#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAMTA1	23261	hgsc.bcm.edu	37	1	7725058	7725058	+	Silent	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:7725058A>G	ENST00000303635.7	+	9	2658	c.2451A>G	c.(2449-2451)gcA>gcG	p.A817A	CAMTA1_ENST00000439411.2_Silent_p.A817A	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	817					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TCACCCAGGCAGAGATGTGCC	0.697			T	WWTR1	epitheliod hemangioendothelioma																																p.A817A		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.A2451G						.						49.0	62.0	58.0					1																	7725058		2202	4296	6498	SO:0001819	synonymous_variant	23261	exon9			CCAGGCAGAGATG	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2451A>G	chr1.hg19:g.7725058A>G		172.0	0.0		114.0	46.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	ENST00000303635.7	hg19	CCDS30576.1																																																																																			.	.		0.697	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
SFPQ	6421	hgsc.bcm.edu	37	1	35653652	35653652	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:35653652C>T	ENST00000357214.5	-	7	1835	c.1737G>A	c.(1735-1737)atG>atA	p.M579I		NM_005066.2	NP_005057.1	P23246	SFPQ_HUMAN	splicing factor proline/glutamine-rich	579					alternative mRNA splicing, via spliceosome (GO:0000380)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H3 deacetylation (GO:0070932)|mRNA processing (GO:0006397)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|histone deacetylase binding (GO:0042826)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)		SFPQ/TFE3(6)	NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				GTTGACGAATCATCATCTCTT	0.438			T	TFE3	papillary renal cell																																p.M579I		Atlas-SNP	.		Dom	yes		1	1p34.3	6421	splicing factor proline/glutamine rich(polypyrimidine tract binding protein associated)		E	.	SFPQ	51	.	0			c.G1737A						.						388.0	334.0	352.0					1																	35653652		2203	4300	6503	SO:0001583	missense	6421	exon7			ACGAATCATCATC	X70944	CCDS388.1	1p34.3	2014-06-13	2010-05-04		ENSG00000116560	ENSG00000116560		"""RNA binding motif (RRM) containing"""	10774	protein-coding gene	gene with protein product	"""polypyrimidine tract binding protein associated"", ""protein phosphatase 1, regulatory subunit 140"""	605199	"""splicing factor proline/glutamine rich (polypyrimidine tract-binding protein-associated)"""			8449401	Standard	NM_005066		Approved	PSF, PPP1R140	uc001bys.3	P23246	OTTHUMG00000004157	ENST00000357214.5:c.1737G>A	chr1.hg19:g.35653652C>T	ENSP00000349748:p.Met579Ile	48.0	0.0		63.0	29.0	NM_005066	P30808|Q5SZ71	Missense_Mutation	SNP	ENST00000357214.5	hg19	CCDS388.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181696	0.57800	.	.	ENSG00000116560	ENST00000357214	T	0.38722	1.12	5.81	5.81	0.92471	.	0.062008	0.64402	D	0.000003	T	0.33876	0.0878	L	0.27053	0.805	0.54753	D	0.999985	B	0.02656	0.0	B	0.04013	0.001	T	0.08932	-1.0698	9	.	.	.	-8.2257	20.0656	0.97703	0.0:1.0:0.0:0.0	.	579	P23246	SFPQ_HUMAN	I	579	ENSP00000349748:M579I	.	M	-	3	0	SFPQ	35426239	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.601000	0.61090	2.752000	0.94435	0.555000	0.69702	ATG	.	.		0.438	SFPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011984.4	NM_005066	
PSMB2	5690	hgsc.bcm.edu	37	1	36074978	36074978	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:36074978C>T	ENST00000373237.3	-	4	728	c.317G>A	c.(316-318)gGc>gAc	p.G106D		NM_002794.4	NP_002785.1	P49721	PSB2_HUMAN	proteasome (prosome, macropain) subunit, beta type, 2	106					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|large_intestine(2)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)			Bortezomib(DB00188)|Carfilzomib(DB08889)	CTCATCATAGCCAGCCAGGAG	0.507																																					p.G106D		Atlas-SNP	.											.	PSMB2	9	.	0			c.G317A						.						86.0	81.0	82.0					1																	36074978		2203	4300	6503	SO:0001583	missense	5690	exon4			TCATAGCCAGCCA	D26599	CCDS394.1, CCDS72755.1	1p34.2	2008-02-05			ENSG00000126067	ENSG00000126067		"""Proteasome (prosome, macropain) subunits"""	9539	protein-coding gene	gene with protein product		602175				7918633	Standard	NM_002794		Approved	HC7-I	uc001bzf.2	P49721	OTTHUMG00000004169	ENST00000373237.3:c.317G>A	chr1.hg19:g.36074978C>T	ENSP00000362334:p.Gly106Asp	164.0	0.0		191.0	13.0	NM_002794	D3DPS0|P31145|Q9BWZ9	Missense_Mutation	SNP	ENST00000373237.3	hg19	CCDS394.1	.	.	.	.	.	.	.	.	.	.	C	35	5.494386	0.96339	.	.	ENSG00000126067	ENST00000373237	T	0.35973	1.28	6.17	6.17	0.99709	.	0.095107	0.64402	D	0.000001	T	0.74245	0.3691	H	0.95365	3.66	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.995;0.995;0.999	T	0.80511	-0.1350	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	81;106;138	B7Z478;P49721;Q59FJ0	.;PSB2_HUMAN;.	D	106	ENSP00000362334:G106D	ENSP00000362334:G106D	G	-	2	0	PSMB2	35847565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.681000	0.84073	2.941000	0.99782	0.655000	0.94253	GGC	.	.		0.507	PSMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012016.1	NM_002794	
PRCC	5546	hgsc.bcm.edu	37	1	156764567	156764567	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:156764567G>T	ENST00000271526.4	+	5	1562	c.1290G>T	c.(1288-1290)ttG>ttT	p.L430F	PRCC_ENST00000353233.3_Missense_Mutation_p.L398F	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	430					mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTAAGTCATTGACAGAAGAGA	0.468			T	TFE3	papillary renal																																p.L430F		Atlas-SNP	.		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	.	PRCC	39	.	0			c.G1290T						.						106.0	99.0	101.0					1																	156764567		2203	4300	6503	SO:0001583	missense	5546	exon5			GTCATTGACAGAA	X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.1290G>T	chr1.hg19:g.156764567G>T	ENSP00000271526:p.Leu430Phe	101.0	0.0		205.0	54.0	NM_005973	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	ENST00000271526.4	hg19	CCDS1157.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.261832|4.261832	0.80358|0.80358	.|.	.|.	ENSG00000143294|ENSG00000143294	ENST00000271526;ENST00000353233;ENST00000368201;ENST00000526188|ENST00000454659	T;T;T|.	0.52526|.	0.66;0.66;0.66|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.123548|.	0.53938|.	D|.	0.000058|.	T|.	0.26919|.	0.0659|.	N|N	0.14661|0.14661	0.345|0.345	0.58432|0.58432	D|D	0.999994|0.999994	D;P|.	0.54047|.	0.964;0.944|.	P;P|.	0.51806|.	0.68;0.497|.	T|.	0.06844|.	-1.0804|.	10|.	0.56958|.	D|.	0.05|.	-0.7622|-0.7622	11.5932|11.5932	0.50957|0.50957	0.0866:0.0:0.9134:0.0|0.0866:0.0:0.9134:0.0	.|.	398;430|.	A6NG79;Q92733|.	.;PRCC_HUMAN|.	F|L	430;398;406;137|196	ENSP00000271526:L430F;ENSP00000339300:L398F;ENSP00000434762:L137F|.	ENSP00000271526:L430F|.	L|X	+|+	3|2	2|2	PRCC|PRCC	155031191|155031191	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	1.716000|1.716000	0.37981|0.37981	2.728000|2.728000	0.93425|0.93425	0.655000|0.655000	0.94253|0.94253	TTG|TGA	.	.		0.468	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098941.2	NM_005973	
PTPRC	5788	hgsc.bcm.edu	37	1	198700795	198700795	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:198700795G>T	ENST00000367376.2	+	18	2079	c.1908G>T	c.(1906-1908)ttG>ttT	p.L636F	PTPRC_ENST00000442510.2_Missense_Mutation_p.L638F|PTPRC_ENST00000352140.3_Missense_Mutation_p.L588F|PTPRC_ENST00000348564.6_Missense_Mutation_p.L477F|PTPRC_ENST00000594404.1_Missense_Mutation_p.L475F	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	636					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CAGATATTTTGTTGGAAACTT	0.353																																					p.L638F		Atlas-SNP	.											.	PTPRC	229	.	0			c.G1914T						.						140.0	138.0	138.0					1																	198700795		2203	4300	6503	SO:0001583	missense	5788	exon18			TATTTTGTTGGAA	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1908G>T	chr1.hg19:g.198700795G>T	ENSP00000356346:p.Leu636Phe	82.0	0.0		208.0	130.0	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	hg19		.	.	.	.	.	.	.	.	.	.	G	20.4	3.979451	0.74360	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.12147	2.71	5.66	3.76	0.43208	.	0.000000	0.39210	N	0.001427	T	0.40040	0.1101	M	0.85630	2.765	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.999;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.979;0.995;1.0;1.0;1.0	T	0.44772	-0.9306	10	0.87932	D	0	.	12.4264	0.55548	0.138:0.0:0.862:0.0	.	572;572;477;588;636	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	F	638;572;588;588;522;636;570;475	ENSP00000193532:L588F	ENSP00000306782:L475F	L	+	3	2	PTPRC	196967418	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	3.157000	0.50716	1.365000	0.46057	0.650000	0.86243	TTG	.	.		0.353	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
FAM177B	400823	hgsc.bcm.edu	37	1	222922851	222922851	+	Missense_Mutation	SNP	A	A	C	rs376128424		TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:222922851A>C	ENST00000445590.2	+	5	552	c.286A>C	c.(286-288)Act>Cct	p.T96P	FAM177B_ENST00000360827.2_Missense_Mutation_p.T96P	NM_207468.2	NP_997351.2	A6PVY3	F177B_HUMAN	family with sequence similarity 177, member B	96										breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	8						CTTTGGTCTTACTCAACCCAA	0.393																																					p.T96P		Atlas-SNP	.											.	FAM177B	19	.	0			c.A286C						.						116.0	105.0	109.0					1																	222922851		1873	4103	5976	SO:0001583	missense	400823	exon5			GGTCTTACTCAAC	AK125494	CCDS1535.2	1q41	2008-08-08			ENSG00000197520	ENSG00000197520			34395	protein-coding gene	gene with protein product							Standard	NM_207468		Approved	RP11-452F19.2, FLJ43505	uc001hnt.3	A6PVY3	OTTHUMG00000037766	ENST00000445590.2:c.286A>C	chr1.hg19:g.222922851A>C	ENSP00000414451:p.Thr96Pro	36.0	0.0		91.0	49.0	NM_207468	Q6ZUN8	Missense_Mutation	SNP	ENST00000445590.2	hg19	CCDS1535.2	.	.	.	.	.	.	.	.	.	.	a	12.93	2.085350	0.36758	.	.	ENSG00000197520	ENST00000434700;ENST00000445590;ENST00000360827;ENST00000456298	T;T;T;T	0.53857	0.6;1.14;1.14;0.6	5.01	0.229	0.15368	.	.	.	.	.	T	0.53206	0.1782	M	0.74467	2.265	0.09310	N	1	P	0.47677	0.899	P	0.44990	0.466	T	0.48139	-0.9061	9	0.66056	D	0.02	.	7.5642	0.27868	0.5436:0.0:0.4564:0.0	.	96	A6PVY3	F177B_HUMAN	P	96	ENSP00000391615:T96P;ENSP00000414451:T96P;ENSP00000354070:T96P;ENSP00000400233:T96P	ENSP00000354070:T96P	T	+	1	0	FAM177B	220989474	0.032000	0.19561	0.661000	0.29709	0.551000	0.35334	0.039000	0.13884	0.126000	0.18424	0.472000	0.43445	ACT	.	.		0.393	FAM177B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092151.2	NM_207468	
ZNF638	27332	hgsc.bcm.edu	37	2	71649966	71649966	+	Missense_Mutation	SNP	A	A	C	rs61739715	byFrequency	TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:71649966A>C	ENST00000409544.1	+	22	3952	c.3322A>C	c.(3322-3324)Att>Ctt	p.I1108L	ZNF638_ENST00000264447.4_Missense_Mutation_p.I1108L|ZNF638_ENST00000355812.3_Intron|ZNF638_ENST00000409407.1_Missense_Mutation_p.I48L	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1108	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AAACAGTCCAATTGATGAAAG	0.348																																					p.I1108L		Atlas-SNP	.											.	ZNF638	179	.	0			c.A3322C						.						59.0	60.0	60.0					2																	71649966		2203	4300	6503	SO:0001583	missense	27332	exon22			AGTCCAATTGATG	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.3322A>C	chr2.hg19:g.71649966A>C	ENSP00000386433:p.Ile1108Leu	91.0	0.0		139.0	62.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	hg19	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.474890	0.43942	.	.	ENSG00000075292	ENST00000394137;ENST00000264447;ENST00000409544;ENST00000409407;ENST00000462695	T;T;T	0.28454	1.61;1.61;1.86	5.32	4.44	0.53790	.	0.134805	0.33959	N	0.004388	T	0.14270	0.0345	N	0.08118	0	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.09164	-1.0687	10	0.19590	T	0.45	-6.3233	8.2665	0.31817	0.1815:0.0:0.8185:0.0	.	1108;1108;1108	A8K583;Q14966-3;Q14966	.;.;ZN638_HUMAN	L	687;1108;1108;48;48	ENSP00000264447:I1108L;ENSP00000386433:I1108L;ENSP00000386813:I48L	ENSP00000264447:I1108L	I	+	1	0	ZNF638	71503474	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.475000	0.45162	0.751000	0.32900	-0.119000	0.15052	ATT	.	A|0.996;G|0.004		0.348	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
MTHFD2	10797	hgsc.bcm.edu	37	2	74438882	74438882	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:74438882A>C	ENST00000394053.2	+	7	858	c.778A>C	c.(778-780)Atc>Ctc	p.I260L	MTHFD2_ENST00000409804.1_Missense_Mutation_p.I132L|MTHFD2_ENST00000394050.3_Missense_Mutation_p.I96L|MTHFD2_ENST00000409601.1_Intron|MTHFD2_ENST00000264090.4_Missense_Mutation_p.I158L|RP11-287D1.3_ENST00000451608.2_3'UTR	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	260					folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	TCCAAATCTGATCACAGCAGA	0.408																																					p.I260L		Atlas-SNP	.											.	MTHFD2	43	.	0			c.A778C						.						80.0	74.0	76.0					2																	74438882		1915	4122	6037	SO:0001583	missense	10797	exon7			AATCTGATCACAG	X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.778A>C	chr2.hg19:g.74438882A>C	ENSP00000377617:p.Ile260Leu	40.0	0.0		63.0	29.0	NM_006636	Q53G90|Q53GV5|Q53S36|Q7Z650	Missense_Mutation	SNP	ENST00000394053.2	hg19	CCDS1935.2	.	.	.	.	.	.	.	.	.	.	A	23.6	4.430197	0.83776	.	.	ENSG00000065911	ENST00000394053;ENST00000409804;ENST00000264090;ENST00000394050	T;T;T;T	0.61627	0.09;0.09;0.09;0.09	5.41	5.41	0.78517	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.71117	0.3302	M	0.64676	1.99	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.69665	-0.5084	10	0.33141	T	0.24	.	13.4509	0.61169	1.0:0.0:0.0:0.0	.	260	P13995	MTDC_HUMAN	L	260;132;158;96	ENSP00000377617:I260L;ENSP00000386536:I132L;ENSP00000264090:I158L;ENSP00000377614:I96L	ENSP00000264090:I158L	I	+	1	0	MTHFD2	74292390	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.883000	0.92426	2.041000	0.60428	0.456000	0.33151	ATC	.	.		0.408	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252045.2		
KANSL3	55683	hgsc.bcm.edu	37	2	97302698	97302698	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:97302698T>C	ENST00000431828.1	-	2	251	c.175A>G	c.(175-177)Atg>Gtg	p.M59V	KANSL3_ENST00000441706.2_5'UTR|KANSL3_ENST00000599854.1_5'UTR|KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000440133.1_5'UTR|KANSL3_ENST00000435669.1_5'UTR			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	59					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											ACAAAGAGCATGCGGGTGGGG	0.567																																					p.M59V		Atlas-SNP	.											.	.	.	.	0			c.A175G						.						33.0	29.0	30.0					2																	97302698		692	1591	2283	SO:0001583	missense	55683	exon2			AGAGCATGCGGGT	BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.175A>G	chr2.hg19:g.97302698T>C	ENSP00000396749:p.Met59Val	210.0	0.0		185.0	75.0	NM_001115016	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	ENST00000431828.1	hg19	CCDS46361.1	.	.	.	.	.	.	.	.	.	.	T	9.679	1.148832	0.21288	.	.	ENSG00000114982	ENST00000431828	T	0.68181	-0.31	4.73	3.55	0.40652	.	.	.	.	.	T	0.50326	0.1609	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.42599	-0.9442	9	0.46703	T	0.11	.	9.7095	0.40236	0.0:0.0:0.1751:0.8249	.	59	Q9P2N6-3	.	V	59	ENSP00000396749:M59V	ENSP00000410775:M59V	M	-	1	0	KIAA1310	96666425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.689000	0.46993	0.816000	0.34421	0.460000	0.39030	ATG	.	.		0.567	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991	
MARCH7	64844	hgsc.bcm.edu	37	2	160605311	160605311	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:160605311G>A	ENST00000259050.4	+	5	1632	c.1510G>A	c.(1510-1512)Gta>Ata	p.V504I	MARCH7_ENST00000409591.1_Missense_Mutation_p.V466I|MARCH7_ENST00000539065.1_Missense_Mutation_p.V448I|MARCH7_ENST00000409175.1_Missense_Mutation_p.V504I	NM_001282805.1|NM_001282807.1|NM_022826.2	NP_001269734.1|NP_001269736.1|NP_073737.1	Q9H992	MARH7_HUMAN	membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase	504					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(2)	18						CATGATCACAGTAGATATTAT	0.393																																					p.V504I		Atlas-SNP	.											.	MARCH7	48	.	0			c.G1510A						.						150.0	164.0	159.0					2																	160605311		2203	4300	6503	SO:0001583	missense	64844	exon5			ATCACAGTAGATA	AK022973	CCDS2210.1, CCDS63038.1, CCDS63039.1	2q24.2	2013-01-09	2012-02-23	2005-01-27	ENSG00000136536	ENSG00000136536		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	17393	protein-coding gene	gene with protein product		613334	"""axotrophin"", ""membrane-associated ring finger (C3HC4) 7"""	AXOT		14722266	Standard	XM_005246773		Approved	MARCH-VII, RNF177	uc002uax.3	Q9H992	OTTHUMG00000132029	ENST00000259050.4:c.1510G>A	chr2.hg19:g.160605311G>A	ENSP00000259050:p.Val504Ile	69.0	0.0		90.0	37.0	NM_022826	A8K9X1|B7Z7P5|D3DPB0|Q53GQ1|Q9BTR9	Missense_Mutation	SNP	ENST00000259050.4	hg19	CCDS2210.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386636	0.82902	.	.	ENSG00000136536	ENST00000409175;ENST00000539065;ENST00000259050;ENST00000409591	T;T;T;T	0.14640	2.49;2.52;2.49;2.49	5.88	5.88	0.94601	.	0.169262	0.51477	D	0.000084	T	0.38639	0.1048	M	0.66939	2.045	0.53688	D	0.999974	D;D;D	0.64830	0.994;0.994;0.994	D;D;D	0.70716	0.913;0.97;0.97	T	0.01508	-1.1337	10	0.51188	T	0.08	-16.0587	20.2441	0.98394	0.0:0.0:1.0:0.0	.	448;466;504	F5H6W4;B7Z7P5;Q9H992	.;.;MARH7_HUMAN	I	504;448;504;466	ENSP00000386830:V504I;ENSP00000442992:V448I;ENSP00000259050:V504I;ENSP00000387238:V466I	ENSP00000259050:V504I	V	+	1	0	MARCH7	160313557	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.562000	0.82300	2.774000	0.95407	0.655000	0.94253	GTA	.	.		0.393	MARCH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255040.3	NM_022826	
PLA2R1	22925	hgsc.bcm.edu	37	2	160862301	160862301	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:160862301T>G	ENST00000283243.7	-	11	1902	c.1696A>C	c.(1696-1698)Agt>Cgt	p.S566R	PLA2R1_ENST00000392771.1_Missense_Mutation_p.S566R	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	566	C-type lectin 3. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ACCACACTACTGATCAAACTG	0.368																																					p.S566R		Atlas-SNP	.											.	PLA2R1	153	.	0			c.A1696C						.						99.0	104.0	102.0					2																	160862301		2203	4300	6503	SO:0001583	missense	22925	exon11			CACTACTGATCAA	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.1696A>C	chr2.hg19:g.160862301T>G	ENSP00000283243:p.Ser566Arg	105.0	0.0		117.0	58.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	hg19	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	T	13.95	2.389824	0.42410	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.18810	2.19;2.19	5.06	2.67	0.31697	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.148878	0.64402	D	0.000016	T	0.20333	0.0489	L	0.42245	1.32	0.43014	D	0.994557	D;B;P	0.54207	0.965;0.257;0.767	P;B;P	0.53912	0.737;0.166;0.465	T	0.33059	-0.9883	10	0.15952	T	0.53	.	1.6751	0.02820	0.1195:0.1635:0.1802:0.5367	.	566;566;566	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	R	566	ENSP00000283243:S566R;ENSP00000376524:S566R	ENSP00000283243:S566R	S	-	1	0	PLA2R1	160570547	0.687000	0.27671	1.000000	0.80357	0.932000	0.56968	0.749000	0.26320	0.356000	0.24157	-0.346000	0.07831	AGT	.	.		0.368	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
ABCA12	26154	hgsc.bcm.edu	37	2	215838711	215838711	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:215838711T>A	ENST00000272895.7	-	36	5743	c.5524A>T	c.(5524-5526)Act>Tct	p.T1842S	ABCA12_ENST00000389661.4_Missense_Mutation_p.T1524S	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1842					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CCAAAATTAGTGATGGGTTCT	0.383																																					p.T1842S	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.A5524T						.						194.0	178.0	183.0					2																	215838711		2203	4300	6503	SO:0001583	missense	26154	exon36			AATTAGTGATGGG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5524A>T	chr2.hg19:g.215838711T>A	ENSP00000272895:p.Thr1842Ser	47.0	0.0		93.0	41.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	9.616	1.132545	0.21041	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.87966	-2.32;-2.31	5.89	3.5	0.40072	.	1.217550	0.05679	N	0.589998	T	0.80819	0.4696	L	0.44542	1.39	0.40208	D	0.977592	B;B	0.09022	0.002;0.001	B;B	0.14578	0.011;0.003	T	0.62053	-0.6935	10	0.09338	T	0.73	.	5.3242	0.15896	0.0:0.1533:0.1502:0.6965	.	1842;1524	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	S	1842;1524	ENSP00000272895:T1842S;ENSP00000374312:T1524S	ENSP00000272895:T1842S	T	-	1	0	ABCA12	215546956	0.975000	0.34042	0.993000	0.49108	0.996000	0.88848	1.809000	0.38922	0.479000	0.27511	0.455000	0.32223	ACT	.	.		0.383	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ECEL1	9427	hgsc.bcm.edu	37	2	233346546	233346546	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:233346546C>T	ENST00000304546.1	-	13	2020	c.1810G>A	c.(1810-1812)Ggg>Agg	p.G604R	ECEL1_ENST00000409941.1_Missense_Mutation_p.G602R	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	604					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CCGATGCCCCCGTAGTTGAGA	0.682																																					p.G604R		Atlas-SNP	.											.	ECEL1	73	.	0			c.G1810A						.						81.0	72.0	75.0					2																	233346546		2203	4300	6503	SO:0001583	missense	9427	exon13			TGCCCCCGTAGTT	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1810G>A	chr2.hg19:g.233346546C>T	ENSP00000302051:p.Gly604Arg	252.0	0.0		177.0	64.0	NM_004826	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	ENST00000304546.1	hg19	CCDS2493.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974381	0.92919	.	.	ENSG00000171551	ENST00000411860;ENST00000304546;ENST00000409941	D;D;D	0.89939	-2.59;-2.59;-2.59	5.54	5.54	0.83059	Peptidase M13, neprilysin, C-terminal (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97620	0.9220	H	0.99847	4.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99429	1.0935	10	0.87932	D	0	-38.1465	19.5428	0.95281	0.0:1.0:0.0:0.0	.	602;604	O95672-2;O95672	.;ECEL1_HUMAN	R	19;604;602	ENSP00000412683:G19R;ENSP00000302051:G604R;ENSP00000386333:G602R	ENSP00000302051:G604R	G	-	1	0	ECEL1	233054790	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.704000	0.84595	2.615000	0.88500	0.558000	0.71614	GGG	.	.		0.682	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
ING5	84289	hgsc.bcm.edu	37	2	242662639	242662639	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr2:242662639G>A	ENST00000313552.6	+	7	659	c.633G>A	c.(631-633)tgG>tgA	p.W211*	ING5_ENST00000406941.1_Nonsense_Mutation_p.W211*|AC114730.11_ENST00000435195.1_RNA	NM_032329.4	NP_115705.2	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5	211					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|skin(1)	3		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		CAATTGAGTGGTTTCACTTTG	0.517																																					p.W211X		Atlas-SNP	.											.	ING5	14	.	0			c.G633A						.						251.0	246.0	247.0					2																	242662639		2203	4300	6503	SO:0001587	stop_gained	84289	exon7			TGAGTGGTTTCAC	AF189286	CCDS33425.1	2q37.3	2013-01-28			ENSG00000168395	ENSG00000168395		"""Zinc fingers, PHD-type"""	19421	protein-coding gene	gene with protein product		608525				12750254	Standard	NM_032329		Approved	FLJ23842, p28ING5	uc002wcd.3	Q8WYH8	OTTHUMG00000151501	ENST00000313552.6:c.633G>A	chr2.hg19:g.242662639G>A	ENSP00000322142:p.Trp211*	181.0	0.0		140.0	56.0	NM_032329	A8K1P3|Q53NU6|Q57Z54|Q9BS30	Nonsense_Mutation	SNP	ENST00000313552.6	hg19	CCDS33425.1	.	.	.	.	.	.	.	.	.	.	G	36	5.760727	0.96906	.	.	ENSG00000168395	ENST00000313552;ENST00000406941	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2098	19.7533	0.96277	0.0:0.0:1.0:0.0	.	.	.	.	X	211	.	ENSP00000322142:W211X	W	+	3	0	ING5	242311312	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.665000	0.91144	2.669000	0.90835	0.643000	0.83706	TGG	.	.		0.517	ING5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322901.3	NM_032329	
DPPA4	55211	hgsc.bcm.edu	37	3	109049584	109049584	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr3:109049584T>G	ENST00000335658.6	-	5	520	c.466A>C	c.(466-468)Acg>Ccg	p.T156P	DPPA4_ENST00000478791.1_5'UTR	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	156					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						TGCAGGGACGTTTCCCCCTTT	0.463																																					p.T156P		Atlas-SNP	.											.	DPPA4	56	.	0			c.A466C						.						80.0	84.0	82.0					3																	109049584		2203	4300	6503	SO:0001583	missense	55211	exon5			GGGACGTTTCCCC	AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.466A>C	chr3.hg19:g.109049584T>G	ENSP00000335306:p.Thr156Pro	217.0	0.0		202.0	93.0	NM_018189	A8K4M7|Q9H9N5|Q9NVI6	Missense_Mutation	SNP	ENST00000335658.6	hg19	CCDS33814.1	.	.	.	.	.	.	.	.	.	.	T	7.050	0.564363	0.13498	.	.	ENSG00000121570	ENST00000335658	T	0.23950	1.88	3.8	-5.44	0.02624	.	2.778230	0.00926	N	0.002652	T	0.09862	0.0242	N	0.08118	0	0.09310	N	1	P;P	0.45283	0.855;0.641	B;B	0.38327	0.271;0.154	T	0.12066	-1.0562	9	.	.	.	-0.0503	1.4213	0.02313	0.1282:0.3027:0.2885:0.2806	.	146;156	B7Z5Q7;Q7L190	.;DPPA4_HUMAN	P	156	ENSP00000335306:T156P	.	T	-	1	0	DPPA4	110532274	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.084000	0.03393	-1.147000	0.02851	-0.609000	0.04063	ACG	.	.		0.463	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353897.1	NM_018189	
FAM131A	131408	hgsc.bcm.edu	37	3	184062581	184062581	+	Silent	SNP	G	G	T	rs145026576	byFrequency	TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr3:184062581G>T	ENST00000310585.4	+	3	2195	c.831G>T	c.(829-831)tcG>tcT	p.S277S	FAM131A_ENST00000340957.5_Silent_p.S223S|FAM131A_ENST00000418281.1_Silent_p.S185S|EIF2B5_ENST00000444495.1_Intron|FAM131A_ENST00000453072.1_Silent_p.S223S|FAM131A_ENST00000383847.2_Silent_p.S308S|FAM131A_ENST00000450976.1_Silent_p.S223S			Q6UXB0	F131A_HUMAN	family with sequence similarity 131, member A	277						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(9)|skin(1)	14	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTACAACTCGCCCCTCACAG	0.672																																					p.S308S		Atlas-SNP	.											FAM131A_ENST00000383847,NS,carcinoma,0,2	FAM131A	37	.	0			c.G924T						.						41.0	48.0	45.0					3																	184062581		2203	4297	6500	SO:0001819	synonymous_variant	131408	exon6			CAACTCGCCCCTC	BC026221	CCDS3262.1, CCDS3262.2, CCDS54689.1	3q27.1	2007-03-20	2007-03-20	2007-03-20	ENSG00000175182	ENSG00000175182			28308	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 40"""	C3orf40		12975309	Standard	NM_144635		Approved	MGC21688	uc003foe.3	Q6UXB0	OTTHUMG00000156206	ENST00000310585.4:c.831G>T	chr3.hg19:g.184062581G>T		115.0	0.0		80.0	36.0	NM_144635	D3DNT6|G5E9B1|Q8TA84	Silent	SNP	ENST00000310585.4	hg19																																																																																				.	G|1.000;A|0.000		0.672	FAM131A-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000343462.1	NM_144635	
LMLN	89782	hgsc.bcm.edu	37	3	197765494	197765494	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr3:197765494C>G	ENST00000330198.4	+	16	1946	c.1924C>G	c.(1924-1926)Ctg>Gtg	p.L642V	LMLN_ENST00000420910.2_Missense_Mutation_p.L679V|LMLN-AS1_ENST00000423460.1_RNA|LMLN_ENST00000332636.5_Missense_Mutation_p.L590V|LMLN_ENST00000482695.1_Missense_Mutation_p.L627V	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	642					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		GCTAGGCAATCTGTTTCCTCT	0.398																																					p.L679V		Atlas-SNP	.											.	LMLN	53	.	0			c.C2035G						.						201.0	200.0	200.0					3																	197765494		2203	4300	6503	SO:0001583	missense	89782	exon17			GGCAATCTGTTTC	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.1924C>G	chr3.hg19:g.197765494C>G	ENSP00000328829:p.Leu642Val	73.0	0.0		157.0	71.0	NM_001136049	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	hg19	CCDS3332.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425262	0.43020	.	.	ENSG00000185621	ENST00000482695;ENST00000330198;ENST00000420910;ENST00000332636	T;T;T;T	0.54279	0.64;0.58;0.6;0.6	5.31	3.52	0.40303	.	0.000000	0.64402	D	0.000012	T	0.55497	0.1924	L	0.27053	0.805	0.46725	D	0.999177	D;D;D;D;D	0.67145	0.993;0.996;0.996;0.993;0.996	D;D;D;D;D	0.75484	0.967;0.986;0.986;0.952;0.986	T	0.50224	-0.8853	10	0.33940	T	0.23	-10.4657	9.9321	0.41528	0.0:0.8324:0.0:0.1676	.	642;590;679;671;627	Q96KR4;F8WCE5;F8WB28;B4DR62;Q96KR4-2	LMLN_HUMAN;.;.;.;.	V	627;642;679;590	ENSP00000418324:L627V;ENSP00000328829:L642V;ENSP00000410926:L679V;ENSP00000328611:L590V	ENSP00000328829:L642V	L	+	1	2	LMLN	199249891	1.000000	0.71417	0.987000	0.45799	0.907000	0.53573	1.677000	0.37576	0.736000	0.32559	-0.145000	0.13849	CTG	.	.		0.398	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
SH3TC1	54436	hgsc.bcm.edu	37	4	8220023	8220023	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr4:8220023C>G	ENST00000245105.3	+	8	932	c.865C>G	c.(865-867)Ccc>Gcc	p.P289A	SH3TC1_ENST00000539824.1_Missense_Mutation_p.P213A	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	289										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						CCCCCAGGACCCCATCGACGA	0.577																																					p.P289A	NSCLC(145;2298 2623 35616 37297)	Atlas-SNP	.											.	SH3TC1	105	.	0			c.C865G						.						62.0	61.0	61.0					4																	8220023		2203	4300	6503	SO:0001583	missense	54436	exon8			CAGGACCCCATCG	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.865C>G	chr4.hg19:g.8220023C>G	ENSP00000245105:p.Pro289Ala	117.0	0.0		77.0	26.0	NM_018986	Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	hg19	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	C	9.127	1.010382	0.19277	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265;ENST00000508641	T;T;T	0.17213	2.29;2.29;2.29	3.53	1.65	0.23941	.	0.502867	0.20790	N	0.085621	T	0.16128	0.0388	L	0.61218	1.895	0.29763	N	0.835407	B	0.31383	0.321	B	0.31946	0.138	T	0.09164	-1.0687	10	0.46703	T	0.11	-18.0482	5.7198	0.17980	0.0:0.6854:0.1997:0.1149	.	289	Q8TE82	S3TC1_HUMAN	A	27;289;213;118;98	ENSP00000245105:P289A;ENSP00000441045:P213A;ENSP00000426035:P98A	ENSP00000245105:P289A	P	+	1	0	SH3TC1	8270923	0.978000	0.34361	0.838000	0.33150	0.235000	0.25334	0.965000	0.29319	0.268000	0.21939	0.561000	0.74099	CCC	.	.		0.577	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206991.2	NM_018986	
OR2V2	285659	hgsc.bcm.edu	37	5	180582886	180582886	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr5:180582886A>G	ENST00000328275.1	+	1	944	c.944A>G	c.(943-945)cAc>cGc	p.H315R		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCAGCCAGCACTGAACCCAG	0.547																																					p.H315R		Atlas-SNP	.											.	OR2V2	56	.	0			c.A944G						.						19.0	22.0	21.0					5																	180582886		2181	4289	6470	SO:0001583	missense	285659	exon1			GCCAGCACTGAAC	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.944A>G	chr5.hg19:g.180582886A>G	ENSP00000332185:p.His315Arg	84.0	0.0		81.0	27.0	NM_206880	Q6IFL6|Q8NGV1	Missense_Mutation	SNP	ENST00000328275.1	hg19	CCDS4461.1	.	.	.	.	.	.	.	.	.	.	.	10.31	1.314534	0.23908	.	.	ENSG00000182613	ENST00000328275	T	0.00030	8.9	3.54	-7.08	0.01558	.	2.120730	0.02782	N	0.121081	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.38779	-0.9645	10	0.02654	T	1	.	7.1403	0.25552	0.1969:0.5375:0.0:0.2656	.	315	Q96R30	OR2V2_HUMAN	R	315	ENSP00000332185:H315R	ENSP00000332185:H315R	H	+	2	0	OR2V2	180515492	0.770000	0.28543	0.000000	0.03702	0.051000	0.14879	-0.239000	0.08965	-1.272000	0.02427	0.254000	0.18369	CAC	.	.		0.547	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253529.1		
EYS	346007	hgsc.bcm.edu	37	6	64499079	64499079	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr6:64499079T>C	ENST00000370621.3	-	38	7976	c.7450A>G	c.(7450-7452)Aat>Gat	p.N2484D	EYS_ENST00000503581.1_Missense_Mutation_p.N2484D|EYS_ENST00000486069.1_5'UTR|EYS_ENST00000370616.2_Missense_Mutation_p.N2484D			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2484	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ACACTGCCATTGAGCAGGCCC	0.522																																					p.N2484D		Atlas-SNP	.											.	EYS	527	.	0			c.A7450G						.						62.0	58.0	59.0					6																	64499079		692	1591	2283	SO:0001583	missense	346007	exon38			TGCCATTGAGCAG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.7450A>G	chr6.hg19:g.64499079T>C	ENSP00000359655:p.Asn2484Asp	51.0	0.0		76.0	31.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	t	15.64	2.894003	0.52121	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	T;T;T	0.68765	-0.35;-0.35;-0.35	4.95	-2.57	0.06248	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.527383	0.14190	N	0.335388	T	0.15132	0.0365	N	0.10760	0.04	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.12156	0.004;0.007	T	0.32375	-0.9909	10	0.13853	T	0.58	-0.1055	5.5419	0.17043	0.0:0.3278:0.2633:0.4089	.	2484;2484	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	D	2484	ENSP00000424243:N2484D;ENSP00000359655:N2484D;ENSP00000359650:N2484D	ENSP00000359650:N2484D	N	-	1	0	EYS	64557038	0.000000	0.05858	0.000000	0.03702	0.752000	0.42762	0.172000	0.16704	-0.329000	0.08527	0.524000	0.50904	AAT	.	.		0.522	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
HEATR2	54919	hgsc.bcm.edu	37	7	794224	794224	+	Splice_Site	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr7:794224A>G	ENST00000297440.6	+	5	1044		c.e5-1		HEATR2_ENST00000313147.5_Splice_Site	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2							cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		TTTTCGTTCCAGAGCGCCGCC	0.537																																					.		Atlas-SNP	.											.	HEATR2	62	.	0			c.1025-2A>G						.						121.0	134.0	130.0					7																	794224		2203	4300	6503	SO:0001630	splice_region_variant	54919	exon5			CGTTCCAGAGCGC	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.1025-1A>G	chr7.hg19:g.794224A>G		238.0	0.0		184.0	71.0	NM_017802	Q69YL1|Q96FI9|Q9NX75	Splice_Site	SNP	ENST00000297440.6	hg19	CCDS34580.1	.	.	.	.	.	.	.	.	.	.	a	16.34	3.094448	0.56075	.	.	ENSG00000164818	ENST00000297440;ENST00000313147;ENST00000437419;ENST00000440747;ENST00000537862	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5709	0.76337	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HEATR2	760750	1.000000	0.71417	0.130000	0.21974	0.008000	0.06430	8.335000	0.90031	2.075000	0.62263	0.418000	0.28097	.	.	.		0.537	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322542.1	NM_017802	Intron
SDK1	221935	hgsc.bcm.edu	37	7	4014141	4014141	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr7:4014141G>C	ENST00000404826.2	+	13	2097	c.1958G>C	c.(1957-1959)gGa>gCa	p.G653A	SDK1_ENST00000389531.3_Missense_Mutation_p.G653A	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	653	Ig-like C2-type 6.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GTTTCTGAAGGAGGGAATGAC	0.557																																					p.G653A		Atlas-SNP	.											.	SDK1	361	.	0			c.G1958C						.						150.0	111.0	124.0					7																	4014141		2203	4300	6503	SO:0001583	missense	221935	exon13			CTGAAGGAGGGAA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.1958G>C	chr7.hg19:g.4014141G>C	ENSP00000385899:p.Gly653Ala	99.0	0.0		112.0	52.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954552	0.34471	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.64438	-0.1;-0.1	5.35	5.35	0.76521	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.086976	0.47093	D	0.000249	T	0.50103	0.1596	N	0.13198	0.31	0.46317	D	0.99898	B	0.31077	0.307	B	0.35470	0.203	T	0.45804	-0.9236	10	0.25106	T	0.35	.	19.0581	0.93074	0.0:0.0:1.0:0.0	.	653	Q7Z5N4	SDK1_HUMAN	A	653	ENSP00000385899:G653A;ENSP00000374182:G653A	ENSP00000374182:G653A	G	+	2	0	SDK1	3980667	1.000000	0.71417	0.156000	0.22583	0.043000	0.13939	4.665000	0.61547	2.484000	0.83849	0.563000	0.77884	GGA	.	.		0.557	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
AP5Z1	9907	hgsc.bcm.edu	37	7	4825922	4825922	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr7:4825922C>A	ENST00000348624.4	+	10	1268	c.1174C>A	c.(1174-1176)Ctg>Atg	p.L392M	MIR4656_ENST00000579503.1_RNA|AP5Z1_ENST00000401897.1_Missense_Mutation_p.L392M	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	392					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CTACCAGCACCTGTTCACCAG	0.627																																					p.L392M		Atlas-SNP	.											.	.	.	.	0			c.C1174A						.						56.0	64.0	61.0					7																	4825922		1995	4155	6150	SO:0001583	missense	9907	exon10			CAGCACCTGTTCA	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1174C>A	chr7.hg19:g.4825922C>A	ENSP00000297562:p.Leu392Met	131.0	0.0		91.0	45.0	NM_014855	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	hg19	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911734	0.52439	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.52754	0.66;0.65	5.29	3.18	0.36537	.	0.188571	0.36303	N	0.002668	T	0.62865	0.2463	M	0.78637	2.42	0.19775	N	0.999952	D	0.76494	0.999	D	0.75484	0.986	T	0.52689	-0.8542	10	0.66056	D	0.02	.	5.4877	0.16759	0.0:0.6315:0.2011:0.1675	.	392	O43299	K0415_HUMAN	M	392	ENSP00000297562:L392M;ENSP00000384980:L392M	ENSP00000297562:L392M	L	+	1	2	KIAA0415	4792448	0.966000	0.33281	0.056000	0.19401	0.984000	0.73092	0.865000	0.27940	1.203000	0.43233	0.561000	0.74099	CTG	.	.		0.627	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
COBL	23242	hgsc.bcm.edu	37	7	51096609	51096609	+	Silent	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr7:51096609G>A	ENST00000265136.7	-	10	2349	c.2184C>T	c.(2182-2184)acC>acT	p.T728T	COBL_ENST00000395542.2_Silent_p.T810T	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	728					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)	p.T728T(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TAATGGCTCCGGTGGAGAGGG	0.507																																					p.T728T	NSCLC(189;2119 2138 12223 30818 34679)	Atlas-SNP	.											COBL,bladder,carcinoma,0,1	COBL	167	.	1	Substitution - coding silent(1)	urinary_tract(1)	c.C2184T						.						102.0	85.0	91.0					7																	51096609		2203	4300	6503	SO:0001819	synonymous_variant	23242	exon10			GGCTCCGGTGGAG	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2184C>T	chr7.hg19:g.51096609G>A		125.0	0.0		110.0	45.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	ENST00000265136.7	hg19	CCDS34637.1																																																																																			.	.		0.507	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
GNAT3	346562	hgsc.bcm.edu	37	7	80103624	80103624	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr7:80103624C>T	ENST00000398291.3	-	5	626	c.533G>A	c.(532-534)cGa>cAa	p.R178Q	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	178					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						CGTTTTCACTCGAGAATGGAG	0.328																																					p.R178Q		Atlas-SNP	.											.	GNAT3	65	.	0			c.G533A						.						71.0	67.0	68.0					7																	80103624		1838	4106	5944	SO:0001583	missense	346562	exon5			TTCACTCGAGAAT		CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.533G>A	chr7.hg19:g.80103624C>T	ENSP00000381339:p.Arg178Gln	44.0	0.0		60.0	16.0	NM_001102386	A4D1B2|A4D1B3|B9EJG5	Missense_Mutation	SNP	ENST00000398291.3	hg19	CCDS47625.1	.	.	.	.	.	.	.	.	.	.	C	36	5.660119	0.96734	.	.	ENSG00000214415	ENST00000398291	D	0.91740	-2.9	5.99	5.99	0.97316	G protein alpha subunit, helical insertion (1);	0.000000	0.64402	U	0.000001	D	0.97782	0.9272	H	0.98407	4.225	0.80722	D	1	D	0.76494	0.999	P	0.62813	0.907	D	0.98556	1.0639	9	.	.	.	.	20.074	0.97736	0.0:1.0:0.0:0.0	.	178	A8MTJ3	GNAT3_HUMAN	Q	178	ENSP00000381339:R178Q	.	R	-	2	0	GNAT3	79941560	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.815000	0.69215	2.853000	0.98044	0.655000	0.94253	CGA	.	.		0.328	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339909.3	XM_294370	
DYNC1I1	1780	hgsc.bcm.edu	37	7	95665003	95665003	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr7:95665003G>A	ENST00000324972.6	+	13	1547	c.1354G>A	c.(1354-1356)Gtc>Atc	p.V452I	DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.V415I|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.V435I|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.V432I|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.V435I|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.V415I	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	452					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			AACGGGAGACGTCAATAACTT	0.468																																					p.V452I		Atlas-SNP	.											.	DYNC1I1	111	.	0			c.G1354A						.						321.0	259.0	280.0					7																	95665003		2203	4300	6503	SO:0001583	missense	1780	exon13			GGAGACGTCAATA	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1354G>A	chr7.hg19:g.95665003G>A	ENSP00000320130:p.Val452Ile	64.0	0.0		149.0	61.0	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	hg19	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	16.40	3.112451	0.56398	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	5.1	5.1	0.69264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76730	0.4028	L	0.31926	0.97	0.80722	D	1	P;D;D;P;P	0.54207	0.941;0.965;0.965;0.899;0.74	P;P;P;B;B	0.51135	0.459;0.66;0.66;0.275;0.163	T	0.72918	-0.4146	10	0.25751	T	0.34	0.0118	19.0933	0.93238	0.0:0.0:1.0:0.0	.	435;432;435;452;415	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	I	435;452;415;432;415;435	ENSP00000392337:V435I;ENSP00000320130:V452I;ENSP00000438377:V415I;ENSP00000398118:V432I;ENSP00000352348:V415I;ENSP00000412444:V435I	ENSP00000320130:V452I	V	+	1	0	DYNC1I1	95502939	1.000000	0.71417	0.995000	0.50966	0.083000	0.17756	9.657000	0.98554	2.830000	0.97506	0.585000	0.79938	GTC	.	.		0.468	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
CPA1	1357	hgsc.bcm.edu	37	7	130020953	130020953	+	Missense_Mutation	SNP	G	G	C	rs547564304		TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr7:130020953G>C	ENST00000011292.3	+	2	230	c.80G>C	c.(79-81)cGa>cCa	p.R27P	CPA1_ENST00000484324.1_5'UTR	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	27					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					CAGGTGCTCCGAATCTCTGTA	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17788	0.0		0.0	False		,,,				2504	0.0				p.R27P		Atlas-SNP	.											.	CPA1	73	.	0			c.G80C						.						46.0	42.0	43.0					7																	130020953		2203	4300	6503	SO:0001583	missense	1357	exon2			TGCTCCGAATCTC		CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.80G>C	chr7.hg19:g.130020953G>C	ENSP00000011292:p.Arg27Pro	356.0	0.0		266.0	96.0	NM_001868	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	ENST00000011292.3	hg19	CCDS5820.1	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676296	0.67928	.	.	ENSG00000091704	ENST00000011292	T	0.20463	2.07	4.54	4.54	0.55810	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.000000	0.85682	D	0.000000	T	0.53190	0.1781	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63431	-0.6639	10	0.87932	D	0	.	12.6567	0.56791	0.0:0.0:1.0:0.0	.	27	P15085	CBPA1_HUMAN	P	27	ENSP00000011292:R27P	ENSP00000011292:R27P	R	+	2	0	CPA1	129808189	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.441000	0.66569	2.372000	0.80975	0.555000	0.69702	CGA	.	.		0.637	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349736.2	NM_001868	
CSMD1	64478	hgsc.bcm.edu	37	8	3165891	3165891	+	Silent	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr8:3165891G>A	ENST00000520002.1	-	25	4324	c.3769C>T	c.(3769-3771)Ctg>Ttg	p.L1257L	CSMD1_ENST00000602557.1_Silent_p.L1257L|CSMD1_ENST00000537824.1_Silent_p.L1256L|CSMD1_ENST00000539096.1_Silent_p.L1256L|CSMD1_ENST00000602723.1_Silent_p.L1257L|CSMD1_ENST00000400186.3_Silent_p.L1257L|CSMD1_ENST00000542608.1_Silent_p.L1256L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1257	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAACAGGTCAGGGTGTTGCTG	0.527																																					p.L1256L		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C3766T						.						134.0	126.0	129.0					8																	3165891		2093	4223	6316	SO:0001819	synonymous_variant	64478	exon24			AGGTCAGGGTGTT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3769C>T	chr8.hg19:g.3165891G>A		61.0	0.0		39.0	23.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	G	4.645	0.119989	0.08881	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.22	-0.372	0.12520	.	.	.	.	.	T	0.39627	0.1085	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27571	-1.0070	4	.	.	.	.	0.6082	0.00756	0.3061:0.1082:0.2831:0.3026	.	.	.	.	L	736	.	.	P	-	2	0	CSMD1	3153298	0.960000	0.32886	0.064000	0.19789	0.637000	0.38172	1.532000	0.36029	0.163000	0.19507	0.561000	0.74099	CCT	.	.		0.527	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ADAM7	8756	hgsc.bcm.edu	37	8	24349552	24349552	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr8:24349552A>G	ENST00000175238.6	+	14	1576	c.1493A>G	c.(1492-1494)tAc>tGc	p.Y498C	ADAM7_ENST00000380789.1_Missense_Mutation_p.Y498C|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Missense_Mutation_p.Y270C|RP11-561E1.1_ENST00000519364.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	498	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TCAGAAGGCTACTGTTTCATG	0.468																																					p.Y498C		Atlas-SNP	.											.	ADAM7	165	.	0			c.A1493G						.						133.0	128.0	130.0					8																	24349552		2203	4299	6502	SO:0001583	missense	8756	exon14			AAGGCTACTGTTT	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1493A>G	chr8.hg19:g.24349552A>G	ENSP00000175238:p.Tyr498Cys	58.0	0.0		107.0	43.0	NM_003817	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	hg19	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163444	0.78226	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.26223	1.75;1.75;1.75	5.84	5.84	0.93424	ADAM, cysteine-rich (2);	0.000000	0.52532	D	0.000072	T	0.65344	0.2682	H	0.97158	3.95	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77645	-0.2510	10	0.87932	D	0	.	14.1687	0.65495	1.0:0.0:0.0:0.0	.	270;498	E5RK87;Q9H2U9	.;ADAM7_HUMAN	C	498;498;270;313	ENSP00000175238:Y498C;ENSP00000370166:Y498C;ENSP00000430400:Y270C	ENSP00000175238:Y498C	Y	+	2	0	ADAM7	24405442	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.438000	0.66550	2.231000	0.72958	0.533000	0.62120	TAC	.	.		0.468	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
UNC13B	10497	hgsc.bcm.edu	37	9	35295866	35295866	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr9:35295866G>A	ENST00000378495.3	+	8	922	c.700G>A	c.(700-702)Gac>Aac	p.D234N	UNC13B_ENST00000378496.4_Missense_Mutation_p.D234N|UNC13B_ENST00000396787.1_Missense_Mutation_p.D246N	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	234					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CAGTTCCCGGGACTCTTGTAA	0.512																																					p.D234N		Atlas-SNP	.											.	UNC13B	153	.	0			c.G700A						.						78.0	68.0	72.0					9																	35295866		2203	4300	6503	SO:0001583	missense	10497	exon8			TCCCGGGACTCTT	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.700G>A	chr9.hg19:g.35295866G>A	ENSP00000367756:p.Asp234Asn	131.0	0.0		109.0	36.0	NM_006377	Q5VYM8	Missense_Mutation	SNP	ENST00000378495.3	hg19	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000172	0.74818	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496	D;T;T	0.83250	-1.7;0.99;0.99	5.8	5.8	0.92144	.	0.319160	0.32002	N	0.006739	T	0.75287	0.3829	L	0.34521	1.04	0.54753	D	0.999989	B;P;B	0.45715	0.007;0.865;0.319	B;B;B	0.36719	0.004;0.231;0.149	T	0.75079	-0.3444	10	0.30854	T	0.27	-2.5223	19.0598	0.93085	0.0:0.0:1.0:0.0	.	234;234;234	Q2NKJ5;F8W8M9;O14795	.;.;UN13B_HUMAN	N	246;234;234	ENSP00000380006:D246N;ENSP00000367756:D234N;ENSP00000367757:D234N	ENSP00000367756:D234N	D	+	1	0	UNC13B	35285866	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	9.476000	0.97823	2.741000	0.93983	0.585000	0.79938	GAC	.	.		0.512	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
NUP214	8021	hgsc.bcm.edu	37	9	134074363	134074363	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr9:134074363A>G	ENST00000359428.5	+	29	5626	c.5482A>G	c.(5482-5484)Aca>Gca	p.T1828A	NUP214_ENST00000451030.1_Missense_Mutation_p.T1829A|NUP214_ENST00000411637.2_Missense_Mutation_p.T1818A|NUP214_ENST00000483497.2_Missense_Mutation_p.T654A			P35658	NU214_HUMAN	nucleoporin 214kDa	1828	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TGCCACCACAACAGCAGCAAC	0.502			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.T1828A	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	166	.	0			c.A5482G						.						52.0	58.0	56.0					9																	134074363		2203	4300	6503	SO:0001583	missense	8021	exon29			ACCACAACAGCAG	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.5482A>G	chr9.hg19:g.134074363A>G	ENSP00000352400:p.Thr1828Ala	106.0	0.0		86.0	35.0	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	A	8.691	0.907321	0.17833	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605;ENST00000483497	T;T;T;T	0.57907	0.85;0.88;0.86;0.37	6.07	3.71	0.42584	.	0.307454	0.23585	N	0.046617	T	0.30135	0.0755	N	0.08118	0	0.43287	D	0.995267	P;P;P;P;B	0.40970	0.734;0.734;0.734;0.734;0.394	B;B;B;B;B	0.42555	0.203;0.391;0.391;0.391;0.12	T	0.03829	-1.1000	10	0.22109	T	0.4	-16.5247	5.9935	0.19480	0.748:0.0:0.1018:0.1503	.	654;1257;1422;1818;1828	B7ZAV2;F5H131;Q5JUP9;P35658-4;P35658	.;.;.;.;NU214_HUMAN	A	1828;1818;1829;1807;1422;1257;654	ENSP00000352400:T1828A;ENSP00000396576:T1818A;ENSP00000405014:T1829A;ENSP00000436793:T654A	ENSP00000352400:T1828A	T	+	1	0	NUP214	133064184	0.994000	0.37717	0.318000	0.25279	0.016000	0.09150	3.294000	0.51787	1.089000	0.41292	0.533000	0.62120	ACA	.	.		0.502	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
CAMSAP1	157922	hgsc.bcm.edu	37	9	138774767	138774767	+	Silent	SNP	T	T	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr9:138774767T>C	ENST00000389532.4	-	2	382	c.318A>G	c.(316-318)ggA>ggG	p.G106G	CAMSAP1_ENST00000312405.6_5'Flank|CAMSAP1_ENST00000409386.3_Silent_p.G106G	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	106					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CAGACTGGTGTCCCTGTAAGG	0.577																																					p.G106G		Atlas-SNP	.											.	CAMSAP1	142	.	0			c.A318G						.						68.0	66.0	67.0					9																	138774767		692	1591	2283	SO:0001819	synonymous_variant	157922	exon2			CTGGTGTCCCTGT	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.318A>G	chr9.hg19:g.138774767T>C		74.0	0.0		54.0	26.0	NM_015447	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Silent	SNP	ENST00000389532.4	hg19	CCDS35176.2																																																																																			.	.		0.577	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
C9orf172	389813	hgsc.bcm.edu	37	9	139741196	139741196	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr9:139741196C>G	ENST00000436881.1	+	1	2330	c.2330C>G	c.(2329-2331)cCc>cGc	p.P777R	PHPT1_ENST00000545326.1_5'Flank|PHPT1_ENST00000247665.10_5'Flank|PHPT1_ENST00000371661.1_5'Flank	NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	777										endometrium(2)|large_intestine(1)|lung(6)	9						CTGCTATCCCCCACCTACCTA	0.706																																					p.P777R		Atlas-SNP	.											.	C9orf172	23	.	0			c.C2330G						.						13.0	14.0	14.0					9																	139741196		1715	3722	5437	SO:0001583	missense	389813	exon1			TATCCCCCACCTA		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.2330C>G	chr9.hg19:g.139741196C>G	ENSP00000412388:p.Pro777Arg	85.0	0.0		75.0	17.0	NM_001080482		Missense_Mutation	SNP	ENST00000436881.1	hg19	CCDS48059.1	.	.	.	.	.	.	.	.	.	.	.	16.25	3.070957	0.55646	.	.	ENSG00000232434	ENST00000436881	.	.	.	3.63	3.63	0.41609	.	.	.	.	.	T	0.77032	0.4071	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80850	-0.1198	8	0.87932	D	0	-9.0615	14.3301	0.66550	0.0:1.0:0.0:0.0	.	777	C9J069	CI172_HUMAN	R	777	.	ENSP00000412388:P777R	P	+	2	0	C9orf172	138861017	1.000000	0.71417	1.000000	0.80357	0.545000	0.35147	5.368000	0.66133	1.573000	0.49748	0.165000	0.16767	CCC	.	.		0.706	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
SLC39A12	221074	hgsc.bcm.edu	37	10	18250708	18250708	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr10:18250708G>A	ENST00000377369.2	+	3	733	c.460G>A	c.(460-462)Gaa>Aaa	p.E154K	SLC39A12_ENST00000377374.4_Missense_Mutation_p.E154K|SLC39A12_ENST00000539911.1_Missense_Mutation_p.E20K|SLC39A12_ENST00000377371.3_Missense_Mutation_p.E154K	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	154					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CAGGCAGGATGAAGATTCCTC	0.393																																					p.E154K		Atlas-SNP	.											.	SLC39A12	181	.	0			c.G460A						.						80.0	83.0	82.0					10																	18250708		2203	4300	6503	SO:0001583	missense	221074	exon3			CAGGATGAAGATT		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.460G>A	chr10.hg19:g.18250708G>A	ENSP00000366586:p.Glu154Lys	126.0	0.0		192.0	83.0	NM_152725	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	hg19	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397757	0.83120	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.64991	0.1;-0.05;0.1;-0.13	5.43	4.5	0.54988	.	0.057246	0.64402	D	0.000002	T	0.78502	0.4293	M	0.76002	2.32	0.49687	D	0.999814	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.81351	-0.0972	10	0.72032	D	0.01	-10.3986	14.9859	0.71348	0.0:0.1433:0.8567:0.0	.	154;154;154	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	K	154;154;154;20;74	ENSP00000366586:E154K;ENSP00000366591:E154K;ENSP00000366588:E154K;ENSP00000440445:E20K	ENSP00000366586:E154K	E	+	1	0	SLC39A12	18290714	1.000000	0.71417	0.993000	0.49108	0.976000	0.68499	6.537000	0.73847	1.230000	0.43646	0.650000	0.86243	GAA	.	.		0.393	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725	
SVIL	6840	hgsc.bcm.edu	37	10	29782297	29782297	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr10:29782297G>A	ENST00000355867.4	-	21	4617	c.3865C>T	c.(3865-3867)Ctc>Ttc	p.L1289F	SVIL_ENST00000375400.3_Missense_Mutation_p.L863F|SVIL_ENST00000375398.2_Missense_Mutation_p.L1289F|SVIL_ENST00000535393.1_Missense_Mutation_p.L203F|SVIL_ENST00000538146.1_Missense_Mutation_p.L81F	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1289					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GTGACAGTGAGCACCGTTTCG	0.398																																					p.L1289F		Atlas-SNP	.											.	SVIL	226	.	0			c.C3865T						.						93.0	86.0	88.0					10																	29782297		2203	4300	6503	SO:0001583	missense	6840	exon21			CAGTGAGCACCGT	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.3865C>T	chr10.hg19:g.29782297G>A	ENSP00000348128:p.Leu1289Phe	134.0	0.0		111.0	36.0	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	hg19	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529773	0.64860	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393;ENST00000535994;ENST00000538146	T;T;T;T;T	0.35236	2.58;2.58;2.58;2.43;1.32	4.28	4.28	0.50868	.	0.056922	0.64402	D	0.000002	T	0.54046	0.1834	M	0.72894	2.215	0.44500	D	0.997443	P;P;D;D	0.57899	0.906;0.906;0.981;0.967	P;P;P;P	0.61397	0.747;0.802;0.888;0.776	T	0.57785	-0.7751	10	0.59425	D	0.04	-19.1242	12.5627	0.56291	0.0843:0.0:0.9157:0.0	.	203;81;863;1289	F5H2Q5;F5GXV0;O95425-2;O95425	.;.;.;SVIL_HUMAN	F	863;1289;1289;203;243;81	ENSP00000364549:L863F;ENSP00000364547:L1289F;ENSP00000348128:L1289F;ENSP00000445472:L203F;ENSP00000440343:L81F	ENSP00000348128:L1289F	L	-	1	0	SVIL	29822303	0.992000	0.36948	0.403000	0.26384	0.981000	0.71138	2.013000	0.40942	2.217000	0.71921	0.485000	0.47835	CTC	.	.		0.398	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
ANKRD30A	91074	hgsc.bcm.edu	37	10	37505130	37505130	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr10:37505130T>A	ENST00000602533.1	+	32	2822	c.2723T>A	c.(2722-2724)aTc>aAc	p.I908N	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.I1027N|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.I908N			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	964					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CTATCAAAAATCTTGGATACA	0.323																																					p.I908N		Atlas-SNP	.											.	ANKRD30A	448	.	0			c.T2723A						.						55.0	50.0	52.0					10																	37505130		1797	4066	5863	SO:0001583	missense	91074	exon32			CAAAAATCTTGGA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2723T>A	chr10.hg19:g.37505130T>A	ENSP00000473551:p.Ile908Asn	158.0	0.0		400.0	157.0	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	hg19		.	.	.	.	.	.	.	.	.	.	t	2.404	-0.336866	0.05278	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.25749	1.78;1.78	2.63	1.45	0.22620	.	.	.	.	.	T	0.26774	0.0655	L	0.61036	1.89	0.09310	N	1	D	0.54772	0.968	P	0.44518	0.452	T	0.12192	-1.0557	9	0.51188	T	0.08	.	6.8755	0.24145	0.0:0.0:0.2375:0.7625	.	964	Q9BXX3	AN30A_HUMAN	N	908;1027	ENSP00000354432:I908N;ENSP00000363792:I1027N	ENSP00000354432:I908N	I	+	2	0	ANKRD30A	37545136	0.988000	0.35896	0.005000	0.12908	0.003000	0.03518	2.736000	0.47385	0.145000	0.18977	-0.844000	0.03045	ATC	.	.		0.323	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
RBP3	5949	hgsc.bcm.edu	37	10	48388858	48388858	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr10:48388858G>A	ENST00000224600.4	-	1	2133	c.2020C>T	c.(2020-2022)Cgc>Tgc	p.R674C	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	674	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	ACAGCTGTGCGGTAGGCGCCC	0.672																																					p.R674C		Atlas-SNP	.											.	RBP3	152	.	0			c.C2020T						.						26.0	30.0	29.0					10																	48388858		2196	4291	6487	SO:0001583	missense	5949	exon1			CTGTGCGGTAGGC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.2020C>T	chr10.hg19:g.48388858G>A	ENSP00000224600:p.Arg674Cys	129.0	0.0		92.0	45.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	hg19	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523988	0.44866	.	.	ENSG00000107618	ENST00000224600	T	0.52983	0.64	5.53	3.68	0.42216	.	0.180634	0.48286	N	0.000184	T	0.44603	0.1301	M	0.71036	2.16	0.80722	D	1	B	0.30179	0.271	B	0.20577	0.03	T	0.44360	-0.9333	10	0.72032	D	0.01	-15.3292	11.0	0.47600	0.1499:0.0:0.8501:0.0	.	674	P10745	RET3_HUMAN	C	674	ENSP00000224600:R674C	ENSP00000224600:R674C	R	-	1	0	RBP3	48008864	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.726000	0.61986	0.719000	0.32188	0.561000	0.74099	CGC	.	.		0.672	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
VDAC2	7417	hgsc.bcm.edu	37	10	76980582	76980582	+	Silent	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr10:76980582A>G	ENST00000332211.6	+	7	651	c.438A>G	c.(436-438)ggA>ggG	p.G146G	VDAC2_ENST00000535553.1_Silent_p.G107G|VDAC2_ENST00000313132.4_Silent_p.G161G|VDAC2_ENST00000472137.1_3'UTR|VDAC2_ENST00000543351.1_Silent_p.G146G	NM_003375.3	NP_003366.2	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	146					anion transport (GO:0006820)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein polymerization (GO:0032272)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	10	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)	ATTTTGCTGGACCTGCAATCC	0.418																																					p.G161G		Atlas-SNP	.											.	VDAC2	27	.	0			c.A483G						.						99.0	97.0	98.0					10																	76980582		2203	4297	6500	SO:0001819	synonymous_variant	7417	exon8			TGCTGGACCTGCA	BC000165	CCDS7348.1, CCDS53544.1	10q22	2011-11-15			ENSG00000165637	ENSG00000165637		"""Voltage-dependent anion channels"""	12672	protein-coding gene	gene with protein product		193245				7517385, 10049775	Standard	NM_003375		Approved		uc021ptp.1	P45880	OTTHUMG00000018517	ENST00000332211.6:c.438A>G	chr10.hg19:g.76980582A>G		196.0	0.0		262.0	114.0	NM_001184783	Q5VWK1|Q5VWK3|Q6IB40|Q7L3J5|Q9BWK8|Q9Y5I6	Silent	SNP	ENST00000332211.6	hg19	CCDS7348.1																																																																																			.	.		0.418	VDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048792.1	NM_003375	
PDZD8	118987	hgsc.bcm.edu	37	10	119133943	119133943	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr10:119133943G>A	ENST00000334464.5	-	1	1035	c.796C>T	c.(796-798)Cag>Tag	p.Q266*		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	266					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		GAGGTGAGCTGGGGCATGGGC	0.587																																					p.Q266X		Atlas-SNP	.											.	PDZD8	85	.	0			c.C796T						.						64.0	70.0	68.0					10																	119133943		2203	4300	6503	SO:0001587	stop_gained	118987	exon1			TGAGCTGGGGCAT	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.796C>T	chr10.hg19:g.119133943G>A	ENSP00000334642:p.Gln266*	143.0	0.0		117.0	53.0	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Nonsense_Mutation	SNP	ENST00000334464.5	hg19	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	G	39	7.443225	0.98286	.	.	ENSG00000165650	ENST00000334464	.	.	.	4.87	4.87	0.63330	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-9.7181	17.9979	0.89189	0.0:0.0:1.0:0.0	.	.	.	.	X	266	.	ENSP00000334642:Q266X	Q	-	1	0	PDZD8	119123933	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.247000	0.95444	2.230000	0.72887	0.655000	0.94253	CAG	.	.		0.587	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
TRIM66	9866	hgsc.bcm.edu	37	11	8662363	8662363	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr11:8662363C>T	ENST00000299550.6	-	9	1318	c.1124G>A	c.(1123-1125)tGc>tAc	p.C375Y	TRIM66_ENST00000402157.2_Missense_Mutation_p.C373Y	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	375						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						ATGAGGGCTGCAGGCCAGCTC	0.672																																					p.C375Y		Atlas-SNP	.											.	TRIM66	45	.	0			c.G1124A						.						14.0	16.0	15.0					11																	8662363		692	1591	2283	SO:0001583	missense	9866	exon9			GGGCTGCAGGCCA	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.1124G>A	chr11.hg19:g.8662363C>T	ENSP00000299550:p.Cys375Tyr	84.0	0.0		52.0	25.0	NM_014818	Q9BQQ4	Missense_Mutation	SNP	ENST00000299550.6	hg19		.	.	.	.	.	.	.	.	.	.	C	15.40	2.823639	0.50739	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	T;T	0.20332	2.08;2.08	5.25	4.33	0.51752	.	0.000000	0.52532	D	0.000069	T	0.33235	0.0856	M	0.67953	2.075	0.09310	N	1	D	0.69078	0.997	P	0.62014	0.897	T	0.21518	-1.0243	10	0.02654	T	1	-6.3451	10.9389	0.47262	0.1462:0.7131:0.1407:0.0	.	375	O15016	TRI66_HUMAN	Y	375;373	ENSP00000299550:C375Y;ENSP00000384876:C373Y	ENSP00000299550:C375Y	C	-	2	0	TRIM66	8618939	0.108000	0.22018	0.758000	0.31321	0.983000	0.72400	0.941000	0.29005	1.208000	0.43306	0.484000	0.47621	TGC	.	.		0.672	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_084529	
EEF1G	1937	hgsc.bcm.edu	37	11	62334458	62334458	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr11:62334458G>A	ENST00000329251.4	-	7	807	c.677C>T	c.(676-678)cCt>cTt	p.P226L	MIR3654_ENST00000496634.2_3'UTR|EEF1G_ENST00000378019.3_Missense_Mutation_p.P276L	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	226					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GTCCTTTTTAGGTTGGGTCTC	0.537																																					p.P226L		Atlas-SNP	.											.	EEF1G	33	.	0			c.C677T						.						147.0	139.0	142.0					11																	62334458		1886	4107	5993	SO:0001583	missense	1937	exon7			TTTTTAGGTTGGG	X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.677C>T	chr11.hg19:g.62334458G>A	ENSP00000331901:p.Pro226Leu	104.0	0.0		95.0	30.0	NM_001404	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Missense_Mutation	SNP	ENST00000329251.4	hg19	CCDS44626.1	.	.	.	.	.	.	.	.	.	.	G	18.11	3.550156	0.65311	.	.	ENSG00000254772	ENST00000329251;ENST00000378019	T;T	0.19938	2.11;2.11	4.8	4.8	0.61643	Glutathione S-transferase, C-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.38241	0.1033	M	0.67397	2.05	0.80722	D	1	D;B	0.62365	0.991;0.0	P;B	0.57101	0.813;0.003	T	0.08006	-1.0743	10	0.33141	T	0.24	.	15.7129	0.77644	0.0:0.0:1.0:0.0	.	276;226	B4DTG2;P26641	.;EF1G_HUMAN	L	226;276	ENSP00000331901:P226L;ENSP00000367258:P276L	ENSP00000331901:P226L	P	-	2	0	EEF1G	62091034	1.000000	0.71417	0.994000	0.49952	0.111000	0.19643	8.944000	0.92980	2.380000	0.81148	0.561000	0.74099	CCT	.	.		0.537	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395047.1	NM_001404	
CTSC	1075	hgsc.bcm.edu	37	11	88061352	88061352	+	Intron	SNP	A	A	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr11:88061352A>T	ENST00000227266.5	-	2	433				CTSC_ENST00000529974.1_Missense_Mutation_p.F111I|CTSC_ENST00000393301.4_5'UTR|CTSC_ENST00000524463.1_Missense_Mutation_p.F111I	NM_001814.4	NP_001805	P53634	CATC_HUMAN	cathepsin C						aging (GO:0007568)|immune response (GO:0006955)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of proteolysis involved in cellular protein catabolic process (GO:1903052)|proteolysis (GO:0006508)|response to organic substance (GO:0010033)|T cell mediated cytotoxicity (GO:0001913)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	chaperone binding (GO:0051087)|chloride ion binding (GO:0031404)|cysteine-type peptidase activity (GO:0008234)|peptidase activator activity involved in apoptotic process (GO:0016505)|phosphatase binding (GO:0019902)|serine-type endopeptidase activity (GO:0004252)			large_intestine(7)|lung(8)|ovary(2)|prostate(3)|skin(2)	22		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGACTGATAAAATCAGTGACA	0.373																																					p.F111I		Atlas-SNP	.											.	CTSC	46	.	0			c.T331A						.						74.0	68.0	70.0					11																	88061352		2201	4299	6500	SO:0001627	intron_variant	1075	exon3			TGATAAAATCAGT	AK223038	CCDS8282.1, CCDS31654.1, CCDS44693.1	11q14.2	2014-09-17			ENSG00000109861	ENSG00000109861	3.4.14.1	"""Cathepsins"""	2528	protein-coding gene	gene with protein product	"""dipeptidyl peptidase 1"""	602365		PLS, PALS		7649281, 9092576	Standard	NM_148170		Approved	DPP1	uc001pck.4	P53634	OTTHUMG00000167290	ENST00000227266.5:c.318+6752T>A	chr11.hg19:g.88061352A>T		75.0	0.0		99.0	42.0	NM_148170	A8K7V2|B5MDD5|Q2HIY8|Q53G93|Q71E75|Q71E76|Q7M4N9|Q7Z3G7|Q7Z5U7|Q8WY99|Q8WYA7|Q8WYA8	Missense_Mutation	SNP	ENST00000227266.5	hg19	CCDS8282.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.372034	0.82573	.	.	ENSG00000109861	ENST00000524463;ENST00000529974	D;D	0.88046	-2.33;-2.33	5.76	4.64	0.57946	.	.	.	.	.	D	0.84329	0.5448	.	.	.	0.22880	N	0.998619	P;B	0.43750	0.816;0.419	P;B	0.44990	0.466;0.183	T	0.74109	-0.3771	7	.	.	.	.	8.5624	0.33518	0.913:0.0:0.087:0.0	.	111;111	Q2HIY8;P53634-2	.;.	I	111	ENSP00000432541:F111I;ENSP00000433539:F111I	.	F	-	1	0	CTSC	87701000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.430000	0.52807	1.010000	0.39314	0.533000	0.62120	TTT	.	.		0.373	CTSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394019.2	NM_001814	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123471213	123471213	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr11:123471213A>G	ENST00000529750.1	+	7	905	c.578A>G	c.(577-579)tAt>tGt	p.Y193C	GRAMD1B_ENST00000322282.7_Missense_Mutation_p.Y193C|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.Y200C	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	193						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GATAGGACATATATGATGATG	0.413																																					p.Y193C		Atlas-SNP	.											.	GRAMD1B	122	.	0			c.A578G						.						102.0	95.0	97.0					11																	123471213		1852	4093	5945	SO:0001583	missense	57476	exon7			GGACATATATGAT	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.578A>G	chr11.hg19:g.123471213A>G	ENSP00000436500:p.Tyr193Cys	38.0	0.0		69.0	18.0	NM_020716	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	hg19	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.851960	0.71719	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.41065	1.37;1.4;1.4;1.46;1.01	5.73	5.73	0.89815	.	0.124524	0.56097	D	0.000029	T	0.63212	0.2492	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.64830	0.994;0.992;0.975;0.987	P;P;P;P	0.60345	0.873;0.819;0.594;0.664	T	0.68405	-0.5417	10	0.87932	D	0	.	16.0093	0.80385	1.0:0.0:0.0:0.0	.	153;200;193;200	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	C	200;200;193;193;153;189	ENSP00000402457:Y200C;ENSP00000325628:Y193C;ENSP00000436500:Y193C;ENSP00000432987:Y153C;ENSP00000434214:Y189C	ENSP00000325628:Y193C	Y	+	2	0	GRAMD1B	122976423	1.000000	0.71417	0.435000	0.26784	0.942000	0.58702	7.254000	0.78329	2.177000	0.69029	0.482000	0.46254	TAT	.	.		0.413	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
TNFRSF1A	7132	hgsc.bcm.edu	37	12	6438604	6438604	+	Silent	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr12:6438604G>A	ENST00000162749.2	-	10	1541	c.1242C>T	c.(1240-1242)cgC>cgT	p.R414R	TNFRSF1A_ENST00000437813.3_5'Flank|TNFRSF1A_ENST00000540022.1_Silent_p.R371R	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	414	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						GCGTGGCCTCGCGCCGCGGCG	0.726																																					p.R414R		Atlas-SNP	.											.	TNFRSF1A	39	.	0			c.C1242T						.						7.0	9.0	8.0					12																	6438604		2103	4099	6202	SO:0001819	synonymous_variant	7132	exon10			GGCCTCGCGCCGC	M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.1242C>T	chr12.hg19:g.6438604G>A		489.0	1.0		299.0	126.0	NM_001065	A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Silent	SNP	ENST00000162749.2	hg19	CCDS8542.1																																																																																			.	.		0.726	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399038.1	NM_001065	
CNTN1	1272	hgsc.bcm.edu	37	12	41421673	41421673	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr12:41421673C>G	ENST00000551295.2	+	22	2842	c.2725C>G	c.(2725-2727)Cca>Gca	p.P909A	CNTN1_ENST00000348761.2_Missense_Mutation_p.P898A|CNTN1_ENST00000550305.1_3'UTR|CNTN1_ENST00000347616.1_Missense_Mutation_p.P909A	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	909	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TAGCCAGCCTCCAAGGATCAT	0.408																																					p.P909A		Atlas-SNP	.											.	CNTN1	207	.	0			c.C2725G						.						126.0	110.0	116.0					12																	41421673		2203	4300	6503	SO:0001583	missense	1272	exon22			CAGCCTCCAAGGA	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2725C>G	chr12.hg19:g.41421673C>G	ENSP00000447006:p.Pro909Ala	50.0	0.0		91.0	44.0	NM_001843	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	hg19	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556673	0.86231	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.53423	0.62;0.62;0.62	5.71	5.71	0.89125	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72716	0.3495	M	0.83603	2.65	0.80722	D	1	D;D	0.64830	0.994;0.989	D;D	0.68765	0.96;0.912	T	0.74685	-0.3582	10	0.66056	D	0.02	.	20.243	0.98386	0.0:1.0:0.0:0.0	.	898;909	Q12860-2;Q12860	.;CNTN1_HUMAN	A	909;909;898	ENSP00000447006:P909A;ENSP00000325660:P909A;ENSP00000261160:P898A	ENSP00000325660:P909A	P	+	1	0	CNTN1	39707940	1.000000	0.71417	0.721000	0.30653	0.997000	0.91878	6.543000	0.73874	2.868000	0.98415	0.557000	0.71058	CCA	.	.		0.408	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
NAV3	89795	hgsc.bcm.edu	37	12	78579428	78579428	+	Missense_Mutation	SNP	C	C	A	rs201844408		TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr12:78579428C>A	ENST00000397909.2	+	31	5913	c.5740C>A	c.(5740-5742)Cgc>Agc	p.R1914S	NAV3_ENST00000228327.6_Missense_Mutation_p.R1892S|NAV3_ENST00000266692.7_Missense_Mutation_p.R1715S|NAV3_ENST00000552300.1_3'UTR|NAV3_ENST00000536525.2_Missense_Mutation_p.R1892S			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1914						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TAAAGATGGCCGCAGTGTGAA	0.343										HNSCC(70;0.22)																											p.R1892S		Atlas-SNP	.											.	NAV3	506	.	0			c.C5674A						.						136.0	124.0	128.0					12																	78579428		1877	4117	5994	SO:0001583	missense	89795	exon30			GATGGCCGCAGTG	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.5740C>A	chr12.hg19:g.78579428C>A	ENSP00000381007:p.Arg1914Ser	50.0	0.0		239.0	155.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.18|17.18	3.325145|3.325145	0.60634|0.60634	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|T;T;T;T;T	.|0.27890	.|1.7;1.68;1.69;1.64;2.52	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.177347	.|0.26883	.|U	.|0.022003	T|T	0.31136|0.31136	0.0787|0.0787	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|B;B;B;P	.|0.36438	.|0.038;0.159;0.028;0.553	.|B;B;B;B	.|0.35114	.|0.02;0.142;0.003;0.196	T|T	0.02837|0.02837	-1.1104|-1.1104	5|10	.|0.21540	.|T	.|0.41	-13.5347|-13.5347	20.0782|20.0782	0.97758|0.97758	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1892;1715;1914;1892	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	Q|S	786|1892;1914;1892;1715;506;514	.|ENSP00000446132:R1892S;ENSP00000381007:R1914S;ENSP00000228327:R1892S;ENSP00000266692:R1715S;ENSP00000448303:R514S	.|ENSP00000228327:R1892S	P|R	+|+	2|1	0|0	NAV3|NAV3	77103559|77103559	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.674000|5.674000	0.68117|0.68117	2.746000|2.746000	0.94184|0.94184	0.655000|0.655000	0.94253|0.94253	CCG|CGC	.	.		0.343	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
PLEKHG7	440107	hgsc.bcm.edu	37	12	93147989	93147989	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr12:93147989G>A	ENST00000344636.3	+	6	623	c.439G>A	c.(439-441)Gct>Act	p.A147T		NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	147	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						CATGGACTCTGCTGAGAAAAT	0.478																																					p.A147T		Atlas-SNP	.											.	PLEKHG7	38	.	0			c.G439A						.						101.0	90.0	93.0					12																	93147989		2203	4300	6503	SO:0001583	missense	440107	exon6			GACTCTGCTGAGA	AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.439G>A	chr12.hg19:g.93147989G>A	ENSP00000344961:p.Ala147Thr	67.0	0.0		224.0	47.0	NM_001004330	B2RNR7	Missense_Mutation	SNP	ENST00000344636.3	hg19	CCDS31873.1	.	.	.	.	.	.	.	.	.	.	G	8.250	0.808888	0.16467	.	.	ENSG00000187510	ENST00000344636	T	0.62788	0.0	5.4	2.78	0.32641	Dbl homology (DH) domain (4);	0.434073	0.26418	N	0.024486	T	0.38692	0.1050	N	0.16790	0.44	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.19647	-1.0299	10	0.09843	T	0.71	-25.0696	8.4224	0.32710	0.7329:0.0:0.2671:0.0	.	147	Q6ZR37	PKHG7_HUMAN	T	147	ENSP00000344961:A147T	ENSP00000344961:A147T	A	+	1	0	PLEKHG7	91672120	0.000000	0.05858	0.027000	0.17364	0.928000	0.56348	0.447000	0.21710	0.248000	0.21435	0.491000	0.48974	GCT	.	.		0.478	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1	NM_001004330	
MYO1H	283446	hgsc.bcm.edu	37	12	109853348	109853348	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr12:109853348C>T	ENST00000431443.2	+	14	1502	c.1502C>T	c.(1501-1503)cCa>cTa	p.P501L	MYO1H_ENST00000310903.5_Missense_Mutation_p.P491L	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	501	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CTGGCTGGTCCAAAGGGCCGA	0.517																																					p.P491L		Atlas-SNP	.											.	MYO1H	98	.	0			c.C1472T						.						47.0	48.0	48.0					12																	109853348		1938	4157	6095	SO:0001583	missense	283446	exon14			CTGGTCCAAAGGG		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1502C>T	chr12.hg19:g.109853348C>T	ENSP00000444076:p.Pro501Leu	43.0	0.0		144.0	53.0	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	hg19		.	.	.	.	.	.	.	.	.	.	C	7.468	0.646053	0.14451	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.89123	-2.44;-2.47	5.5	5.5	0.81552	.	.	.	.	.	T	0.79173	0.4401	N	0.20328	0.56	0.40158	D	0.977031	P	0.38827	0.649	B	0.32624	0.149	T	0.78940	-0.2006	9	0.25106	T	0.35	.	13.7776	0.63064	0.1542:0.8458:0.0:0.0	.	491	F5H3C6	.	L	491;501	ENSP00000439182:P491L;ENSP00000444076:P501L	ENSP00000439182:P491L	P	+	2	0	MYO1H	108337731	0.890000	0.30428	0.178000	0.23040	0.815000	0.46073	2.697000	0.47060	2.568000	0.86640	0.655000	0.94253	CCA	.	.		0.517	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
CSNK1A1L	122011	hgsc.bcm.edu	37	13	37679130	37679130	+	Silent	SNP	T	T	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr13:37679130T>C	ENST00000379800.3	-	1	673	c.264A>G	c.(262-264)ctA>ctG	p.L88L		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	88	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		GGTCCATGACTAGCACATTGT	0.468																																					p.L88L		Atlas-SNP	.											.	CSNK1A1L	69	.	0			c.A264G						.						121.0	111.0	115.0					13																	37679130		2203	4300	6503	SO:0001819	synonymous_variant	122011	exon1			CATGACTAGCACA	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.264A>G	chr13.hg19:g.37679130T>C		75.0	0.0		118.0	47.0	NM_145203	Q5T2N2	Silent	SNP	ENST00000379800.3	hg19	CCDS9363.1																																																																																			.	.		0.468	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
SLAIN1	122060	hgsc.bcm.edu	37	13	78320728	78320728	+	Silent	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr13:78320728A>G	ENST00000466548.1	+	5	956	c.930A>G	c.(928-930)aaA>aaG	p.K310K	SLAIN1_ENST00000351546.3_Silent_p.K47K|SLAIN1_ENST00000418532.1_Silent_p.K91K|SLAIN1_ENST00000488699.1_Silent_p.K168K|SLAIN1_ENST00000358679.3_Silent_p.K47K|SLAIN1_ENST00000314070.5_Intron|SLAIN1_ENST00000465831.1_3'UTR|SLAIN1_ENST00000267219.8_Silent_p.K91K	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	310										breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		CAGGAAAAAAAGGGACATGTA	0.403																																					p.K332K		Atlas-SNP	.											.	SLAIN1	43	.	0			c.A996G						.						133.0	121.0	125.0					13																	78320728		2203	4300	6503	SO:0001819	synonymous_variant	122060	exon4			AAAAAAAGGGACA	AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.930A>G	chr13.hg19:g.78320728A>G		72.0	0.0		115.0	5.0	NM_001242868	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Silent	SNP	ENST00000466548.1	hg19																																																																																				.	.		0.403	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000355018.1	NM_144595	
MYO16	23026	hgsc.bcm.edu	37	13	109792761	109792761	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr13:109792761G>T	ENST00000357550.2	+	31	4176	c.4135G>T	c.(4135-4137)Gcc>Tcc	p.A1379S	MYO16_ENST00000356711.2_Missense_Mutation_p.A1379S	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			gcccgcgggcgccccgggggc	0.736																																					p.A1401S		Atlas-SNP	.											MYO16,lower_third,carcinoma,0,1	MYO16	285	.	0			c.G4201T						.						9.0	9.0	9.0					13																	109792761		2086	4051	6137	SO:0001583	missense	23026	exon32			GCGGGCGCCCCGG		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.4135G>T	chr13.hg19:g.109792761G>T	ENSP00000350160:p.Ala1379Ser	79.0	0.0		50.0	17.0	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	hg19	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	G	9.766	1.171412	0.21621	.	.	ENSG00000041515	ENST00000356711;ENST00000357550	T;T	0.45276	0.9;0.9	4.84	2.08	0.27032	.	0.919043	0.08880	U	0.880173	T	0.18759	0.0450	N	0.02916	-0.46	0.34161	D	0.668651	B	0.27823	0.19	B	0.23716	0.048	T	0.29119	-1.0022	9	.	.	.	.	9.5435	0.39266	0.0756:0.2665:0.6578:0.0	.	1379	Q9Y6X6	MYO16_HUMAN	S	1379	ENSP00000349145:A1379S;ENSP00000350160:A1379S	.	A	+	1	0	MYO16	108590762	0.000000	0.05858	0.000000	0.03702	0.387000	0.30353	-0.071000	0.11505	0.091000	0.17302	0.305000	0.20034	GCC	.	.		0.736	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
DAAM1	23002	hgsc.bcm.edu	37	14	59730340	59730340	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr14:59730340C>T	ENST00000395125.1	+	1	168	c.145C>T	c.(145-147)Cct>Tct	p.P49S	DAAM1_ENST00000360909.3_Missense_Mutation_p.P49S|DAAM1_ENST00000556135.1_Missense_Mutation_p.P49S|DAAM1_ENST00000351081.1_Missense_Mutation_p.P49S	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	49	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GCCCATGCCCCCTGTGGAGGA	0.507																																					p.P49S		Atlas-SNP	.											.	DAAM1	95	.	0			c.C145T						.						110.0	96.0	101.0					14																	59730340		2203	4300	6503	SO:0001583	missense	23002	exon2			ATGCCCCCTGTGG	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.145C>T	chr14.hg19:g.59730340C>T	ENSP00000378557:p.Pro49Ser	135.0	0.0		123.0	56.0	NM_001270520	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	hg19	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	C	8.294	0.818315	0.16607	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000556135;ENST00000395125	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	5.79	4.85	0.62838	GTPase-binding/formin homology 3 (1);Diaphanous GTPase-binding (1);	0.147991	0.45361	D	0.000376	T	0.81173	0.4767	N	0.13272	0.32	0.48975	D	0.999732	B;B;P	0.46859	0.122;0.149;0.885	B;B;P	0.51324	0.06;0.099;0.666	T	0.77024	-0.2741	10	0.02654	T	1	.	16.3348	0.83053	0.0:0.868:0.132:0.0	.	49;49;49	Q9Y4D1-2;Q9Y4D1;A8K6X5	.;DAAM1_HUMAN;.	S	49	ENSP00000354162:P49S;ENSP00000247170:P49S;ENSP00000450498:P49S;ENSP00000378557:P49S	ENSP00000247170:P49S	P	+	1	0	DAAM1	58800093	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	3.602000	0.54066	2.744000	0.94065	0.650000	0.86243	CCT	.	.		0.507	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
KCNH5	27133	hgsc.bcm.edu	37	14	63473124	63473124	+	Silent	SNP	G	G	A	rs373008977		TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr14:63473124G>A	ENST00000322893.7	-	3	532	c.264C>T	c.(262-264)taC>taT	p.Y88Y	KCNH5_ENST00000394968.1_Silent_p.Y30Y|KCNH5_ENST00000394964.2_Silent_p.Y30Y|KCNH5_ENST00000420622.2_Silent_p.Y88Y	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	88	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		AGTTTGATTCGTAGTTGTCAA	0.338																																					p.Y88Y		Atlas-SNP	.											.	KCNH5	320	.	0			c.C264T						.	G	,,	0,4404		0,0,2202	105.0	102.0	103.0		264,264,90	-1.1	1.0	14		103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	KCNH5	NM_139318.3,NM_172375.1,NM_172376.1	,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,	88/989,88/612,30/625	63473124	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	27133	exon3			TGATTCGTAGTTG	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.264C>T	chr14.hg19:g.63473124G>A		50.0	0.0		62.0	19.0	NM_172375	C9JP98	Silent	SNP	ENST00000322893.7	hg19	CCDS9756.1																																																																																			.	.		0.338	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
LTK	4058	hgsc.bcm.edu	37	15	41796631	41796631	+	Splice_Site	SNP	C	C	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr15:41796631C>G	ENST00000263800.6	-	19	2352		c.e19-1		LTK_ENST00000453182.2_Splice_Site|LTK_ENST00000355166.5_Splice_Site|LTK_ENST00000561619.1_Splice_Site	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase						cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		GATGCGGTACCTGGGGAGAGG	0.627										TSP Lung(18;0.14)																											.		Atlas-SNP	.											.	LTK	117	.	0			c.2256-1G>C						.						84.0	73.0	77.0					15																	41796631		2203	4300	6503	SO:0001630	splice_region_variant	4058	exon20			CGGTACCTGGGGA	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.2256-1G>C	chr15.hg19:g.41796631C>G		82.0	0.0		72.0	26.0	NM_002344	A6NNJ8|B4DL89|E9PFX4	Splice_Site	SNP	ENST00000263800.6	hg19	CCDS10077.1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.902864	0.72754	.	.	ENSG00000062524	ENST00000355166;ENST00000263800;ENST00000453182	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1285	0.81410	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LTK	39583923	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.838000	0.75359	2.335000	0.79485	0.655000	0.94253	.	.	.		0.627	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		Intron
SLC24A5	283652	hgsc.bcm.edu	37	15	48429129	48429129	+	Silent	SNP	A	A	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr15:48429129A>C	ENST00000341459.3	+	6	913	c.840A>C	c.(838-840)atA>atC	p.I280I	SLC24A5_ENST00000449382.2_Silent_p.I220I	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	280					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		AGCTCTCTATAAGTTTACATG	0.363																																					p.I280I		Atlas-SNP	.											.	SLC24A5	64	.	0			c.A840C						.						80.0	81.0	81.0					15																	48429129		2198	4297	6495	SO:0001819	synonymous_variant	283652	exon6			CTCTATAAGTTTA	AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.840A>C	chr15.hg19:g.48429129A>C		58.0	0.0		104.0	35.0	NM_205850	A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Silent	SNP	ENST00000341459.3	hg19	CCDS10128.1																																																																																			.	.		0.363	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254340.2	NM_205850	
FBN1	2200	hgsc.bcm.edu	37	15	48779389	48779389	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr15:48779389C>A	ENST00000316623.5	-	29	3927	c.3472G>T	c.(3472-3474)Gaa>Taa	p.E1158*		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1158	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGCTCACATTCATTGATGTCT	0.468																																					p.E1158X		Atlas-SNP	.											.	FBN1	310	.	0			c.G3472T						.						84.0	78.0	80.0					15																	48779389		2198	4296	6494	SO:0001587	stop_gained	2200	exon29			CACATTCATTGAT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.3472G>T	chr15.hg19:g.48779389C>A	ENSP00000325527:p.Glu1158*	65.0	0.0		76.0	30.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Nonsense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	46	12.843127	0.99700	.	.	ENSG00000166147	ENST00000316623	.	.	.	5.3	5.3	0.74995	.	0.046832	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.7483	0.91802	0.0:1.0:0.0:0.0	.	.	.	.	X	1158	.	ENSP00000325527:E1158X	E	-	1	0	FBN1	46566681	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	7.564000	0.82326	2.758000	0.94735	0.655000	0.94253	GAA	.	.		0.468	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
DPP8	54878	hgsc.bcm.edu	37	15	65759147	65759147	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr15:65759147C>G	ENST00000341861.5	-	14	3322	c.1742G>C	c.(1741-1743)tGt>tCt	p.C581S	DPP8_ENST00000321118.7_Missense_Mutation_p.C581S|DPP8_ENST00000559233.1_Missense_Mutation_p.C581S|DPP8_ENST00000321147.6_Missense_Mutation_p.C581S|DPP8_ENST00000358939.4_Missense_Mutation_p.C565S|DPP8_ENST00000339244.5_Missense_Mutation_p.C408S|DPP8_ENST00000300141.6_Missense_Mutation_p.C565S	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	581					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AAAGAAGTCACAGTGCTAGAG	0.358																																					p.C581S		Atlas-SNP	.											.	DPP8	78	.	0			c.G1742C						.						76.0	75.0	75.0					15																	65759147		2201	4299	6500	SO:0001583	missense	54878	exon15			AAGTCACAGTGCT	AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.1742G>C	chr15.hg19:g.65759147C>G	ENSP00000339208:p.Cys581Ser	65.0	0.0		82.0	34.0	NM_197960	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	ENST00000341861.5	hg19	CCDS10207.1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.454142	0.43634	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000339244;ENST00000395652	T;T;T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68;1.68;1.68	5.61	5.61	0.85477	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.41581	0.1165	M	0.72894	2.215	0.54753	D	0.999988	B;B;D;P;P	0.56968	0.417;0.371;0.978;0.753;0.792	B;B;P;B;B	0.50659	0.356;0.141;0.647;0.406;0.3	T	0.11743	-1.0575	10	0.26408	T	0.33	-22.3355	19.718	0.96131	0.0:1.0:0.0:0.0	.	408;565;565;581;581	C9JSG1;Q6V1X1-3;Q6V1X1-4;Q6V1X1-2;Q6V1X1	.;.;.;.;DPP8_HUMAN	S	581;565;565;581;581;408;581	ENSP00000339208:C581S;ENSP00000351817:C565S;ENSP00000300141:C565S;ENSP00000318111:C581S;ENSP00000316373:C581S;ENSP00000341230:C408S;ENSP00000379013:C581S	ENSP00000300141:C565S	C	-	2	0	DPP8	63546200	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	5.661000	0.68025	2.663000	0.90544	0.454000	0.30748	TGT	.	.		0.358	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743	
HCN4	10021	hgsc.bcm.edu	37	15	73617688	73617688	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr15:73617688A>T	ENST00000261917.3	-	5	2681	c.1688T>A	c.(1687-1689)aTg>aAg	p.M563K		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	563					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		CTCGTCGAACATCTTGCCCTG	0.652																																					p.M563K		Atlas-SNP	.											.	HCN4	150	.	0			c.T1688A						.						95.0	96.0	96.0					15																	73617688		2198	4297	6495	SO:0001583	missense	10021	exon5			TCGAACATCTTGC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1688T>A	chr15.hg19:g.73617688A>T	ENSP00000261917:p.Met563Lys	151.0	0.0		90.0	33.0	NM_005477	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	hg19	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	a	18.71	3.682281	0.68042	.	.	ENSG00000138622	ENST00000261917	D	0.96427	-4.01	3.28	3.28	0.37604	Cyclic nucleotide-binding-like (1);	.	.	.	.	D	0.97548	0.9197	M	0.82323	2.585	0.53005	D	0.999967	D	0.53885	0.963	D	0.63597	0.916	D	0.97148	0.9829	9	0.45353	T	0.12	.	12.1159	0.53866	1.0:0.0:0.0:0.0	.	563	Q9Y3Q4	HCN4_HUMAN	K	563	ENSP00000261917:M563K	ENSP00000261917:M563K	M	-	2	0	HCN4	71404741	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.956000	0.93066	1.504000	0.48704	0.449000	0.29647	ATG	.	.		0.652	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
APOBR	55911	hgsc.bcm.edu	37	16	28506821	28506821	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr16:28506821C>A	ENST00000431282.1	+	2	469	c.459C>A	c.(457-459)agC>agA	p.S153R	APOBR_ENST00000328423.5_Missense_Mutation_p.S153R|CLN3_ENST00000569430.1_5'UTR|CLN3_ENST00000567160.1_5'UTR|APOBR_ENST00000564831.1_Missense_Mutation_p.S153R			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	153					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						AAGACAGGAGCGGCCAAGCCC	0.617																																					p.S153R		Atlas-SNP	.											.	APOBR	89	.	0			c.C459A						.						9.0	12.0	11.0					16																	28506821		2013	4167	6180	SO:0001583	missense	55911	exon2			CAGGAGCGGCCAA	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.459C>A	chr16.hg19:g.28506821C>A	ENSP00000416094:p.Ser153Arg	399.0	0.0		266.0	106.0	NM_018690	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	ENST00000431282.1	hg19		.	.	.	.	.	.	.	.	.	.	C	10.90	1.481315	0.26598	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.59502	0.26;0.26	4.88	-0.759	0.11045	.	.	.	.	.	T	0.41166	0.1147	N	0.20986	0.625	0.09310	N	1	P	0.44344	0.833	B	0.43386	0.418	T	0.28744	-1.0034	9	0.49607	T	0.09	-4.5254	5.6128	0.17414	0.0:0.5099:0.1398:0.3503	.	153	Q9NS13	.	R	153	ENSP00000327669:S153R;ENSP00000416094:S153R	ENSP00000327669:S153R	S	+	3	2	APOBR	28414322	0.000000	0.05858	0.014000	0.15608	0.030000	0.12068	-0.176000	0.09811	0.021000	0.15133	-0.245000	0.11935	AGC	.	.		0.617	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_182804	
MYH2	4620	hgsc.bcm.edu	37	17	10443978	10443978	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr17:10443978G>C	ENST00000245503.5	-	11	1325	c.941C>G	c.(940-942)cCa>cGa	p.P314R	MYH2_ENST00000397183.2_Missense_Mutation_p.P314R|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.P314R	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	314	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						ACTGACAAATGGGTAATCATA	0.363																																					p.P314R		Atlas-SNP	.											.	MYH2	390	.	0			c.C941G						.						103.0	94.0	97.0					17																	10443978		2203	4300	6503	SO:0001583	missense	4620	exon11			ACAAATGGGTAAT		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.941C>G	chr17.hg19:g.10443978G>C	ENSP00000245503:p.Pro314Arg	82.0	0.0		40.0	33.0	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	hg19	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711468	0.48517	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183	D;D;D	0.86097	-2.07;-2.07;-2.07	5.25	5.25	0.73442	Myosin head, motor domain (2);	0.524332	0.14333	U	0.326202	D	0.82309	0.5009	N	0.17631	0.505	0.38045	D	0.935604	B;B	0.26512	0.04;0.151	B;B	0.43360	0.038;0.417	T	0.77194	-0.2677	10	0.26408	T	0.33	.	13.5171	0.61547	0.0:0.0:0.8339:0.1661	.	314;314	Q567P6;Q9UKX2	.;MYH2_HUMAN	R	314	ENSP00000433944:P314R;ENSP00000245503:P314R;ENSP00000380367:P314R	ENSP00000245503:P314R	P	-	2	0	MYH2	10384703	0.998000	0.40836	0.998000	0.56505	0.998000	0.95712	2.598000	0.46223	2.742000	0.94016	0.650000	0.86243	CCA	.	.		0.363	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
SLC13A2	9058	hgsc.bcm.edu	37	17	26822770	26822770	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr17:26822770C>T	ENST00000314669.5	+	10	1826	c.1406C>T	c.(1405-1407)aCc>aTc	p.T469I	SLC13A2_ENST00000537681.1_Missense_Mutation_p.T398I|SLC13A2_ENST00000444914.3_Missense_Mutation_p.T518I|SLC13A2_ENST00000545060.1_Missense_Mutation_p.T426I	NM_003984.3	NP_003975.1	Q13183	S13A2_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2	469					dicarboxylic acid transport (GO:0006835)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	low-affinity sodium:dicarboxylate symporter activity (GO:0015361)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CTGGTGGCCACCTTCACCGAG	0.612																																					p.T518I		Atlas-SNP	.											.	SLC13A2	125	.	0			c.C1553T						.						149.0	125.0	133.0					17																	26822770		2203	4300	6503	SO:0001583	missense	9058	exon10			TGGCCACCTTCAC	U26209	CCDS11231.1, CCDS54098.1	17p13.2	2013-05-22			ENSG00000007216	ENSG00000007216		"""Solute carriers"""	10917	protein-coding gene	gene with protein product		604148				8967342, 10343111	Standard	NM_001145975		Approved	NaDC-1	uc010wan.2	Q13183	OTTHUMG00000132523	ENST00000314669.5:c.1406C>T	chr17.hg19:g.26822770C>T	ENSP00000316202:p.Thr469Ile	39.0	0.0		34.0	8.0	NM_001145975	B2RBI9|B4DPL1|E7ETH5|Q4VAR7	Missense_Mutation	SNP	ENST00000314669.5	hg19	CCDS11231.1	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.364550	0.01235	.	.	ENSG00000007216	ENST00000314669;ENST00000444914;ENST00000545060;ENST00000537681	T;T;T;T	0.02812	4.15;4.15;4.15;4.15	5.19	0.924	0.19418	.	0.517771	0.23666	N	0.045768	T	0.02494	0.0076	L	0.33710	1.025	0.43453	D	0.995649	B;B;B;B	0.22604	0.072;0.0;0.016;0.002	B;B;B;B	0.23275	0.045;0.014;0.018;0.02	T	0.53514	-0.8428	10	0.24483	T	0.36	-12.5262	9.0667	0.36467	0.0:0.6233:0.0:0.3767	.	426;518;398;469	F5GWV6;E7ETH5;G3V1L2;Q13183	.;.;.;S13A2_HUMAN	I	469;518;426;398	ENSP00000316202:T469I;ENSP00000392411:T518I;ENSP00000441935:T426I;ENSP00000440802:T398I	ENSP00000316202:T469I	T	+	2	0	SLC13A2	23846897	0.430000	0.25538	0.333000	0.25482	0.200000	0.23975	1.658000	0.37376	-0.030000	0.13804	-0.379000	0.06801	ACC	.	.		0.612	SLC13A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255722.1	NM_003984	
ABCA9	10350	hgsc.bcm.edu	37	17	67023238	67023238	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr17:67023238T>A	ENST00000340001.4	-	15	2140	c.1929A>T	c.(1927-1929)gaA>gaT	p.E643D	ABCA9_ENST00000453985.2_Missense_Mutation_p.E643D|ABCA9_ENST00000370732.2_Missense_Mutation_p.E643D	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	643	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					CAGCAGTCGGTTCATCCAATA	0.408																																					p.E643D		Atlas-SNP	.											.	ABCA9	192	.	0			c.A1929T						.						71.0	72.0	71.0					17																	67023238		2203	4300	6503	SO:0001583	missense	10350	exon15			AGTCGGTTCATCC	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.1929A>T	chr17.hg19:g.67023238T>A	ENSP00000342216:p.Glu643Asp	41.0	0.0		96.0	12.0	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	hg19	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.724541	0.48728	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	T;T	0.69435	-0.4;-0.4	5.31	1.88	0.25563	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.49305	D	0.000153	D	0.83105	0.5182	M	0.93462	3.42	0.47341	D	0.999394	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.988	T	0.82579	-0.0387	10	0.87932	D	0	.	8.0357	0.30491	0.0:0.3115:0.0:0.6885	.	643;643	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	D	643;626;643;638	ENSP00000342216:E643D;ENSP00000359767:E643D	ENSP00000342216:E643D	E	-	3	2	ABCA9	64534833	0.998000	0.40836	1.000000	0.80357	0.121000	0.20230	0.494000	0.22467	0.419000	0.25927	0.477000	0.44152	GAA	.	.		0.408	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
PTPRM	5797	hgsc.bcm.edu	37	18	7955137	7955137	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr18:7955137C>T	ENST00000332175.8	+	7	1894	c.857C>T	c.(856-858)gCc>gTc	p.A286V	PTPRM_ENST00000444013.1_Missense_Mutation_p.A73V|PTPRM_ENST00000400060.4_Missense_Mutation_p.A286V|PTPRM_ENST00000580170.1_Missense_Mutation_p.A286V|PTPRM_ENST00000400053.4_Missense_Mutation_p.A224V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	286	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GTTCCTATTGCCCCACCTCAG	0.488																																					p.A286V		Atlas-SNP	.											.	PTPRM	185	.	0			c.C857T						.						66.0	64.0	65.0					18																	7955137		2203	4300	6503	SO:0001583	missense	5797	exon7			CTATTGCCCCACC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.857C>T	chr18.hg19:g.7955137C>T	ENSP00000331418:p.Ala286Val	94.0	0.0		100.0	28.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342388	0.61073	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	6.02	6.02	0.97574	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72700	0.3493	M	0.81802	2.56	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76575	0.929;0.988;0.988	T	0.72431	-0.4296	10	0.54805	T	0.06	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	73;286;286	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	V	286;286;224;73	ENSP00000331418:A286V;ENSP00000382933:A286V;ENSP00000382927:A224V;ENSP00000387608:A73V	ENSP00000331418:A286V	A	+	2	0	PTPRM	7945137	1.000000	0.71417	0.661000	0.29709	0.986000	0.74619	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	GCC	.	.		0.488	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
TWSG1	57045	hgsc.bcm.edu	37	18	9399524	9399524	+	Nonstop_Mutation	SNP	A	A	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr18:9399524A>T	ENST00000262120.5	+	5	862	c.671A>T	c.(670-672)tAa>tTa	p.*224L		NM_020648.5	NP_065699.1	Q9GZX9	TWSG1_HUMAN	twisted gastrulation BMP signaling modulator 1	0					BMP signaling pathway (GO:0030509)|camera-type eye development (GO:0043010)|cell differentiation (GO:0030154)|forebrain development (GO:0030900)|hemopoiesis (GO:0030097)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of osteoblast differentiation (GO:0045668)|ossification (GO:0001503)|positive regulation of BMP signaling pathway (GO:0030513)|salivary gland morphogenesis (GO:0007435)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|pancreas(2)	10						TGCATGTTTTAAAGAAGACAA	0.348																																					p.X224L		Atlas-SNP	.											.	TWSG1	23	.	0			c.A671T						.						68.0	67.0	67.0					18																	9399524		2203	4300	6503	SO:0001578	stop_lost	57045	exon5			TGTTTTAAAGAAG	AA486291	CCDS11844.1	18p11.3	2013-10-03	2013-10-03		ENSG00000128791	ENSG00000128791			12429	protein-coding gene	gene with protein product		605049	"""twisted gastrulation homolog 1 (Drosophila)"""			11260715	Standard	NM_020648		Approved	TSG	uc002knz.3	Q9GZX9	OTTHUMG00000131597	ENST00000262120.5:c.671A>T	chr18.hg19:g.9399524A>T	ENSP00000262120:p.*224Leuext*10	61.0	0.0		52.0	18.0	NM_020648	B2RE08|D3DUH9|Q8NBI7|Q96K46	Missense_Mutation	SNP	ENST00000262120.5	hg19	CCDS11844.1	.	.	.	.	.	.	.	.	.	.	A	13.53	2.264447	0.39995	.	.	ENSG00000128791	ENST00000262120	.	.	.	4.8	2.39	0.29439	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.2843	0.10848	0.5984:0.0:0.4016:0.0	.	.	.	.	L	224	.	.	X	+	2	2	TWSG1	9389524	1.000000	0.71417	0.958000	0.39756	0.777000	0.43975	3.958000	0.56737	0.686000	0.31488	0.374000	0.22700	TAA	.	.		0.348	TWSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254480.2		
CHMP1B	57132	hgsc.bcm.edu	37	18	11851773	11851773	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr18:11851773T>C	ENST00000526991.2	+	1	379	c.263T>C	c.(262-264)gTg>gCg	p.V88A	GNAL_ENST00000535121.1_Intron|GNAL_ENST00000334049.6_Intron|RP11-78A19.3_ENST00000586474.1_RNA|GNAL_ENST00000423027.3_Intron|GNAL_ENST00000269162.5_Intron	NM_020412.4	NP_065145.2	Q7LBR1	CHM1B_HUMAN	charged multivesicular body protein 1B	88					cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|protein transport (GO:0015031)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|lung(1)|urinary_tract(1)	3						ATGGGCAAGGTGACCAAGTCG	0.537																																					p.V88A		Atlas-SNP	.											.	CHMP1B	16	.	0			c.T263C						.						138.0	150.0	146.0					18																	11851773		2159	4275	6434	SO:0001583	missense	57132	exon1			GCAAGGTGACCAA	AF306520	CCDS54180.1	18p11.21	2011-09-21	2011-09-21		ENSG00000255112	ENSG00000255112		"""Charged multivesicular body proteins"""	24287	protein-coding gene	gene with protein product		606486	"""chromatin modifying protein 1B"""			15537668	Standard	NM_020412		Approved	CHMP1.5, C18orf2, Vps46B	uc002kqe.3	Q7LBR1	OTTHUMG00000165820	ENST00000526991.2:c.263T>C	chr18.hg19:g.11851773T>C	ENSP00000432279:p.Val88Ala	63.0	0.0		40.0	23.0	NM_020412	Q96E89|Q9HD41	Missense_Mutation	SNP	ENST00000526991.2	hg19	CCDS54180.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.621079	0.87460	.	.	ENSG00000255112	ENST00000526991	T	0.76578	-1.03	5.08	5.08	0.68730	.	.	.	.	.	D	0.90597	0.7052	H	0.95745	3.715	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.92557	0.6055	9	0.87932	D	0	.	11.4276	0.50020	0.0:0.0:0.0:1.0	.	88	Q7LBR1	CHM1B_HUMAN	A	88	ENSP00000432279:V88A	ENSP00000432279:V88A	V	+	2	0	CHMP1B	11841773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.263000	0.75096	0.533000	0.62120	GTG	.	.		0.537	CHMP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386375.2	NM_020412	
DAZAP1	26528	hgsc.bcm.edu	37	19	1429964	1429964	+	Splice_Site	SNP	A	A	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr19:1429964A>C	ENST00000233078.4	+	9	861		c.e9-1		DAZAP1_ENST00000336761.6_Splice_Site	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1						cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTCTTATCTAGGAATGTGGG	0.592																																					.		Atlas-SNP	.											.	DAZAP1	52	.	0			c.701-2A>C						.						56.0	45.0	49.0					19																	1429964		2195	4292	6487	SO:0001630	splice_region_variant	26528	exon9			TTATCTAGGAATG		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.701-1A>C	chr19.hg19:g.1429964A>C		120.0	0.0		79.0	25.0	NM_018959	Q96MJ3|Q9NRR9	Splice_Site	SNP	ENST00000233078.4	hg19	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	A	19.34	3.808395	0.70797	.	.	ENSG00000071626	ENST00000233078;ENST00000336761	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3044	0.60345	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DAZAP1	1380964	1.000000	0.71417	0.986000	0.45419	0.879000	0.50718	6.456000	0.73501	1.833000	0.53350	0.454000	0.30748	.	.	.		0.592	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	Intron
ZNF493	284443	hgsc.bcm.edu	37	19	21606246	21606246	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr19:21606246A>G	ENST00000355504.4	+	2	667	c.401A>G	c.(400-402)cAg>cGg	p.Q134R	ZNF493_ENST00000392288.2_Missense_Mutation_p.Q262R|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	134					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						CATACTGGACAGAAACCCTAC	0.363																																					p.Q262R		Atlas-SNP	.											.	ZNF493	178	.	0			c.A785G						.						40.0	43.0	42.0					19																	21606246		2203	4297	6500	SO:0001583	missense	284443	exon4			CTGGACAGAAACC	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.401A>G	chr19.hg19:g.21606246A>G	ENSP00000347691:p.Gln134Arg	108.0	0.0		211.0	80.0	NM_001076678	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	hg19	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	8.227	0.803755	0.16467	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.19250	2.16;2.16	0.927	0.927	0.19437	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11452	0.0279	N	0.13003	0.285	0.80722	D	1	B;B	0.32467	0.046;0.372	B;B	0.33121	0.158;0.074	T	0.12889	-1.0530	9	0.72032	D	0.01	.	6.8319	0.23915	1.0:0.0:0.0:0.0	.	134;262	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	R	262;134	ENSP00000376110:Q262R;ENSP00000347691:Q134R	ENSP00000347691:Q134R	Q	+	2	0	ZNF493	21398086	0.709000	0.27886	0.317000	0.25265	0.305000	0.27757	2.645000	0.46621	0.321000	0.23259	0.315000	0.21342	CAG	.	.		0.363	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
RYR1	6261	hgsc.bcm.edu	37	19	38958307	38958307	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr19:38958307C>A	ENST00000359596.3	+	25	3236	c.3236C>A	c.(3235-3237)tCc>tAc	p.S1079Y	RYR1_ENST00000355481.4_Missense_Mutation_p.S1079Y|RYR1_ENST00000360985.3_Missense_Mutation_p.S1079Y			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1079	6 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCAGAGAAATCCTATACAGTG	0.587																																					p.S1079Y		Atlas-SNP	.											RYR1,acral,malignant_melanoma,0,1	RYR1	708	.	0			c.C3236A						.						99.0	93.0	95.0					19																	38958307		2203	4300	6503	SO:0001583	missense	6261	exon25			AGAAATCCTATAC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3236C>A	chr19.hg19:g.38958307C>A	ENSP00000352608:p.Ser1079Tyr	131.0	0.0		89.0	39.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	c	7.897	0.733632	0.15574	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.74737	-0.87;-0.87;-0.87	2.77	2.77	0.32553	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.64402	U	0.000020	D	0.83732	0.5318	M	0.81112	2.525	0.39065	D	0.960607	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.973	D	0.85766	0.1352	10	0.72032	D	0.01	.	9.5055	0.39044	0.0:0.8864:0.0:0.1136	.	1079;1079	P21817-2;P21817	.;RYR1_HUMAN	Y	1079	ENSP00000352608:S1079Y;ENSP00000347667:S1079Y;ENSP00000354254:S1079Y	ENSP00000347667:S1079Y	S	+	2	0	RYR1	43650147	0.862000	0.29867	0.999000	0.59377	0.683000	0.39861	1.061000	0.30542	1.883000	0.54544	0.154000	0.16183	TCC	.	.		0.587	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
NCOA6	23054	hgsc.bcm.edu	37	20	33328358	33328358	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr20:33328358G>C	ENST00000374796.2	-	12	8272	c.5702C>G	c.(5701-5703)gCa>gGa	p.A1901G	NCOA6_ENST00000359003.2_Missense_Mutation_p.A1901G			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1901	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GCTGGGTCCTGCTGAGGCAGT	0.592																																					p.A1901G		Atlas-SNP	.											.	NCOA6	219	.	0			c.C5702G						.						54.0	53.0	53.0					20																	33328358		2203	4300	6503	SO:0001583	missense	23054	exon11			GGTCCTGCTGAGG	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.5702C>G	chr20.hg19:g.33328358G>C	ENSP00000363929:p.Ala1901Gly	43.0	0.0		58.0	22.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651618	0.47362	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.25579	1.79;1.79	5.65	4.64	0.57946	.	0.752314	0.12599	N	0.454854	T	0.14960	0.0361	N	0.08118	0	0.22081	N	0.999379	B	0.19200	0.034	B	0.14023	0.01	T	0.08411	-1.0723	10	0.36615	T	0.2	0.0536	13.2479	0.60033	0.0826:0.0:0.9174:0.0	.	1901	Q14686	NCOA6_HUMAN	G	1901	ENSP00000363929:A1901G;ENSP00000351894:A1901G	ENSP00000351894:A1901G	A	-	2	0	NCOA6	32792019	0.988000	0.35896	1.000000	0.80357	0.947000	0.59692	2.574000	0.46016	2.941000	0.99782	0.655000	0.94253	GCA	.	.		0.592	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
SNRPD3	6634	hgsc.bcm.edu	37	22	24967931	24967931	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr22:24967931C>A	ENST00000215829.3	+	4	954	c.367C>A	c.(367-369)Caa>Aaa	p.Q123K	SNRPD3_ENST00000402849.1_Intron	NM_001278656.1|NM_004175.3	NP_001265585.1|NP_004166.1	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein D3 polypeptide 18kDa	123	Arg/Lys-rich (basic).				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	enzyme binding (GO:0019899)|histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6						AAACATCTTTCAAAAGCGAAG	0.438																																					p.Q123K		Atlas-SNP	.											.	SNRPD3	12	.	0			c.C367A						.						99.0	88.0	92.0					22																	24967931		2203	4300	6503	SO:0001583	missense	6634	exon4			ATCTTTCAAAAGC	U15009	CCDS13828.1	22q11.23	2011-10-11	2002-08-29		ENSG00000100028	ENSG00000100028			11160	protein-coding gene	gene with protein product		601062	"""small nuclear ribonucleoprotein D3 polypeptide (18kD)"""			1701240, 7527560	Standard	NM_004175		Approved	SMD3, Sm-D3	uc003aam.1	P62318	OTTHUMG00000150727	ENST00000215829.3:c.367C>A	chr22.hg19:g.24967931C>A	ENSP00000215829:p.Gln123Lys	225.0	0.0		189.0	79.0	NM_004175	B4DJP7|B5BU13|P43331	Missense_Mutation	SNP	ENST00000215829.3	hg19	CCDS13828.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599794	0.46318	.	.	ENSG00000100028	ENST00000215829	.	.	.	5.99	5.99	0.97316	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.053084	0.85682	D	0.000000	T	0.46870	0.1415	N	0.14661	0.345	0.80722	D	1	P	0.34587	0.458	B	0.39152	0.292	T	0.34625	-0.9821	9	0.20519	T	0.43	.	19.437	0.94799	0.0:1.0:0.0:0.0	.	123	P62318	SMD3_HUMAN	K	123	.	ENSP00000385994:Q123K	Q	+	1	0	SNRPD3	23297931	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.780000	0.75063	2.843000	0.97960	0.655000	0.94253	CAA	.	.		0.438	SNRPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319813.1	NM_004175	
KLHDC7B	113730	hgsc.bcm.edu	37	22	50987118	50987118	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr22:50987118A>T	ENST00000395676.2	+	1	657	c.523A>T	c.(523-525)Aag>Tag	p.K175*	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	175										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCTCACGGAAAAGCAGGAGGA	0.761																																					p.K175X		Atlas-SNP	.											.	KLHDC7B	39	.	0			c.A523T						.						2.0	3.0	3.0					22																	50987118		1643	3545	5188	SO:0001587	stop_gained	113730	exon1			ACGGAAAAGCAGG	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.523A>T	chr22.hg19:g.50987118A>T	ENSP00000379034:p.Lys175*	103.0	0.0		55.0	45.0	NM_138433		Nonsense_Mutation	SNP	ENST00000395676.2	hg19	CCDS14097.2	.	.	.	.	.	.	.	.	.	.	A	17.97	3.519163	0.64634	.	.	ENSG00000130487	ENST00000395676	.	.	.	3.6	2.54	0.30619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1696	0.31247	0.7962:0.2038:0.0:0.0	.	.	.	.	X	175	.	ENSP00000379034:K175X	K	+	1	0	KLHDC7B	49333984	0.000000	0.05858	0.115000	0.21578	0.077000	0.17291	0.115000	0.15540	0.449000	0.26747	0.165000	0.16767	AAG	.	.		0.761	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317089.2	NM_138433	
ASMT	438	hgsc.bcm.edu	37	X	1742043	1742043	+	Silent	SNP	C	C	T			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chrX:1742043C>T	ENST00000381229.4	+	2	117	c.81C>T	c.(79-81)gcC>gcT	p.A27A	ASMT_ENST00000381233.3_Silent_p.A27A|ASMT_ENST00000381241.3_Silent_p.A27A			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	27					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	TTCTCTTCGCCGCCTGCGAGC	0.637																																					p.A27A		Atlas-SNP	.											.	ASMT	31	.	0			c.C81T						.						69.0	65.0	66.0					X																	1742043		2203	4296	6499	SO:0001819	synonymous_variant	438	exon2			CTTCGCCGCCTGC	M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.81C>T	chrX.hg19:g.1742043C>T		213.0	0.0		129.0	112.0	NM_001171039	B2RC33|Q16598|Q5JQ72|Q5JQ73	Silent	SNP	ENST00000381229.4	hg19																																																																																				.	.		0.637	ASMT-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055612.1	NM_004043	
AP3M2	10947	hgsc.bcm.edu	37	8	42015551	42015558	+	Frame_Shift_Del	DEL	ATTGGCTA	ATTGGCTA	-			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	ATTGGCTA	ATTGGCTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr8:42015551_42015558delATTGGCTA	ENST00000518421.1	+	4	657_664	c.366_373delATTGGCTA	c.(364-375)ccattggctaccfs	p.LAT123fs	AP3M2_ENST00000520685.1_Intron|AP3M2_ENST00000396926.3_Frame_Shift_Del_p.LAT123fs|AP3M2_ENST00000174653.3_Frame_Shift_Del_p.LAT123fs|AP3M2_ENST00000517922.1_Frame_Shift_Del_p.LAT123fs	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	123					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			ATGGTTTTCCATTGGCTACCGAGTCGAA	0.433																																					p.122_124del		Atlas-Indel,Pindel	.											.	AP3M2	41	.	0			c.365_372del						.																																			SO:0001589	frameshift_variant	10947	exon4			.	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.366_373delATTGGCTA	chr8.hg19:g.42015551_42015558delATTGGCTA	ENSP00000428787:p.Leu123fs	105.0	0.0		91.0	32.0	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Frame_Shift_Del	DEL	ENST00000518421.1	hg19	CCDS6125.1																																																																																			.	.		0.433	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
FAM114A1	92689	hgsc.bcm.edu	37	4	38933200	38933201	+	Frame_Shift_Ins	INS	-	-	A	rs370882686		TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr4:38933200_38933201insA	ENST00000358869.2	+	11	1466_1467	c.1290_1291insA	c.(1291-1293)aaafs	p.K431fs	FAM114A1_ENST00000515037.1_Frame_Shift_Ins_p.K224fs	NM_138389.2	NP_612398.2	Q8IWE2	NXP20_HUMAN	family with sequence similarity 114, member A1	431						cytoplasm (GO:0005737)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	20						CTCAAGAAGACAAAAAGGAGGA	0.371																																					p.D430fs		Atlas-Indel,Pindel	.											.	FAM114A1	42	.	0			c.1290_1291insA						.																																			SO:0001589	frameshift_variant	92689	exon11			.		CCDS3447.1	4p14	2006-09-21			ENSG00000197712	ENSG00000197712			25087	protein-coding gene	gene with protein product							Standard	NM_138389		Approved	Noxp20	uc003gtn.3	Q8IWE2	OTTHUMG00000128583	ENST00000358869.2:c.1295dupA	chr4.hg19:g.38933205_38933205dupA	ENSP00000351740:p.Lys431fs	175.0	0.0		206.0	78.0	NM_138389	A8K9W6|Q6MZV4|Q9BVL6	Frame_Shift_Ins	INS	ENST00000358869.2	hg19	CCDS3447.1																																																																																			.	.		0.371	FAM114A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250436.1	NM_138389	
SRMS	6725	hgsc.bcm.edu	37	20	62178723	62178724	+	Frame_Shift_Ins	INS	-	-	G	rs572426427		TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr20:62178723_62178724insG	ENST00000217188.1	-	1	133_134	c.93_94insC	c.(91-96)cccgggfs	p.G32fs		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	32	N-terminal.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			TCCAGGGACCCGGGGGTGCCAT	0.693																																					p.G32fs		Atlas-INDEL	.											.	SRMS	48	.	0			c.94_95insC						.																																			SO:0001589	frameshift_variant	6725	exon1			.		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.94dupC	chr20.hg19:g.62178728_62178728dupG	ENSP00000217188:p.Gly32fs	202.0	0.0		160.0	10.0	NM_080823		Frame_Shift_Ins	INS	ENST00000217188.1	hg19	CCDS13525.1																																																																																			.	.		0.693	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823	
COL16A1	1307	hgsc.bcm.edu	37	1	32162681	32162682	+	Frame_Shift_Ins	INS	-	-	G			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:32162681_32162682insG	ENST00000373672.3	-	8	1262_1263	c.746_747insC	c.(745-747)ccafs	p.P249fs	COL16A1_ENST00000373668.3_Frame_Shift_Ins_p.P249fs|COL16A1_ENST00000271069.6_Frame_Shift_Ins_p.P249fs	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	249	Nonhelical region 10 (NC10).				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TGGAGGTCTCTGGGGGGCACTG	0.594																																					p.P249fs	Colon(143;498 1786 21362 25193 36625)	Atlas-Indel,Pindel	.											.	COL16A1	137	.	0			c.747_748insC						.																																			SO:0001589	frameshift_variant	1307	exon8			.	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.747dupC	chr1.hg19:g.32162687_32162687dupG	ENSP00000362776:p.Pro249fs	88.0	0.0		76.0	25.0	NM_001856	Q16593|Q59F89|Q71RG9	Frame_Shift_Ins	INS	ENST00000373672.3	hg19	CCDS41297.1																																																																																			.	.		0.594	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
CNTN2	6900	hgsc.bcm.edu	37	1	205027137	205027137	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H0-01A-11D-A382-10	TCGA-2Y-A9H0-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	87054fed-dd7d-4c27-af8f-4a559cca7800	d7df8ad9-70a5-4728-874c-8a1cf595ed35	g.chr1:205027137delG	ENST00000331830.4	+	3	443	c.159delG	c.(157-159)acgfs	p.T53fs		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	53	Ig-like C2-type 1.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGGAGTCCACGGAGGAGCAGG	0.642																																					p.T53fs	Melanoma(183;2548 2817 37099 41192)	Atlas-Indel,Pindel	.											.	CNTN2	116	.	0			c.158delC						.						37.0	37.0	37.0					1																	205027137		2203	4300	6503	SO:0001589	frameshift_variant	6900	exon3			.	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.159delG	chr1.hg19:g.205027137delG	ENSP00000330633:p.Thr53fs	210.0	0.0		260.0	173.0	NM_005076	P78432|Q5T054	Frame_Shift_Del	DEL	ENST00000331830.4	hg19	CCDS1449.1																																																																																			.	.		0.642	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
