chr3.hg19:g.78706316C>T	ENSP00000420321:p.Ser849Asn	146.0	0.0		144.0	34.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	hg19	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740716	0.69304	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	6.04	6.04	0.98038	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.109901	0.85682	D	0.000000	T	0.66396	0.2785	L	0.44542	1.39	0.54753	D	0.999987	P;D;D;P;P	0.67145	0.939;0.987;0.996;0.888;0.935	P;D;D;P;P	0.65573	0.503;0.926;0.936;0.777;0.669	T	0.59830	-0.7380	9	.	.	.	.	20.6396	0.99537	0.0:1.0:0.0:0.0	.	813;849;813;813;810	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	N	810;813;849;813;813;853	ENSP00000406043:S810N;ENSP00000420321:S849N;ENSP00000420637:S813N;ENSP00000417992:S813N	.	S	-	2	0	ROBO1	78789006	1.000000	0.71417	0.997000	0.53966	0.228000	0.25075	4.836000	0.62789	2.881000	0.98747	0.650000	0.86243	AGT	.	.		0.512	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
ADCY5	111	hgsc.bcm.edu	37	3	123046605	123046605	+	Splice_Site	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr3:123046605G>A	ENST00000462833.1	-	7	3019	c.1807C>T	c.(1807-1809)Cgc>Tgc	p.R603C	ADCY5_ENST00000491190.1_Splice_Site_p.R236C|ADCY5_ENST00000309879.5_Splice_Site_p.R253C	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	603					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		ATGTGGATGCGTCTACAGGGG	0.557																																					p.R603C		Atlas-SNP	.											.	ADCY5	169	.	0			c.C1807T						.						68.0	56.0	60.0					3																	123046605		2203	4300	6503	SO:0001630	splice_region_variant	111	exon7			GGATGCGTCTACA	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1806-1C>T	chr3.hg19:g.123046605G>A		77.0	0.0		96.0	24.0	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	hg19	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382739	0.82792	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.52	4.63	0.57726	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.64402	D	0.000001	D	0.90614	0.7057	M	0.86573	2.825	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.97110	0.89;1.0	D	0.91789	0.5442	10	0.56958	D	0.05	.	15.5175	0.75837	0.0:0.0:0.8606:0.1394	.	603;236	O95622;B3KWA8	ADCY5_HUMAN;.	C	603;236;253;162	ENSP00000419361:R603C;ENSP00000418537:R236C;ENSP00000308685:R253C;ENSP00000420082:R162C	ENSP00000308685:R253C	R	-	1	0	ADCY5	124529295	1.000000	0.71417	0.986000	0.45419	0.847000	0.48162	7.915000	0.87484	1.274000	0.44362	0.655000	0.94253	CGC	.	.		0.557	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	Missense_Mutation
MAN2B2	23324	hgsc.bcm.edu	37	4	6602390	6602390	+	Silent	SNP	G	G	A	rs376601093		TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr4:6602390G>A	ENST00000285599.3	+	10	1482	c.1446G>A	c.(1444-1446)ccG>ccA	p.P482P	MAN2B2_ENST00000504248.1_Silent_p.P431P	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	482					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						TCTACAACCCGCTGGCCTGGA	0.592																																					p.P482P		Atlas-SNP	.											.	MAN2B2	80	.	0			c.G1446A						.						149.0	117.0	128.0					4																	6602390		2203	4300	6503	SO:0001819	synonymous_variant	23324	exon10			CAACCCGCTGGCC	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1446G>A	chr4.hg19:g.6602390G>A		103.0	0.0		76.0	4.0	NM_015274	Q66MP2|Q86T67	Silent	SNP	ENST00000285599.3	hg19	CCDS33951.1	.	.	.	.	.	.	.	.	.	.	g	1.930	-0.446246	0.04604	.	.	ENSG00000013288	ENST00000505907	.	.	.	4.67	-2.0	0.07433	.	.	.	.	.	T	0.38719	0.1051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27434	-1.0074	4	.	.	.	-29.3766	1.041	0.01559	0.2933:0.2926:0.2471:0.167	.	.	.	.	H	481	.	.	R	+	2	0	MAN2B2	6653291	0.051000	0.20477	0.987000	0.45799	0.139000	0.21198	-1.276000	0.02815	-0.462000	0.06984	-2.005000	0.00442	CGC	.	.		0.592	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
COX18	285521	hgsc.bcm.edu	37	4	73931079	73931079	+	Silent	SNP	T	T	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr4:73931079T>G	ENST00000295890.4	-	3	577	c.486A>C	c.(484-486)cgA>cgC	p.R162R	COX18_ENST00000507544.2_Silent_p.R162R	NM_173827.2	NP_776188.1	Q8N8Q8	COX18_HUMAN	COX18 cytochrome C oxidase assembly factor	162					protein insertion into mitochondrial membrane (GO:0051204)|protein transport (GO:0015031)|respiratory chain complex IV assembly (GO:0008535)	integral component of mitochondrial inner membrane (GO:0031305)	protein transporter activity (GO:0008565)			large_intestine(4)|lung(2)	6	Breast(15;0.00096)		Epithelial(6;1.26e-06)|OV - Ovarian serous cystadenocarcinoma(6;9.45e-06)|all cancers(17;2.05e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGCAGTTATCTCGCACATATA	0.433																																					p.R162R		Atlas-SNP	.											.	COX18	20	.	0			c.A486C						.						122.0	115.0	118.0					4																	73931079		2203	4300	6503	SO:0001819	synonymous_variant	285521	exon3			GTTATCTCGCACA	AY957564	CCDS3554.1, CCDS75139.1	4q13.3	2013-06-12	2013-06-12		ENSG00000163626	ENSG00000163626		"""Mitochondrial respiratory chain complex assembly factors"""	26801	protein-coding gene	gene with protein product		610428	"""COX18 cytochrome c oxidase assembly homolog (S. cerevisiae)"", ""cytochrome c oxidase assembly homolog 18 (yeast)"""			16212937, 16911509	Standard	XM_005265679		Approved	FLJ38991	uc003hgm.1	Q8N8Q8	OTTHUMG00000129917	ENST00000295890.4:c.486A>C	chr4.hg19:g.73931079T>G		188.0	0.0		161.0	7.0	NM_173827	Q2PB66|Q2PB67|Q2PB68|Q49B97|Q6IPP9	Silent	SNP	ENST00000295890.4	hg19	CCDS3554.1																																																																																			.	.		0.433	COX18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252169.2	NM_173827	
ALB	213	hgsc.bcm.edu	37	4	74280813	74280813	+	Missense_Mutation	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr4:74280813G>T	ENST00000503124.1	+	7	877	c.670G>T	c.(670-672)Gcc>Tcc	p.A224S	ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Missense_Mutation_p.A259S|ALB_ENST00000295897.4_Missense_Mutation_p.A374S|ALB_ENST00000509063.1_Missense_Mutation_p.A374S|ALB_ENST00000415165.2_Missense_Mutation_p.A182S			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCTGAGACTTGCCAAGACATA	0.388																																					p.A374S		Atlas-SNP	.											.	ALB	132	.	0			c.G1120T						.						146.0	143.0	144.0					4																	74280813		2203	4300	6503	SO:0001583	missense	213	exon9			AGACTTGCCAAGA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.670G>T	chr4.hg19:g.74280813G>T	ENSP00000421027:p.Ala224Ser	131.0	0.0		137.0	38.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.49|19.49	3.838263|3.838263	0.71373|0.71373	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202|ENST00000511370	T;T;T;T;T|.	0.76709|.	-1.04;-1.04;-1.04;-1.04;-1.04|.	5.84|5.84	5.84|5.84	0.93424|0.93424	Serum albumin-like (1);Serum albumin, N-terminal (3);|.	0.138111|.	0.49916|.	D|.	0.000136|.	T|T	0.79046|0.79046	0.4380|0.4380	M|M	0.80982|0.80982	2.52|2.52	0.52099|0.52099	D|D	0.999941|0.999941	P;P;P;P;P|.	0.50528|.	0.936;0.673;0.723;0.535;0.535|.	D;P;P;P;P|.	0.67231|.	0.95;0.844;0.761;0.784;0.784|.	T|T	0.78785|0.78785	-0.2068|-0.2068	10|5	0.66056|.	D|.	0.02|.	-13.5493|-13.5493	18.6984|18.6984	0.91611|0.91611	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	259;182;224;374;374|.	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768|.	.;.;.;.;ALBU_HUMAN|.	S|F	374;182;224;374;259;383|218	ENSP00000295897:A374S;ENSP00000401820:A182S;ENSP00000421027:A224S;ENSP00000422784:A374S;ENSP00000384695:A259S|.	ENSP00000295897:A374S|.	A|C	+|+	1|2	0|0	ALB|ALB	74499677|74499677	1.000000|1.000000	0.71417|0.71417	0.958000|0.958000	0.39756|0.39756	0.299000|0.299000	0.27559|0.27559	2.901000|2.901000	0.48695|0.48695	2.765000|2.765000	0.95021|0.95021	0.655000|0.655000	0.94253|0.94253	GCC|TGC	.	.		0.388	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
MMRN1	22915	hgsc.bcm.edu	37	4	90816240	90816240	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr4:90816240C>T	ENST00000394980.1	+	2	437	c.118C>T	c.(118-120)Cct>Tct	p.P40S	MMRN1_ENST00000264790.2_Missense_Mutation_p.P40S|MMRN1_ENST00000394981.1_Missense_Mutation_p.P40S			Q13201	MMRN1_HUMAN	multimerin 1	40					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GAAGACTATGCCTTCTGCTTC	0.448																																					p.P40S		Atlas-SNP	.											.	MMRN1	174	.	0			c.C118T						.						80.0	88.0	85.0					4																	90816240		2203	4300	6503	SO:0001583	missense	22915	exon1			ACTATGCCTTCTG	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.118C>T	chr4.hg19:g.90816240C>T	ENSP00000378431:p.Pro40Ser	101.0	0.0		92.0	18.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	hg19	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	C	7.804	0.714296	0.15306	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981	T;T;T	0.69435	0.28;0.28;-0.4	4.67	-4.62	0.03370	.	0.778991	0.11199	N	0.589080	T	0.32194	0.0821	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.09377	0.0;0.004	T	0.19910	-1.0291	10	0.17832	T	0.49	.	0.4684	0.00528	0.2632:0.1518:0.2937:0.2913	.	40;40	Q13201-2;Q13201	.;MMRN1_HUMAN	S	40	ENSP00000378431:P40S;ENSP00000264790:P40S;ENSP00000378432:P40S	ENSP00000264790:P40S	P	+	1	0	MMRN1	91035263	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.081000	0.14823	-0.506000	0.06558	-0.363000	0.07495	CCT	.	.		0.448	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
SLC12A7	10723	hgsc.bcm.edu	37	5	1053548	1053548	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr5:1053548C>T	ENST00000264930.5	-	23	3119	c.3076G>A	c.(3076-3078)Gtc>Atc	p.V1026I		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	1026					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TTGAGGACGACGCCATTGAGC	0.632																																					p.V1026I		Atlas-SNP	.											SLC12A7,NS,neuroblastoma,0,1	SLC12A7	97	.	0			c.G3076A						.						170.0	133.0	145.0					5																	1053548		2203	4300	6503	SO:0001583	missense	10723	exon23			GGACGACGCCATT	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.3076G>A	chr5.hg19:g.1053548C>T	ENSP00000264930:p.Val1026Ile	80.0	0.0		72.0	13.0	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	hg19	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.096368	0.36952	.	.	ENSG00000113504	ENST00000264930	T	0.63913	-0.07	3.88	3.88	0.44766	.	0.077059	0.52532	D	0.000075	T	0.53514	0.1801	L	0.48174	1.505	0.50039	D	0.999842	B	0.20887	0.049	B	0.20184	0.028	T	0.50841	-0.8780	10	0.23891	T	0.37	.	13.6707	0.62422	0.0:1.0:0.0:0.0	.	1026	Q9Y666	S12A7_HUMAN	I	1026	ENSP00000264930:V1026I	ENSP00000264930:V1026I	V	-	1	0	SLC12A7	1106548	0.997000	0.39634	0.084000	0.20598	0.549000	0.35272	3.833000	0.55790	1.885000	0.54596	0.491000	0.48974	GTC	.	.		0.632	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
EDIL3	10085	hgsc.bcm.edu	37	5	83402637	83402637	+	Missense_Mutation	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr5:83402637G>T	ENST00000296591.5	-	6	899	c.481C>A	c.(481-483)Cca>Aca	p.P161T	EDIL3_ENST00000380138.3_Missense_Mutation_p.P151T	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	161	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		ATTCCCAGTGGGCCTGAGCAT	0.368																																					p.P161T		Atlas-SNP	.											.	EDIL3	94	.	0			c.C481A						.						123.0	131.0	129.0					5																	83402637		2203	4299	6502	SO:0001583	missense	10085	exon6			CCAGTGGGCCTGA	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.481C>A	chr5.hg19:g.83402637G>T	ENSP00000296591:p.Pro161Thr	136.0	0.0		131.0	21.0	NM_005711	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	hg19	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	G	15.26	2.781884	0.49891	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.99259	-5.64;-5.64	5.86	5.86	0.93980	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.215828	0.49305	D	0.000158	D	0.98789	0.9592	M	0.82923	2.615	0.80722	D	1	P;B	0.41848	0.763;0.107	B;B	0.39027	0.288;0.065	D	0.99924	1.1270	10	0.72032	D	0.01	-14.9132	20.1891	0.98225	0.0:0.0:1.0:0.0	.	151;161	O43854-2;O43854	.;EDIL3_HUMAN	T	161;151	ENSP00000296591:P161T;ENSP00000369483:P151T	ENSP00000296591:P161T	P	-	1	0	EDIL3	83438393	1.000000	0.71417	0.984000	0.44739	0.240000	0.25518	9.209000	0.95087	2.787000	0.95880	0.650000	0.86243	CCA	.	.		0.368	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	
NEUROG1	4762	hgsc.bcm.edu	37	5	134870884	134870884	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr5:134870884G>A	ENST00000314744.4	-	1	755	c.497C>T	c.(496-498)cCg>cTg	p.P166L		NM_006161.2	NP_006152.2	Q92886	NGN1_HUMAN	neurogenin 1	166					cell fate commitment (GO:0045165)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perikaryon (GO:0043204)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			endometrium(1)|liver(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCACTGCGGCGGCAGGAGGCG	0.746																																					p.P166L		Atlas-SNP	.											.	NEUROG1	18	.	0			c.C497T						.						11.0	15.0	14.0					5																	134870884		2151	4239	6390	SO:0001583	missense	4762	exon1			TGCGGCGGCAGGA	U63842	CCDS4187.1	5q23-q31	2013-05-21			ENSG00000181965	ENSG00000181965		"""Basic helix-loop-helix proteins"""	7764	protein-coding gene	gene with protein product	"""neurogenic differentiation 3"""	601726		NEUROD3		9119405	Standard	NM_006161		Approved	AKA, Math4C, ngn1, bHLHa6	uc003lax.3	Q92886	OTTHUMG00000129138	ENST00000314744.4:c.497C>T	chr5.hg19:g.134870884G>A	ENSP00000317580:p.Pro166Leu	80.0	0.0		82.0	25.0	NM_006161	Q5U0Q9|Q96HE1	Missense_Mutation	SNP	ENST00000314744.4	hg19	CCDS4187.1	.	.	.	.	.	.	.	.	.	.	G	5.123	0.208348	0.09757	.	.	ENSG00000181965	ENST00000314744	D	0.95853	-3.83	5.05	3.21	0.36854	Helix-loop-helix DNA-binding (1);	0.395940	0.22744	N	0.056170	D	0.82674	0.5088	N	0.01874	-0.695	0.24034	N	0.996109	B	0.11235	0.004	B	0.04013	0.001	T	0.71781	-0.4489	10	0.16896	T	0.51	-34.5207	4.858	0.13570	0.1504:0.0:0.5331:0.3165	.	166	Q92886	NGN1_HUMAN	L	166	ENSP00000317580:P166L	ENSP00000317580:P166L	P	-	2	0	NEUROG1	134898783	0.000000	0.05858	0.992000	0.48379	0.178000	0.23041	-0.251000	0.08818	1.060000	0.40578	0.655000	0.94253	CCG	.	.		0.746	NEUROG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251192.1	NM_006161	
PCDHB3	56132	hgsc.bcm.edu	37	5	140480872	140480872	+	Silent	SNP	C	C	T	rs148121148		TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr5:140480872C>T	ENST00000231130.2	+	1	639	c.639C>T	c.(637-639)acC>acT	p.T213T	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAACGCTCACCGCGCTGGACG	0.562																																					p.T213T		Atlas-SNP	.											PCDHB3,NS,adenoma,0,1	PCDHB3	208	.	0			c.C639T						.	C		1,4405	2.1+/-5.4	0,1,2202	51.0	51.0	51.0		639	-10.2	0.0	5	dbSNP_134	51	0,8600		0,0,4300	no	coding-synonymous	PCDHB3	NM_018937.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		213/797	140480872	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56132	exon1			GCTCACCGCGCTG	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.639C>T	chr5.hg19:g.140480872C>T		134.0	0.0		123.0	22.0	NM_018937	B2R8P2	Silent	SNP	ENST00000231130.2	hg19	CCDS4245.1																																																																																			.	C|1.000;T|0.000		0.562	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDH12	51294	hgsc.bcm.edu	37	5	141329103	141329103	+	Silent	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr5:141329103G>A	ENST00000231484.3	-	3	4234	c.3024C>T	c.(3022-3024)ggC>ggT	p.G1008G	AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	1008					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTCTGTCTGGCCTCCAGCCC	0.527																																					p.G1008G		Atlas-SNP	.											.	PCDH12	133	.	0			c.C3024T						.						139.0	131.0	134.0					5																	141329103		2203	4300	6503	SO:0001819	synonymous_variant	51294	exon3			TGTCTGGCCTCCA	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.3024C>T	chr5.hg19:g.141329103G>A		94.0	0.0		95.0	23.0	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	hg19	CCDS4269.1																																																																																			.	.		0.527	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
STK10	6793	hgsc.bcm.edu	37	5	171471887	171471887	+	Silent	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr5:171471887T>C	ENST00000176763.5	-	19	3249	c.2906A>G	c.(2905-2907)tAa>tGa	p.*969*		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	0					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGGCGGTTGTTAAGAAGCATC	0.587																																					p.X969X		Atlas-SNP	.											.	STK10	100	.	0			c.A2906G						.						69.0	70.0	70.0					5																	171471887		2203	4300	6503	SO:0001819	synonymous_variant	6793	exon19			GGTTGTTAAGAAG	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2906A>G	chr5.hg19:g.171471887T>C		63.0	0.0		72.0	22.0	NM_005990	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	ENST00000176763.5	hg19	CCDS34290.1																																																																																			.	.		0.587	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372374.2	NM_005990	
N4BP3	23138	hgsc.bcm.edu	37	5	177548182	177548182	+	Silent	SNP	T	T	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr5:177548182T>A	ENST00000274605.5	+	4	1295	c.936T>A	c.(934-936)gcT>gcA	p.A312A		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	312						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCAGAAGGCTGAGCGCAGCG	0.672											OREG0017096	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A312A		Atlas-SNP	.											.	N4BP3	25	.	0			c.T936A						.						11.0	12.0	12.0					5																	177548182		2193	4289	6482	SO:0001819	synonymous_variant	23138	exon4			GAAGGCTGAGCGC	AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.936T>A	chr5.hg19:g.177548182T>A		49.0	0.0	1939	77.0	14.0	NM_015111	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Silent	SNP	ENST00000274605.5	hg19	CCDS34307.1																																																																																			.	.		0.672	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373552.2	NM_015111	
F13A1	2162	hgsc.bcm.edu	37	6	6225010	6225010	+	Silent	SNP	A	A	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr6:6225010A>T	ENST00000264870.3	-	7	1147	c.882T>A	c.(880-882)acT>acA	p.T294T		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	294					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CAACGCTTCCAGTCCAGGCCG	0.498																																					p.T294T		Atlas-SNP	.											.	F13A1	135	.	0			c.T882A						.						99.0	99.0	99.0					6																	6225010		2203	4300	6503	SO:0001819	synonymous_variant	2162	exon7			GCTTCCAGTCCAG	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.882T>A	chr6.hg19:g.6225010A>T		165.0	0.0		154.0	28.0	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Silent	SNP	ENST00000264870.3	hg19	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.454408	0.26161	.	.	ENSG00000124491	ENST00000445223	.	.	.	5.51	-6.28	0.02020	.	.	.	.	.	T	0.17195	0.0413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40327	-0.9569	4	.	.	.	.	0.4812	0.00548	0.207:0.1815:0.2471:0.3644	.	.	.	.	Q	11	.	.	L	-	2	0	F13A1	6170009	0.000000	0.05858	0.883000	0.34634	0.960000	0.62799	-6.324000	0.00070	-1.488000	0.01847	0.460000	0.39030	CTG	.	.		0.498	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
HIST1H2BM	8342	hgsc.bcm.edu	37	6	27783152	27783152	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr6:27783152G>A	ENST00000359465.4	+	1	331	c.331G>A	c.(331-333)Gcc>Acc	p.A111T	HIST1H2AJ_ENST00000333151.3_5'Flank	NM_003521.2	NP_003512.1	Q99879	H2B1M_HUMAN	histone cluster 1, H2bm	111					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	12						GGCCAAGCACGCCGTGTCCGA	0.617																																					p.A111T		Atlas-SNP	.											.	HIST1H2BM	36	.	0			c.G331A						.						56.0	58.0	57.0					6																	27783152		2203	4300	6503	SO:0001583	missense	8342	exon1			AAGCACGCCGTGT	Z83738	CCDS4629.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196374	ENSG00000273703		"""Histones / Replication-dependent"""	4750	protein-coding gene	gene with protein product		602802	"""H2B histone family, member E"", ""histone 1, H2bm"""	H2BFE		9439656, 12408966	Standard	NM_003521		Approved	H2B/e, dJ160A22.3	uc003njo.3	Q99879	OTTHUMG00000014489	ENST00000359465.4:c.331G>A	chr6.hg19:g.27783152G>A	ENSP00000352442:p.Ala111Thr	62.0	0.0		55.0	8.0	NM_003521	Q6NWQ3	Missense_Mutation	SNP	ENST00000359465.4	hg19	CCDS4629.1	.	.	.	.	.	.	.	.	.	.	.	9.718	1.158902	0.21454	.	.	ENSG00000196374	ENST00000359465	T	0.36340	1.26	4.34	4.34	0.51931	Histone-fold (2);	0.000000	0.56097	U	0.000026	T	0.33614	0.0869	M	0.86420	2.815	0.58432	D	0.999999	B	0.24317	0.101	B	0.14023	0.01	T	0.45906	-0.9229	10	0.59425	D	0.04	.	16.3606	0.83263	0.0:0.0:1.0:0.0	.	111	Q99879	H2B1M_HUMAN	T	111	ENSP00000352442:A111T	ENSP00000352442:A111T	A	+	1	0	HIST1H2BM	27891131	1.000000	0.71417	0.999000	0.59377	0.031000	0.12232	9.129000	0.94430	2.391000	0.81399	0.563000	0.77884	GCC	.	.		0.617	HIST1H2BM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040157.1	NM_003521	
OR2H1	26716	hgsc.bcm.edu	37	6	29430083	29430083	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr6:29430083C>T	ENST00000377136.1	+	4	1002	c.537C>T	c.(535-537)gtC>gtT	p.V179V	OR2H1_ENST00000377133.1_Silent_p.V179V|OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000377132.1_Silent_p.V179V|OR2H1_ENST00000442615.1_Silent_p.V179V|OR2H1_ENST00000396792.2_Silent_p.V179V			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						TATGTGAGGTCCCATCTCTGA	0.507																																					p.V179V		Atlas-SNP	.											.	OR2H1	38	.	0			c.C537T						.						196.0	206.0	202.0					6																	29430083		1511	2709	4220	SO:0001819	synonymous_variant	26716	exon3			TGAGGTCCCATCT	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.537C>T	chr6.hg19:g.29430083C>T		115.0	0.0		111.0	26.0	NM_030883	B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Silent	SNP	ENST00000377136.1	hg19	CCDS4660.1																																																																																			.	.		0.507	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3		
ZBTB22	9278	hgsc.bcm.edu	37	6	33281114	33281114	+	IGR	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr6:33281114G>T	ENST00000431845.2	-	0	2651				TAPBP_ENST00000489157.1_Intron|TAPBP_ENST00000434618.2_Silent_p.R117R|TAPBP_ENST00000456592.2_Silent_p.R117R|TAPBP_ENST00000475304.1_Silent_p.R117R|TAPBP_ENST00000426633.2_Silent_p.R117R	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						TCCAGGGCCCGCGGGCAGTTC	0.692																																					p.R117R		Atlas-SNP	.											.	TAPBP	48	.	0			c.C349A						.						20.0	24.0	23.0					6																	33281114		2196	4292	6488	SO:0001628	intergenic_variant	6892	exon3			GGGCCCGCGGGCA	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110		chr6.hg19:g.33281114G>T		49.0	0.0		54.0	4.0	NM_172208	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Silent	SNP	ENST00000431845.2	hg19	CCDS4775.1																																																																																			.	.		0.692	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
ZNF292	23036	hgsc.bcm.edu	37	6	87964507	87964507	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr6:87964507G>A	ENST00000369577.3	+	8	1203	c.1160G>A	c.(1159-1161)cGt>cAt	p.R387H	ZNF292_ENST00000339907.4_Missense_Mutation_p.R382H	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	387						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GAAGTTAAACGTGCTTGTCAA	0.378																																					p.R387H		Atlas-SNP	.											.	ZNF292	479	.	0			c.G1160A						.						134.0	126.0	129.0					6																	87964507		1906	4130	6036	SO:0001583	missense	23036	exon8			TTAAACGTGCTTG	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1160G>A	chr6.hg19:g.87964507G>A	ENSP00000358590:p.Arg387His	183.0	0.0		205.0	60.0	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	hg19	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068105	0.76301	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.44083	0.93;0.93	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.62816	0.2459	M	0.73962	2.25	0.54753	D	0.999981	D	0.89917	1.0	D	0.83275	0.996	T	0.64437	-0.6408	10	0.87932	D	0	.	20.3172	0.98658	0.0:0.0:1.0:0.0	.	387	O60281	ZN292_HUMAN	H	387;382	ENSP00000358590:R387H;ENSP00000342847:R382H	ENSP00000342847:R382H	R	+	2	0	ZNF292	88021226	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.801000	0.96364	0.650000	0.86243	CGT	.	.		0.378	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
SOGA3	387104	hgsc.bcm.edu	37	6	127837105	127837105	+	Missense_Mutation	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr6:127837105A>G	ENST00000525778.1	-	2	1400	c.655T>C	c.(655-657)Tcc>Ccc	p.S219P	SOGA3_ENST00000481848.2_Missense_Mutation_p.S219P|SOGA3_ENST00000368268.2_Missense_Mutation_p.S219P|SOGA3_ENST00000465909.2_Missense_Mutation_p.S219P|SOGA3_ENST00000556132.1_Missense_Mutation_p.S219P			Q5TF21	SOGA3_HUMAN	SOGA family member 3	219	Gly-rich.				regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GAAGAGGAGGATGGAGAAGGG	0.721																																					p.S219P		Atlas-SNP	.											.	.	.	.	0			c.T655C						.						10.0	11.0	11.0					6																	127837105		1744	3988	5732	SO:0001583	missense	387104	exon2			AGGAGGATGGAGA	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.655T>C	chr6.hg19:g.127837105A>G	ENSP00000434570:p.Ser219Pro	36.0	0.0		38.0	5.0	NM_001012279		Missense_Mutation	SNP	ENST00000525778.1	hg19	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	A	5.712	0.315943	0.10789	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	3.58	1.18	0.20946	.	1.067160	0.07444	N	0.897937	T	0.09247	0.0228	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31251	-0.9950	10	0.36615	T	0.2	-2.1391	3.1615	0.06522	0.5979:0.0:0.2229:0.1791	.	219	Q5TF21	CF174_HUMAN	P	219	ENSP00000451768:S219P;ENSP00000357251:S219P;ENSP00000434570:S219P;ENSP00000435559:S219P	ENSP00000435559:S219P	S	-	1	0	C6orf174	127878798	0.984000	0.35163	0.010000	0.14722	0.499000	0.33736	0.367000	0.20382	0.136000	0.18733	0.459000	0.35465	TCC	.	.		0.721	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
AP5Z1	9907	hgsc.bcm.edu	37	7	4815367	4815367	+	Missense_Mutation	SNP	G	G	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr7:4815367G>C	ENST00000348624.4	+	1	115	c.21G>C	c.(19-21)gaG>gaC	p.E7D	AP5Z1_ENST00000401897.1_Missense_Mutation_p.E7D	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	7					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CAGGAGCGGAGAGTTTGCTCC	0.687																																					p.E7D		Atlas-SNP	.											.	.	.	.	0			c.G21C						.						34.0	42.0	40.0					7																	4815367		2019	4164	6183	SO:0001583	missense	9907	exon1			AGCGGAGAGTTTG	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.21G>C	chr7.hg19:g.4815367G>C	ENSP00000297562:p.Glu7Asp	49.0	0.0		36.0	8.0	NM_014855	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	hg19	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417901	0.25552	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.66638	-0.22;0.67	4.32	1.47	0.22746	.	0.063933	0.64402	D	0.000012	T	0.56761	0.2007	L	0.59436	1.845	0.42964	D	0.994419	P	0.41524	0.753	B	0.37091	0.241	T	0.55431	-0.8142	10	0.87932	D	0	.	7.8103	0.29228	0.2792:0.0:0.7208:0.0	.	7	O43299	K0415_HUMAN	D	7	ENSP00000297562:E7D;ENSP00000384980:E7D	ENSP00000297562:E7D	E	+	3	2	KIAA0415	4781893	1.000000	0.71417	0.467000	0.27180	0.027000	0.11550	0.930000	0.28858	0.109000	0.17891	-0.935000	0.02700	GAG	.	.		0.687	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
POM121	9883	hgsc.bcm.edu	37	7	72418914	72418914	+	IGR	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr7:72418914A>G	ENST00000434423.2	+	0	3750				NSUN5P2_ENST00000388955.4_RNA|POM121_ENST00000395270.1_Missense_Mutation_p.N969D|POM121_ENST00000446813.1_Missense_Mutation_p.N969D			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GAAGGGACCCAATAACCTTTC	0.512																																					p.N969D		Atlas-SNP	.											.	POM121	131	.	0			c.A2905G						.						55.0	63.0	60.0					7																	72418914		2198	4300	6498	SO:0001628	intergenic_variant	9883	exon16			GGACCCAATAACC	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527		chr7.hg19:g.72418914A>G		94.0	0.0		77.0	21.0	NM_001257190	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	ENST00000434423.2	hg19		.	.	.	.	.	.	.	.	.	.	A	11.02	1.515420	0.27123	.	.	ENSG00000196313	ENST00000446813;ENST00000395270	T;T	0.05513	3.43;3.43	1.6	1.6	0.23607	.	.	.	.	.	T	0.04092	0.0114	.	.	.	0.20703	N	0.999867	P	0.35714	0.517	B	0.21546	0.035	T	0.38714	-0.9648	8	0.87932	D	0	.	6.4313	0.21798	1.0:0.0:0.0:0.0	.	969	A8MXF9	.	D	969	ENSP00000393020:N969D;ENSP00000378687:N969D	ENSP00000378687:N969D	N	+	1	0	POM121	72056850	0.004000	0.15560	0.004000	0.12327	0.164000	0.22412	0.681000	0.25320	0.728000	0.32382	0.136000	0.15936	AAT	.	.		0.512	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347344.1		
GSAP	54103	hgsc.bcm.edu	37	7	77010640	77010640	+	Silent	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr7:77010640T>C	ENST00000257626.7	-	8	636	c.558A>G	c.(556-558)caA>caG	p.Q186Q		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	186					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										TTCCATCTTCTTGGGCGACAT	0.299																																					p.Q186Q		Atlas-SNP	.											.	PION	74	.	0			c.A558G						.						78.0	73.0	74.0					7																	77010640		1807	4071	5878	SO:0001819	synonymous_variant	54103	exon8			ATCTTCTTGGGCG		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.558A>G	chr7.hg19:g.77010640T>C		70.0	0.0		73.0	19.0	NM_017439	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Silent	SNP	ENST00000257626.7	hg19	CCDS34672.2																																																																																			.	.		0.299	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
MAGI2	9863	hgsc.bcm.edu	37	7	77998508	77998508	+	Silent	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr7:77998508T>C	ENST00000354212.4	-	7	1321	c.1068A>G	c.(1066-1068)aaA>aaG	p.K356K	MAGI2_ENST00000535697.1_Silent_p.K193K|MAGI2_ENST00000522391.1_Silent_p.K356K|MAGI2_ENST00000419488.1_Silent_p.K356K|MAGI2_ENST00000536571.1_Silent_p.K188K	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	356	Interaction with DDN.|WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GATCATCGATTTTTTCCCAGC	0.249																																					p.K356K		Atlas-SNP	.											.	MAGI2	246	.	0			c.A1068G						.						61.0	63.0	62.0					7																	77998508		2202	4300	6502	SO:0001819	synonymous_variant	9863	exon7			ATCGATTTTTTCC	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1068A>G	chr7.hg19:g.77998508T>C		483.0	1.0		525.0	124.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	hg19	CCDS5594.1																																																																																			.	.		0.249	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
GNAI1	2770	hgsc.bcm.edu	37	7	79846776	79846776	+	Missense_Mutation	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr7:79846776A>G	ENST00000351004.3	+	8	1405	c.1032A>G	c.(1030-1032)atA>atG	p.I344M	GNAI1_ENST00000457358.2_Missense_Mutation_p.I292M	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	344					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						ATGTCATCATAAAAAATAATC	0.323																																					p.I344M		Atlas-SNP	.											.	GNAI1	44	.	0			c.A1032G						.						94.0	90.0	91.0					7																	79846776		2203	4299	6502	SO:0001583	missense	2770	exon8			CATCATAAAAAAT	AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.1032A>G	chr7.hg19:g.79846776A>G	ENSP00000343027:p.Ile344Met	214.0	0.0		220.0	44.0	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Missense_Mutation	SNP	ENST00000351004.3	hg19	CCDS5595.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.720670	0.48728	.	.	ENSG00000127955	ENST00000351004;ENST00000457358	T;T	0.70631	-0.5;-0.5	5.9	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.79070	0.4384	M	0.79805	2.47	0.80722	D	1	P	0.46327	0.876	P	0.54815	0.761	T	0.78465	-0.2193	9	.	.	.	.	8.7936	0.34866	0.7436:0.1237:0.0:0.1327	.	344	P63096	GNAI1_HUMAN	M	344;292	ENSP00000343027:I344M;ENSP00000410572:I292M	.	I	+	3	3	GNAI1	79684712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.581000	0.53914	1.019000	0.39547	0.460000	0.39030	ATA	.	.		0.323	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
SLC26A3	1811	hgsc.bcm.edu	37	7	107431676	107431676	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr7:107431676C>T	ENST00000340010.5	-	5	571	c.387G>A	c.(385-387)ccG>ccA	p.P129P	SLC26A3_ENST00000422236.2_Silent_p.P94P	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	129			P -> L (in DIAR1). {ECO:0000269|PubMed:21394828}.		anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						GAATCGGAAACGGACCTAATT	0.433																																					p.P129P		Atlas-SNP	.											SLC26A3,NS,haematopoietic_neoplasm,0,2	SLC26A3	120	.	0			c.G387A						.						175.0	157.0	163.0					7																	107431676		2203	4300	6503	SO:0001819	synonymous_variant	1811	exon5			CGGAAACGGACCT	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.387G>A	chr7.hg19:g.107431676C>T		163.0	0.0		142.0	30.0	NM_000111		Silent	SNP	ENST00000340010.5	hg19	CCDS5748.1																																																																																			.	.		0.433	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111	
NCAPG2	54892	hgsc.bcm.edu	37	7	158449049	158449049	+	Missense_Mutation	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr7:158449049A>G	ENST00000409423.1	-	20	2463	c.2291T>C	c.(2290-2292)aTt>aCt	p.I764T	NCAPG2_ENST00000449727.2_Missense_Mutation_p.I764T|NCAPG2_ENST00000541468.1_Missense_Mutation_p.I265T|NCAPG2_ENST00000275830.10_Missense_Mutation_p.I556T|NCAPG2_ENST00000356309.3_Missense_Mutation_p.I764T|NCAPG2_ENST00000409339.3_Missense_Mutation_p.I764T	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	764					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CAGATACTCAATGTAGACCAA	0.463																																					p.I764T		Atlas-SNP	.											.	NCAPG2	80	.	0			c.T2291C						.						157.0	161.0	160.0					7																	158449049		2007	4178	6185	SO:0001583	missense	54892	exon19			TACTCAATGTAGA	BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.2291T>C	chr7.hg19:g.158449049A>G	ENSP00000386569:p.Ile764Thr	187.0	0.0		183.0	47.0	NM_017760	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	ENST00000409423.1	hg19	CCDS43686.1	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804492	0.31869	.	.	ENSG00000146918	ENST00000541468;ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000545393;ENST00000449727	T;T;T;T;T;T	0.33865	1.4;1.41;1.41;1.41;1.39;1.39	5.91	5.91	0.95273	.	0.454398	0.26931	N	0.021765	T	0.32704	0.0838	L	0.48642	1.525	0.30241	N	0.795049	B;B;B;B	0.27068	0.045;0.167;0.007;0.055	B;B;B;B	0.26864	0.019;0.074;0.014;0.02	T	0.34900	-0.9810	10	0.49607	T	0.09	-4.5291	11.387	0.49791	0.9303:0.0:0.0697:0.0	.	764;207;556;764	Q86XI2-2;B4DHE5;E7EUH9;Q86XI2	.;.;.;CNDG2_HUMAN	T	265;764;764;556;764;207;764	ENSP00000442337:I265T;ENSP00000348657:I764T;ENSP00000386569:I764T;ENSP00000275830:I556T;ENSP00000387007:I764T;ENSP00000388326:I764T	ENSP00000275830:I556T	I	-	2	0	NCAPG2	158141810	0.943000	0.32029	0.129000	0.21949	0.407000	0.30961	6.421000	0.73353	2.254000	0.74563	0.533000	0.62120	ATT	.	.		0.463	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760	
GSR	2936	hgsc.bcm.edu	37	8	30539480	30539480	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr8:30539480G>A	ENST00000221130.5	-	11	1342	c.1252C>T	c.(1252-1254)Cac>Tac	p.H418Y	GSR_ENST00000541648.1_Missense_Mutation_p.H365Y|GSR_ENST00000537535.1_Missense_Mutation_p.H336Y|GSR_ENST00000414019.1_Missense_Mutation_p.H375Y|GSR_ENST00000546342.1_Missense_Mutation_p.H389Y	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	418					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	ATAGGGGGGTGGCTGAAGACC	0.438																																					p.H418Y		Atlas-SNP	.											.	GSR	53	.	0			c.C1252T						.						94.0	101.0	98.0					8																	30539480		2203	4300	6503	SO:0001583	missense	2936	exon11			GGGGGTGGCTGAA		CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.1252C>T	chr8.hg19:g.30539480G>A	ENSP00000221130:p.His418Tyr	108.0	0.0		100.0	23.0	NM_000637	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	ENST00000221130.5	hg19	CCDS34877.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813187	0.90707	.	.	ENSG00000104687	ENST00000221130;ENST00000414019;ENST00000546342;ENST00000541648;ENST00000537535	D;D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17;-3.17	5.56	5.56	0.83823	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.000000	0.85682	D	0.000000	D	0.98046	0.9356	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99308	1.0903	10	0.87932	D	0	-23.1765	17.0923	0.86625	0.0:0.0:1.0:0.0	.	418	P00390	GSHR_HUMAN	Y	418;375;389;365;336	ENSP00000221130:H418Y;ENSP00000390065:H375Y;ENSP00000445516:H389Y;ENSP00000444559:H365Y;ENSP00000438845:H336Y	ENSP00000221130:H418Y	H	-	1	0	GSR	30659022	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	8.746000	0.91604	2.622000	0.88805	0.644000	0.83932	CAC	.	.		0.438	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376519.1		
FNTA	2339	hgsc.bcm.edu	37	8	42911566	42911566	+	Missense_Mutation	SNP	C	C	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr8:42911566C>G	ENST00000302279.3	+	1	271	c.77C>G	c.(76-78)cCg>cGg	p.P26R	FNTA_ENST00000342116.4_Missense_Mutation_p.P26R|FNTA_ENST00000524546.1_3'UTR|FNTA_ENST00000529687.1_5'Flank|RP11-598P20.5_ENST00000534420.1_Intron	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	26	Pro-rich.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			CCGCCCCAGCCGCACCCACCG	0.746																																					p.P26R		Atlas-SNP	.											.	FNTA	34	.	0			c.C77G						.						5.0	6.0	6.0					8																	42911566		2067	4078	6145	SO:0001583	missense	2339	exon1			CCCAGCCGCACCC	L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.77C>G	chr8.hg19:g.42911566C>G	ENSP00000303423:p.Pro26Arg	55.0	0.0		34.0	12.0	NM_002027	A6NJW0|Q53XJ9|Q9UDC1	Missense_Mutation	SNP	ENST00000302279.3	hg19	CCDS6140.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331146	0.41297	.	.	ENSG00000168522	ENST00000302279;ENST00000342116;ENST00000531266	.	.	.	4.93	3.99	0.46301	.	0.000000	0.51477	D	0.000087	T	0.18257	0.0438	N	0.08118	0	0.09310	N	0.999999	P;B	0.34662	0.462;0.218	B;B	0.32211	0.142;0.067	T	0.17048	-1.0382	9	0.72032	D	0.01	-9.8866	9.7132	0.40258	0.2066:0.7933:0.0:0.0	.	26;26	P49354-2;P49354	.;FNTA_HUMAN	R	26;26;21	.	ENSP00000303423:P26R	P	+	2	0	FNTA	43030723	0.329000	0.24696	0.961000	0.40146	0.768000	0.43524	0.912000	0.28597	2.277000	0.76020	0.585000	0.79938	CCG	.	.		0.746	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383178.1	NM_002027	
TRPS1	7227	hgsc.bcm.edu	37	8	116427157	116427157	+	Silent	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr8:116427157T>C	ENST00000220888.5	-	6	3099	c.2940A>G	c.(2938-2940)ttA>ttG	p.L980L	TRPS1_ENST00000395715.3_Silent_p.L993L|TRPS1_ENST00000519076.1_Silent_p.L734L|TRPS1_ENST00000520276.1_Silent_p.L984L			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	980					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ACCTCCTCTCTAACGGGCTTC	0.498									Langer-Giedion syndrome																												p.L993L		Atlas-SNP	.											.	TRPS1	516	.	0			c.A2979G						.						169.0	163.0	165.0					8																	116427157		1974	4151	6125	SO:0001819	synonymous_variant	7227	exon7	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	CCTCTCTAACGGG	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2940A>G	chr8.hg19:g.116427157T>C		105.0	0.0		168.0	21.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	T	3.363	-0.130165	0.06753	.	.	ENSG00000104447	ENST00000518018	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	T	0.73071	0.3540	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72250	-0.4348	4	.	.	.	.	16.1729	0.81831	0.0:0.0:0.0:1.0	.	.	.	.	G	105	.	.	R	-	1	2	TRPS1	116496333	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.495000	0.35627	2.214000	0.71695	0.533000	0.62120	AGA	.	.		0.498	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
FAM135B	51059	hgsc.bcm.edu	37	8	139163633	139163633	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr8:139163633C>T	ENST00000395297.1	-	13	3255	c.3085G>A	c.(3085-3087)Gag>Aag	p.E1029K		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1029										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TTCACAACCTCCACAGCCTTC	0.527										HNSCC(54;0.14)																											p.E1029K		Atlas-SNP	.											.	FAM135B	423	.	0			c.G3085A						.						70.0	70.0	70.0					8																	139163633		2203	4300	6503	SO:0001583	missense	51059	exon13			CAACCTCCACAGC	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3085G>A	chr8.hg19:g.139163633C>T	ENSP00000378710:p.Glu1029Lys	162.0	0.0		285.0	99.0	NM_015912	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	hg19	CCDS6375.2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985026	0.74474	.	.	ENSG00000147724	ENST00000395297	T	0.18960	2.18	5.33	4.46	0.54185	.	0.119617	0.56097	D	0.000036	T	0.43722	0.1260	M	0.72894	2.215	0.41599	D	0.988847	D;D;P	0.76494	0.999;0.997;0.953	D;D;P	0.69479	0.964;0.935;0.551	T	0.44742	-0.9308	10	0.72032	D	0.01	-7.4971	13.0315	0.58845	0.0:0.9225:0.0:0.0775	.	1029;1029;1029	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	K	1029	ENSP00000378710:E1029K	ENSP00000276737:E1029K	E	-	1	0	FAM135B	139232815	1.000000	0.71417	0.986000	0.45419	0.472000	0.32918	7.487000	0.81328	1.259000	0.44117	0.655000	0.94253	GAG	.	.		0.527	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
TMEM215	401498	hgsc.bcm.edu	37	9	32784868	32784868	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr9:32784868G>A	ENST00000342743.5	+	2	1052	c.687G>A	c.(685-687)tgG>tgA	p.W229*		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	229						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						AAGGCAGGTGGGACCACGAGA	0.478																																					p.W229X		Atlas-SNP	.											.	TMEM215	38	.	0			c.G687A						.						64.0	56.0	59.0					9																	32784868		2125	4164	6289	SO:0001587	stop_gained	401498	exon2			CAGGTGGGACCAC		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.687G>A	chr9.hg19:g.32784868G>A	ENSP00000345468:p.Trp229*	128.0	0.0		125.0	32.0	NM_212558	Q6ZUU2	Nonsense_Mutation	SNP	ENST00000342743.5	hg19	CCDS6530.1	.	.	.	.	.	.	.	.	.	.	G	38	7.213905	0.98139	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.57	5.57	0.84162	.	0.094723	0.47455	D	0.000234	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.9916	17.0359	0.86476	0.0:0.0:1.0:0.0	.	.	.	.	X	229	.	ENSP00000345468:W229X	W	+	3	0	TMEM215	32774868	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.421000	0.52742	2.622000	0.88805	0.655000	0.94253	TGG	.	.		0.478	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	NM_212558	
GOLM1	51280	hgsc.bcm.edu	37	9	88692475	88692475	+	Missense_Mutation	SNP	C	C	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr9:88692475C>A	ENST00000388712.3	-	3	329	c.161G>T	c.(160-162)cGc>cTc	p.R54L	GOLM1_ENST00000257504.6_5'UTR|GOLM1_ENST00000388711.3_Missense_Mutation_p.R54L	NM_016548.3	NP_057632.2	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	54					nucleus organization (GO:0006997)|regulation of lipid metabolic process (GO:0019216)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17						AGCCGCCCTGCGGACCCTGCC	0.607																																					p.R54L		Atlas-SNP	.											.	GOLM1	36	.	0			c.G161T						.						82.0	82.0	82.0					9																	88692475		2203	4300	6503	SO:0001583	missense	51280	exon3			GCCCTGCGGACCC	AF236056	CCDS35054.1	9q21.33	2012-12-13	2007-07-30	2007-07-30	ENSG00000135052	ENSG00000135052			15451	protein-coding gene	gene with protein product		606804	"""golgi phosphoprotein 2"", ""chromosome 9 open reading frame 155"""	GOLPH2, C9orf155		10831838, 18953438, 22542941	Standard	NM_016548		Approved	GP73, FLJ23608, bA379P1.3	uc004aol.3	Q8NBJ4	OTTHUMG00000020130	ENST00000388712.3:c.161G>T	chr9.hg19:g.88692475C>A	ENSP00000373364:p.Arg54Leu	52.0	0.0		64.0	15.0	NM_016548	Q6IAF4|Q9NRB9	Missense_Mutation	SNP	ENST00000388712.3	hg19	CCDS35054.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419149	0.62622	.	.	ENSG00000135052	ENST00000388712;ENST00000388711;ENST00000486130;ENST00000466178	T;T;D	0.89875	1.0;1.0;-2.58	5.61	5.61	0.85477	.	0.057169	0.64402	D	0.000001	D	0.93074	0.7795	M	0.65498	2.005	0.48696	D	0.999695	D	0.89917	1.0	D	0.81914	0.995	D	0.92886	0.6327	10	0.62326	D	0.03	3.5297	12.9051	0.58147	0.0:0.9248:0.0:0.0752	.	54	Q8NBJ4	GOLM1_HUMAN	L	54	ENSP00000373364:R54L;ENSP00000373363:R54L;ENSP00000419076:R54L	ENSP00000373363:R54L	R	-	2	0	GOLM1	87882295	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	3.615000	0.54167	2.804000	0.96469	0.462000	0.41574	CGC	.	.		0.607	GOLM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052904.2	NM_177937	
CTNNAL1	8727	hgsc.bcm.edu	37	9	111739250	111739250	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr9:111739250T>A	ENST00000325551.4	-	8	1266	c.1180A>T	c.(1180-1182)Aag>Tag	p.K394*	CTNNAL1_ENST00000325580.6_Nonsense_Mutation_p.K394*|CTNNAL1_ENST00000374595.4_Nonsense_Mutation_p.K394*|CTNNAL1_ENST00000488130.1_5'UTR	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	394					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		ACTTCTTTCTTAAGTTCATTA	0.284																																					p.K394X		Atlas-SNP	.											.	CTNNAL1	51	.	0			c.A1180T						.						97.0	91.0	93.0					9																	111739250		2189	4288	6477	SO:0001587	stop_gained	8727	exon8			CTTTCTTAAGTTC	AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.1180A>T	chr9.hg19:g.111739250T>A	ENSP00000320434:p.Lys394*	48.0	0.0		44.0	11.0	NM_003798	B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Nonsense_Mutation	SNP	ENST00000325551.4	hg19	CCDS6775.1	.	.	.	.	.	.	.	.	.	.	T	38	6.721503	0.97788	.	.	ENSG00000119326	ENST00000374595;ENST00000325551;ENST00000325580	.	.	.	5.56	4.39	0.52855	.	0.145281	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-7.0276	9.4249	0.38574	0.0:0.0:0.1794:0.8206	.	.	.	.	X	394	.	ENSP00000320434:K394X	K	-	1	0	CTNNAL1	110779071	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.755000	0.68750	0.896000	0.36366	0.533000	0.62120	AAG	.	.		0.284	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053577.1	NM_003798	
ADARB2	105	hgsc.bcm.edu	37	10	1405746	1405746	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr10:1405746G>A	ENST00000381312.1	-	3	879	c.554C>T	c.(553-555)gCa>gTa	p.A185V	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	185	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GGACCTGAGTGCCAGCTCCGC	0.701																																					p.A185V		Atlas-SNP	.											.	ADARB2	95	.	0			c.C554T						.						36.0	32.0	33.0					10																	1405746		2203	4299	6502	SO:0001583	missense	105	exon3			CTGAGTGCCAGCT	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.554C>T	chr10.hg19:g.1405746G>A	ENSP00000370713:p.Ala185Val	140.0	0.0		164.0	40.0	NM_018702	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	hg19	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	g	26.0	4.690510	0.88735	.	.	ENSG00000185736	ENST00000381312	D	0.85013	-1.93	5.14	5.14	0.70334	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.099447	0.64402	D	0.000002	D	0.91536	0.7327	M	0.73217	2.22	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	D	0.92291	0.5841	10	0.66056	D	0.02	-30.0799	18.6205	0.91319	0.0:0.0:1.0:0.0	.	185	Q9NS39	RED2_HUMAN	V	185	ENSP00000370713:A185V	ENSP00000370713:A185V	A	-	2	0	ADARB2	1395746	1.000000	0.71417	0.945000	0.38365	0.594000	0.36715	9.713000	0.98740	2.393000	0.81446	0.556000	0.70494	GCA	.	.		0.701	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
ZSWIM8	23053	hgsc.bcm.edu	37	10	75561253	75561253	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr10:75561253C>T	ENST00000605216.1	+	26	5707	c.5490C>T	c.(5488-5490)ctC>ctT	p.L1830L	RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604524.1_Silent_p.L1648L|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000604729.1_Silent_p.L1827L|ZSWIM8_ENST00000603114.1_Silent_p.L1789L|ZSWIM8_ENST00000398706.2_Silent_p.L1835L	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1830							zinc ion binding (GO:0008270)										GGGTCTCACTCGAGATGGCCA	0.592																																					p.R1800X		Atlas-SNP	.											.	.	.	.	0			c.C5398T						.						65.0	71.0	69.0					10																	75561253		2067	4212	6279	SO:0001819	synonymous_variant	23053	exon26			CTCACTCGAGATG	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.5490C>T	chr10.hg19:g.75561253C>T		77.0	0.0		91.0	18.0	NM_001242488	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Nonsense_Mutation	SNP	ENST00000605216.1	hg19		.	.	.	.	.	.	.	.	.	.	C	3.374	-0.127854	0.06753	.	.	ENSG00000214655	ENST00000412198	.	.	.	5.99	1.43	0.22495	.	.	.	.	.	T	0.43366	0.1244	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24835	-1.0149	4	.	.	.	-4.5216	2.2063	0.03936	0.2036:0.3643:0.2793:0.1528	.	.	.	.	L	1105	.	.	S	+	2	0	KIAA0913	75231259	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.476000	0.22180	0.387000	0.25024	0.655000	0.94253	TCG	.	.		0.592	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000468545.1	NM_001242487	
LRIT2	340745	hgsc.bcm.edu	37	10	85982126	85982126	+	Silent	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr10:85982126A>G	ENST00000372113.4	-	3	1208	c.1203T>C	c.(1201-1203)gaT>gaC	p.D401D	LRIT2_ENST00000538192.1_Silent_p.D411D	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	401	Fibronectin type-III.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						TGAAGGCTTCATCCGATGCAA	0.532																																					p.D401D		Atlas-SNP	.											.	LRIT2	81	.	0			c.T1203C						.						108.0	97.0	100.0					10																	85982126		2203	4300	6503	SO:0001819	synonymous_variant	340745	exon3			GGCTTCATCCGAT		CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1203T>C	chr10.hg19:g.85982126A>G		60.0	0.0		79.0	29.0	NM_001017924	B7ZME6	Silent	SNP	ENST00000372113.4	hg19	CCDS31234.1																																																																																			.	.		0.532	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049110.4	XM_291697	
EBF3	253738	hgsc.bcm.edu	37	10	131761669	131761669	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr10:131761669C>T	ENST00000355311.5	-	2	325	c.253G>A	c.(253-255)Gaa>Aaa	p.E85K	EBF3_ENST00000368648.3_Missense_Mutation_p.E85K			Q9H4W6	COE3_HUMAN	early B-cell factor 3	85					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GCGGTCCTTTCAATCTCCACC	0.557																																					p.E85K		Atlas-SNP	.											.	EBF3	193	.	0			c.G253A						.						79.0	86.0	84.0					10																	131761669		2203	4300	6503	SO:0001583	missense	253738	exon2			TCCTTTCAATCTC		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.253G>A	chr10.hg19:g.131761669C>T	ENSP00000347463:p.Glu85Lys	78.0	0.0		88.0	34.0	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	hg19		.	.	.	.	.	.	.	.	.	.	C	22.8	4.342455	0.81911	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.58797	0.31;0.35	3.45	3.45	0.39498	.	0.000000	0.85682	U	0.000000	T	0.76630	0.4014	M	0.87456	2.885	0.80722	D	1	D;D	0.71674	0.998;0.997	D;P	0.64595	0.927;0.89	T	0.82657	-0.0349	10	0.87932	D	0	-6.2858	14.5175	0.67827	0.0:1.0:0.0:0.0	.	85;85	Q9H4W6;Q9H4W6-2	COE3_HUMAN;.	K	85	ENSP00000347463:E85K;ENSP00000357637:E85K	ENSP00000347463:E85K	E	-	1	0	EBF3	131651659	1.000000	0.71417	0.999000	0.59377	0.908000	0.53690	7.027000	0.76463	1.453000	0.47775	0.205000	0.17691	GAA	.	.		0.557	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
B4GALNT4	338707	hgsc.bcm.edu	37	11	377314	377314	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr11:377314G>A	ENST00000329962.6	+	14	2191	c.2191G>A	c.(2191-2193)Gcg>Acg	p.A731T		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	731					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCGGCTGAACGCGCGCCACGG	0.701																																					p.A731T		Atlas-SNP	.											.	B4GALNT4	83	.	0			c.G2191A						.						10.0	7.0	8.0					11																	377314		1972	3868	5840	SO:0001583	missense	338707	exon14			CTGAACGCGCGCC	AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.2191G>A	chr11.hg19:g.377314G>A	ENSP00000328277:p.Ala731Thr	68.0	0.0		74.0	6.0	NM_178537	Q96LV2	Missense_Mutation	SNP	ENST00000329962.6	hg19	CCDS7694.1	.	.	.	.	.	.	.	.	.	.	g	9.533	1.111282	0.20714	.	.	ENSG00000182272	ENST00000329962	T	0.15256	2.44	3.28	0.294	0.15747	.	0.382752	0.24774	N	0.035713	T	0.11410	0.0278	L	0.39898	1.24	0.26844	N	0.9683	P	0.34837	0.472	B	0.30855	0.121	T	0.17319	-1.0373	10	0.34782	T	0.22	-8.9964	9.0266	0.36234	0.2727:0.0:0.7273:0.0	.	731	Q76KP1	B4GN4_HUMAN	T	731	ENSP00000328277:A731T	ENSP00000328277:A731T	A	+	1	0	B4GALNT4	367314	0.703000	0.27826	0.058000	0.19502	0.114000	0.19823	1.287000	0.33284	0.232000	0.21100	0.205000	0.17691	GCG	.	.		0.701	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239289.2	NM_178537	
SAA2	6289	hgsc.bcm.edu	37	11	18266987	18266987	+	Silent	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr11:18266987T>C	ENST00000526900.1	-	4	489	c.306A>G	c.(304-306)aaA>aaG	p.K102K	SAA2_ENST00000414546.2_Intron|SAA2_ENST00000256733.4_Silent_p.K102K|SAA2_ENST00000528349.1_Intron|SAA2_ENST00000529528.1_Silent_p.K102K|SAA2_ENST00000530400.1_Intron|RNA5SP333_ENST00000363466.1_RNA|SAA2-SAA4_ENST00000524555.1_RNA			P0DJI9	SAA2_HUMAN	serum amyloid A2	102					acute-phase response (GO:0006953)	extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(1)	6						TCCTGCCCCATTTATTGGCAG	0.567																																					p.K102K		Atlas-SNP	.											.	SAA2	22	.	0			c.A306G						.						94.0	84.0	87.0					11																	18266987		2199	4293	6492	SO:0001819	synonymous_variant	6289	exon4			GCCCCATTTATTG	M26152	CCDS7833.1, CCDS44548.1	11p15.1-p14	2008-07-21			ENSG00000134339	ENSG00000134339			10514	protein-coding gene	gene with protein product		104751				7686132	Standard	NM_030754		Approved			P0DJI9	OTTHUMG00000166484	ENST00000526900.1:c.306A>G	chr11.hg19:g.18266987T>C		135.0	0.0		143.0	29.0	NM_030754	G3XAK9|P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Silent	SNP	ENST00000526900.1	hg19	CCDS7833.1																																																																																			.	.		0.567	SAA2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389983.1	NM_030754	
C11orf30	56946	hgsc.bcm.edu	37	11	76175034	76175034	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr11:76175034C>T	ENST00000529032.1	+	6	741	c.741C>T	c.(739-741)agC>agT	p.S247S	C11orf30_ENST00000525038.1_Silent_p.S262S|C11orf30_ENST00000524490.1_Silent_p.S248S|C11orf30_ENST00000525919.1_Silent_p.S248S|C11orf30_ENST00000533248.1_Silent_p.S261S|C11orf30_ENST00000343878.3_Silent_p.S247S|C11orf30_ENST00000524767.1_Silent_p.S262S|C11orf30_ENST00000334736.3_Silent_p.S247S			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	247	Interaction with BRCA2.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						TCATGCAGAGCATTGCCAACT	0.453																																					p.S247S		Atlas-SNP	.											.	C11orf30	123	.	0			c.C741T						.						184.0	163.0	170.0					11																	76175034		2200	4292	6492	SO:0001819	synonymous_variant	56946	exon7			GCAGAGCATTGCC	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.741C>T	chr11.hg19:g.76175034C>T		177.0	0.0		212.0	29.0	NM_020193	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Silent	SNP	ENST00000529032.1	hg19	CCDS8244.1																																																																																			.	.		0.453	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193	
KCNC2	3747	hgsc.bcm.edu	37	12	75601373	75601373	+	Missense_Mutation	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr12:75601373C>T	ENST00000549446.1	-	2	1071	c.391G>A	c.(391-393)Ggg>Agg	p.G131R	KCNC2_ENST00000341669.3_Missense_Mutation_p.G131R|KCNC2_ENST00000393288.2_Missense_Mutation_p.G131R|KCNC2_ENST00000548513.1_Missense_Mutation_p.G131R|KCNC2_ENST00000550433.1_Missense_Mutation_p.G131R|KCNC2_ENST00000298972.1_Missense_Mutation_p.G131R|KCNC2_ENST00000350228.2_Missense_Mutation_p.G131R|KCNC2_ENST00000540018.1_Missense_Mutation_p.G131R	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	131					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	AAGAGCGGCCCGCACACGTCT	0.672																																					p.G131R		Atlas-SNP	.											.	KCNC2	239	.	0			c.G391A						.						31.0	36.0	34.0					12																	75601373		2203	4299	6502	SO:0001583	missense	3747	exon2			GCGGCCCGCACAC	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.391G>A	chr12.hg19:g.75601373C>T	ENSP00000449253:p.Gly131Arg	583.0	1.0		694.0	227.0	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	ENST00000549446.1	hg19	CCDS9007.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460089	0.84317	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	3.38	3.38	0.38709	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.470849	0.17462	N	0.173406	T	0.64371	0.2592	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.97110	1.0;1.0;0.98;1.0;0.92	T	0.69967	-0.5001	10	0.66056	D	0.02	.	15.3106	0.74028	0.0:1.0:0.0:0.0	.	131;131;131;131;131	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	R	131	ENSP00000448301:G131R;ENSP00000449941:G131R;ENSP00000449253:G131R;ENSP00000340121:G131R;ENSP00000298972:G131R;ENSP00000319877:G131R;ENSP00000438423:G131R;ENSP00000376966:G131R	ENSP00000298972:G131R	G	-	1	0	KCNC2	73887640	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.370000	0.79589	1.898000	0.54952	0.462000	0.41574	GGG	.	.		0.672	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
TBX5	6910	hgsc.bcm.edu	37	12	114793370	114793370	+	Silent	SNP	A	A	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr12:114793370A>C	ENST00000310346.4	-	9	2190	c.1524T>G	c.(1522-1524)gtT>gtG	p.V508V	TBX5_ENST00000349716.5_Silent_p.V458V|TBX5_ENST00000405440.2_Silent_p.V508V	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	508				PRTLSPHQYHSVHGVGMVPEWSDNS -> QGLYPLISTTLC TELAWCRVERQ (in Ref. 1; CAA70592). {ECO:0000305}.	apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GCACCATGCCAACTCCGTGCA	0.542																																					p.V508V	NSCLC(152;1358 1980 4050 23898 40356)	Atlas-SNP	.											.	TBX5	188	.	0			c.T1524G						.						52.0	50.0	50.0					12																	114793370		2203	4300	6503	SO:0001819	synonymous_variant	6910	exon9			CATGCCAACTCCG	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1524T>G	chr12.hg19:g.114793370A>C		93.0	0.0		121.0	44.0	NM_000192	A6ND77|O15301|Q96TB0|Q9Y4I2	Silent	SNP	ENST00000310346.4	hg19	CCDS9173.1																																																																																			.	.		0.542	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
RNF17	56163	hgsc.bcm.edu	37	13	25433158	25433158	+	Missense_Mutation	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr13:25433158G>T	ENST00000255324.5	+	26	3682	c.3630G>T	c.(3628-3630)atG>atT	p.M1210I	RNF17_ENST00000381921.1_Missense_Mutation_p.M1210I|RNF17_ENST00000339524.3_Missense_Mutation_p.M262I	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1210					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TAATAAAAATGACAAATGAAA	0.299																																					p.M1210I		Atlas-SNP	.											RNF17_ENST00000255324,NS,carcinoma,0,1	RNF17	259	.	0			c.G3630T						.						36.0	38.0	37.0					13																	25433158		2203	4300	6503	SO:0001583	missense	56163	exon26			AAAAATGACAAAT	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3630G>T	chr13.hg19:g.25433158G>T	ENSP00000255324:p.Met1210Ile	113.0	0.0		135.0	26.0	NM_031277	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420515	0.42918	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000418120;ENST00000339524	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	5.14	5.14	0.70334	Maternal tudor protein (1);	0.208576	0.43110	D	0.000619	T	0.09512	0.0234	N	0.24115	0.695	0.80722	D	1	P;B;B;P	0.40000	0.454;0.31;0.4;0.698	B;B;B;B	0.40702	0.192;0.171;0.121;0.338	T	0.10177	-1.0641	10	0.45353	T	0.12	-22.1835	12.9058	0.58152	0.0:0.0:0.8374:0.1626	.	1206;262;1210;1210	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	I	1210;1210;534;262	ENSP00000255324:M1210I;ENSP00000371346:M1210I;ENSP00000388892:M534I;ENSP00000344776:M262I	ENSP00000255324:M1210I	M	+	3	0	RNF17	24331158	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	4.869000	0.63028	2.832000	0.97577	0.655000	0.94253	ATG	.	.		0.299	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
COL4A1	1282	hgsc.bcm.edu	37	13	110835346	110835346	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr13:110835346G>A	ENST00000375820.4	-	28	2210	c.2089C>T	c.(2089-2091)Ccc>Tcc	p.P697S		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	697	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TTACCTTTGGGGCCGGGGGGC	0.612																																					p.P697S		Atlas-SNP	.											.	COL4A1	372	.	0			c.C2089T						.						14.0	17.0	16.0					13																	110835346		2201	4299	6500	SO:0001583	missense	1282	exon28			CTTTGGGGCCGGG	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2089C>T	chr13.hg19:g.110835346G>A	ENSP00000364979:p.Pro697Ser	103.0	0.0		106.0	27.0	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	hg19	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227252	0.58668	.	.	ENSG00000187498	ENST00000375820	D	0.96587	-4.06	4.7	4.7	0.59300	.	0.194402	0.45361	D	0.000376	D	0.97049	0.9036	M	0.76938	2.355	0.80722	D	1	D	0.59767	0.986	P	0.62740	0.906	D	0.96032	0.9017	10	0.08837	T	0.75	.	13.7388	0.62836	0.0:0.1541:0.8459:0.0	.	697	P02462	CO4A1_HUMAN	S	697	ENSP00000364979:P697S	ENSP00000364979:P697S	P	-	1	0	COL4A1	109633347	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.589000	0.61006	2.328000	0.79073	0.561000	0.74099	CCC	.	.		0.612	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
PSMB5	5693	hgsc.bcm.edu	37	14	23504068	23504068	+	Missense_Mutation	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr14:23504068T>C	ENST00000361611.6	-	1	286	c.23A>G	c.(22-24)gAg>gGg	p.E8G	AL132780.1_ENST00000385031.1_RNA|PSMB5_ENST00000493471.2_Missense_Mutation_p.E8G|PSMB5_ENST00000460922.2_Missense_Mutation_p.E8G|PSMB5_ENST00000425762.2_Intron	NM_002797.3	NP_002788.1	P28074	PSB5_HUMAN	proteasome (prosome, macropain) subunit, beta type, 5	8					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to oxidative stress (GO:0006979)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0121)	Bortezomib(DB00188)|Carfilzomib(DB08889)	TAGCGGTCTCTCCAACACGCT	0.577																																					p.E8G		Atlas-SNP	.											.	PSMB5	31	.	0			c.A23G						.						40.0	39.0	39.0					14																	23504068		2203	4300	6503	SO:0001583	missense	5693	exon1			GGTCTCTCCAACA	D29011	CCDS9584.1, CCDS45083.1, CCDS45084.1	14q11.2	2008-08-29			ENSG00000100804	ENSG00000100804		"""Proteasome (prosome, macropain) subunits"""	9542	protein-coding gene	gene with protein product		600306				8066462, 8811196	Standard	NM_001130725		Approved	X, MB1	uc001wii.3	P28074	OTTHUMG00000028713	ENST00000361611.6:c.23A>G	chr14.hg19:g.23504068T>C	ENSP00000355325:p.Glu8Gly	112.0	0.0		103.0	21.0	NM_001144932	B2R4N9|B4DUM9|D3DS43|E9PAV2|Q16242|Q6PEW2|Q7Z3B5|Q86T01|Q9TNN9	Missense_Mutation	SNP	ENST00000361611.6	hg19	CCDS9584.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.907091	0.33628	.	.	ENSG00000100804	ENST00000361611;ENST00000493471;ENST00000460922	T;T;T	0.51817	0.69;0.69;0.69	5.22	5.22	0.72569	.	0.405202	0.27891	N	0.017439	T	0.30510	0.0767	N	0.24115	0.695	0.80722	D	1	B;B	0.30281	0.275;0.023	B;B	0.30179	0.112;0.026	T	0.11991	-1.0565	10	0.02654	T	1	-15.9303	14.0914	0.64993	0.0:0.0:0.0:1.0	.	8;8	P28074-2;P28074	.;PSB5_HUMAN	G	8	ENSP00000355325:E8G;ENSP00000452424:E8G;ENSP00000451286:E8G	ENSP00000334973:E8G	E	-	2	0	PSMB5	22573908	1.000000	0.71417	0.992000	0.48379	0.747000	0.42532	1.140000	0.31516	1.967000	0.57214	0.454000	0.30748	GAG	.	.		0.577	PSMB5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071695.4	NM_002797	
SLC22A17	51310	hgsc.bcm.edu	37	14	23815958	23815958	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr14:23815958G>A	ENST00000206544.8	-	9	1852	c.1516C>T	c.(1516-1518)Cgg>Tgg	p.R506W	SLC22A17_ENST00000474057.1_5'UTR|SLC22A17_ENST00000397267.1_Missense_Mutation_p.R506W|SLC22A17_ENST00000397260.3_Missense_Mutation_p.R377W|SLC22A17_ENST00000354772.3_Missense_Mutation_p.R488W	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	506					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TCCCCGTCCCGGAGCACCTCG	0.692																																					p.R506W		Atlas-SNP	.											.	SLC22A17	32	.	0			c.C1516T						.						6.0	8.0	8.0					14																	23815958		2134	4208	6342	SO:0001583	missense	51310	exon9			CGTCCCGGAGCAC	AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1516C>T	chr14.hg19:g.23815958G>A	ENSP00000206544:p.Arg506Trp	82.0	0.0		61.0	12.0	NM_020372	A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Missense_Mutation	SNP	ENST00000206544.8	hg19	CCDS9593.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.423948	0.62733	.	.	ENSG00000092096	ENST00000354772;ENST00000397260;ENST00000206544;ENST00000397267	T;T;T;T	0.71222	-0.32;-0.55;-0.27;-0.27	5.38	4.43	0.53597	.	0.154548	0.45126	D	0.000397	T	0.72867	0.3514	N	0.22421	0.69	0.36510	D	0.869537	D;D	0.89917	1.0;1.0	D;D	0.71184	0.951;0.972	T	0.78743	-0.2085	10	0.87932	D	0	-17.5241	13.0764	0.59089	0.0:0.0:0.7716:0.2284	.	488;506	Q8WUG5-2;Q8WUG5	.;S22AH_HUMAN	W	488;377;506;506	ENSP00000346824:R488W;ENSP00000380430:R377W;ENSP00000206544:R506W;ENSP00000380437:R506W	ENSP00000206544:R506W	R	-	1	2	SLC22A17	22885798	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.084000	0.41625	2.804000	0.96469	0.462000	0.41574	CGG	.	.		0.692	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157223.3	NM_020372	
FOXG1	2290	hgsc.bcm.edu	37	14	29236983	29236983	+	Silent	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr14:29236983G>A	ENST00000313071.4	+	1	697	c.498G>A	c.(496-498)ggG>ggA	p.G166G	RP11-966I7.1_ENST00000546560.1_RNA|RP11-966I7.1_ENST00000551395.1_RNA|FOXG1_ENST00000382535.3_Silent_p.G166G|RP11-966I7.1_ENST00000549487.1_RNA	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	166	Gly-rich.				aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G166G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		gcaaggacggggaggggggca	0.711																																					p.G166G		Atlas-SNP	.											FOXG1,arm,malignant_melanoma,0,1	FOXG1	92	.	1	Substitution - coding silent(1)	skin(1)	c.G498A						.						12.0	13.0	13.0					14																	29236983		2191	4294	6485	SO:0001819	synonymous_variant	2290	exon1			GGACGGGGAGGGG		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.498G>A	chr14.hg19:g.29236983G>A		376.0	0.0		340.0	71.0	NM_005249	A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	ENST00000313071.4	hg19	CCDS9636.1																																																																																			.	.		0.711	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
EML5	161436	hgsc.bcm.edu	37	14	89153622	89153622	+	Missense_Mutation	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr14:89153622G>T	ENST00000380664.5	-	19	2791	c.2792C>A	c.(2791-2793)tCt>tAt	p.S931Y	EML5_ENST00000352093.5_Missense_Mutation_p.S893Y|EML5_ENST00000554922.1_Missense_Mutation_p.S931Y			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	931						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TCTTTCAAAAGAGTCATCCCA	0.343																																					p.S931Y		Atlas-SNP	.											.	EML5	141	.	0			c.C2792A						.						59.0	52.0	54.0					14																	89153622		1803	4074	5877	SO:0001583	missense	161436	exon19			TCAAAAGAGTCAT	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.2792C>A	chr14.hg19:g.89153622G>T	ENSP00000370039:p.Ser931Tyr	296.0	0.0		295.0	60.0	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509389	0.64522	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.44083	0.93;2.16;2.67	4.5	4.5	0.54988	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.323197	0.28104	N	0.016588	T	0.46870	0.1415	L	0.40543	1.245	0.41614	D	0.988924	P;B	0.35033	0.481;0.349	P;B	0.45195	0.473;0.206	T	0.52290	-0.8595	10	0.62326	D	0.03	-0.9106	17.3499	0.87321	0.0:0.0:1.0:0.0	.	931;931	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	Y	931;893;931	ENSP00000451998:S931Y;ENSP00000298315:S893Y;ENSP00000370039:S931Y	ENSP00000298315:S893Y	S	-	2	0	EML5	88223375	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.124000	0.64709	2.498000	0.84270	0.467000	0.42956	TCT	.	.		0.343	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
RTL1	388015	hgsc.bcm.edu	37	14	101349210	101349210	+	Missense_Mutation	SNP	A	A	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr14:101349210A>C	ENST00000534062.1	-	1	1974	c.1916T>G	c.(1915-1917)aTg>aGg	p.M639R	MIR433_ENST00000384837.1_RNA|MIR136_ENST00000385207.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	639					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GTTGGTCAGCATGTCCTGCAG	0.542																																					p.M639R		Atlas-SNP	.											.	RTL1	120	.	0			c.T1916G						.						94.0	77.0	82.0					14																	101349210		692	1591	2283	SO:0001583	missense	388015	exon1			GTCAGCATGTCCT		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.1916T>G	chr14.hg19:g.101349210A>C	ENSP00000435342:p.Met639Arg	79.0	0.0		81.0	27.0	NM_001134888	E9PKS8	Missense_Mutation	SNP	ENST00000534062.1	hg19	CCDS53910.1	.	.	.	.	.	.	.	.	.	.	A	15.72	2.917220	0.52546	.	.	ENSG00000254656	ENST00000534062	T	0.39997	1.05	3.4	3.4	0.38934	.	.	.	.	.	T	0.39064	0.1064	N	0.10685	0.025	0.33343	D	0.570139	D	0.61080	0.989	P	0.62382	0.901	T	0.54523	-0.8281	9	0.87932	D	0	.	10.4533	0.44535	1.0:0.0:0.0:0.0	.	639	E9PKS8	.	R	639	ENSP00000435342:M639R	ENSP00000435342:M639R	M	-	2	0	RTL1	100418963	1.000000	0.71417	0.939000	0.37840	0.992000	0.81027	5.553000	0.67287	1.782000	0.52362	0.383000	0.25322	ATG	.	.		0.542	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
MYO1E	4643	hgsc.bcm.edu	37	15	59466403	59466403	+	Missense_Mutation	SNP	C	C	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr15:59466403C>G	ENST00000288235.4	-	20	2485	c.2086G>C	c.(2086-2088)Gat>Cat	p.D696H	MIR2116_ENST00000517221.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	696	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		GCATACCCATCATACTTTCTC	0.408																																					p.D696H		Atlas-SNP	.											.	MYO1E	99	.	0			c.G2086C						.						135.0	140.0	138.0					15																	59466403		2191	4291	6482	SO:0001583	missense	4643	exon20			ACCCATCATACTT	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2086G>C	chr15.hg19:g.59466403C>G	ENSP00000288235:p.Asp696His	78.0	0.0		73.0	18.0	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	hg19	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279506	0.59758	.	.	ENSG00000157483	ENST00000288235	D	0.95137	-3.62	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.93184	0.7829	M	0.78916	2.43	0.80722	D	1	P	0.39157	0.662	B	0.37387	0.248	D	0.91497	0.5216	10	0.05721	T	0.95	.	19.15	0.93483	0.0:1.0:0.0:0.0	.	696	Q12965	MYO1E_HUMAN	H	696	ENSP00000288235:D696H	ENSP00000288235:D696H	D	-	1	0	MYO1E	57253695	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.908000	0.69916	2.750000	0.94351	0.655000	0.94253	GAT	.	.		0.408	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
MCTP2	55784	hgsc.bcm.edu	37	15	94841718	94841718	+	Missense_Mutation	SNP	A	A	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr15:94841718A>G	ENST00000357742.4	+	1	224	c.224A>G	c.(223-225)tAc>tGc	p.Y75C	MCTP2_ENST00000331706.4_5'UTR|MCTP2_ENST00000451018.3_Missense_Mutation_p.Y75C|MCTP2_ENST00000543482.1_Missense_Mutation_p.Y75C	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	75					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CAGTCTTCCTACACCTCGGTG	0.587																																					p.Y75C		Atlas-SNP	.											.	MCTP2	122	.	0			c.A224G						.						55.0	59.0	57.0					15																	94841718		2197	4298	6495	SO:0001583	missense	55784	exon1			CTTCCTACACCTC	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.224A>G	chr15.hg19:g.94841718A>G	ENSP00000350377:p.Tyr75Cys	71.0	0.0		65.0	12.0	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	hg19	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.637714	0.47049	.	.	ENSG00000140563	ENST00000543482;ENST00000556363;ENST00000451018;ENST00000357742	T;T;T	0.69926	-0.44;-0.21;-0.05	5.04	3.87	0.44632	.	0.136830	0.32918	N	0.005496	T	0.58864	0.2152	N	0.24115	0.695	0.36343	D	0.859602	P;P;P;P;D	0.67145	0.944;0.904;0.845;0.906;0.996	P;P;B;B;P	0.56216	0.634;0.513;0.315;0.43;0.794	T	0.63972	-0.6516	10	0.39692	T	0.17	.	4.8741	0.13648	0.4753:0.3241:0.0:0.2006	.	75;75;75;75;75	F5H415;Q6DN12-2;Q6DN12;B7Z6H2;G3V2J2	.;.;MCTP2_HUMAN;.;.	C	75	ENSP00000438521:Y75C;ENSP00000395109:Y75C;ENSP00000350377:Y75C	ENSP00000350377:Y75C	Y	+	2	0	MCTP2	92642722	0.799000	0.28903	0.980000	0.43619	0.650000	0.38633	2.731000	0.47343	1.906000	0.55180	0.460000	0.39030	TAC	.	.		0.587	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
PKD1	5310	hgsc.bcm.edu	37	16	2140499	2140499	+	Silent	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr16:2140499G>A	ENST00000262304.4	-	45	12439	c.12231C>T	c.(12229-12231)gcC>gcT	p.A4077A	PKD1_ENST00000423118.1_Silent_p.A4076A|MIR1225_ENST00000408729.1_RNA|RP11-304L19.1_ENST00000570072.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	4077					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCCAGGACTCGGCAGGACACA	0.682																																					p.A4077A		Atlas-SNP	.											.	PKD1	184	.	0			c.C12231T						.						25.0	28.0	27.0					16																	2140499		2185	4288	6473	SO:0001819	synonymous_variant	5310	exon45			GGACTCGGCAGGA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.12231C>T	chr16.hg19:g.2140499G>A		113.0	0.0		90.0	4.0	NM_001009944	Q15140|Q15141	Silent	SNP	ENST00000262304.4	hg19	CCDS32369.1																																																																																			.	.		0.682	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
SRRM2	23524	hgsc.bcm.edu	37	16	2819139	2819139	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr16:2819139C>T	ENST00000301740.8	+	12	8424	c.7875C>T	c.(7873-7875)tcC>tcT	p.S2625S	AC092117.2_ENST00000581119.1_RNA|SRRM2_ENST00000574593.1_3'UTR	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2625	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						cctcctcctcctcttcttcct	0.592																																					p.S2625S		Atlas-SNP	.											.	SRRM2	263	.	0			c.C7875T						.						141.0	121.0	128.0					16																	2819139		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon12			CTCCTCCTCTTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.7875C>T	chr16.hg19:g.2819139C>T		56.0	0.0		69.0	4.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	hg19	CCDS32373.1																																																																																			.	.		0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
GLG1	2734	hgsc.bcm.edu	37	16	74524981	74524981	+	Missense_Mutation	SNP	T	T	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr16:74524981T>A	ENST00000422840.2	-	8	1366	c.1367A>T	c.(1366-1368)cAt>cTt	p.H456L	GLG1_ENST00000447066.2_Missense_Mutation_p.H445L|GLG1_ENST00000205061.5_Missense_Mutation_p.H456L	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	456					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CCCTTTTCGATGTAATCCGGA	0.502																																					p.H456L		Atlas-SNP	.											.	GLG1	106	.	0			c.A1367T						.						164.0	142.0	149.0					16																	74524981		2198	4300	6498	SO:0001583	missense	2734	exon8			TTTCGATGTAATC		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1367A>T	chr16.hg19:g.74524981T>A	ENSP00000405984:p.His456Leu	166.0	0.0		190.0	10.0	NM_001145667	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	hg19	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	T	33	5.274972	0.95459	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.57710	0.2072	L	0.53249	1.67	0.80722	D	1	P;P;P	0.42620	0.785;0.758;0.714	B;B;B	0.43052	0.406;0.195;0.163	T	0.57081	-0.7872	9	0.33940	T	0.23	-3.1895	15.9905	0.80202	0.0:0.0:0.0:1.0	.	456;456;445	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	L	456;445;456	.	ENSP00000205061:H456L	H	-	2	0	GLG1	73082482	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.825000	0.86693	2.176000	0.68965	0.533000	0.62120	CAT	.	.		0.502	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
OR1A1	8383	hgsc.bcm.edu	37	17	3118953	3118953	+	Missense_Mutation	SNP	C	C	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr17:3118953C>G	ENST00000304094.1	+	1	39	c.39C>G	c.(37-39)atC>atG	p.I13M		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						TGGAATTCATCCTCCTGGGAG	0.418																																					p.I13M		Atlas-SNP	.											.	OR1A1	54	.	0			c.C39G						.						109.0	94.0	99.0					17																	3118953		2203	4300	6503	SO:0001583	missense	8383	exon1			ATTCATCCTCCTG	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.39C>G	chr17.hg19:g.3118953C>G	ENSP00000305207:p.Ile13Met	99.0	0.0		73.0	17.0	NM_014565	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	ENST00000304094.1	hg19	CCDS11022.1	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742613	0.49151	.	.	ENSG00000172146	ENST00000304094	T	0.01034	5.42	4.76	-1.89	0.07689	.	0.278577	0.25951	N	0.027260	T	0.02304	0.0071	M	0.82630	2.6	0.21416	N	0.999693	D	0.53462	0.96	P	0.49502	0.613	T	0.23476	-1.0187	10	0.72032	D	0.01	.	8.8951	0.35458	0.0:0.4024:0.0:0.5976	.	13	Q9P1Q5	OR1A1_HUMAN	M	13	ENSP00000305207:I13M	ENSP00000305207:I13M	I	+	3	3	OR1A1	3065703	0.000000	0.05858	0.992000	0.48379	0.867000	0.49689	-0.944000	0.03913	-0.186000	0.10533	0.436000	0.28706	ATC	.	.		0.418	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207292.1	NM_014565	
COL1A1	1277	hgsc.bcm.edu	37	17	48263287	48263287	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr17:48263287G>A	ENST00000225964.5	-	50	4218	c.4100C>T	c.(4099-4101)aCc>aTc	p.T1367I		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1367	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GCAGTGGTAGGTGATGTTCTG	0.627			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.T1367I		Atlas-SNP	.		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1	158	.	0			c.C4100T						.						104.0	78.0	87.0					17																	48263287		2203	4300	6503	SO:0001583	missense	1277	exon50			TGGTAGGTGATGT	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.4100C>T	chr17.hg19:g.48263287G>A	ENSP00000225964:p.Thr1367Ile	90.0	0.0		85.0	16.0	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	hg19	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874688	0.51695	.	.	ENSG00000108821	ENST00000225964	T	0.80909	-1.43	4.07	4.07	0.47477	Fibrillar collagen, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.92792	0.7708	H	0.96833	3.89	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.95224	0.8336	10	0.87932	D	0	.	15.1789	0.72938	0.0:0.0:1.0:0.0	.	1367	P02452	CO1A1_HUMAN	I	1367	ENSP00000225964:T1367I	ENSP00000225964:T1367I	T	-	2	0	COL1A1	45618286	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.534000	0.98061	2.094000	0.63399	0.313000	0.20887	ACC	.	.		0.627	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
CEP112	201134	hgsc.bcm.edu	37	17	63685338	63685338	+	Splice_Site	SNP	T	T	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr17:63685338T>A	ENST00000392769.2	-	24	2826		c.e24-2		CEP112_ENST00000535342.2_Splice_Site|CEP112_ENST00000580482.1_Splice_Site|CEP112_ENST00000537949.1_Splice_Site|CEP112_ENST00000541355.1_Splice_Site|CEP112_ENST00000317442.8_Splice_Site	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa						receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						TTGTAAAACCTGAAACGGTAT	0.353																																					.		Atlas-SNP	.											.	CEP112	192	.	0			c.376-2A>T						.						88.0	83.0	85.0					17																	63685338		2203	4299	6502	SO:0001630	splice_region_variant	201134	exon5			AAAACCTGAAACG	AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.2608-2A>T	chr17.hg19:g.63685338T>A		83.0	0.0		110.0	24.0	NM_001037325	Q6PIB5|Q8NCR4|Q8NFR4	Splice_Site	SNP	ENST00000392769.2	hg19	CCDS32710.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.958452	0.34565	.	.	ENSG00000154240	ENST00000535342;ENST00000392769;ENST00000317442;ENST00000541355;ENST00000537949	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5364	0.67963	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CEP112	61115800	1.000000	0.71417	0.998000	0.56505	0.164000	0.22412	5.062000	0.64326	2.221000	0.72209	0.460000	0.39030	.	.	.		0.353	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446582.1	NM_145036	Intron
DSC1	1823	hgsc.bcm.edu	37	18	28720139	28720139	+	Silent	SNP	A	A	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr18:28720139A>T	ENST00000257198.5	-	10	1647	c.1386T>A	c.(1384-1386)atT>atA	p.I462I	DSC1_ENST00000257197.3_Silent_p.I462I|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	462	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			CACTGTCTATAATTTTAACGG	0.448																																					p.I462I		Atlas-SNP	.											.	DSC1	240	.	0			c.T1386A						.						105.0	100.0	102.0					18																	28720139		2203	4300	6503	SO:0001819	synonymous_variant	1823	exon10			GTCTATAATTTTA	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1386T>A	chr18.hg19:g.28720139A>T		109.0	0.0		126.0	21.0	NM_004948	Q9HB01	Silent	SNP	ENST00000257198.5	hg19	CCDS11894.1																																																																																			.	.		0.448	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421	
DPP9	91039	hgsc.bcm.edu	37	19	4682753	4682753	+	Missense_Mutation	SNP	T	T	C	rs376453990		TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr19:4682753T>C	ENST00000598800.1	-	21	2847	c.2342A>G	c.(2341-2343)tAt>tGt	p.Y781C	DPP9_ENST00000262960.9_Missense_Mutation_p.Y810C|DPP9_ENST00000594671.1_Missense_Mutation_p.Y781C|AC005594.3_ENST00000381796.1_RNA|DPP9_ENST00000601173.1_5'Flank			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	781						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		ACCCGCCTCATAGCCGTGCTG	0.667																																					p.Y810C		Atlas-SNP	.											.	DPP9	59	.	0			c.A2429G						.	T	CYS/TYR,	1,4261		0,1,2130	57.0	69.0	65.0		2429,	2.2	1.0	19		65	0,8496		0,0,4248	no	missense,intron	DPP9,LOC100131094	NM_139159.4,NM_001242901.1	194,	0,1,6378	CC,CT,TT		0.0,0.0235,0.0078	probably-damaging,	810/893,	4682753	1,12757	2131	4248	6379	SO:0001583	missense	91039	exon20			GCCTCATAGCCGT	AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.2342A>G	chr19.hg19:g.4682753T>C	ENSP00000469603:p.Tyr781Cys	81.0	0.0		70.0	17.0	NM_139159	O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Missense_Mutation	SNP	ENST00000598800.1	hg19		.	.	.	.	.	.	.	.	.	.	t	17.15	3.314916	0.60524	2.35E-4	0.0	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	T	0.40756	1.02	3.29	2.24	0.28232	.	0.000000	0.85682	D	0.000000	T	0.76154	0.3948	H	0.99516	4.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78448	-0.2200	10	0.87932	D	0	-24.3259	8.3565	0.32333	0.1756:0.0:0.0:0.8243	.	810	Q1ZZB8	.	C	889;751;810	ENSP00000262960:Y810C	ENSP00000262960:Y810C	Y	-	2	0	DPP9	4633753	1.000000	0.71417	0.995000	0.50966	0.916000	0.54674	7.691000	0.84191	0.451000	0.26802	0.444000	0.29173	TAT	.	.		0.667	DPP9-026	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000459343.2		
MUC16	94025	hgsc.bcm.edu	37	19	9063485	9063485	+	Silent	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr19:9063485G>T	ENST00000397910.4	-	3	24164	c.23961C>A	c.(23959-23961)tcC>tcA	p.S7987S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7989	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTAATGTGGAGGAAACAGGAG	0.473																																					p.S7987S		Atlas-SNP	.											.	MUC16	4315	.	0			c.C23961A						.						88.0	85.0	86.0					19																	9063485		2002	4172	6174	SO:0001819	synonymous_variant	94025	exon3			TGTGGAGGAAACA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23961C>A	chr19.hg19:g.9063485G>T		104.0	0.0		116.0	23.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TSPAN16	26526	hgsc.bcm.edu	37	19	11411928	11411930	+	Missense_Mutation	TNP	AGA	AGA	TTT			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A|G|A	A|G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr19:11411928_11411930AGA>TTT	ENST00000316737.1	+	4	544_546	c.394_396AGA>TTT	c.(394-396)AGA>TTT	p.R132F	TSPAN16_ENST00000592955.1_Missense_Mutation_p.R107F|CTC-510F12.4_ENST00000586356.1_RNA|TSPAN16_ENST00000590327.1_Missense_Mutation_p.R132F	NM_012466.2	NP_036598.1	Q9UKR8	TSN16_HUMAN	tetraspanin 16	132						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	12						GAAGAATTACAGAGGTTACAACG	0.458																																					p.R132X|p.R132I|p.R132S		Atlas-SNP	.											.	TSPAN16	22	.	0			c.A394T|c.G395T|c.A396T						.																																			SO:0001583	missense	26526	exon4			AATTACAGAGGTT|ATTACAGAGGTTA|TTACAGAGGTTAC	BC029908	CCDS12256.1, CCDS62549.1, CCDS62550.1	19p13.2	2013-02-14	2005-03-21	2005-03-21	ENSG00000130167	ENSG00000130167		"""Tetraspanins"""	30725	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 16"""	TM4SF16		10500248	Standard	NM_012466		Approved	TM4-B, TM-8	uc002mqv.1	Q9UKR8	OTTHUMG00000180833	ENST00000316737.1:c.394_396AGA>TTT	chr19.hg19:g.11411928AGA>TTT	ENSP00000319486:p.Arg132Phe	143.0|144.0|145.0	0.0		162.0|160.0|160.0	30.0|31.0|31.0	NM_012466	K7EN22|K7EPD8|Q8N6J7	Nonsense_Mutation|Missense_Mutation|Missense_Mutation	SNP	ENST00000316737.1	hg19	CCDS12256.1																																																																																			.	.		0.458	TSPAN16-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453204.1	NM_012466	
ZC3H4	23211	hgsc.bcm.edu	37	19	47575379	47575379	+	Splice_Site	SNP	C	C	G			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr19:47575379C>G	ENST00000253048.5	-	13	1840		c.e13-1		ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4								metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TCCAGGGAACCTAGAAGAGGG	0.672																																					.		Atlas-SNP	.											.	ZC3H4	96	.	0			c.1803-1G>C						.						13.0	14.0	14.0					19																	47575379		1960	4127	6087	SO:0001630	splice_region_variant	23211	exon14			GGGAACCTAGAAG	AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.1803-1G>C	chr19.hg19:g.47575379C>G		37.0	0.0		34.0	12.0	NM_015168	Q9Y420	Splice_Site	SNP	ENST00000253048.5	hg19	CCDS42582.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.324898	0.24080	.	.	ENSG00000130749	ENST00000253048	.	.	.	5.21	4.18	0.49190	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0474	0.47867	0.0:0.9115:0.0:0.0884	.	.	.	.	.	-1	.	.	.	-	.	.	ZC3H4	52267219	1.000000	0.71417	0.987000	0.45799	0.219000	0.24729	4.618000	0.61211	1.192000	0.43071	-0.145000	0.13849	.	.	.		0.672	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		Intron
ZNF836	162962	hgsc.bcm.edu	37	19	52659296	52659296	+	Missense_Mutation	SNP	A	A	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr19:52659296A>T	ENST00000322146.8	-	5	2161	c.1640T>A	c.(1639-1641)aTt>aAt	p.I547N	ZNF836_ENST00000597252.1_Missense_Mutation_p.I547N|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	547					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CCCAGTATGAATTCTTAAATG	0.373																																					p.I547N		Atlas-SNP	.											.	ZNF836	158	.	0			c.T1640A						.						129.0	139.0	136.0					19																	52659296		2061	4238	6299	SO:0001583	missense	162962	exon5			GTATGAATTCTTA	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.1640T>A	chr19.hg19:g.52659296A>T	ENSP00000325038:p.Ile547Asn	141.0	0.0		137.0	29.0	NM_001102657		Missense_Mutation	SNP	ENST00000322146.8	hg19	CCDS46162.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.239099	0.39598	.	.	ENSG00000196267	ENST00000322146	T	0.07567	3.18	2.09	2.09	0.27110	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14787	0.0357	L	0.31578	0.945	0.20821	N	0.999842	D	0.76494	0.999	D	0.87578	0.998	T	0.12041	-1.0563	9	0.59425	D	0.04	.	6.0777	0.19925	0.7365:0.2635:0.0:0.0	.	547	Q6ZNA1	ZN836_HUMAN	N	547	ENSP00000325038:I547N	ENSP00000325038:I547N	I	-	2	0	ZNF836	57351108	0.000000	0.05858	0.054000	0.19295	0.012000	0.07955	0.823000	0.27366	0.952000	0.37798	0.397000	0.26171	ATT	.	.		0.373	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
USP29	57663	hgsc.bcm.edu	37	19	57641665	57641665	+	Missense_Mutation	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr19:57641665G>A	ENST00000254181.4	+	4	2076	c.1622G>A	c.(1621-1623)tGc>tAc	p.C541Y	USP29_ENST00000598197.1_Missense_Mutation_p.C541Y	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	541	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCTTCTTATTGCAATGAAAGC	0.403																																					p.C541Y		Atlas-SNP	.											.	USP29	186	.	0			c.G1622A						.						139.0	148.0	145.0					19																	57641665		2203	4300	6503	SO:0001583	missense	57663	exon4			CTTATTGCAATGA		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1622G>A	chr19.hg19:g.57641665G>A	ENSP00000254181:p.Cys541Tyr	100.0	0.0		97.0	23.0	NM_020903		Missense_Mutation	SNP	ENST00000254181.4	hg19	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.471022	0.26423	.	.	ENSG00000131864	ENST00000254181	T	0.31247	1.5	2.52	2.52	0.30459	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.52435	0.1734	M	0.75447	2.3	0.35851	D	0.826793	D	0.89917	1.0	D	0.97110	1.0	T	0.65533	-0.6145	9	0.87932	D	0	-4.2598	11.1806	0.48625	0.0:0.0:1.0:0.0	.	541	Q9HBJ7	UBP29_HUMAN	Y	541	ENSP00000254181:C541Y	ENSP00000254181:C541Y	C	+	2	0	USP29	62333477	1.000000	0.71417	0.013000	0.15412	0.044000	0.14063	5.155000	0.64900	1.678000	0.50952	0.467000	0.42956	TGC	.	.		0.403	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
RSPH1	89765	hgsc.bcm.edu	37	21	43912902	43912902	+	Silent	SNP	G	G	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr21:43912902G>T	ENST00000291536.3	-	3	407	c.240C>A	c.(238-240)ggC>ggA	p.G80G	RSPH1_ENST00000398352.3_Silent_p.G42G	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	80					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						ATATAAAAGTGCCTTGACCGT	0.318																																					p.G80G	Esophageal Squamous(23;63 706 6286 10288 12913)	Atlas-SNP	.											.	RSPH1	36	.	0			c.C240A						.						157.0	158.0	157.0					21																	43912902		2203	4300	6503	SO:0001819	synonymous_variant	89765	exon3			AAAAGTGCCTTGA	AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.240C>A	chr21.hg19:g.43912902G>T		86.0	0.0		90.0	5.0	NM_080860	A8MWV0|B2RBN9|Q3MJA1	Silent	SNP	ENST00000291536.3	hg19	CCDS13688.1																																																																																			.	.		0.318	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195379.1		
TMPRSS6	164656	hgsc.bcm.edu	37	22	37482384	37482384	+	Silent	SNP	C	C	T			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr22:37482384C>T	ENST00000346753.3	-	8	1055	c.939G>A	c.(937-939)aaG>aaA	p.K313K	TMPRSS6_ENST00000406725.1_Silent_p.K304K|TMPRSS6_ENST00000442782.2_Silent_p.K313K|TMPRSS6_ENST00000406856.1_Silent_p.K304K|TMPRSS6_ENST00000381792.2_Silent_p.K304K	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	313	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GCAGGCCCTTCTTCCAGACGA	0.667																																					p.K313K		Atlas-SNP	.											.	TMPRSS6	99	.	0			c.G939A						.						32.0	30.0	30.0					22																	37482384		2203	4299	6502	SO:0001819	synonymous_variant	164656	exon8			GCCCTTCTTCCAG	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.939G>A	chr22.hg19:g.37482384C>T		264.0	0.0		296.0	71.0	NM_153609	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	ENST00000346753.3	hg19	CCDS13941.1																																																																																			.	.		0.667	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318822.1	NM_153609	
EP300	2033	hgsc.bcm.edu	37	22	41574171	41574171	+	Silent	SNP	G	G	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr22:41574171G>A	ENST00000263253.7	+	31	7675	c.6456G>A	c.(6454-6456)caG>caA	p.Q2152Q	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2152	Interaction with HTLV-1 Tax.|Interaction with NCOA2.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AACCACAGCAGCAACTCCAGC	0.587			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.Q2152Q		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.G6456A						.						76.0	60.0	65.0					22																	41574171		2203	4300	6503	SO:0001819	synonymous_variant	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	ACAGCAGCAACTC	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.6456G>A	chr22.hg19:g.41574171G>A		174.0	0.0		153.0	36.0	NM_001429	B1AKC2	Silent	SNP	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.		0.587	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
FAM47A	158724	hgsc.bcm.edu	37	X	34148187	34148187	+	Missense_Mutation	SNP	T	T	C			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chrX:34148187T>C	ENST00000346193.3	-	1	2260	c.2209A>G	c.(2209-2211)Att>Gtt	p.I737V		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	737										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TTAAAGGCAATTGGTCCATAA	0.423																																					p.I737V		Atlas-SNP	.											.	FAM47A	249	.	0			c.A2209G						.						132.0	127.0	129.0					X																	34148187		2202	4300	6502	SO:0001583	missense	158724	exon1			AGGCAATTGGTCC	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.2209A>G	chrX.hg19:g.34148187T>C	ENSP00000345029:p.Ile737Val	191.0	0.0		167.0	62.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	T	11.55	1.672427	0.29693	.	.	ENSG00000185448	ENST00000346193	T	0.15139	2.45	1.17	1.17	0.20885	.	.	.	.	.	T	0.26268	0.0641	L	0.49126	1.545	0.21105	N	0.999782	D	0.56968	0.978	D	0.67725	0.953	T	0.14035	-1.0487	9	0.25751	T	0.34	.	4.2137	0.10524	0.0:0.0:0.0:1.0	.	737	Q5JRC9	FA47A_HUMAN	V	737	ENSP00000345029:I737V	ENSP00000345029:I737V	I	-	1	0	FAM47A	34058108	0.949000	0.32298	0.765000	0.31456	0.166000	0.22503	0.853000	0.27777	0.724000	0.32296	0.441000	0.28932	ATT	.	.		0.423	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382417	24382418	+	IGR	INS	-	-	CTGCTGCTC	rs185449787		TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chrX:24382417_24382418insCTGCTGCTC								AC004552.1 (15394 upstream) : PDK3 (100919 downstream)																							tgctgctgctgctgctgctgct	0.619																																					p.A514delinsAAAP		Atlas-INDEL	.											.	.	.	.	0			c.1540_1541insCTGCTGCTC						.																																			SO:0001628	intergenic_variant	100130302	exon1			.																													chrX.hg19:g.24382417_24382418insCTGCTGCTC		59.0	0.0		85.0	38.0	NM_001136234		In_Frame_Ins	INS		hg19																																																																																				.	.	0	0.619								
OCRL	4952	hgsc.bcm.edu	37	X	128694557	128694557	+	Silent	SNP	C	C	A			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chrX:128694557C>A	ENST00000371113.4	+	9	918	c.753C>A	c.(751-753)ggC>ggA	p.G251G	OCRL_ENST00000357121.5_Silent_p.G251G	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	251	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						ATGTGAATGGCCAGTCTCCAG	0.363																																					p.G251G		Atlas-SNP	.											.	OCRL	117	.	0			c.C753A						.						127.0	108.0	115.0					X																	128694557		2203	4300	6503	SO:0001819	synonymous_variant	4952	exon9			GAATGGCCAGTCT	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.753C>A	chrX.hg19:g.128694557C>A		54.0	0.0		91.0	26.0	NM_000276	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Silent	SNP	ENST00000371113.4	hg19	CCDS35393.1																																																																																			.	.		0.363	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
ZBTB1	22890	hgsc.bcm.edu	37	14	64988788	64988796	+	In_Frame_Del	DEL	TATTTGATG	TATTTGATG	-			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	TATTTGATG	TATTTGATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr14:64988788_64988796delTATTTGATG	ENST00000554015.1	+	4	997_1005	c.566_574delTATTTGATG	c.(565-576)ctatttgatgta>cta	p.FDV190del	ZBTB1_ENST00000394712.2_In_Frame_Del_p.FDV190del|ZBTB1_ENST00000358738.3_In_Frame_Del_p.FDV190del|RP11-973N13.4_ENST00000554918.1_RNA			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	190					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		CCTGAGCCACTATTTGATGTATGTAAAAA	0.416																																					p.189_191del		Atlas-Indel,Pindel	.											.	ZBTB1	93	.	0			c.565_573del						.																																			SO:0001651	inframe_deletion	22890	exon2			.	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.566_574delTATTTGATG	chr14.hg19:g.64988788_64988796delTATTTGATG	ENSP00000451000:p.Phe190_Val192del	184.0	0.0		191.0	28.0	NM_001123329	A8K6S8|Q86SW8	In_Frame_Del	DEL	ENST00000554015.1	hg19	CCDS45126.1																																																																																			.	.		0.416	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
ARID1A	8289	hgsc.bcm.edu	37	1	27102134	27102134	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:27102134delC	ENST00000324856.7	+	19	5431	c.5060delC	c.(5059-5061)gcafs	p.A1687fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.A1470fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.A1304fs|ARID1A_ENST00000540690.1_Frame_Shift_Del_p.A15fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1687					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGCACATGGGCATTAGATACC	0.502			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.A1687fs		Atlas-Indel,Pindel	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.5059delG						.						149.0	118.0	129.0					1																	27102134		2203	4300	6503	SO:0001589	frameshift_variant	8289	exon19			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5060delC	chr1.hg19:g.27102134delC	ENSP00000320485:p.Ala1687fs	70.0	0.0		112.0	22.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.		0.502	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37947212	37947212	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr1:37947212delC	ENST00000373087.6	+	4	710	c.594delC	c.(592-594)atcfs	p.I198fs		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ACCAGCACATCCTGCGGGAAC	0.597																																					p.I198fs		Atlas-Indel,Pindel	.											.	ZC3H12A	58	.	0			c.593delT						.						153.0	142.0	146.0					1																	37947212		2203	4300	6503	SO:0001589	frameshift_variant	80149	exon4			.		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.594delC	chr1.hg19:g.37947212delC	ENSP00000362179:p.Ile198fs	101.0	0.0		75.0	12.0	NM_025079		Frame_Shift_Del	DEL	ENST00000373087.6	hg19	CCDS417.1																																																																																			.	.		0.597	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
MAN2C1	4123	hgsc.bcm.edu	37	15	75660853	75660889	+	Frame_Shift_Del	DEL	GAGCGGCGACACGAACTTCTCCACCCGCTCCAGCGTG	GAGCGGCGACACGAACTTCTCCACCCGCTCCAGCGTG	-	rs199781388		TCGA-2V-A95S-01A-11D-A36X-10	TCGA-2V-A95S-10D-01D-A370-10	GAGCGGCGACACGAACTTCTCCACCCGCTCCAGCGTG	GAGCGGCGACACGAACTTCTCCACCCGCTCCAGCGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	163604c4-1a54-4072-9821-38e000866920	2143f2ba-4527-449c-975d-fbeff27126ca	g.chr15:75660853_75660889delGAGCGGCGACACGAACTTCTCCACCCGCTCCAGCGTG	ENST00000267978.5	-	1	82_118	c.36_72delCACGCTGGAGCGGGTGGAGAAGTTCGTGTCGCCGCTC	c.(34-72)accacgctggagcgggtggagaagttcgtgtcgccgctcfs	p.TTLERVEKFVSPL12fs	MAN2C1_ENST00000565683.1_Frame_Shift_Del_p.TTLERVEKFVSPL12fs|RP11-817O13.8_ENST00000563278.1_lincRNA|MAN2C1_ENST00000563622.1_Frame_Shift_Del_p.TTLERVEKFVSPL12fs|MAN2C1_ENST00000563539.1_5'UTR|MAN2C1_ENST00000569482.1_Frame_Shift_Del_p.TTLERVEKFVSPL12fs	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	12					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.P23L(1)		central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						CGGTAAAGTAGAGCGGCGACACGAACTTCTCCACCCGCTCCAGCGTGGTGCGCCAGT	0.679																																					p.13_25del		Atlas-Indel,Pindel	.											.	MAN2C1	76	.	1	Substitution - Missense(1)	large_intestine(1)	c.37_73del						.																																			SO:0001589	frameshift_variant	4123	exon1			.	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.36_72delCACGCTGGAGCGGGTGGAGAAGTTCGTGTCGCCGCTC	chr15.hg19:g.75660853_75660889delGAGCGGCGACACGAACTTCTCCACCCGCTCCAGCGTG	ENSP00000267978:p.Thr12fs	237.0	0.0		176.0	26.0	NM_001256494	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Frame_Shift_Del	DEL	ENST00000267978.5	hg19	CCDS32298.1																																																																																			.	.		0.679	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1		
