#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MEGF6	1953	hgsc.bcm.edu	37	1	3407516	3407516	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:3407516G>A	ENST00000356575.4	-	36	4750	c.4524C>T	c.(4522-4524)ccC>ccT	p.P1508P	MEGF6_ENST00000294599.4_Silent_p.P1196P	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	1508						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GGAGCCGGAGGGGCCCACCTG	0.632																																					p.P1508P	Ovarian(73;978 3658)	Atlas-SNP	.											.	MEGF6	91	.	0			c.C4524T						.						35.0	45.0	42.0					1																	3407516		1950	4122	6072	SO:0001819	synonymous_variant	1953	exon36			CCGGAGGGGCCCA	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.4524C>T	chr1.hg19:g.3407516G>A		61.0	0.0		52.0	20.0	NM_001409	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	hg19	CCDS41237.1	.	.	.	.	.	.	.	.	.	.	G	0.956	-0.704716	0.03255	.	.	ENSG00000162591	ENST00000491842	T	0.75260	-0.92	3.41	2.46	0.29980	.	0.420992	0.19241	U	0.119169	T	0.76176	0.3951	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.77032	-0.2738	7	0.72032	D	0.01	-0.2284	6.6805	0.23117	0.1385:0.0:0.8615:0.0	.	.	.	.	L	239	ENSP00000420386:P239L	ENSP00000420386:P239L	P	-	2	0	MEGF6	3397376	0.000000	0.05858	0.668000	0.29813	0.566000	0.35808	-0.183000	0.09712	1.759000	0.51996	0.655000	0.94253	CCC	.	.		0.632	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
MASP2	10747	hgsc.bcm.edu	37	1	11102990	11102990	+	Silent	SNP	G	G	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:11102990G>C	ENST00000400897.3	-	6	846	c.831C>G	c.(829-831)acC>acG	p.T277T		NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	277	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		CTGTGACAAAGGTGATGGTCA	0.493																																					p.T277T	GBM(35;611 746 20780 22741 36496)	Atlas-SNP	.											.	MASP2	71	.	0			c.C831G						.						226.0	194.0	205.0					1																	11102990		2203	4300	6503	SO:0001819	synonymous_variant	10747	exon6			GACAAAGGTGATG	X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.831C>G	chr1.hg19:g.11102990G>C		98.0	0.0		88.0	24.0	NM_006610	A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Silent	SNP	ENST00000400897.3	hg19	CCDS123.1																																																																																			.	.		0.493	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006072.1	NM_006610	
PADI2	11240	hgsc.bcm.edu	37	1	17395676	17395676	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:17395676G>A	ENST00000375486.4	-	16	1924	c.1861C>T	c.(1861-1863)Ctc>Ttc	p.L621F	PADI2_ENST00000466151.1_5'UTR|PADI2_ENST00000444885.2_Missense_Mutation_p.L505F	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	621					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	GGCTCCAGGAGGCCACGCACG	0.587																																					p.L621F		Atlas-SNP	.											.	PADI2	72	.	0			c.C1861T						.						112.0	100.0	104.0					1																	17395676		2203	4300	6503	SO:0001583	missense	11240	exon16			CCAGGAGGCCACG	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.1861C>T	chr1.hg19:g.17395676G>A	ENSP00000364635:p.Leu621Phe	88.0	0.0		135.0	48.0	NM_007365	Q96DA7|Q9UPN2	Missense_Mutation	SNP	ENST00000375486.4	hg19	CCDS177.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803976	0.70682	.	.	ENSG00000117115	ENST00000375486;ENST00000444885	T;T	0.35973	1.28;1.28	5.46	4.52	0.55395	Protein-arginine deiminase, C-terminal (1);	0.068640	0.64402	D	0.000014	T	0.64864	0.2637	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;0.99	D;D	0.76071	0.987;0.936	T	0.71570	-0.4553	10	0.66056	D	0.02	-21.9687	14.3329	0.66569	0.0:0.0:0.8513:0.1487	.	505;621	B4DIU3;Q9Y2J8	.;PADI2_HUMAN	F	621;505	ENSP00000364635:L621F;ENSP00000405894:L505F	ENSP00000364635:L621F	L	-	1	0	PADI2	17268263	1.000000	0.71417	0.978000	0.43139	0.653000	0.38743	4.601000	0.61090	2.582000	0.87167	0.655000	0.94253	CTC	.	.		0.587	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006624.1		
ELOVL1	64834	hgsc.bcm.edu	37	1	43830911	43830911	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:43830911G>A	ENST00000372458.3	-	3	300	c.183C>T	c.(181-183)ttC>ttT	p.F61F	ELOVL1_ENST00000413844.2_Silent_p.F61F|ELOVL1_ENST00000470769.1_5'UTR	NM_001256399.1|NM_001256402.1|NM_022821.3	NP_001243328.1|NP_001243331.1|NP_073732.1	Q9BW60	ELOV1_HUMAN	ELOVL fatty acid elongase 1	61					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|prostate(1)	4	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGACAATCATGAAGCCACGGA	0.522																																					p.F61F		Atlas-SNP	.											.	ELOVL1	18	.	0			c.C183T						.						71.0	66.0	67.0					1																	43830911		2203	4300	6503	SO:0001819	synonymous_variant	64834	exon3			AATCATGAAGCCA	AK001653	CCDS485.1, CCDS57987.1	1p34	2011-05-25	2011-05-25		ENSG00000066322	ENSG00000066322			14418	protein-coding gene	gene with protein product		611813	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1"""				Standard	NM_022821		Approved	Ssc1	uc031pmf.1	Q9BW60	OTTHUMG00000007422	ENST00000372458.3:c.183C>T	chr1.hg19:g.43830911G>A		206.0	0.0		198.0	65.0	NM_001256399	B4DP24|Q53HT2|Q5JUY3|Q8WXU3|Q9NVD9|Q9Y396	Silent	SNP	ENST00000372458.3	hg19	CCDS485.1																																																																																			.	.		0.522	ELOVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019496.1	NM_022821	
KDM4A	9682	hgsc.bcm.edu	37	1	44170005	44170005	+	Nonsense_Mutation	SNP	T	T	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:44170005T>G	ENST00000372396.3	+	22	3293	c.3159T>G	c.(3157-3159)taT>taG	p.Y1053*	KDM4A-AS1_ENST00000418149.1_RNA|KDM4A-AS1_ENST00000398804.3_RNA|KDM4A-AS1_ENST00000453015.1_RNA|KDM4A-AS1_ENST00000434346.1_RNA|KDM4A-AS1_ENST00000439057.1_RNA	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	1053					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						GGGAAGATTATATTGAGCCTG	0.483																																					p.Y1053X		Atlas-SNP	.											.	KDM4A	74	.	0			c.T3159G						.						141.0	145.0	143.0					1																	44170005		2203	4300	6503	SO:0001587	stop_gained	9682	exon22			AGATTATATTGAG	AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.3159T>G	chr1.hg19:g.44170005T>G	ENSP00000361473:p.Tyr1053*	80.0	0.0		96.0	26.0	NM_014663	Q5VVB1	Nonsense_Mutation	SNP	ENST00000372396.3	hg19	CCDS491.1	.	.	.	.	.	.	.	.	.	.	T	39	7.465155	0.98302	.	.	ENSG00000066135	ENST00000372396	.	.	.	5.8	-1.8	0.07907	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.8745	17.0927	0.86626	0.0:0.7677:0.0:0.2323	.	.	.	.	X	1053	.	ENSP00000361473:Y1053X	Y	+	3	2	KDM4A	43942592	1.000000	0.71417	0.866000	0.34008	0.992000	0.81027	1.408000	0.34668	-0.279000	0.09167	0.533000	0.62120	TAT	.	.		0.483	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019960.1	NM_014663	
C8B	732	hgsc.bcm.edu	37	1	57395082	57395082	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:57395082A>C	ENST00000371237.4	-	12	1837	c.1771T>G	c.(1771-1773)Tcc>Gcc	p.S591A	C8B_ENST00000543257.1_Missense_Mutation_p.S539A|C8B_ENST00000535057.1_Missense_Mutation_p.S529A	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	591	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						ATCTGCTAGGAGCAGTCAAGT	0.517																																					p.S591A		Atlas-SNP	.											.	C8B	107	.	0			c.T1771G						.						119.0	103.0	108.0					1																	57395082		2203	4300	6503	SO:0001583	missense	732	exon12			GCTAGGAGCAGTC	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1771T>G	chr1.hg19:g.57395082A>C	ENSP00000360281:p.Ser591Ala	31.0	0.0		76.0	22.0	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	hg19	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.579731	0.65992	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	T;T;T	0.27720	1.82;1.84;1.65	3.76	3.76	0.43208	.	1.501350	0.04137	N	0.318936	T	0.32406	0.0828	L	0.41492	1.28	0.24873	N	0.992274	B;B;B	0.15930	0.015;0.015;0.009	B;B;B	0.17098	0.017;0.011;0.005	T	0.25467	-1.0131	10	0.54805	T	0.06	24.0104	12.6727	0.56876	1.0:0.0:0.0:0.0	.	539;529;591	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	A	591;539;529	ENSP00000360281:S591A;ENSP00000442548:S539A;ENSP00000440113:S529A	ENSP00000360281:S591A	S	-	1	0	C8B	57167670	1.000000	0.71417	0.854000	0.33618	0.410000	0.31052	6.198000	0.72106	1.958000	0.56883	0.379000	0.24179	TCC	.	.		0.517	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
LRRC7	57554	hgsc.bcm.edu	37	1	70504820	70504820	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:70504820G>C	ENST00000035383.5	+	19	3229	c.3199G>C	c.(3199-3201)Gcc>Ccc	p.A1067P	LRRC7_ENST00000310961.5_Missense_Mutation_p.A1072P|LRRC7_ENST00000415775.2_Missense_Mutation_p.A351P	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1067						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.A1067T(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CAAAAACATCGCCAAGGATTT	0.463																																					p.A1067P		Atlas-SNP	.											LRRC7,colon,carcinoma,0,1	LRRC7	400	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3199C						.						66.0	71.0	69.0					1																	70504820		2203	4300	6503	SO:0001583	missense	57554	exon19			AACATCGCCAAGG		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.3199G>C	chr1.hg19:g.70504820G>C	ENSP00000035383:p.Ala1067Pro	79.0	0.0		145.0	40.0	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	ENST00000035383.5	hg19	CCDS645.1	.	.	.	.	.	.	.	.	.	.	G	0.291	-0.979888	0.02197	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.36340	1.26;1.32;2.41	5.76	1.87	0.25490	.	0.189978	0.45867	D	0.000331	T	0.06962	0.0177	N	0.16130	0.375	0.28817	N	0.897917	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.10450	0.003;0.005;0.001	T	0.32903	-0.9889	10	0.36615	T	0.2	.	6.8269	0.23889	0.2764:0.1239:0.5996:0.0	.	351;1067;1067	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	P	1072;1067;351;890	ENSP00000309245:A1072P;ENSP00000035383:A1067P;ENSP00000394867:A351P	ENSP00000035383:A1067P	A	+	1	0	LRRC7	70277408	0.760000	0.28428	0.168000	0.22838	0.001000	0.01503	1.111000	0.31159	0.103000	0.17682	-0.122000	0.15005	GCC	.	.		0.463	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
PTGFR	5737	hgsc.bcm.edu	37	1	78958702	78958702	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:78958702T>C	ENST00000370757.3	+	2	511	c.274T>C	c.(274-276)Tat>Cat	p.Y92H	PTGFR_ENST00000370758.1_Missense_Mutation_p.Y92H|PTGFR_ENST00000370756.3_Missense_Mutation_p.Y92H	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	92					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	AGTATTTGTATATGCTTCTGA	0.428																																					p.Y92H		Atlas-SNP	.											.	PTGFR	121	.	0			c.T274C						.						130.0	123.0	125.0					1																	78958702		2203	4300	6503	SO:0001583	missense	5737	exon2			TTTGTATATGCTT	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.274T>C	chr1.hg19:g.78958702T>C	ENSP00000359793:p.Tyr92His	75.0	0.0		101.0	38.0	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	hg19	CCDS686.1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.005698	0.35415	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.38401	1.14;1.14;1.14	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.059523	0.64402	D	0.000001	T	0.41994	0.1183	L	0.37630	1.12	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.25641	-1.0126	10	0.42905	T	0.14	-22.8463	16.5479	0.84454	0.0:0.0:0.0:1.0	.	92;92	P43088;P43088-2	PF2R_HUMAN;.	H	92	ENSP00000359794:Y92H;ENSP00000359793:Y92H;ENSP00000359792:Y92H	ENSP00000359792:Y92H	Y	+	1	0	PTGFR	78731290	1.000000	0.71417	0.712000	0.30502	0.013000	0.08279	5.955000	0.70306	2.371000	0.80710	0.533000	0.62120	TAT	.	.		0.428	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
COL11A1	1301	hgsc.bcm.edu	37	1	103444972	103444972	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:103444972C>A	ENST00000370096.3	-	32	2888	c.2576G>T	c.(2575-2577)gGg>gTg	p.G859V	COL11A1_ENST00000358392.2_Missense_Mutation_p.G871V|COL11A1_ENST00000512756.1_Missense_Mutation_p.G743V|COL11A1_ENST00000353414.4_Missense_Mutation_p.G820V	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	859	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACCTGGAAACCCAGGGAATCC	0.353																																					p.G871V		Atlas-SNP	.											.	COL11A1	972	.	0			c.G2612T						.						42.0	46.0	44.0					1																	103444972		2203	4300	6503	SO:0001583	missense	1301	exon32			GGAAACCCAGGGA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2576G>T	chr1.hg19:g.103444972C>A	ENSP00000359114:p.Gly859Val	109.0	0.0		220.0	62.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440828	0.83993	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.97941	-4.62;-4.62;-4.62;-4.62	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.99152	0.9707	M	0.94142	3.5	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;0.998;0.998	D	0.99360	1.0917	10	0.87932	D	0	.	18.5374	0.91015	0.0:1.0:0.0:0.0	.	743;820;871;859;79	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	V	859;871;820;79;743	ENSP00000359114:G859V;ENSP00000351163:G871V;ENSP00000302551:G820V;ENSP00000426533:G743V	ENSP00000302551:G820V	G	-	2	0	COL11A1	103217560	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.425000	0.66470	2.612000	0.88384	0.655000	0.94253	GGG	.	.		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
GABPB2	126626	hgsc.bcm.edu	37	1	151070417	151070417	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:151070417G>A	ENST00000368918.3	+	5	892	c.561G>A	c.(559-561)acG>acA	p.T187T	GABPB2_ENST00000467551.1_3'UTR|GABPB2_ENST00000368916.1_Silent_p.T187T|GABPB2_ENST00000368917.1_Silent_p.T187T	NM_144618.2	NP_653219.1	Q8TAK5	GABP2_HUMAN	GA binding protein transcription factor, beta subunit 2	187					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(3)|liver(2)|lung(7)	15				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		TCATCTTCACGTCGGGTGAGG	0.418																																					p.T187T		Atlas-SNP	.											.	GABPB2	41	.	0			c.G561A						.						136.0	116.0	123.0					1																	151070417		2203	4300	6503	SO:0001819	synonymous_variant	126626	exon5			CTTCACGTCGGGT		CCDS983.1	1q21.2	2013-01-10			ENSG00000143458	ENSG00000143458		"""Ankyrin repeat domain containing"""	28441	protein-coding gene	gene with protein product						7958862	Standard	NM_144618		Approved	MGC29891	uc001ewr.2	Q8TAK5	OTTHUMG00000012193	ENST00000368918.3:c.561G>A	chr1.hg19:g.151070417G>A		155.0	0.0		194.0	48.0	NM_144618	B1AVJ8|D3DV14|Q8NAR5	Silent	SNP	ENST00000368918.3	hg19	CCDS983.1																																																																																			.	.		0.418	GABPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033700.2	NM_144618	
FLG2	388698	hgsc.bcm.edu	37	1	152326933	152326933	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:152326933C>T	ENST00000388718.5	-	3	3401	c.3329G>A	c.(3328-3330)gGt>gAt	p.G1110D	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1110	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGAGGACTGACCTGAGCCTGG	0.517																																					p.G1110D		Atlas-SNP	.											.	FLG2	431	.	0			c.G3329A						.						253.0	258.0	257.0					1																	152326933		2203	4300	6503	SO:0001583	missense	388698	exon3			GACTGACCTGAGC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3329G>A	chr1.hg19:g.152326933C>T	ENSP00000373370:p.Gly1110Asp	55.0	0.0		197.0	44.0	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	hg19	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167463	0.57476	.	.	ENSG00000143520	ENST00000388718	T	0.03745	3.82	4.78	4.78	0.61160	.	.	.	.	.	T	0.04907	0.0132	L	0.50333	1.59	0.20821	N	0.999844	D	0.60160	0.987	P	0.57548	0.823	T	0.34825	-0.9813	9	0.38643	T	0.18	-0.1739	13.3657	0.60682	0.0:1.0:0.0:0.0	.	1110	Q5D862	FILA2_HUMAN	D	1110	ENSP00000373370:G1110D	ENSP00000373370:G1110D	G	-	2	0	FLG2	150593557	0.000000	0.05858	0.006000	0.13384	0.190000	0.23558	0.546000	0.23284	2.210000	0.71456	0.558000	0.71614	GGT	.	.		0.517	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
KCNN3	3782	hgsc.bcm.edu	37	1	154842253	154842253	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:154842253G>T	ENST00000271915.4	-	1	503	c.188C>A	c.(187-189)cCt>cAt	p.P63H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	63	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	aagctgcggaggctgaggctg	0.697																																					p.P63H		Atlas-SNP	.											.	KCNN3	141	.	0			c.C188A						.						6.0	4.0	5.0					1																	154842253		1984	3925	5909	SO:0001583	missense	3782	exon1			TGCGGAGGCTGAG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.188C>A	chr1.hg19:g.154842253G>T	ENSP00000271915:p.Pro63His	70.0	0.0		109.0	15.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	g	11.14	1.552427	0.27739	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.56275	0.47	5.07	3.18	0.36537	.	1.727610	0.03258	N	0.182822	T	0.18551	0.0445	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.11372	-1.0590	8	0.33141	T	0.24	-4.1487	6.4327	0.21807	0.0918:0.0:0.7284:0.1798	.	.	.	.	H	63;158	ENSP00000271915:P63H	ENSP00000271915:P63H	P	-	2	0	KCNN3	153108877	0.863000	0.29885	1.000000	0.80357	0.998000	0.95712	1.873000	0.39558	0.823000	0.34589	0.563000	0.77884	CCT	.	.		0.697	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
CD1B	910	hgsc.bcm.edu	37	1	158300831	158300831	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:158300831A>T	ENST00000368168.3	-	2	190	c.83T>A	c.(82-84)tTt>tAt	p.F28Y		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	28					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					GATAACATGAAAGGAGGTCGG	0.473																																					p.F28Y		Atlas-SNP	.											.	CD1B	78	.	0			c.T83A						.						202.0	197.0	198.0					1																	158300831		2203	4300	6503	SO:0001583	missense	910	exon2			ACATGAAAGGAGG	M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.83T>A	chr1.hg19:g.158300831A>T	ENSP00000357150:p.Phe28Tyr	157.0	0.0		320.0	88.0	NM_001764	Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	hg19	CCDS1176.1	.	.	.	.	.	.	.	.	.	.	A	11.33	1.605532	0.28623	.	.	ENSG00000158485	ENST00000368168	T	0.07688	3.17	4.15	-3.82	0.04281	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.741874	0.11633	N	0.544566	T	0.05731	0.0150	L	0.37897	1.145	0.09310	N	1	D;B	0.60575	0.988;0.389	P;B	0.61592	0.891;0.2	T	0.10660	-1.0620	10	0.49607	T	0.09	-2.9917	10.0175	0.42022	0.3325:0.0:0.0:0.6675	.	28;28	B4E0D2;P29016	.;CD1B_HUMAN	Y	28	ENSP00000357150:F28Y	ENSP00000357150:F28Y	F	-	2	0	CD1B	156567455	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.897000	0.04110	-0.846000	0.04174	-0.336000	0.08194	TTT	.	.		0.473	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764	
MROH9	80133	hgsc.bcm.edu	37	1	171033398	171033399	+	Missense_Mutation	DNP	CC	CC	AA	rs546065073		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:171033398_171033399CC>AA	ENST00000367759.4	+	22	2657_2658	c.2503_2504CC>AA	c.(2503-2505)CCt>AAt	p.P835N		NM_001163629.1	NP_001157101.1	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	439																	AAAATTGAAGCCTCTTTACAAT	0.332																																					p.P835T|p.P835H		Atlas-SNP	.											.	.	.	.	0			c.C2503A|c.C2504A						.																																			SO:0001583	missense	80133	exon22			TTGAAGCCTCTTT|TGAAGCCTCTTTA	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	Exception_encountered	chr1.hg19:g.171033398_171033399delinsAA	ENSP00000356733:p.Pro835Asn	250.0|249.0	0.0		491.0|488.0	246.0|243.0	NM_001163629	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367759.4	hg19	CCDS53429.1																																																																																			.	.		0.332	MROH9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_025063	
TNR	7143	hgsc.bcm.edu	37	1	175360435	175360435	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr1:175360435C>T	ENST00000367674.2	-	7	2204	c.1496G>A	c.(1495-1497)aGc>aAc	p.S499N	TNR_ENST00000263525.2_Missense_Mutation_p.S499N			Q92752	TENR_HUMAN	tenascin R	499	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TGTGGAGACGCTGGCCGAGGT	0.542																																					p.S499N		Atlas-SNP	.											.	TNR	399	.	0			c.G1496A						.						66.0	69.0	68.0					1																	175360435		2203	4300	6503	SO:0001583	missense	7143	exon7			GAGACGCTGGCCG	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1496G>A	chr1.hg19:g.175360435C>T	ENSP00000356646:p.Ser499Asn	54.0	0.0		106.0	33.0	NM_003285	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	hg19	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018938	0.54576	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.55413	0.52;0.52	5.23	5.23	0.72850	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.050437	0.85682	D	0.000000	T	0.47948	0.1473	L	0.29908	0.895	0.49299	D	0.999774	D	0.54964	0.969	P	0.48654	0.585	T	0.32929	-0.9888	10	0.11794	T	0.64	.	18.3986	0.90507	0.0:1.0:0.0:0.0	.	499	Q92752	TENR_HUMAN	N	499	ENSP00000356646:S499N;ENSP00000263525:S499N	ENSP00000263525:S499N	S	-	2	0	TNR	173627058	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	6.050000	0.71063	2.429000	0.82318	0.655000	0.94253	AGC	.	.		0.542	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
HADHB	3032	hgsc.bcm.edu	37	2	26477337	26477337	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:26477337C>G	ENST00000317799.5	+	3	208	c.104C>G	c.(103-105)gCc>gGc	p.A35G	HADHB_ENST00000405867.3_Missense_Mutation_p.A35G|HADHB_ENST00000545822.1_5'UTR|HADHB_ENST00000537713.1_Missense_Mutation_p.A35G	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	35					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTACGAGCTGCCCCAGGTACA	0.353																																					p.A35G		Atlas-SNP	.											.	HADHB	50	.	0			c.C104G						.						50.0	47.0	48.0					2																	26477337		2203	4300	6503	SO:0001583	missense	3032	exon3			GAGCTGCCCCAGG		CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.104C>G	chr2.hg19:g.26477337C>G	ENSP00000325136:p.Ala35Gly	132.0	0.0		199.0	72.0	NM_000183	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	ENST00000317799.5	hg19	CCDS1722.1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913903	0.33815	.	.	ENSG00000138029	ENST00000448743;ENST00000317799;ENST00000405867;ENST00000537713;ENST00000425035;ENST00000412805	D;D;D;D;D;D	0.97455	-3.89;-3.23;-3.34;-3.27;-4.39;-2.23	5.2	3.36	0.38483	.	0.609412	0.15497	N	0.259203	D	0.90734	0.7092	N	0.08118	0	0.58432	D	0.999998	B;B;B	0.26547	0.0;0.152;0.0	B;B;B	0.18263	0.0;0.021;0.0	D	0.86053	0.1527	10	0.59425	D	0.04	1.0E-4	8.9495	0.35781	0.0:0.7663:0.1499:0.0838	.	35;35;35	F5GZQ3;B5MD38;P55084	.;.;ECHB_HUMAN	G	35	ENSP00000415300:A35G;ENSP00000325136:A35G;ENSP00000385411:A35G;ENSP00000444295:A35G;ENSP00000404633:A35G;ENSP00000413103:A35G	ENSP00000325136:A35G	A	+	2	0	HADHB	26330841	0.533000	0.26354	0.952000	0.39060	0.974000	0.67602	1.580000	0.36547	0.669000	0.31146	0.650000	0.86243	GCC	.	.		0.353	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
LTBP1	4052	hgsc.bcm.edu	37	2	33359882	33359882	+	Silent	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:33359882C>A	ENST00000404816.2	+	5	1409	c.1056C>A	c.(1054-1056)atC>atA	p.I352I	LTBP1_ENST00000407925.1_Silent_p.I26I|LTBP1_ENST00000404525.1_Silent_p.I26I|LTBP1_ENST00000354476.3_Silent_p.I352I|LTBP1_ENST00000390003.4_Silent_p.I26I|LTBP1_ENST00000418533.2_Silent_p.I26I|LTBP1_ENST00000402934.1_Silent_p.I26I			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	352					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CTGGCCGCATCAAGGTGGTCT	0.488																																					p.I352I		Atlas-SNP	.											.	LTBP1	317	.	0			c.C1056A						.						107.0	93.0	98.0					2																	33359882		2203	4300	6503	SO:0001819	synonymous_variant	4052	exon5			CCGCATCAAGGTG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1056C>A	chr2.hg19:g.33359882C>A		136.0	0.0		246.0	70.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	hg19	CCDS33177.2																																																																																			.	.		0.488	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
SPTBN1	6711	hgsc.bcm.edu	37	2	54858513	54858513	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:54858513A>T	ENST00000356805.4	+	16	3610	c.3329A>T	c.(3328-3330)gAg>gTg	p.E1110V	SPTBN1_ENST00000333896.5_Missense_Mutation_p.E1097V	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1110					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			ATCAAGAACGAGATCGACAAC	0.587																																					p.E1110V		Atlas-SNP	.											.	SPTBN1	378	.	0			c.A3329T						.						176.0	144.0	154.0					2																	54858513		2203	4300	6503	SO:0001583	missense	6711	exon16			AGAACGAGATCGA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3329A>T	chr2.hg19:g.54858513A>T	ENSP00000349259:p.Glu1110Val	162.0	0.0		189.0	77.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.586216	0.86851	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.50277	0.75;0.75	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.71609	0.3360	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.87578	0.982;0.998	T	0.76729	-0.2852	10	0.87932	D	0	.	15.727	0.77770	1.0:0.0:0.0:0.0	.	1097;1110	Q01082-3;Q01082	.;SPTB2_HUMAN	V	1110;1097	ENSP00000349259:E1110V;ENSP00000334156:E1097V	ENSP00000334156:E1097V	E	+	2	0	SPTBN1	54712017	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.281000	0.95811	2.118000	0.64928	0.533000	0.62120	GAG	.	.		0.587	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
LCT	3938	hgsc.bcm.edu	37	2	136555611	136555611	+	Missense_Mutation	SNP	A	A	G	rs5834448		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:136555611A>G	ENST00000264162.2	-	13	4974	c.4964T>C	c.(4963-4965)cTc>cCc	p.L1655P		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1655	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	AGACTTGTTGAGGCCTGCAGC	0.552											OREG0014998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1655P		Atlas-SNP	.											.	LCT	309	.	0			c.T4964C						.						98.0	90.0	93.0					2																	136555611		2203	4300	6503	SO:0001583	missense	3938	exon13			TTGTTGAGGCCTG	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4964T>C	chr2.hg19:g.136555611A>G	ENSP00000264162:p.Leu1655Pro	38.0	0.0	1626	42.0	14.0	NM_002299	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	hg19	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.084469	0.76642	.	.	ENSG00000115850	ENST00000264162	T	0.33438	1.41	5.76	5.76	0.90799	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.064020	0.64402	D	0.000005	T	0.61751	0.2372	M	0.87180	2.865	0.80722	D	1	P	0.45569	0.861	D	0.64687	0.928	T	0.67530	-0.5647	10	0.87932	D	0	-22.6791	16.0843	0.81031	1.0:0.0:0.0:0.0	.	1655	P09848	LPH_HUMAN	P	1655	ENSP00000264162:L1655P	ENSP00000264162:L1655P	L	-	2	0	LCT	136272081	1.000000	0.71417	0.991000	0.47740	0.953000	0.61014	5.828000	0.69307	2.191000	0.70037	0.533000	0.62120	CTC	.	.		0.552	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
FMNL2	114793	hgsc.bcm.edu	37	2	153399308	153399308	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:153399308A>G	ENST00000288670.9	+	3	624	c.257A>G	c.(256-258)tAt>tGt	p.Y86C		NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	86	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CTCAAAGGCTATCTGGATCCA	0.433																																					p.Y86C		Atlas-SNP	.											.	FMNL2	75	.	0			c.A257G						.						152.0	142.0	145.0					2																	153399308		1921	4098	6019	SO:0001583	missense	114793	exon3			AAGGCTATCTGGA	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.257A>G	chr2.hg19:g.153399308A>G	ENSP00000288670:p.Tyr86Cys	69.0	0.0		124.0	38.0	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	hg19	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	A	18.43	3.621326	0.66787	.	.	ENSG00000157827	ENST00000288670	D	0.89123	-2.47	6.02	6.02	0.97574	.	0.054202	0.85682	D	0.000000	D	0.93148	0.7818	M	0.82056	2.57	0.80722	D	1	D	0.63046	0.992	P	0.55999	0.789	D	0.93836	0.7132	10	0.72032	D	0.01	.	15.5272	0.75919	1.0:0.0:0.0:0.0	.	86	Q96PY5-3	.	C	86	ENSP00000288670:Y86C	ENSP00000288670:Y86C	Y	+	2	0	FMNL2	153107554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.501000	0.60393	2.311000	0.77944	0.533000	0.62120	TAT	.	.		0.433	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
CYTIP	9595	hgsc.bcm.edu	37	2	158272637	158272637	+	Missense_Mutation	SNP	G	G	C	rs374851359		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:158272637G>C	ENST00000264192.3	-	8	753	c.632C>G	c.(631-633)cCc>cGc	p.P211R	CYTIP_ENST00000540637.1_Missense_Mutation_p.P105R	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	211					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						TTCCAAACTGGGGCAATTAGC	0.453																																					p.P211R		Atlas-SNP	.											CYTIP,NS,carcinoma,0,1	CYTIP	45	.	0			c.C632G						.						48.0	41.0	43.0					2																	158272637		2203	4300	6503	SO:0001583	missense	9595	exon8			AAACTGGGGCAAT	L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.632C>G	chr2.hg19:g.158272637G>C	ENSP00000264192:p.Pro211Arg	52.0	0.0		86.0	33.0	NM_004288	B4DWH9|Q15630|Q8NE32	Missense_Mutation	SNP	ENST00000264192.3	hg19	CCDS2204.1	.	.	.	.	.	.	.	.	.	.	G	5.350	0.249932	0.10130	.	.	ENSG00000115165	ENST00000264192;ENST00000540637;ENST00000418920	T;T;T	0.54071	1.94;0.59;1.45	5.71	1.97	0.26223	.	0.520860	0.20892	N	0.083815	T	0.49474	0.1559	M	0.66939	2.045	0.09310	N	1	B	0.24092	0.097	B	0.29598	0.104	T	0.48692	-0.9013	10	0.62326	D	0.03	-0.7162	8.5093	0.33206	0.3091:0.0:0.6909:0.0	.	211	O60759	CYTIP_HUMAN	R	211;105;105	ENSP00000264192:P211R;ENSP00000440801:P105R;ENSP00000394308:P105R	ENSP00000264192:P211R	P	-	2	0	CYTIP	157980883	0.003000	0.15002	0.009000	0.14445	0.005000	0.04900	1.013000	0.29937	0.091000	0.17302	-0.150000	0.13652	CCC	.	.		0.453	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254926.1	NM_004288	
STAT1	6772	hgsc.bcm.edu	37	2	191854348	191854348	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:191854348A>G	ENST00000361099.3	-	12	1477	c.1090T>C	c.(1090-1092)Ttt>Ctt	p.F364L	STAT1_ENST00000392323.2_Missense_Mutation_p.F366L|STAT1_ENST00000409465.1_Missense_Mutation_p.F364L|STAT1_ENST00000392322.3_Missense_Mutation_p.F364L|STAT1_ENST00000540176.1_3'UTR	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	364					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			TACTTATCAAATAAGACTTTG	0.269																																					p.F364L		Atlas-SNP	.											.	STAT1	93	.	0			c.T1090C						.																																			SO:0001583	missense	6772	exon12			TATCAAATAAGAC		CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1090T>C	chr2.hg19:g.191854348A>G	ENSP00000354394:p.Phe364Leu	398.0	0.0		512.0	184.0	NM_007315	A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	ENST00000361099.3	hg19	CCDS2309.1	.	.	.	.	.	.	.	.	.	.	A	16.07	3.017266	0.54576	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000392322;ENST00000392323	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.56	5.56	0.83823	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.147057	0.64402	D	0.000006	T	0.69842	0.3156	M	0.61703	1.905	0.80722	D	1	B;B	0.19073	0.033;0.009	B;B	0.21151	0.027;0.033	T	0.65323	-0.6196	10	0.29301	T	0.29	-24.8303	10.8909	0.46994	0.8597:0.0:0.0:0.1403	.	364;364	P42224-2;P42224	.;STAT1_HUMAN	L	364;364;364;366	ENSP00000354394:F364L;ENSP00000386244:F364L;ENSP00000376136:F364L;ENSP00000376137:F366L	ENSP00000354394:F364L	F	-	1	0	STAT1	191562593	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	3.798000	0.55522	2.120000	0.65058	0.454000	0.30748	TTT	.	.		0.269	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255997.3	NM_007315	
AAMP	14	hgsc.bcm.edu	37	2	219134201	219134201	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:219134201C>T	ENST00000248450.4	-	2	348	c.178G>A	c.(178-180)Ggc>Agc	p.G60S	AAMP_ENST00000444053.1_Missense_Mutation_p.G61S|PNKD_ENST00000273077.4_5'Flank|PNKD_ENST00000248451.3_5'Flank|AAMP_ENST00000420660.1_Missense_Mutation_p.G41S			Q13685	AAMP_HUMAN	angio-associated, migratory cell protein	60					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|positive regulation of endothelial cell migration (GO:0010595)|smooth muscle cell migration (GO:0014909)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(4)|ovary(2)|skin(1)	11		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCTTCGTTGCCCTCTTCCTCC	0.587																																					p.G60S		Atlas-SNP	.											.	AAMP	29	.	0			c.G178A						.						111.0	105.0	107.0					2																	219134201		2203	4300	6503	SO:0001583	missense	14	exon2			CGTTGCCCTCTTC	AB209790	CCDS33378.1	2q	2013-01-10			ENSG00000127837	ENSG00000127837		"""WD repeat domain containing"""	18	protein-coding gene	gene with protein product		603488				7743515	Standard	XM_005246325		Approved		uc002vhk.3	Q13685	OTTHUMG00000155202	ENST00000248450.4:c.178G>A	chr2.hg19:g.219134201C>T	ENSP00000248450:p.Gly60Ser	106.0	0.0		121.0	41.0	NM_001087	Q8WUJ9|Q96H92	Missense_Mutation	SNP	ENST00000248450.4	hg19	CCDS33378.1	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473029	0.63737	.	.	ENSG00000127837	ENST00000248450;ENST00000444053;ENST00000420660;ENST00000447885	T;T;T;T	0.53640	0.62;0.63;0.61;0.87	4.56	4.56	0.56223	.	0.513245	0.20459	N	0.091937	T	0.37571	0.1008	L	0.34521	1.04	0.38698	D	0.952919	B;B;B	0.28378	0.127;0.127;0.209	B;B;B	0.29077	0.039;0.039;0.098	T	0.31586	-0.9938	10	0.33940	T	0.23	-8.7876	13.0252	0.58810	0.0:0.8242:0.1758:0.0	.	61;60;41	C9JEH3;Q13685;C9JG97	.;AAMP_HUMAN;.	S	60;61;41;14	ENSP00000248450:G60S;ENSP00000403343:G61S;ENSP00000416394:G41S;ENSP00000393818:G14S	ENSP00000248450:G60S	G	-	1	0	AAMP	218842445	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.430000	0.52807	2.378000	0.81104	0.655000	0.94253	GGC	.	.		0.587	AAMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338756.1	NM_001087	
ASIC4	55515	hgsc.bcm.edu	37	2	220396813	220396813	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:220396813C>T	ENST00000347842.3	+	3	1213	c.1199C>T	c.(1198-1200)cCa>cTa	p.P400L	ASIC4_ENST00000358078.4_Missense_Mutation_p.P400L|ASIC4_ENST00000473709.1_3'UTR	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	400					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										GGGGTGTCCCCAGGCTTCCAG	0.622																																					p.P400L		Atlas-SNP	.											.	.	.	.	0			c.C1199T						.						65.0	70.0	69.0					2																	220396813		2203	4300	6503	SO:0001583	missense	55515	exon3			TGTCCCCAGGCTT	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1199C>T	chr2.hg19:g.220396813C>T	ENSP00000326627:p.Pro400Leu	114.0	0.0		97.0	37.0	NM_182847	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	ENST00000347842.3	hg19	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685527	0.88639	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.66280	-0.2;-0.2	3.8	3.8	0.43715	.	0.131097	0.51477	D	0.000098	D	0.82449	0.5039	M	0.92317	3.295	0.80722	D	1	D;D;D	0.76494	0.994;0.987;0.999	P;D;D	0.67382	0.863;0.94;0.951	D	0.87759	0.2597	10	0.72032	D	0.01	-2.9921	15.8578	0.78994	0.0:1.0:0.0:0.0	.	400;400;400	Q96FT7;Q96FT7-4;Q96FT7-2	ACCN4_HUMAN;.;.	L	400	ENSP00000326627:P400L;ENSP00000350786:P400L	ENSP00000326627:P400L	P	+	2	0	ACCN4	220105057	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	5.884000	0.69729	2.152000	0.67230	0.561000	0.74099	CCA	.	.		0.622	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
RTP5	285093	hgsc.bcm.edu	37	2	242814897	242814897	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr2:242814897T>A	ENST00000343216.3	+	2	1218	c.1190T>A	c.(1189-1191)cTc>cAc	p.L397H		NM_173821.2	NP_776182.2																					GGCCAGGGCCTCGTCCCAGTG	0.617																																					p.L397H		Atlas-SNP	.											.	.	.	.	0			c.T1190A						.						27.0	32.0	31.0					2																	242814897		2008	4159	6167	SO:0001583	missense	285093	exon2			AGGGCCTCGTCCC																												ENST00000343216.3:c.1190T>A	chr2.hg19:g.242814897T>A	ENSP00000345374:p.Leu397His	96.0	0.0		53.0	15.0	NM_173821		Missense_Mutation	SNP	ENST00000343216.3	hg19	CCDS42843.1	.	.	.	.	.	.	.	.	.	.	.	10.02	1.234841	0.22626	.	.	ENSG00000188011	ENST00000343216	T	0.25579	1.79	2.41	-3.58	0.04597	.	.	.	.	.	T	0.10895	0.0266	N	0.08118	0	0.09310	N	1	D	0.56521	0.976	B	0.43728	0.429	T	0.12477	-1.0546	9	0.62326	D	0.03	-8.4013	2.7914	0.05389	0.1632:0.2019:0.4878:0.1471	.	397	Q14D33	CB085_HUMAN	H	397	ENSP00000345374:L397H	ENSP00000345374:L397H	L	+	2	0	C2orf85	242463570	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.575000	0.02131	-0.847000	0.04168	0.374000	0.22700	CTC	.	.		0.617	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	55.0	0.0		150.0	54.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CDCP1	64866	hgsc.bcm.edu	37	3	45132884	45132884	+	Nonsense_Mutation	SNP	T	T	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr3:45132884T>A	ENST00000296129.1	-	7	1908	c.1774A>T	c.(1774-1776)Aag>Tag	p.K592*		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	592						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		CTCCGCTCCTTAAAGAAAGTC	0.632																																					p.K592X		Atlas-SNP	.											.	CDCP1	61	.	0			c.A1774T						.						34.0	33.0	33.0					3																	45132884		2203	4300	6503	SO:0001587	stop_gained	64866	exon7			GCTCCTTAAAGAA	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.1774A>T	chr3.hg19:g.45132884T>A	ENSP00000296129:p.Lys592*	87.0	0.0		75.0	19.0	NM_022842	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Nonsense_Mutation	SNP	ENST00000296129.1	hg19	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	T	32	5.167200	0.94768	.	.	ENSG00000163814	ENST00000296129	.	.	.	5.84	3.35	0.38373	.	0.292843	0.36444	N	0.002594	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4321	0.32764	0.0:0.0651:0.246:0.6889	.	.	.	.	X	592	.	ENSP00000296129:K592X	K	-	1	0	CDCP1	45107888	0.990000	0.36364	0.045000	0.18777	0.189000	0.23516	2.959000	0.49153	0.420000	0.25954	0.454000	0.30748	AAG	.	.		0.632	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
ARIH2	10425	hgsc.bcm.edu	37	3	49006081	49006081	+	Missense_Mutation	SNP	A	A	G	rs144088007		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr3:49006081A>G	ENST00000356401.4	+	7	992	c.653A>G	c.(652-654)tAt>tGt	p.Y218C	ARIH2_ENST00000490095.1_3'UTR|ARIH2_ENST00000449376.1_Missense_Mutation_p.Y218C	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	218					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TTCAGGGACTATGTGGAGGTA	0.507																																					p.Y218C		Atlas-SNP	.											.	ARIH2	32	.	0			c.A653G						.	A	CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	148.0	144.0	146.0		653	5.9	1.0	3	dbSNP_134	146	0,8600		0,0,4300	no	missense	ARIH2	NM_006321.2	194	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	benign	218/494	49006081	1,13005	2203	4300	6503	SO:0001583	missense	10425	exon7			GGGACTATGTGGA	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.653A>G	chr3.hg19:g.49006081A>G	ENSP00000348769:p.Tyr218Cys	54.0	0.0		41.0	16.0	NM_006321	Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	ENST00000356401.4	hg19	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	A	19.12	3.766000	0.69878	2.27E-4	0.0	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	D;D	0.81579	-1.51;-1.51	5.95	5.95	0.96441	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	D	0.90403	0.6996	M	0.83774	2.66	0.80722	D	1	D;D;B	0.76494	0.999;0.999;0.212	D;D;B	0.85130	0.971;0.997;0.236	D	0.91349	0.5103	10	0.62326	D	0.03	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	225;218;218	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	C	218;218;217;42	ENSP00000348769:Y218C;ENSP00000403222:Y218C	ENSP00000348769:Y218C	Y	+	2	0	ARIH2	48981085	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	8.932000	0.92897	2.279000	0.76181	0.533000	0.62120	TAT	.	A|1.000;G|0.000		0.507	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257525.1	NM_006321	
FLNB	2317	hgsc.bcm.edu	37	3	58067391	58067391	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr3:58067391G>A	ENST00000295956.4	+	4	840	c.675G>A	c.(673-675)gtG>gtA	p.V225V	FLNB_ENST00000358537.3_Silent_p.V225V|FLNB_ENST00000493452.1_Silent_p.V56V|FLNB_ENST00000490882.1_Silent_p.V225V|FLNB_ENST00000429972.2_Silent_p.V225V|FLNB_ENST00000419752.2_Silent_p.V56V|FLNB_ENST00000348383.5_Silent_p.V225V|FLNB_ENST00000357272.4_Silent_p.V225V	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	225	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		ACCCGGATGTGGACGAGCACT	0.498																																					p.V225V		Atlas-SNP	.											.	FLNB	430	.	0			c.G675A						.						148.0	138.0	141.0					3																	58067391		2203	4300	6503	SO:0001819	synonymous_variant	2317	exon4			GGATGTGGACGAG	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.675G>A	chr3.hg19:g.58067391G>A		71.0	0.0		124.0	52.0	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	ENST00000295956.4	hg19	CCDS2885.1																																																																																			.	.		0.498	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
DCUN1D1	54165	hgsc.bcm.edu	37	3	182665421	182665421	+	Splice_Site	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr3:182665421C>A	ENST00000292782.4	-	5	674		c.e5-1		DCUN1D1_ENST00000469954.1_Splice_Site	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1							ubiquitin ligase complex (GO:0000151)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			ATTTCTAGATCTGAAATAGTA	0.279																																					.		Atlas-SNP	.											.	DCUN1D1	27	.	0			c.521-1G>T						.						42.0	44.0	43.0					3																	182665421		2194	4270	6464	SO:0001630	splice_region_variant	54165	exon6			CTAGATCTGAAAT	AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.521-1G>T	chr3.hg19:g.182665421C>A		374.0	0.0		542.0	156.0	NM_020640	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Splice_Site	SNP	ENST00000292782.4	hg19	CCDS3240.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153449	0.78114	.	.	ENSG00000043093	ENST00000292782;ENST00000458486;ENST00000469954	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0578	0.93072	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCUN1D1	184148115	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.391000	0.79828	2.482000	0.83794	0.551000	0.68910	.	.	.		0.279	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350658.1	NM_020640	Intron
ATP8A1	10396	hgsc.bcm.edu	37	4	42457611	42457611	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:42457611C>A	ENST00000381668.5	-	28	2856	c.2625G>T	c.(2623-2625)tgG>tgT	p.W875C	ATP8A1_ENST00000264449.10_Missense_Mutation_p.W860C	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	875					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	CAAAGGCAAACCAGATCTAGG	0.358																																					p.W875C		Atlas-SNP	.											.	ATP8A1	206	.	0			c.G2625T						.						72.0	72.0	72.0					4																	42457611		2203	4300	6503	SO:0001583	missense	10396	exon28			GGCAAACCAGATC	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2625G>T	chr4.hg19:g.42457611C>A	ENSP00000371084:p.Trp875Cys	174.0	0.0		245.0	79.0	NM_006095	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	hg19	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120166	0.77323	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.74209	-0.82;-0.82	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000001	D	0.91385	0.7282	H	0.97103	3.94	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.999	D;D;D	0.76071	0.945;0.987;0.987	D	0.93860	0.7153	10	0.87932	D	0	.	19.5488	0.95310	0.0:1.0:0.0:0.0	.	860;875;867	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	C	875;860	ENSP00000371084:W875C;ENSP00000264449:W860C	ENSP00000264449:W860C	W	-	3	0	ATP8A1	42152368	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.839000	0.62810	2.680000	0.91292	0.650000	0.86243	TGG	.	.		0.358	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
OCIAD1	54940	hgsc.bcm.edu	37	4	48834685	48834685	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:48834685C>T	ENST00000381473.3	+	2	462	c.44C>T	c.(43-45)cCa>cTa	p.P15L	OCIAD1_ENST00000396448.2_Missense_Mutation_p.P15L|OCIAD1_ENST00000509122.1_Missense_Mutation_p.P15L|OCIAD1_ENST00000513391.2_Missense_Mutation_p.P15L|OCIAD1_ENST00000506801.1_Intron|OCIAD1_ENST00000508293.1_Missense_Mutation_p.P15L|OCIAD1_ENST00000264312.7_Missense_Mutation_p.P15L|OCIAD1_ENST00000512981.1_Intron|OCIAD1_ENST00000444354.2_Missense_Mutation_p.P15L|OCIAD1_ENST00000425583.2_Missense_Mutation_p.P15L	NM_001079839.2	NP_001073308.1	Q9NX40	OCAD1_HUMAN	OCIA domain containing 1	15	OCIA.					endosome (GO:0005768)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(2)|large_intestine(2)|lung(2)|prostate(1)|skin(2)	9						GCAGAGGTTCCAAGACCAATT	0.383																																					p.P20L		Atlas-SNP	.											.	OCIAD1	27	.	0			c.C59T						.						142.0	160.0	154.0					4																	48834685		2203	4300	6503	SO:0001583	missense	54940	exon2			AGGTTCCAAGACC	AF324350	CCDS3484.1, CCDS43228.1, CCDS47052.1	4p11	2010-03-19			ENSG00000109180	ENSG00000109180			16074	protein-coding gene	gene with protein product						11162530, 18328549	Standard	NM_017830		Approved	FLJ20455, TPA018, OCIA, Asrij	uc010igk.3	Q9NX40	OTTHUMG00000102095	ENST00000381473.3:c.44C>T	chr4.hg19:g.48834685C>T	ENSP00000370882:p.Pro15Leu	79.0	0.0		77.0	23.0	NM_001168254	C9K030|G8JLN7|Q9BZE8	Missense_Mutation	SNP	ENST00000381473.3	hg19	CCDS3484.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.541031	0.45280	.	.	ENSG00000109180	ENST00000504654;ENST00000509122;ENST00000509664;ENST00000505922;ENST00000514981;ENST00000511662;ENST00000508996;ENST00000507210;ENST00000264312;ENST00000396448;ENST00000512236;ENST00000509164;ENST00000511102;ENST00000381473;ENST00000444354;ENST00000509963;ENST00000425583;ENST00000508293;ENST00000513391	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46819	0.92;0.95;0.92;0.95;0.95;0.86;0.88;0.93;0.95;0.93;0.86;0.89;0.95;0.89;0.86;0.86	4.13	3.26	0.37387	.	0.832273	0.10462	N	0.671809	T	0.27489	0.0675	N	0.08118	0	0.41011	D	0.985006	B;B;B;B	0.28713	0.22;0.082;0.082;0.213	B;B;B;B	0.25506	0.036;0.023;0.023;0.061	T	0.05484	-1.0882	10	0.36615	T	0.2	-0.9676	9.8208	0.40880	0.0:0.7903:0.2097:0.0	.	15;15;15;15	D6RBN5;Q9NX40-3;Q9NX40-2;Q9NX40	.;.;.;OCAD1_HUMAN	L	15	ENSP00000423381:P15L;ENSP00000422171:P15L;ENSP00000423845:P15L;ENSP00000424252:P15L;ENSP00000420917:P15L;ENSP00000264312:P15L;ENSP00000379725:P15L;ENSP00000426386:P15L;ENSP00000426902:P15L;ENSP00000427389:P15L;ENSP00000370882:P15L;ENSP00000399656:P15L;ENSP00000425633:P15L;ENSP00000416943:P15L;ENSP00000423002:P15L;ENSP00000423909:P15L	ENSP00000264312:P15L	P	+	2	0	OCIAD1	48529442	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.826000	0.39092	1.048000	0.40298	0.655000	0.94253	CCA	.	.		0.383	OCIAD1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361812.3	NM_017830	
LPHN3	23284	hgsc.bcm.edu	37	4	62845399	62845399	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:62845399G>A	ENST00000514591.1	+	17	3049	c.2720G>A	c.(2719-2721)aGt>aAt	p.S907N	LPHN3_ENST00000512091.2_Missense_Mutation_p.S907N|LPHN3_ENST00000514996.1_Missense_Mutation_p.S907N|LPHN3_ENST00000509896.1_Missense_Mutation_p.S975N|LPHN3_ENST00000506746.1_Missense_Mutation_p.S975N|LPHN3_ENST00000507625.1_Missense_Mutation_p.S975N|LPHN3_ENST00000514157.1_Missense_Mutation_p.S907N|LPHN3_ENST00000545650.1_Missense_Mutation_p.S907N|LPHN3_ENST00000507164.1_Missense_Mutation_p.S975N|LPHN3_ENST00000506700.1_Missense_Mutation_p.S907N|LPHN3_ENST00000504896.1_Missense_Mutation_p.S907N|LPHN3_ENST00000511324.1_Missense_Mutation_p.S975N|LPHN3_ENST00000508693.1_Missense_Mutation_p.S975N|LPHN3_ENST00000508946.1_Missense_Mutation_p.S907N|LPHN3_ENST00000506720.1_Missense_Mutation_p.S975N			Q9HAR2	LPHN3_HUMAN	latrophilin 3	894					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GGGCTCCAGAGTGACCGTAAC	0.488																																					p.S907N		Atlas-SNP	.											.	LPHN3	800	.	0			c.G2720A						.						204.0	206.0	205.0					4																	62845399		2063	4220	6283	SO:0001583	missense	23284	exon15			TCCAGAGTGACCG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2720G>A	chr4.hg19:g.62845399G>A	ENSP00000422533:p.Ser907Asn	61.0	0.0		115.0	41.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718910	0.89205	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.5	5.5	0.81552	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.62417	0.2426	L	0.41710	1.295	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.996	D;D;D	0.79108	0.992;0.992;0.986	T	0.62431	-0.6856	10	0.54805	T	0.06	.	19.0068	0.92854	0.0:0.0:1.0:0.0	.	907;894;907	E9PE04;Q9HAR2;Q9HAR2-2	.;LPHN3_HUMAN;.	N	907;907;975;975;907;907;894;907;975;975;975;907;907;907;975;975;907	ENSP00000423388:S907N;ENSP00000422533:S907N;ENSP00000423787:S975N;ENSP00000425033:S975N;ENSP00000424120:S907N;ENSP00000439831:S907N;ENSP00000421476:S975N;ENSP00000424030:S975N;ENSP00000421372:S975N;ENSP00000425201:S907N;ENSP00000423434:S907N;ENSP00000421627:S907N;ENSP00000420931:S975N;ENSP00000425884:S975N;ENSP00000424258:S907N	ENSP00000280009:S907N	S	+	2	0	LPHN3	62527994	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.808000	0.99193	2.580000	0.87095	0.467000	0.42956	AGT	.	.		0.488	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
STAP1	26228	hgsc.bcm.edu	37	4	68442954	68442954	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:68442954G>A	ENST00000265404.2	+	4	422	c.340G>A	c.(340-342)Ggc>Agc	p.G114S	STAP1_ENST00000396225.1_Missense_Mutation_p.G114S	NM_012108.2	NP_036240.1	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1	114	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	12						AGAATGGAGAGGCTTCATTCT	0.363																																					p.G114S		Atlas-SNP	.											.	STAP1	46	.	0			c.G340A						.						85.0	78.0	80.0					4																	68442954		2203	4300	6503	SO:0001583	missense	26228	exon4			TGGAGAGGCTTCA	AB023483	CCDS3515.1	4q13.2	2013-02-14	2007-08-09		ENSG00000035720	ENSG00000035720		"""SH2 domain containing"""	24133	protein-coding gene	gene with protein product	"""BCR downstream signaling 1"""	604298				10518561, 10679268	Standard	NM_012108		Approved	STAP-1, BRDG1	uc003hde.4	Q9ULZ2	OTTHUMG00000129304	ENST00000265404.2:c.340G>A	chr4.hg19:g.68442954G>A	ENSP00000265404:p.Gly114Ser	188.0	0.0		339.0	115.0	NM_012108	B2R980	Missense_Mutation	SNP	ENST00000265404.2	hg19	CCDS3515.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.407790	0.83340	.	.	ENSG00000035720	ENST00000265404;ENST00000396225	T;T	0.73897	-0.79;-0.79	5.01	5.01	0.66863	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.85517	0.5715	M	0.77820	2.39	0.50632	D	0.999884	D	0.76494	0.999	D	0.91635	0.999	D	0.86629	0.1884	10	0.72032	D	0.01	-9.8908	14.0103	0.64493	0.0:0.0:1.0:0.0	.	114	Q9ULZ2	STAP1_HUMAN	S	114	ENSP00000265404:G114S;ENSP00000379527:G114S	ENSP00000265404:G114S	G	+	1	0	STAP1	68125549	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.389000	0.44407	2.764000	0.94973	0.655000	0.94253	GGC	.	.		0.363	STAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251434.1	NM_012108	
PRSS12	8492	hgsc.bcm.edu	37	4	119204214	119204214	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:119204214G>T	ENST00000296498.3	-	12	2374	c.2092C>A	c.(2092-2094)Ctg>Atg	p.L698M	PRSS12_ENST00000510903.1_5'UTR	NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	698	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						TCTGGTACCAGAGTATGATAA	0.453																																					p.L698M		Atlas-SNP	.											.	PRSS12	71	.	0			c.C2092A						.						147.0	155.0	152.0					4																	119204214		2203	4300	6503	SO:0001583	missense	8492	exon12			GTACCAGAGTATG	AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.2092C>A	chr4.hg19:g.119204214G>T	ENSP00000296498:p.Leu698Met	38.0	0.0		71.0	22.0	NM_003619	Q9UP16	Missense_Mutation	SNP	ENST00000296498.3	hg19	CCDS3709.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970656	0.53614	.	.	ENSG00000164099	ENST00000296498	D	0.89939	-2.59	5.88	1.22	0.21188	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.074425	0.56097	D	0.000039	D	0.88651	0.6494	L	0.34521	1.04	0.38363	D	0.944678	D	0.89917	1.0	D	0.79784	0.993	D	0.86179	0.1605	10	0.62326	D	0.03	.	6.5315	0.22330	0.3732:0.1156:0.5111:0.0	.	698	P56730	NETR_HUMAN	M	698	ENSP00000296498:L698M	ENSP00000296498:L698M	L	-	1	2	PRSS12	119423662	0.305000	0.24481	0.985000	0.45067	0.532000	0.34746	0.672000	0.25187	0.108000	0.17862	0.591000	0.81541	CTG	.	.		0.453	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
KIAA0922	23240	hgsc.bcm.edu	37	4	154525446	154525446	+	Silent	SNP	A	A	G	rs17030219	byFrequency	TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:154525446A>G	ENST00000409663.3	+	25	3331	c.3279A>G	c.(3277-3279)tcA>tcG	p.S1093S	KIAA0922_ENST00000440693.1_Silent_p.S1010S|KIAA0922_ENST00000409959.3_Silent_p.S1094S	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1093						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TTAAAACTTCAGAGAACACAG	0.408																																					p.S1094S		Atlas-SNP	.											.	KIAA0922	214	.	0			c.A3282G						.						51.0	52.0	52.0					4																	154525446		2203	4300	6503	SO:0001819	synonymous_variant	23240	exon25			AACTTCAGAGAAC	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3279A>G	chr4.hg19:g.154525446A>G		173.0	0.0		368.0	104.0	NM_001131007	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Silent	SNP	ENST00000409663.3	hg19	CCDS3783.2																																																																																			.	A|0.987;C|0.013		0.408	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330370.1	NM_015196	
NPY2R	4887	hgsc.bcm.edu	37	4	156135952	156135953	+	Nonsense_Mutation	DNP	CC	CC	AT			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:156135952_156135953CC>AT	ENST00000329476.3	+	2	1350_1351	c.861_862CC>AT	c.(859-864)ttCCag>ttATag	p.287_288FQ>L*	NPY2R_ENST00000506608.1_Nonsense_Mutation_p.287_288FQ>L*	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	287					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	TCCATGCCTTCCAGCTTGCCGT	0.52																																					p.F287L|p.Q288X		Atlas-SNP	.											.|NPY2R,NS,carcinoma,0,1	NPY2R	87	.	0			c.C861A|c.C862T						.																																			SO:0001587	stop_gained	4887	exon2			TGCCTTCCAGCTT|GCCTTCCAGCTTG	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		Exception_encountered	chr4.hg19:g.156135952_156135953delinsAT	ENSP00000332591:p.F287_Q288delinsL*	49.0	0.0		132.0	37.0	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000329476.3	hg19	CCDS3791.1																																																																																			.	.		0.520	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
VCAN	1462	hgsc.bcm.edu	37	5	82837017	82837017	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr5:82837017C>A	ENST00000265077.3	+	8	8760	c.8195C>A	c.(8194-8196)gCa>gAa	p.A2732E	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.A1745E|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2732	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CAAGCTATTGCAGACCAAAGT	0.408																																					p.A2732E		Atlas-SNP	.											.	VCAN	498	.	0			c.C8195A						.						41.0	39.0	39.0					5																	82837017		2203	4300	6503	SO:0001583	missense	1462	exon8			CTATTGCAGACCA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8195C>A	chr5.hg19:g.82837017C>A	ENSP00000265077:p.Ala2732Glu	30.0	0.0		145.0	35.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	hg19	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747501	0.89663	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.38401	1.14;1.14	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000005	T	0.60560	0.2278	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.50432	-0.8829	10	0.27785	T	0.31	.	18.6676	0.91497	0.0:1.0:0.0:0.0	.	1745;2732	P13611-2;P13611	.;CSPG2_HUMAN	E	2732;1745	ENSP00000265077:A2732E;ENSP00000340062:A1745E	ENSP00000265077:A2732E	A	+	2	0	VCAN	82872773	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.259000	0.51515	2.941000	0.99782	0.655000	0.94253	GCA	.	.		0.408	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128864307	128864307	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr5:128864307T>C	ENST00000274487.4	+	6	1392	c.1247T>C	c.(1246-1248)tTa>tCa	p.L416S	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	416	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L416*(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GATATACATTTAGAGATGTCA	0.358																																					p.L416S		Atlas-SNP	.											ADAMTS19,NS,carcinoma,0,1	ADAMTS19	216	.	1	Substitution - Nonsense(1)	lung(1)	c.T1247C						.						95.0	99.0	98.0					5																	128864307		2203	4300	6503	SO:0001583	missense	171019	exon6			TACATTTAGAGAT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1247T>C	chr5.hg19:g.128864307T>C	ENSP00000274487:p.Leu416Ser	127.0	0.0		352.0	172.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	T	5.134	0.210418	0.09757	.	.	ENSG00000145808	ENST00000274487	T	0.64260	-0.09	4.02	2.86	0.33363	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.405885	0.20588	N	0.089414	T	0.40372	0.1114	N	0.14661	0.345	0.36183	D	0.849586	B	0.16166	0.016	B	0.15052	0.012	T	0.33343	-0.9872	9	.	.	.	.	9.9033	0.41362	0.0:0.083:0.0:0.917	.	416	Q8TE59	ATS19_HUMAN	S	416	ENSP00000274487:L416S	.	L	+	2	0	ADAMTS19	128892206	1.000000	0.71417	0.982000	0.44146	0.967000	0.64934	3.795000	0.55499	0.891000	0.36235	0.529000	0.55759	TTA	.	.		0.358	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
PPP2CA	5515	hgsc.bcm.edu	37	5	133541801	133541801	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr5:133541801C>G	ENST00000481195.1	-	2	404	c.124G>C	c.(124-126)Gaa>Caa	p.E42Q	CDKL3_ENST00000609654.1_Missense_Mutation_p.E392Q|CDKL3_ENST00000609383.1_3'UTR|CTD-2410N18.4_ENST00000518409.1_RNA|PPP2CA_ENST00000231504.5_5'UTR|CTD-2410N18.5_ENST00000519718.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	42					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	ACGTTGGATTCTTTTGTCAGG	0.368																																					p.E42Q		Atlas-SNP	.											.	PPP2CA	29	.	0			c.G124C						.						130.0	116.0	121.0					5																	133541801		2203	4300	6503	SO:0001583	missense	5515	exon2			TGGATTCTTTTGT		CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.124G>C	chr5.hg19:g.133541801C>G	ENSP00000418447:p.Glu42Gln	90.0	0.0		179.0	38.0	NM_002715	P05323|P13197	Missense_Mutation	SNP	ENST00000481195.1	hg19	CCDS4173.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707532	0.89018	.	.	ENSG00000113575	ENST00000481195;ENST00000523082	T;T	0.08458	3.09;3.09	5.35	4.47	0.54385	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.000000	0.85682	D	0.000000	T	0.26593	0.0650	M	0.65320	2	0.80722	D	1	D;P	0.76494	0.999;0.726	D;B	0.81914	0.995;0.313	T	0.01839	-1.1263	10	0.87932	D	0	-1.0918	15.6497	0.77081	0.1384:0.8616:0.0:0.0	.	392;42	B7Z2C5;P67775	.;PP2AA_HUMAN	Q	42;29	ENSP00000418447:E42Q;ENSP00000428816:E29Q	ENSP00000418447:E42Q	E	-	1	0	PPP2CA	133569700	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.776000	0.85560	1.373000	0.46208	0.591000	0.81541	GAA	.	.		0.368	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251165.1	NM_002715	
SLC36A3	285641	hgsc.bcm.edu	37	5	150678157	150678157	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr5:150678157C>A	ENST00000335230.3	-	2	627	c.216G>T	c.(214-216)ttG>ttT	p.L72F	SLC36A3_ENST00000377713.3_Missense_Mutation_p.L72F	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	72						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCTTACCAACAAGCCGGCAT	0.507																																					p.L72F		Atlas-SNP	.											.	SLC36A3	54	.	0			c.G216T						.						86.0	73.0	77.0					5																	150678157		2203	4300	6503	SO:0001583	missense	285641	exon2			TACCAACAAGCCG	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.216G>T	chr5.hg19:g.150678157C>A	ENSP00000334750:p.Leu72Phe	62.0	0.0		80.0	37.0	NM_181774	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	hg19	CCDS4314.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243464	0.39697	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.03152	4.03;4.03	4.62	-3.67	0.04476	.	0.251060	0.31495	N	0.007542	T	0.10937	0.0267	M	0.90369	3.11	0.21762	N	0.999558	P;P	0.48162	0.906;0.853	P;P	0.52823	0.611;0.71	T	0.02132	-1.1208	10	0.72032	D	0.01	.	6.9009	0.24283	0.0:0.5411:0.173:0.2859	.	72;72	Q495N2-3;Q495N2	.;S36A3_HUMAN	F	72	ENSP00000334750:L72F;ENSP00000366942:L72F	ENSP00000334750:L72F	L	-	3	2	SLC36A3	150658350	0.001000	0.12720	0.670000	0.29842	0.385000	0.30292	-1.408000	0.02485	-0.391000	0.07763	-1.152000	0.01820	TTG	.	.		0.507	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
SOX30	11063	hgsc.bcm.edu	37	5	157078733	157078733	+	Silent	SNP	G	G	A	rs577314769		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr5:157078733G>A	ENST00000265007.6	-	1	695	c.354C>T	c.(352-354)ggC>ggT	p.G118G	SOX30_ENST00000311371.5_Silent_p.G118G|SOX30_ENST00000519442.1_Intron	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	118					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGAGGTGGCGCCGTCTGACG	0.701													.|||	1	0.000199681	0.0008	0.0	5008	,	,		12981	0.0		0.0	False		,,,				2504	0.0				p.G118G	Esophageal Squamous(31;525 799 19355 21125 41744)	Atlas-SNP	.											.	SOX30	67	.	0			c.C354T						.						4.0	5.0	5.0					5																	157078733		1990	4005	5995	SO:0001819	synonymous_variant	11063	exon1			GGTGGCGCCGTCT	AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.354C>T	chr5.hg19:g.157078733G>A		62.0	0.0		97.0	12.0	NM_178424	O94995|Q8IYX6	Silent	SNP	ENST00000265007.6	hg19	CCDS4339.1																																																																																			.	.		0.701	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252571.2	NM_007017	
NSD1	64324	hgsc.bcm.edu	37	5	176721059	176721059	+	Silent	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr5:176721059A>G	ENST00000439151.2	+	23	6735	c.6690A>G	c.(6688-6690)ccA>ccG	p.P2230P	NSD1_ENST00000347982.4_Silent_p.P1961P|NSD1_ENST00000354179.4_Silent_p.P1961P|NSD1_ENST00000361032.4_Silent_p.P2127P	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2230	Pro-rich.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CGCTGCCTCCAGGGCCAAGCA	0.577			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.P2230P		Atlas-SNP	.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	416	.	0			c.A6690G						.						76.0	75.0	75.0					5																	176721059		2203	4300	6503	SO:0001819	synonymous_variant	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	GCCTCCAGGGCCA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6690A>G	chr5.hg19:g.176721059A>G		44.0	0.0		77.0	25.0	NM_022455	Q96PD8|Q96RN7	Silent	SNP	ENST00000439151.2	hg19	CCDS4412.1																																																																																			.	.		0.577	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
ATXN1	6310	hgsc.bcm.edu	37	6	16327286	16327286	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr6:16327286C>G	ENST00000244769.4	-	8	2192	c.1256G>C	c.(1255-1257)gGg>gCg	p.G419A	ATXN1_ENST00000436367.1_Missense_Mutation_p.G419A	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	419					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				GCCAGGCTTCCCTAAATGCAG	0.622																																					p.G419A		Atlas-SNP	.											.	ATXN1	117	.	0			c.G1256C						.						148.0	160.0	156.0					6																	16327286		2203	4300	6503	SO:0001583	missense	6310	exon7			GGCTTCCCTAAAT	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.1256G>C	chr6.hg19:g.16327286C>G	ENSP00000244769:p.Gly419Ala	49.0	0.0		53.0	16.0	NM_001128164	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	hg19	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328368	0.60743	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	D;D	0.85171	-1.95;-1.95	4.86	3.93	0.45458	.	0.000000	0.85682	D	0.000000	T	0.72503	0.3468	N	0.24115	0.695	0.58432	D	0.999998	P	0.41978	0.767	P	0.45138	0.471	T	0.75388	-0.3335	10	0.38643	T	0.18	-19.9113	14.5332	0.67942	0.0:0.8528:0.1472:0.0	.	419	P54253	ATX1_HUMAN	A	419	ENSP00000244769:G419A;ENSP00000416360:G419A	ENSP00000244769:G419A	G	-	2	0	ATXN1	16435265	1.000000	0.71417	0.996000	0.52242	0.919000	0.55068	4.302000	0.59092	2.241000	0.73720	0.561000	0.74099	GGG	.	.		0.622	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
GNL1	2794	hgsc.bcm.edu	37	6	30520392	30520392	+	Silent	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr6:30520392C>T	ENST00000376621.3	-	8	1921	c.951G>A	c.(949-951)ggG>ggA	p.G317G		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	317	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CCCAGGTGGCCCCAGCCACAT	0.587																																					p.G317G		Atlas-SNP	.											.	GNL1	47	.	0			c.G951A						.						66.0	66.0	66.0					6																	30520392		2203	4300	6503	SO:0001819	synonymous_variant	2794	exon8			GGTGGCCCCAGCC		CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.951G>A	chr6.hg19:g.30520392C>T		54.0	0.0		59.0	15.0	NM_005275	B0S838|Q96CT5	Silent	SNP	ENST00000376621.3	hg19	CCDS4680.1																																																																																			.	.		0.587	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076241.2		
ZBTB22	9278	hgsc.bcm.edu	37	6	33283384	33283384	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr6:33283384G>A	ENST00000431845.2	-	2	1461	c.1310C>T	c.(1309-1311)tCc>tTc	p.S437F	TAPBP_ENST00000434618.2_5'Flank|ZBTB22_ENST00000418724.1_Missense_Mutation_p.S437F|TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	437					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						AGCCTGTGAGGATGAGGATGA	0.647																																					p.S437F		Atlas-SNP	.											.	ZBTB22	48	.	0			c.C1310T						.						112.0	124.0	120.0					6																	33283384		2203	4300	6503	SO:0001583	missense	9278	exon2			TGTGAGGATGAGG	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.1310C>T	chr6.hg19:g.33283384G>A	ENSP00000407545:p.Ser437Phe	124.0	0.0		109.0	38.0	NM_001145338	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	ENST00000431845.2	hg19	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.161734	0.38119	.	.	ENSG00000236104	ENST00000418724;ENST00000431845	T;T	0.05996	3.36;3.36	3.76	2.88	0.33553	.	.	.	.	.	T	0.06462	0.0166	L	0.40543	1.245	0.41788	D	0.989856	D	0.61080	0.989	D	0.65140	0.932	T	0.22765	-1.0207	9	0.52906	T	0.07	.	6.9586	0.24585	0.1291:0.0:0.8709:0.0	.	437	O15209	ZBT22_HUMAN	F	437	ENSP00000404403:S437F;ENSP00000407545:S437F	ENSP00000404403:S437F	S	-	2	0	ZBTB22	33391362	0.997000	0.39634	0.978000	0.43139	0.870000	0.49936	3.633000	0.54295	0.756000	0.33013	0.393000	0.25936	TCC	.	.		0.647	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
PI16	221476	hgsc.bcm.edu	37	6	36926970	36926970	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr6:36926970G>A	ENST00000373674.3	+	2	549	c.221G>A	c.(220-222)tGc>tAc	p.C74Y		NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	74	SCP.				negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCACGGCAGTGCGTGTGGGGC	0.667																																					p.C74Y		Atlas-SNP	.											.	PI16	50	.	0			c.G221A						.						23.0	21.0	21.0					6																	36926970		2201	4299	6500	SO:0001583	missense	221476	exon3			GGCAGTGCGTGTG		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.221G>A	chr6.hg19:g.36926970G>A	ENSP00000362778:p.Cys74Tyr	135.0	0.0		129.0	44.0	NM_001199159	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	hg19	CCDS34440.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629445	0.87660	.	.	ENSG00000164530	ENST00000536757;ENST00000373674	T	0.16597	2.33	5.29	5.29	0.74685	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.48537	0.1505	M	0.93241	3.395	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.63812	-0.6552	10	0.87932	D	0	.	18.5179	0.90942	0.0:0.0:1.0:0.0	.	74;74	Q6UXB8;Q6UXB8-2	PI16_HUMAN;.	Y	74	ENSP00000362778:C74Y	ENSP00000362778:C74Y	C	+	2	0	PI16	37034948	1.000000	0.71417	0.793000	0.32043	0.975000	0.68041	7.016000	0.76393	2.462000	0.83206	0.511000	0.50034	TGC	.	.		0.667	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040380.1	NM_153370	
TRERF1	55809	hgsc.bcm.edu	37	6	42227293	42227293	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr6:42227293T>C	ENST00000372922.4	-	9	2615	c.2053A>G	c.(2053-2055)Agc>Ggc	p.S685G	TRERF1_ENST00000354325.2_Missense_Mutation_p.S602G|TRERF1_ENST00000541110.1_Missense_Mutation_p.S705G|TRERF1_ENST00000340840.2_Missense_Mutation_p.S602G|TRERF1_ENST00000372917.4_Missense_Mutation_p.S602G	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	685	Interacts with CREBBP.|Pro-rich.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CGCAGCTGGCTCTGGTACAGG	0.706																																					p.S685G		Atlas-SNP	.											.	TRERF1	124	.	0			c.A2053G						.						25.0	35.0	31.0					6																	42227293		2199	4297	6496	SO:0001583	missense	55809	exon9			GCTGGCTCTGGTA	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2053A>G	chr6.hg19:g.42227293T>C	ENSP00000362013:p.Ser685Gly	166.0	0.0		170.0	54.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	hg19	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.240207	0.79912	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.21543	2.01;2.0;2.13;2.0;2.01	5.32	5.32	0.75619	.	0.078338	0.53938	D	0.000042	T	0.26268	0.0641	M	0.80332	2.49	0.43368	D	0.995451	B;B;B;B;P	0.47604	0.421;0.297;0.297;0.421;0.898	B;B;B;B;P	0.47603	0.254;0.129;0.129;0.254;0.551	T	0.12630	-1.0540	10	0.72032	D	0.01	-12.703	15.2762	0.73742	0.0:0.0:0.0:1.0	.	602;705;685;441;441	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	G	705;602;685;602;602	ENSP00000439689:S705G;ENSP00000362008:S602G;ENSP00000362013:S685G;ENSP00000339438:S602G;ENSP00000346285:S602G	ENSP00000339438:S602G	S	-	1	0	TRERF1	42335271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.883000	0.87264	2.000000	0.58554	0.533000	0.62120	AGC	.	.		0.706	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
TIAM2	26230	hgsc.bcm.edu	37	6	155450964	155450964	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr6:155450964A>C	ENST00000461783.3	+	6	1880	c.607A>C	c.(607-609)Acc>Ccc	p.T203P	TIAM2_ENST00000529824.2_Missense_Mutation_p.T203P|TIAM2_ENST00000318981.5_Missense_Mutation_p.T203P|TIAM2_ENST00000360366.4_Missense_Mutation_p.T203P|TIAM2_ENST00000456144.1_Missense_Mutation_p.T203P|TIAM2_ENST00000367174.2_5'UTR			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	203					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GTACTCACCTACCTTAGCATC	0.627																																					p.T203P		Atlas-SNP	.											.	TIAM2	161	.	0			c.A607C						.						40.0	38.0	38.0					6																	155450964		2203	4300	6503	SO:0001583	missense	26230	exon3			TCACCTACCTTAG		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.607A>C	chr6.hg19:g.155450964A>C	ENSP00000437188:p.Thr203Pro	63.0	0.0		66.0	15.0	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	hg19	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	A	9.247	1.039697	0.19669	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.06768	3.38;3.26;3.33;3.38;3.4;3.33	4.64	0.821	0.18799	.	0.174023	0.50627	D	0.000107	T	0.02727	0.0082	L	0.60455	1.87	0.80722	D	1	P	0.43169	0.8	B	0.32289	0.143	T	0.48352	-0.9043	10	0.49607	T	0.09	.	8.5141	0.33235	0.6814:0.0:0.3186:0.0	.	203	Q8IVF5	TIAM2_HUMAN	P	203;449;203;203;203;203;203	ENSP00000437188:T203P;ENSP00000434901:T203P;ENSP00000407746:T203P;ENSP00000327315:T203P;ENSP00000353528:T203P;ENSP00000433348:T203P	ENSP00000327315:T203P	T	+	1	0	TIAM2	155492656	0.895000	0.30542	0.133000	0.22050	0.026000	0.11368	2.155000	0.42301	-0.027000	0.13873	0.402000	0.26972	ACC	.	.		0.627	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
CCZ1	51622	hgsc.bcm.edu	37	7	5965278	5965278	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr7:5965278T>G	ENST00000325974.6	+	15	1475	c.1409T>G	c.(1408-1410)cTt>cGt	p.L470R	CCZ1_ENST00000537980.1_Missense_Mutation_p.L327R|RSPH10B_ENST00000539903.1_3'UTR|CCZ1_ENST00000496860.1_3'UTR|RSPH10B_ENST00000535104.1_5'Flank	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)	470						lysosome (GO:0005764)|membrane (GO:0016020)				large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						GTCAAGAAACTTTGTGCAACG	0.403																																					p.L470R		Atlas-SNP	.											.	CCZ1	21	.	0			c.T1409G						.						71.0	62.0	65.0					7																	5965278		2202	4296	6498	SO:0001583	missense	51622	exon15			AGAAACTTTGTGC	AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.1409T>G	chr7.hg19:g.5965278T>G	ENSP00000325681:p.Leu470Arg	851.0	2.0		852.0	247.0	NM_015622	A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	ENST00000325974.6	hg19	CCDS34597.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.045259	0.75846	.	.	ENSG00000122674	ENST00000325974;ENST00000537980	.	.	.	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.77198	0.4095	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80379	-0.1407	9	0.87932	D	0	-17.7306	13.6665	0.62398	0.0:0.0:0.0:1.0	.	470	P86790	CCZ1L_HUMAN	R	470;327	.	ENSP00000325681:L470R	L	+	2	0	CCZ1	5931804	1.000000	0.71417	0.993000	0.49108	0.872000	0.50106	7.635000	0.83286	1.890000	0.54733	0.450000	0.29827	CTT	.	.		0.403	CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340391.1	NM_015622	
ABCA13	154664	hgsc.bcm.edu	37	7	48411826	48411826	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr7:48411826T>C	ENST00000435803.1	+	33	10889	c.10865T>C	c.(10864-10866)aTg>aCg	p.M3622T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3622					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CTGGAGAACATGGCTGTGTTG	0.453																																					p.M3622T		Atlas-SNP	.											.	ABCA13	1192	.	0			c.T10865C						.						179.0	176.0	177.0					7																	48411826		2049	4197	6246	SO:0001583	missense	154664	exon33			AGAACATGGCTGT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.10865T>C	chr7.hg19:g.48411826T>C	ENSP00000411096:p.Met3622Thr	45.0	0.0		122.0	31.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	T	1.321	-0.599506	0.03744	.	.	ENSG00000179869	ENST00000435803	D	0.83163	-1.69	5.77	-2.36	0.06663	.	1.028390	0.07712	N	0.942177	T	0.67524	0.2902	N	0.15975	0.35	0.09310	N	1	B;B	0.14438	0.002;0.01	B;B	0.15052	0.005;0.012	T	0.55140	-0.8187	10	0.56958	D	0.05	.	7.4768	0.27380	0.0:0.3991:0.123:0.4779	.	1324;3622	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	T	3622	ENSP00000411096:M3622T	ENSP00000411096:M3622T	M	+	2	0	ABCA13	48382372	0.788000	0.28762	0.036000	0.18154	0.312000	0.27988	1.075000	0.30716	-0.302000	0.08869	-0.290000	0.09829	ATG	.	.		0.453	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
RNF148	378925	hgsc.bcm.edu	37	7	122342165	122342165	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr7:122342165T>C	ENST00000434824.1	-	1	856	c.640A>G	c.(640-642)Aca>Gca	p.T214A	CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000313070.7_Intron|RNF148_ENST00000447240.1_Intron|CADPS2_ENST00000334010.7_Intron|RNF133_ENST00000340112.2_5'Flank|CADPS2_ENST00000412584.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	214						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						ACTCTAGGTGTAAGTCTCCAG	0.443																																					p.T214A		Atlas-SNP	.											.	RNF148	71	.	0			c.A640G						.						92.0	88.0	89.0					7																	122342165		1962	4155	6117	SO:0001583	missense	378925	exon1			TAGGTGTAAGTCT	BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.640A>G	chr7.hg19:g.122342165T>C	ENSP00000388207:p.Thr214Ala	22.0	0.0		51.0	16.0	NM_198085	A4D0X4|Q8N308	Missense_Mutation	SNP	ENST00000434824.1	hg19	CCDS47692.1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.923573	0.00498	.	.	ENSG00000235631	ENST00000434824	T	0.04194	3.68	.	.	.	.	.	.	.	.	T	0.02012	0.0063	N	0.08118	0	0.33361	D	0.572291	B	0.02656	0.0	B	0.01281	0.0	T	0.43261	-0.9402	8	0.16896	T	0.51	.	2.6478	0.04990	0.0:0.4877:0.0:0.5123	.	214	Q8N7C7	RN148_HUMAN	A	214	ENSP00000388207:T214A	ENSP00000388207:T214A	T	-	1	0	RNF148	122129401	0.331000	0.24713	0.527000	0.27925	0.590000	0.36582	0.118000	0.15605	0.103000	0.17682	0.102000	0.15555	ACA	.	.		0.443	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347424.1	NM_198085	
HIPK2	28996	hgsc.bcm.edu	37	7	139316421	139316421	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr7:139316421C>T	ENST00000406875.3	-	3	1248	c.1154G>A	c.(1153-1155)tGg>tAg	p.W385*	HIPK2_ENST00000342645.6_Nonsense_Mutation_p.W385*|HIPK2_ENST00000428878.2_Nonsense_Mutation_p.W385*	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	385	Interaction with DAXX.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					GCCCAGGGACCACATGTCAAT	0.468																																					p.W385X		Atlas-SNP	.											.	HIPK2	192	.	0			c.G1154A						.						104.0	99.0	101.0					7																	139316421		1995	4200	6195	SO:0001587	stop_gained	28996	exon3			AGGGACCACATGT	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1154G>A	chr7.hg19:g.139316421C>T	ENSP00000385571:p.Trp385*	47.0	0.0		93.0	30.0	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Nonsense_Mutation	SNP	ENST00000406875.3	hg19		.	.	.	.	.	.	.	.	.	.	C	38	6.749965	0.97809	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.8925	0.92410	0.0:1.0:0.0:0.0	.	.	.	.	X	385	.	ENSP00000343108:W385X	W	-	2	0	HIPK2	138966961	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.516000	0.81772	2.700000	0.92200	0.467000	0.42956	TGG	.	.		0.468	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
SLC4A2	6522	hgsc.bcm.edu	37	7	150765081	150765081	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr7:150765081C>A	ENST00000485713.1	+	8	2127	c.1087C>A	c.(1087-1089)Ccc>Acc	p.P363T	SLC4A2_ENST00000461735.1_Missense_Mutation_p.P349T|SLC4A2_ENST00000392826.2_Missense_Mutation_p.P354T|SLC4A2_ENST00000413384.2_Missense_Mutation_p.P363T|SLC4A2_ENST00000310317.5_Missense_Mutation_p.P281T	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	363					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGGGGGAAGCCCCACGTGGC	0.657																																					p.P363T		Atlas-SNP	.											.	SLC4A2	98	.	0			c.C1087A						.						32.0	35.0	34.0					7																	150765081		2203	4300	6503	SO:0001583	missense	6522	exon8			GGGAAGCCCCACG		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.1087C>A	chr7.hg19:g.150765081C>A	ENSP00000419412:p.Pro363Thr	84.0	0.0		72.0	22.0	NM_003040	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	hg19	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316304	0.81469	.	.	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	D;D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;-2.22	4.4	4.4	0.53042	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	D	0.95522	0.8545	H	0.95950	3.745	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	D	0.96998	0.9727	10	0.87932	D	0	.	15.7379	0.77859	0.0:1.0:0.0:0.0	.	354;349;363	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	T	363;363;281;354;349	ENSP00000419412:P363T;ENSP00000405600:P363T;ENSP00000311402:P281T;ENSP00000376571:P354T;ENSP00000419164:P349T	ENSP00000311402:P281T	P	+	1	0	SLC4A2	150396014	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	7.647000	0.83462	2.292000	0.77174	0.462000	0.41574	CCC	.	.		0.657	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
CSMD1	64478	hgsc.bcm.edu	37	8	2976077	2976077	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:2976077G>A	ENST00000520002.1	-	43	6832	c.6277C>T	c.(6277-6279)Cca>Tca	p.P2093S	CSMD1_ENST00000602723.1_Missense_Mutation_p.P2093S|CSMD1_ENST00000542608.1_Missense_Mutation_p.P2092S|CSMD1_ENST00000400186.3_Missense_Mutation_p.P2093S|CSMD1_ENST00000537824.1_Missense_Mutation_p.P2092S|CSMD1_ENST00000602557.1_Missense_Mutation_p.P2093S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2093	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTCTGAAATGGGGGTGGATCT	0.408																																					p.P2092S		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C6274T						.						125.0	121.0	122.0					8																	2976077		1957	4137	6094	SO:0001583	missense	64478	exon42			GAAATGGGGGTGG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.6277C>T	chr8.hg19:g.2976077G>A	ENSP00000430733:p.Pro2093Ser	128.0	0.0		79.0	39.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.95|19.95	3.921259|3.921259	0.73213|0.73213	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T|T;T;T;T	0.67865|0.63913	-0.29|-0.07;-0.07;-0.07;-0.07	5.03|5.03	3.19|3.19	0.36642|0.36642	.|Complement control module (2);Sushi/SCR/CCP (3);	0.142749|0.142749	0.47455|0.47455	D|N	0.000228|0.000228	T|T	0.69878|0.69878	0.3160|0.3160	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	D|D	1|1	.|B;P;P	.|0.38250	.|0.012;0.615;0.624	.|B;P;B	.|0.62014	.|0.037;0.897;0.341	T|T	0.62882|0.62882	-0.6760|-0.6760	8|10	0.33141|0.24483	T|T	0.24|0.36	.|.	10.1054|10.1054	0.42530|0.42530	0.0758:0.143:0.7811:0.0|0.0758:0.143:0.7811:0.0	.|.	.|2093;2093;2092	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	L|S	1572|2093;2093;1954;2092;2092	ENSP00000334828:P1572L|ENSP00000383047:P2093S;ENSP00000430733:P2093S;ENSP00000441462:P2092S;ENSP00000446243:P2092S	ENSP00000334828:P1572L|ENSP00000320445:P1954S	P|P	-|-	2|1	0|0	CSMD1|CSMD1	2963484|2963484	1.000000|1.000000	0.71417|0.71417	0.033000|0.033000	0.17914|0.17914	0.964000|0.964000	0.63967|0.63967	4.546000|4.546000	0.60705|0.60705	0.593000|0.593000	0.29745|0.29745	0.563000|0.563000	0.77884|0.77884	CCC|CCA	.	.		0.408	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
GFRA2	2675	hgsc.bcm.edu	37	8	21608422	21608422	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:21608422T>C	ENST00000524240.1	-	4	1122	c.472A>G	c.(472-474)Agc>Ggc	p.S158G	GFRA2_ENST00000400782.4_Missense_Mutation_p.S53G|GFRA2_ENST00000518077.1_Missense_Mutation_p.S25G|GFRA2_ENST00000517328.1_Missense_Mutation_p.S158G	NM_001495.4	NP_001486.4	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2	158					negative regulation of protein autophosphorylation (GO:0031953)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|prostate(1)|skin(1)	7				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CAATGGTTGCTCTTGGCGCTG	0.602																																					p.S158G		Atlas-SNP	.											.	GFRA2	23	.	0			c.A472G						.						25.0	28.0	27.0					8																	21608422		2192	4284	6476	SO:0001583	missense	2675	exon4			GGTTGCTCTTGGC	AF002700	CCDS47816.1, CCDS55207.1	8p21.3	2008-05-02			ENSG00000168546	ENSG00000168546			4244	protein-coding gene	gene with protein product		601956				9177201	Standard	NM_001165038		Approved	RETL2, GDNFRB, NTNRA, TRNR2	uc003wzu.1	O00451	OTTHUMG00000163897	ENST00000524240.1:c.472A>G	chr8.hg19:g.21608422T>C	ENSP00000428518:p.Ser158Gly	111.0	0.0		81.0	50.0	NM_001495	E9PD47|O15316|O15328|Q58J92|Q6GTR9|Q7Z5C2	Missense_Mutation	SNP	ENST00000524240.1	hg19	CCDS47816.1	.	.	.	.	.	.	.	.	.	.	T	7.686	0.690104	0.15039	.	.	ENSG00000168546	ENST00000524240;ENST00000400782;ENST00000517328;ENST00000518077;ENST00000517892;ENST00000522071;ENST00000520826	T;T;T;T;T;T	0.44482	1.9;1.49;1.9;1.51;1.49;0.92	4.76	4.76	0.60689	.	0.252628	0.48286	D	0.000185	T	0.40040	0.1101	N	0.14661	0.345	0.32595	N	0.526654	D;D;B	0.62365	0.991;0.982;0.017	P;D;B	0.67548	0.64;0.952;0.007	T	0.38972	-0.9636	10	0.13470	T	0.59	-36.1787	10.173	0.42922	0.0:0.0:0.1674:0.8326	.	25;53;158	O00451-2;E9PD47;O00451	.;.;GFRA2_HUMAN	G	158;53;158;25;53;158;150	ENSP00000428518:S158G;ENSP00000383592:S53G;ENSP00000429445:S158G;ENSP00000429206:S25G;ENSP00000429979:S53G;ENSP00000428721:S158G	ENSP00000383592:S53G	S	-	1	0	GFRA2	21652702	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.972000	0.49256	1.784000	0.52394	0.260000	0.18958	AGC	.	.		0.602	GFRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376254.3	NM_001495	
DUSP26	78986	hgsc.bcm.edu	37	8	33449660	33449660	+	Silent	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:33449660C>T	ENST00000256261.4	-	4	1024	c.507G>A	c.(505-507)ctG>ctA	p.L169L	DUSP26_ENST00000523956.1_Silent_p.L169L	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	169	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		GGTGGTGGTACAGCATGAGGT	0.597																																					p.L169L		Atlas-SNP	.											.	DUSP26	42	.	0			c.G507A						.						110.0	87.0	95.0					8																	33449660		2203	4300	6503	SO:0001819	synonymous_variant	78986	exon4			GTGGTACAGCATG	AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.507G>A	chr8.hg19:g.33449660C>T		120.0	0.0		75.0	32.0	NM_024025	D3DSV8|Q9BTW0	Silent	SNP	ENST00000256261.4	hg19	CCDS6092.1																																																																																			.	.		0.597	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376564.1	NM_024025	
PREX2	80243	hgsc.bcm.edu	37	8	69031729	69031729	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:69031729C>A	ENST00000288368.4	+	28	3761	c.3484C>A	c.(3484-3486)Ctt>Att	p.L1162I		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1162					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ACATAGTTGCCTTGAGCATCT	0.393																																					p.L1162I		Atlas-SNP	.											.	PREX2	614	.	0			c.C3484A						.						206.0	187.0	193.0					8																	69031729		2203	4300	6503	SO:0001583	missense	80243	exon28			AGTTGCCTTGAGC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3484C>A	chr8.hg19:g.69031729C>A	ENSP00000288368:p.Leu1162Ile	40.0	0.0		212.0	84.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190982	0.78789	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.39592	1.07	5.39	3.21	0.36854	.	0.000000	0.64402	D	0.000004	T	0.46210	0.1381	M	0.62723	1.935	0.50171	D	0.999856	P	0.46142	0.873	P	0.51701	0.677	T	0.47446	-0.9117	10	0.72032	D	0.01	.	4.4749	0.11731	0.0:0.5573:0.0:0.4426	.	1162	Q70Z35	PREX2_HUMAN	I	1162;1168	ENSP00000288368:L1162I	ENSP00000288368:L1162I	L	+	1	0	PREX2	69194283	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	3.517000	0.53443	1.415000	0.47037	0.650000	0.86243	CTT	.	.		0.393	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
POP1	10940	hgsc.bcm.edu	37	8	99170330	99170330	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:99170330A>T	ENST00000401707.2	+	16	2987	c.2906A>T	c.(2905-2907)cAg>cTg	p.Q969L	POP1_ENST00000349693.3_Missense_Mutation_p.Q969L	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	969					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			TTTGTGACTCAGGGAGATTTT	0.592																																					p.Q969L		Atlas-SNP	.											.	POP1	85	.	0			c.A2906T						.						95.0	99.0	98.0					8																	99170330		2203	4300	6503	SO:0001583	missense	10940	exon16			TGACTCAGGGAGA	D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.2906A>T	chr8.hg19:g.99170330A>T	ENSP00000385787:p.Gln969Leu	37.0	0.0		115.0	43.0	NM_001145860	A8K5W9|Q15037	Missense_Mutation	SNP	ENST00000401707.2	hg19	CCDS6277.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.844303	0.71488	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.15952	2.38;2.38	5.67	4.52	0.55395	.	0.259831	0.39274	N	0.001417	T	0.25865	0.0630	M	0.67953	2.075	0.38672	D	0.95233	D	0.54964	0.969	P	0.52159	0.691	T	0.09037	-1.0693	10	0.27082	T	0.32	-0.1377	8.1131	0.30926	0.8311:0.0:0.1689:0.0	.	969	Q99575	POP1_HUMAN	L	969	ENSP00000385787:Q969L;ENSP00000339529:Q969L	ENSP00000339529:Q969L	Q	+	2	0	POP1	99239506	1.000000	0.71417	0.993000	0.49108	0.957000	0.61999	4.859000	0.62954	0.979000	0.38497	0.455000	0.32223	CAG	.	.		0.592	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
NIPAL2	79815	hgsc.bcm.edu	37	8	99224705	99224705	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:99224705T>C	ENST00000341166.3	-	6	838	c.583A>G	c.(583-585)Att>Gtt	p.I195V	NIPAL2_ENST00000430223.2_Missense_Mutation_p.I195V|NIPAL2_ENST00000520545.1_5'UTR	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	195						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						TACAGGAGAATGCAGAAAATT	0.299																																					p.I195V		Atlas-SNP	.											.	NIPAL2	23	.	0			c.A583G						.						50.0	53.0	52.0					8																	99224705		2203	4297	6500	SO:0001583	missense	79815	exon6			GGAGAATGCAGAA	AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.583A>G	chr8.hg19:g.99224705T>C	ENSP00000339256:p.Ile195Val	21.0	0.0		185.0	23.0	NM_024759	A2RTY8	Missense_Mutation	SNP	ENST00000341166.3	hg19	CCDS6278.1	.	.	.	.	.	.	.	.	.	.	T	6.616	0.482133	0.12581	.	.	ENSG00000104361	ENST00000430223;ENST00000341166	D;D	0.90504	-2.68;-2.68	5.56	0.586	0.17434	.	0.289069	0.32703	N	0.005752	T	0.76814	0.4040	N	0.16130	0.375	0.37300	D	0.90866	B;B	0.06786	0.0;0.001	B;B	0.12156	0.006;0.007	T	0.63001	-0.6734	10	0.07813	T	0.8	-7.903	8.1431	0.31095	0.0:0.3175:0.0:0.6825	.	195;195	A2RTY8;Q9H841	.;NPAL2_HUMAN	V	195	ENSP00000407087:I195V;ENSP00000339256:I195V	ENSP00000339256:I195V	I	-	1	0	NIPAL2	99293881	0.996000	0.38824	0.951000	0.38953	0.992000	0.81027	0.419000	0.21247	0.078000	0.16900	0.533000	0.62120	ATT	.	.		0.299	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759	
ODF1	4956	hgsc.bcm.edu	37	8	103572893	103572893	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:103572893G>A	ENST00000285402.3	+	2	690	c.534G>A	c.(532-534)ccG>ccA	p.P178P	ODF1_ENST00000518835.1_Intron	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	178					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.P178P(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			TCAGCTTGCCGCCCTGTGTGG	0.517																																					p.P178P		Atlas-SNP	.											ODF1,NS,carcinoma,0,1	ODF1	55	.	1	Substitution - coding silent(1)	endometrium(1)	c.G534A						.						130.0	99.0	110.0					8																	103572893		2203	4300	6503	SO:0001819	synonymous_variant	4956	exon2			CTTGCCGCCCTGT	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.534G>A	chr8.hg19:g.103572893G>A		78.0	0.0		304.0	33.0	NM_024410	Q3SX72	Silent	SNP	ENST00000285402.3	hg19	CCDS6293.1																																																																																			.	.		0.517	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
AARD	441376	hgsc.bcm.edu	37	8	117950586	117950586	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr8:117950586A>G	ENST00000378279.3	+	1	149	c.104A>G	c.(103-105)gAc>gGc	p.D35G		NM_001025357.2	NP_001020528.1	Q4LEZ3	AARD_HUMAN	alanine and arginine rich domain containing protein	35					lung development (GO:0030324)												CCCGCGTGCGACTTCTTCGGG	0.692																																					p.D35G		Atlas-SNP	.											.	.	.	.	0			c.A104G						.						23.0	24.0	23.0					8																	117950586		2203	4300	6503	SO:0001583	missense	441376	exon1			CGTGCGACTTCTT	AB181519, BC140924	CCDS34935.1	8q24.11	2012-04-19	2012-04-19	2012-04-19	ENSG00000205002	ENSG00000205002			33842	protein-coding gene	gene with protein product	"""Alanine and arginine-rich domain-containing protein"""		"""chromosome 8 open reading frame 85"""	C8orf85			Standard	NM_001025357		Approved	LOC441376	uc003yof.3	Q4LEZ3	OTTHUMG00000164961	ENST00000378279.3:c.104A>G	chr8.hg19:g.117950586A>G	ENSP00000367528:p.Asp35Gly	130.0	0.0		586.0	219.0	NM_001025357	A5PKU8	Missense_Mutation	SNP	ENST00000378279.3	hg19	CCDS34935.1	.	.	.	.	.	.	.	.	.	.	A	0.171	-1.071249	0.01918	.	.	ENSG00000205002	ENST00000378279	T	0.28895	1.59	3.48	1.47	0.22746	.	0.863989	0.09657	N	0.772909	T	0.09158	0.0226	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37731	-0.9693	10	0.07482	T	0.82	0.0097	3.8652	0.09013	0.1301:0.0:0.6361:0.2338	.	35	Q4LEZ3	AARD_HUMAN	G	35	ENSP00000367528:D35G	ENSP00000367528:D35G	D	+	2	0	C8orf85	118019767	0.007000	0.16637	0.011000	0.14972	0.001000	0.01503	0.761000	0.26489	0.786000	0.33708	-0.251000	0.11542	GAC	.	.		0.692	AARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381195.1	NM_001025357	
PIGO	84720	hgsc.bcm.edu	37	9	35092036	35092036	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr9:35092036G>A	ENST00000378617.3	-	7	2242	c.1848C>T	c.(1846-1848)caC>caT	p.H616H	PIGO_ENST00000341666.3_Silent_p.H616H|PIGO_ENST00000361778.2_Intron|PIGO_ENST00000298004.5_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	616					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ATGCACCATTGTGCCGTGGGG	0.542																																					p.H616H		Atlas-SNP	.											.	PIGO	86	.	0			c.C1848T						.						61.0	52.0	55.0					9																	35092036		2203	4300	6503	SO:0001819	synonymous_variant	84720	exon7			ACCATTGTGCCGT	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.1848C>T	chr9.hg19:g.35092036G>A		91.0	0.0		109.0	35.0	NM_032634	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Silent	SNP	ENST00000378617.3	hg19	CCDS6575.1																																																																																			.	.		0.542	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634	
ALDH1B1	219	hgsc.bcm.edu	37	9	38397141	38397141	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr9:38397141G>C	ENST00000377698.3	+	2	1549	c.1396G>C	c.(1396-1398)Ggg>Cgg	p.G466R		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	466					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		ACTCCAGGCCGGGACCGTGTG	0.592																																					p.G466R		Atlas-SNP	.											.	ALDH1B1	50	.	0			c.G1396C						.						65.0	63.0	64.0					9																	38397141		2203	4300	6503	SO:0001583	missense	219	exon2			CAGGCCGGGACCG	M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.1396G>C	chr9.hg19:g.38397141G>C	ENSP00000366927:p.Gly466Arg	83.0	0.0		107.0	34.0	NM_000692	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	hg19	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843424	0.71488	.	.	ENSG00000137124	ENST00000377698;ENST00000540055	D	0.87029	-2.2	5.84	4.95	0.65309	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.64402	D	0.000004	D	0.96144	0.8743	H	0.98883	4.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97148	0.9829	10	0.87932	D	0	.	12.9396	0.58335	0.0785:0.0:0.9215:0.0	.	466	P30837	AL1B1_HUMAN	R	466;167	ENSP00000366927:G466R	ENSP00000366927:G466R	G	+	1	0	ALDH1B1	38387141	1.000000	0.71417	0.287000	0.24848	0.972000	0.66771	9.487000	0.97945	1.468000	0.48064	0.650000	0.86243	GGG	.	.		0.592	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1		
WNK2	65268	hgsc.bcm.edu	37	9	96018645	96018645	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr9:96018645C>A	ENST00000297954.4	+	9	2099	c.2099C>A	c.(2098-2100)cCg>cAg	p.P700Q	WNK2_ENST00000395475.2_Intron|WNK2_ENST00000395477.2_Missense_Mutation_p.P700Q|WNK2_ENST00000427277.2_Missense_Mutation_p.P312Q|WNK2_ENST00000349097.3_Missense_Mutation_p.P312Q|WNK2_ENST00000356055.3_5'UTR	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	700					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CAGCACTTCCCGGATCCGGCC	0.736																																					p.P700Q		Atlas-SNP	.											.	WNK2	277	.	0			c.C2099A						.						8.0	9.0	9.0					9																	96018645		2171	4251	6422	SO:0001583	missense	65268	exon9			ACTTCCCGGATCC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.2099C>A	chr9.hg19:g.96018645C>A	ENSP00000297954:p.Pro700Gln	79.0	0.0		74.0	20.0	NM_006648	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	ENST00000297954.4	hg19		.	.	.	.	.	.	.	.	.	.	C	5.333	0.246830	0.10130	.	.	ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000349097;ENST00000427277	T;T;T;T	0.68624	-0.34;-0.31;0.32;0.3	4.21	3.3	0.37823	.	0.426866	0.23139	N	0.051481	T	0.60599	0.2281	M	0.65975	2.015	0.80722	D	1	B;B;B;B	0.31153	0.31;0.207;0.31;0.207	B;B;B;B	0.31290	0.127;0.041;0.127;0.06	T	0.54268	-0.8319	10	0.11182	T	0.66	.	12.2786	0.54751	0.3239:0.6761:0.0:0.0	.	700;303;700;700	Q9Y3S1-2;A6PVR4;F8W9F9;Q9Y3S1	.;.;.;WNK2_HUMAN	Q	700;700;312;312	ENSP00000297954:P700Q;ENSP00000378860:P700Q;ENSP00000297876:P312Q;ENSP00000411181:P312Q	ENSP00000297954:P700Q	P	+	2	0	WNK2	95058466	0.941000	0.31946	0.729000	0.30791	0.002000	0.02628	1.830000	0.39131	0.979000	0.38497	-0.521000	0.04368	CCG	.	.		0.736	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317359.1	NM_006648	
ERP44	23071	hgsc.bcm.edu	37	9	102782996	102782996	+	Silent	SNP	G	G	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr9:102782996G>T	ENST00000262455.6	-	6	688	c.489C>A	c.(487-489)atC>atA	p.I163I		NM_015051.1	NP_055866.1	Q9BS26	ERP44_HUMAN	endoplasmic reticulum protein 44	163					cell redox homeostasis (GO:0045454)|glycoprotein metabolic process (GO:0009100)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)	19						AATATCCAATGATATTTCTTT	0.328																																					p.I163I		Atlas-SNP	.											.	ERP44	38	.	0			c.C489A						.						80.0	73.0	75.0					9																	102782996		2202	4300	6502	SO:0001819	synonymous_variant	23071	exon6			TCCAATGATATTT	AB011145	CCDS35082.1	9q22.33	2011-10-19	2009-02-23	2009-02-23	ENSG00000023318	ENSG00000023318		"""Protein disulfide isomerases"""	18311	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 10"""	609170	"""thioredoxin domain containing 4 (endoplasmic reticulum)"""	TXNDC4		11847130	Standard	NM_015051		Approved	KIAA0573, PDIA10	uc004bam.3	Q9BS26	OTTHUMG00000020363	ENST00000262455.6:c.489C>A	chr9.hg19:g.102782996G>T		35.0	0.0		78.0	19.0	NM_015051	O60319|Q4VXC1|Q5VWZ7|Q6UW14|Q8WX67	Silent	SNP	ENST00000262455.6	hg19	CCDS35082.1																																																																																			.	.		0.328	ERP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053402.1	XM_088476	
ENG	2022	hgsc.bcm.edu	37	9	130588910	130588910	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr9:130588910G>T	ENST00000373203.4	-	4	802	c.402C>A	c.(400-402)aaC>aaA	p.N134K	ENG_ENST00000344849.3_Missense_Mutation_p.N134K|ENG_ENST00000480266.1_5'Flank	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	134	Required for interaction with EGL.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						GCTCTGTGGTGTTGACCCCCG	0.617									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																												p.N134K		Atlas-SNP	.											.	ENG	44	.	0			c.C402A						.						62.0	60.0	61.0					9																	130588910		2203	4300	6503	SO:0001583	missense	2022	exon4	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	TGTGGTGTTGACC	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.402C>A	chr9.hg19:g.130588910G>T	ENSP00000362299:p.Asn134Lys	104.0	0.0		87.0	5.0	NM_001114753	Q14248|Q14926|Q5T9C0	Missense_Mutation	SNP	ENST00000373203.4	hg19	CCDS48029.1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.635369	0.47049	.	.	ENSG00000106991	ENST00000373203;ENST00000344849;ENST00000545345	T;T	0.40756	1.02;1.6	5.22	2.4	0.29515	.	0.286793	0.30193	N	0.010189	T	0.32585	0.0834	M	0.65975	2.015	0.09310	N	0.999997	P;P	0.43094	0.799;0.799	B;B	0.35931	0.214;0.214	T	0.20974	-1.0259	10	0.36615	T	0.2	-9.6678	5.093	0.14718	0.2547:0.1505:0.5948:0.0	.	134;134	Q5T9B9;P17813	.;EGLN_HUMAN	K	134	ENSP00000362299:N134K;ENSP00000341917:N134K	ENSP00000341917:N134K	N	-	3	2	ENG	129628731	0.000000	0.05858	0.007000	0.13788	0.501000	0.33797	0.084000	0.14891	0.306000	0.22856	-0.254000	0.11334	AAC	.	.		0.617	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054313.1		
NUP214	8021	hgsc.bcm.edu	37	9	134073496	134073496	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr9:134073496A>T	ENST00000359428.5	+	29	4759	c.4615A>T	c.(4615-4617)Aaa>Taa	p.K1539*	NUP214_ENST00000411637.2_Nonsense_Mutation_p.K1529*|NUP214_ENST00000483497.2_Nonsense_Mutation_p.K365*|NUP214_ENST00000451030.1_Nonsense_Mutation_p.K1540*			P35658	NU214_HUMAN	nucleoporin 214kDa	1539	11 X 3 AA approximate repeats.|11 X 5 AA approximate repeats.|18 X 4 AA approximate repeats.|Pro/Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CTCTGTTAAAAAAGAACCTGT	0.537			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.K1539X	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	166	.	0			c.A4615T						.						46.0	48.0	47.0					9																	134073496		2203	4300	6503	SO:0001587	stop_gained	8021	exon29			GTTAAAAAAGAAC	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.4615A>T	chr9.hg19:g.134073496A>T	ENSP00000352400:p.Lys1539*	101.0	0.0		113.0	42.0	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Nonsense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.	.	.	.	.	.	.	.	.	.	A	45	11.278235	0.99540	.	.	ENSG00000126883	ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605;ENST00000483497;ENST00000531600;ENST00000541688	.	.	.	5.57	4.44	0.53790	.	0.000000	0.47093	D	0.000259	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.1444	9.9107	0.41403	0.9192:0.0:0.0808:0.0	.	.	.	.	X	1539;1529;1540;1518;1133;968;365;316;316	.	ENSP00000352400:K1539X	K	+	1	0	NUP214	133063317	0.065000	0.20965	0.226000	0.23910	0.572000	0.35998	1.033000	0.30191	2.119000	0.64992	0.459000	0.35465	AAA	.	.		0.537	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
PNPLA7	375775	hgsc.bcm.edu	37	9	140361782	140361782	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr9:140361782T>C	ENST00000277531.4	-	25	3137	c.2951A>G	c.(2950-2952)aAg>aGg	p.K984R	PNPLA7_ENST00000492278.1_5'UTR|PNPLA7_ENST00000406427.1_Missense_Mutation_p.K1009R|PNPLA7_ENST00000371457.1_Missense_Mutation_p.K590R	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	984	Patatin.				lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GGCCCACTGCTTGGCCCGGAT	0.667																																					p.K1009R		Atlas-SNP	.											.	PNPLA7	124	.	0			c.A3026G						.						103.0	72.0	83.0					9																	140361782		2201	4298	6499	SO:0001583	missense	375775	exon26			CACTGCTTGGCCC	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.2951A>G	chr9.hg19:g.140361782T>C	ENSP00000277531:p.Lys984Arg	68.0	0.0		80.0	30.0	NM_001098537	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	ENST00000277531.4	hg19	CCDS7045.1	.	.	.	.	.	.	.	.	.	.	T	8.235	0.805591	0.16467	.	.	ENSG00000130653	ENST00000371457;ENST00000371446;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1	5.41	4.13	0.48395	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.169680	0.48767	N	0.000175	T	0.49115	0.1538	N	0.04387	-0.21	0.28028	N	0.934251	B;B;B;B	0.18013	0.001;0.025;0.001;0.001	B;B;B;B	0.19946	0.009;0.027;0.013;0.009	T	0.43475	-0.9389	10	0.02654	T	1	-32.055	6.6828	0.23129	0.0:0.2909:0.0:0.7091	.	392;1009;984;250	E2QRF8;Q6ZV29-5;Q6ZV29;B3KXH5	.;.;PLPL7_HUMAN;.	R	590;392;984;1009;984;975	ENSP00000360512:K590R;ENSP00000360501:K392R;ENSP00000277531:K984R;ENSP00000384610:K1009R;ENSP00000400582:K975R	ENSP00000277531:K984R	K	-	2	0	PNPLA7	139481603	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	3.101000	0.50283	0.761000	0.33130	0.459000	0.35465	AAG	.	.		0.667	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254787.1	NM_152286	
PITX3	5309	hgsc.bcm.edu	37	10	103991819	103991819	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr10:103991819T>G	ENST00000370002.3	-	2	172	c.19A>C	c.(19-21)Agc>Cgc	p.S7R	PITX3_ENST00000539804.1_Missense_Mutation_p.S7R	NM_005029.3	NP_005020.1	O75364	PITX3_HUMAN	paired-like homeodomain 3	7					dopaminergic neuron differentiation (GO:0071542)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|locomotory behavior (GO:0007626)|midbrain development (GO:0030901)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|large_intestine(2)|lung(2)	5		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TCTGCCTCGCTGAGCAGGCCG	0.662																																					p.S7R		Atlas-SNP	.											.	PITX3	9	.	0			c.A19C						.						9.0	12.0	11.0					10																	103991819		2191	4283	6474	SO:0001583	missense	5309	exon2			CCTCGCTGAGCAG		CCDS7532.1	10q24.32	2013-11-14	2007-07-12		ENSG00000107859	ENSG00000107859		"""Homeoboxes / PRD class"""	9006	protein-coding gene	gene with protein product		602669	"""paired-like homeodomain transcription factor 3"", ""anterior segment mesenchymal dysgenesis"""	ASMD		9620774	Standard	NM_005029		Approved		uc001kuu.1	O75364	OTTHUMG00000018952	ENST00000370002.3:c.19A>C	chr10.hg19:g.103991819T>G	ENSP00000359019:p.Ser7Arg	77.0	0.0		76.0	22.0	NM_005029	Q5VZL2	Missense_Mutation	SNP	ENST00000370002.3	hg19	CCDS7532.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.240015	0.39598	.	.	ENSG00000107859	ENST00000370002;ENST00000539804	D;D	0.89196	-2.48;-2.48	5.58	1.93	0.25924	.	0.138414	0.64402	D	0.000007	T	0.71953	0.3401	N	0.14661	0.345	0.23468	N	0.997612	B	0.22604	0.072	B	0.20384	0.029	T	0.57590	-0.7785	10	0.02654	T	1	.	5.5871	0.17281	0.0:0.2243:0.1352:0.6405	.	7	O75364	PITX3_HUMAN	R	7	ENSP00000359019:S7R;ENSP00000439383:S7R	ENSP00000359019:S7R	S	-	1	0	PITX3	103981809	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	2.957000	0.49137	0.084000	0.17077	0.374000	0.22700	AGC	.	.		0.662	PITX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050031.1		
ADAM12	8038	hgsc.bcm.edu	37	10	127806605	127806605	+	Splice_Site	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr10:127806605A>G	ENST00000368679.4	-	6	922		c.e6+1		ADAM12_ENST00000368676.4_Splice_Site	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12						cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TATCCCCCTTACCCTTCTTGC	0.493																																					.		Atlas-SNP	.											.	ADAM12	388	.	0			c.612+2T>C						.						183.0	165.0	171.0					10																	127806605		2203	4300	6503	SO:0001630	splice_region_variant	8038	exon7			CCCCTTACCCTTC	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.612+1T>C	chr10.hg19:g.127806605A>G		31.0	0.0		62.0	18.0	NM_003474	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Splice_Site	SNP	ENST00000368679.4	hg19	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	A	11.62	1.693361	0.30052	.	.	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	.	.	.	4.89	3.74	0.42951	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2945	0.43616	0.8342:0.1658:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAM12	127796595	1.000000	0.71417	0.987000	0.45799	0.240000	0.25518	1.895000	0.39778	0.866000	0.35629	0.533000	0.62120	.	.	.		0.493	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		Intron
MUC2	4583	hgsc.bcm.edu	37	11	1093305	1093305	+	Silent	SNP	C	C	G	rs62637245		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr11:1093305C>G	ENST00000441003.2	+	30	5151	c.5124C>G	c.(5122-5124)acC>acG	p.T1708T	MUC2_ENST00000359061.5_Silent_p.T1675T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ctacggtgaccccaaccccaa	0.637																																					p.T1708T		Atlas-SNP	.											.	MUC2	614	.	0			c.C5124G						.						136.0	184.0	168.0					11																	1093305		1897	3515	5412	SO:0001819	synonymous_variant	4583	exon30			GGTGACCCCAACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5124C>G	chr11.hg19:g.1093305C>G		20.0	0.0		19.0	7.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR51A7	119687	hgsc.bcm.edu	37	11	4928615	4928615	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr11:4928615A>G	ENST00000359350.4	+	1	16	c.16A>G	c.(16-18)Aac>Gac	p.N6D	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTTCTCAATAACTCCGAAGT	0.433																																					p.N6D		Atlas-SNP	.											.	OR51A7	86	.	0			c.A16G						.						85.0	80.0	81.0					11																	4928615		2201	4298	6499	SO:0001583	missense	119687	exon1			CTCAATAACTCCG	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.16A>G	chr11.hg19:g.4928615A>G	ENSP00000352305:p.Asn6Asp	22.0	0.0		61.0	19.0	NM_001004749	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	hg19	CCDS31364.1	.	.	.	.	.	.	.	.	.	.	A	1.994	-0.431106	0.04669	.	.	ENSG00000176895	ENST00000359350;ENST00000545959	T	0.00505	6.93	5.02	-1.33	0.09172	.	0.557473	0.16229	N	0.223676	T	0.00328	0.0010	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46219	-0.9207	10	0.35671	T	0.21	.	1.0455	0.01568	0.4545:0.1499:0.2511:0.1445	.	6	Q8NH64	O51A7_HUMAN	D	6	ENSP00000352305:N6D	ENSP00000352305:N6D	N	+	1	0	OR51A7	4885191	0.000000	0.05858	0.002000	0.10522	0.039000	0.13416	-1.319000	0.02702	-0.483000	0.06772	-1.587000	0.00848	AAC	.	.		0.433	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
MED17	9440	hgsc.bcm.edu	37	11	93526996	93526996	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr11:93526996T>G	ENST00000251871.3	+	4	1027	c.740T>G	c.(739-741)aTt>aGt	p.I247S		NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	247					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GATGTCCAAATTCCTAGTGAT	0.318																																					p.I247S		Atlas-SNP	.											.	MED17	37	.	0			c.T740G						.						81.0	79.0	80.0					11																	93526996		2201	4298	6499	SO:0001583	missense	9440	exon4			TCCAAATTCCTAG	AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.740T>G	chr11.hg19:g.93526996T>G	ENSP00000251871:p.Ile247Ser	96.0	0.0		132.0	43.0	NM_004268	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	hg19	CCDS8295.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.147437	0.77888	.	.	ENSG00000042429	ENST00000251871;ENST00000427225;ENST00000528786	T;T	0.55413	0.52;0.52	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.65554	0.2702	M	0.61703	1.905	0.80722	D	1	D	0.63880	0.993	P	0.57620	0.824	T	0.68040	-0.5514	10	0.54805	T	0.06	-20.3107	15.554	0.76177	0.0:0.0:0.0:1.0	.	247	Q9NVC6	MED17_HUMAN	S	247;217;139	ENSP00000251871:I247S;ENSP00000433626:I139S	ENSP00000251871:I247S	I	+	2	0	MED17	93166644	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.941000	0.87700	2.095000	0.63458	0.533000	0.62120	ATT	.	.		0.318	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268	
PGR	5241	hgsc.bcm.edu	37	11	100933279	100933279	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr11:100933279T>C	ENST00000325455.5	-	4	3564	c.2111A>G	c.(2110-2112)gAc>gGc	p.D704G	PGR_ENST00000263463.5_Intron|PGR_ENST00000534013.1_Missense_Mutation_p.D110G	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	704	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	TTTTGTGTTGTCATGTCCTGC	0.423																																					p.D704G	Pancreas(124;2271 2354 21954 22882)	Atlas-SNP	.											.	PGR	115	.	0			c.A2111G						.						238.0	220.0	226.0					11																	100933279		2203	4300	6503	SO:0001583	missense	5241	exon4			GTGTTGTCATGTC	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2111A>G	chr11.hg19:g.100933279T>C	ENSP00000325120:p.Asp704Gly	72.0	0.0		168.0	50.0	NM_000926	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	hg19	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.534211	0.85812	.	.	ENSG00000082175	ENST00000325455;ENST00000534013	D;D	0.96685	-4.09;-4.09	5.86	5.86	0.93980	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.000000	0.85682	D	0.000000	D	0.98356	0.9454	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	D	0.99368	1.0919	10	0.72032	D	0.01	.	16.254	0.82501	0.0:0.0:0.0:1.0	.	704;85	P06401;A7LQ08	PRGR_HUMAN;.	G	704;110	ENSP00000325120:D704G;ENSP00000436561:D110G	ENSP00000325120:D704G	D	-	2	0	PGR	100438489	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.685000	0.84117	2.232000	0.73038	0.533000	0.62120	GAC	.	.		0.423	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
LMBR1L	55716	hgsc.bcm.edu	37	12	49496110	49496110	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr12:49496110C>G	ENST00000267102.8	-	10	1161	c.819G>C	c.(817-819)caG>caC	p.Q273H	LMBR1L_ENST00000553204.1_5'Flank|LMBR1L_ENST00000395141.4_Missense_Mutation_p.Q268H|LMBR1L_ENST00000547382.1_Missense_Mutation_p.Q273H	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	273					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GAGCCAGGACCTGTCTGTGTA	0.567																																					p.Q273H		Atlas-SNP	.											.	LMBR1L	61	.	0			c.G819C						.						144.0	134.0	137.0					12																	49496110		2203	4300	6503	SO:0001583	missense	55716	exon10			CAGGACCTGTCTG	AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.819G>C	chr12.hg19:g.49496110C>G	ENSP00000267102:p.Gln273His	95.0	0.0		143.0	42.0	NM_018113	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	ENST00000267102.8	hg19	CCDS8780.2	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418397	0.62622	.	.	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000395141	T;T;T	0.28454	1.61;1.61;1.61	5.65	4.73	0.59995	LMBR1-like membrane protein (1);	0.261816	0.45126	D	0.000393	T	0.20373	0.0490	N	0.08118	0	0.34175	D	0.670252	B;D;P;P;P	0.56035	0.115;0.974;0.799;0.832;0.731	B;P;B;P;B	0.47299	0.086;0.543;0.277;0.5;0.323	T	0.33954	-0.9848	10	0.72032	D	0.01	.	9.7867	0.40681	0.0:0.8308:0.0:0.1692	.	271;273;273;273;268	Q6UX01-2;Q6UX01-5;Q6UX01-3;Q6UX01;Q6UX01-4	.;.;.;LMBRL_HUMAN;.	H	273;273;268	ENSP00000267102:Q273H;ENSP00000447329:Q273H;ENSP00000378573:Q268H	ENSP00000267102:Q273H	Q	-	3	2	LMBR1L	47782377	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.264000	0.33015	1.561000	0.49584	0.655000	0.94253	CAG	.	.		0.567	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318696.1	NM_018113	
FAM186A	121006	hgsc.bcm.edu	37	12	50749666	50749666	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr12:50749666G>C	ENST00000327337.5	-	4	948	c.949C>G	c.(949-951)Cag>Gag	p.Q317E	FAM186A_ENST00000543111.1_Missense_Mutation_p.Q317E	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	317																	AGTTTCTGCTGAAGCATTTCA	0.363																																					p.Q317E	NSCLC(138;1796 1887 12511 19463 37884)	Atlas-SNP	.											.	FAM186A	181	.	0			c.C949G						.						218.0	157.0	175.0					12																	50749666		692	1591	2283	SO:0001583	missense	121006	exon4			TCTGCTGAAGCAT		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.949C>G	chr12.hg19:g.50749666G>C	ENSP00000329995:p.Gln317Glu	56.0	0.0		54.0	13.0	NM_001145475		Missense_Mutation	SNP	ENST00000327337.5	hg19	CCDS44878.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496901	0.26861	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.09817	2.94;2.94	4.47	1.22	0.21188	.	.	.	.	.	T	0.07863	0.0197	L	0.27053	0.805	0.09310	N	1	B;B	0.28998	0.23;0.23	B;B	0.25140	0.058;0.058	T	0.31308	-0.9948	9	0.87932	D	0	.	8.7139	0.34399	0.0:0.3032:0.5417:0.1551	.	317;317	F5GYN0;A6NE01	.;F186A_HUMAN	E	317	ENSP00000441337:Q317E;ENSP00000329995:Q317E	ENSP00000329995:Q317E	Q	-	1	0	FAM186A	49035933	0.998000	0.40836	0.643000	0.29450	0.714000	0.41099	0.693000	0.25497	0.573000	0.29400	0.591000	0.81541	CAG	.	.		0.363	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
CCDC59	29080	hgsc.bcm.edu	37	12	82750988	82750988	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr12:82750988C>T	ENST00000256151.7	-	2	626	c.215G>A	c.(214-216)cGg>cAg	p.R72Q	METTL25_ENST00000248306.3_5'Flank|CCDC59_ENST00000548126.1_5'UTR	NM_014167.4	NP_054886.2	Q9P031	TAP26_HUMAN	coiled-coil domain containing 59	72					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)	5						CTTTTCCTTCCGTAGCAATTT	0.368																																					p.R72Q		Atlas-SNP	.											.	CCDC59	17	.	0			c.G215A						.						125.0	119.0	121.0					12																	82750988		2203	4300	6503	SO:0001583	missense	29080	exon2			TCCTTCCGTAGCA	AF213377	CCDS9023.1	12q21.31	2007-10-17				ENSG00000133773			25005	protein-coding gene	gene with protein product						16630564, 12882447	Standard	NM_014167		Approved	HSPC128, TAP26, BR22	uc001szp.4	Q9P031		ENST00000256151.7:c.215G>A	chr12.hg19:g.82750988C>T	ENSP00000256151:p.Arg72Gln	82.0	0.0		91.0	35.0	NM_014167	Q9H2V5|Q9NW62	Missense_Mutation	SNP	ENST00000256151.7	hg19	CCDS9023.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.910181	0.33721	.	.	ENSG00000133773	ENST00000552377;ENST00000256151	.	.	.	5.43	5.43	0.79202	.	0.468033	0.23672	N	0.045701	T	0.26702	0.0653	L	0.39245	1.2	0.25735	N	0.985227	D	0.56521	0.976	B	0.39068	0.289	T	0.27331	-1.0077	9	0.33141	T	0.24	-3.652	10.7574	0.46245	0.0:0.88:0.0:0.12	.	72	Q9P031	TAP26_HUMAN	Q	72	.	ENSP00000256151:R72Q	R	-	2	0	CCDC59	81275119	0.112000	0.22096	0.128000	0.21923	0.008000	0.06430	1.265000	0.33027	2.546000	0.85860	0.655000	0.94253	CGG	.	.		0.368	CCDC59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408186.1	NM_014167	
GAS2L3	283431	hgsc.bcm.edu	37	12	101017580	101017580	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr12:101017580C>T	ENST00000539410.1	+	9	1383	c.997C>T	c.(997-999)Ccc>Tcc	p.P333S	GAS2L3_ENST00000547754.1_Missense_Mutation_p.P333S|GAS2L3_ENST00000266754.5_Missense_Mutation_p.P333S|GAS2L3_ENST00000537247.1_Missense_Mutation_p.P229S			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	333					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						AAATTCAAAACCCAGCGTGCC	0.448																																					p.P333S		Atlas-SNP	.											.	GAS2L3	76	.	0			c.C997T						.						57.0	57.0	57.0					12																	101017580		2203	4300	6503	SO:0001583	missense	283431	exon10			TCAAAACCCAGCG	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.997C>T	chr12.hg19:g.101017580C>T	ENSP00000439672:p.Pro333Ser	69.0	0.0		140.0	38.0	NM_174942	B2RCN2	Missense_Mutation	SNP	ENST00000539410.1	hg19	CCDS9079.1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.519740	0.64634	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.25579	1.81;1.81;1.79;1.81	5.71	5.71	0.89125	.	0.281738	0.35525	N	0.003152	T	0.30510	0.0767	L	0.49126	1.545	0.37945	D	0.932445	P	0.52577	0.954	P	0.47673	0.554	T	0.05767	-1.0865	10	0.20519	T	0.43	-14.6589	15.3495	0.74370	0.0:0.861:0.139:0.0	.	333	Q86XJ1	GA2L3_HUMAN	S	333;333;229;333	ENSP00000266754:P333S;ENSP00000448955:P333S;ENSP00000442406:P229S;ENSP00000439672:P333S	ENSP00000266754:P333S	P	+	1	0	GAS2L3	99541711	0.743000	0.28239	0.932000	0.37286	0.485000	0.33311	2.054000	0.41335	2.697000	0.92050	0.655000	0.94253	CCC	.	.		0.448	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409143.1	NM_174942	
UBE3B	89910	hgsc.bcm.edu	37	12	109959357	109959357	+	Splice_Site	SNP	G	G	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr12:109959357G>T	ENST00000342494.3	+	21	2959		c.e21+1		UBE3B_ENST00000434735.2_Splice_Site	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TGTGTATGAGGTAGGAACGTT	0.453																																					.		Atlas-SNP	.											.	UBE3B	116	.	0			c.2364+1G>T						.						85.0	76.0	79.0					12																	109959357		2203	4300	6503	SO:0001630	splice_region_variant	89910	exon21			TATGAGGTAGGAA	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2364+1G>T	chr12.hg19:g.109959357G>T		77.0	0.0		84.0	4.0	NM_183415	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Splice_Site	SNP	ENST00000342494.3	hg19	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344620	0.82022	.	.	ENSG00000151148	ENST00000434735;ENST00000539599;ENST00000342494;ENST00000539584;ENST00000538070	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.86	0.88778	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBE3B	108443740	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.842000	0.92136	2.684000	0.91462	0.655000	0.94253	.	.	.		0.453	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	Intron
VWA8	23078	hgsc.bcm.edu	37	13	42179341	42179341	+	Missense_Mutation	SNP	T	T	A	rs544413664		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr13:42179341T>A	ENST00000379310.3	-	40	5017	c.4949A>T	c.(4948-4950)cAg>cTg	p.Q1650L		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1650						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										GGAGTGCACCTGTCGCCGAAC	0.423													T|||	1	0.000199681	0.0008	0.0	5008	,	,		19877	0.0		0.0	False		,,,				2504	0.0				p.Q1650L		Atlas-SNP	.											.	.	.	.	0			c.A4949T						.						139.0	133.0	135.0					13																	42179341		1909	4120	6029	SO:0001583	missense	23078	exon40			TGCACCTGTCGCC	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.4949A>T	chr13.hg19:g.42179341T>A	ENSP00000368612:p.Gln1650Leu	29.0	0.0		68.0	29.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	hg19	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	T	32	5.121712	0.94385	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.11930	2.73	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.42404	0.1201	M	0.82823	2.61	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	T	0.36407	-0.9749	10	0.62326	D	0.03	.	16.4675	0.84087	0.0:0.0:0.0:1.0	.	1650	A3KMH1	K0564_HUMAN	L	1554;1650	ENSP00000368612:Q1650L	ENSP00000251030:Q1554L	Q	-	2	0	KIAA0564	41077341	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	7.930000	0.87610	2.367000	0.80283	0.528000	0.53228	CAG	.	.		0.423	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
LMO7	4008	hgsc.bcm.edu	37	13	76381866	76381866	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr13:76381866G>A	ENST00000321797.8	+	8	1469	c.748G>A	c.(748-750)Gac>Aac	p.D250N	LMO7_ENST00000377534.3_Missense_Mutation_p.D535N|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000465261.2_Missense_Mutation_p.D250N|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000357063.3_Missense_Mutation_p.D535N			Q8WWI1	LMO7_HUMAN	LIM domain 7	535					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AGCTTTTGAAGACTTTAGAAA	0.408																																					p.D250N		Atlas-SNP	.											.	LMO7	334	.	0			c.G748A						.						84.0	81.0	82.0					13																	76381866		1568	3582	5150	SO:0001583	missense	4008	exon7			TTTGAAGACTTTA	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.748G>A	chr13.hg19:g.76381866G>A	ENSP00000317802:p.Asp250Asn	60.0	0.0		84.0	4.0	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.24|17.24	3.338365|3.338365	0.60963|0.60963	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261|ENST00000447038	T;T;T;T|.	0.52754|.	0.65;0.65;0.65;0.65|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.376542|.	0.29544|.	N|.	0.011843|.	T|T	0.55114|0.55114	0.1900|0.1900	L|L	0.59436|0.59436	1.845|1.845	0.25346|0.25346	N|N	0.988907|0.988907	P;P|.	0.39480|.	0.675;0.675|.	B;B|.	0.35413|.	0.202;0.202|.	T|T	0.51521|0.51521	-0.8695|-0.8695	10|5	0.21540|.	T|.	0.41|.	-23.0716|-23.0716	13.0756|13.0756	0.59085|0.59085	0.0:0.0:0.7347:0.2653|0.0:0.0:0.7347:0.2653	.|.	535;250|.	Q8WWI1;E9PLH4|.	LMO7_HUMAN;.|.	N|K	535;535;250;250|158	ENSP00000349571:D535N;ENSP00000366757:D535N;ENSP00000317802:D250N;ENSP00000433352:D250N|.	ENSP00000317802:D250N|.	D|R	+|+	1|2	0|0	LMO7|LMO7	75279867|75279867	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.343000|4.343000	0.59348|0.59348	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GAC|AGA	.	.		0.408	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
POTEG	404785	hgsc.bcm.edu	37	14	19566058	19566058	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr14:19566058G>A	ENST00000409832.3	+	6	1154	c.1102G>A	c.(1102-1104)Gtc>Atc	p.V368I	CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	368								p.V368F(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GATGCTAAAAGTCTCTTCTGA	0.318																																					p.V368I		Atlas-SNP	.											POTEG,NS,malignant_melanoma,0,1	POTEG	118	.	1	Substitution - Missense(1)	lung(1)	c.G1102A						.						84.0	98.0	93.0					14																	19566058		1508	2699	4207	SO:0001583	missense	404785	exon6			CTAAAAGTCTCTT		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1102G>A	chr14.hg19:g.19566058G>A	ENSP00000386971:p.Val368Ile	246.0	0.0		570.0	78.0	NM_001005356	A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	ENST00000409832.3	hg19	CCDS32018.1	.	.	.	.	.	.	.	.	.	.	g	0.007	-1.960118	0.00465	.	.	ENSG00000222036	ENST00000409832	T	0.16897	2.31	2.2	-4.4	0.03600	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.05823	0.0152	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.40739	-0.9547	9	0.02654	T	1	.	3.6859	0.08328	0.2852:0.0:0.4944:0.2203	.	368	Q6S5H5	POTEG_HUMAN	I	368	ENSP00000386971:V368I	ENSP00000386971:V368I	V	+	1	0	POTEG	18636058	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.216000	0.09266	-0.934000	0.03733	-1.109000	0.02080	GTC	.	.		0.318	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1	NM_001005356	
KLHDC1	122773	hgsc.bcm.edu	37	14	50192421	50192421	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr14:50192421G>A	ENST00000359332.2	+	6	591	c.501G>A	c.(499-501)tgG>tgA	p.W167*	KLHDC1_ENST00000554512.1_3'UTR	NM_172193.2	NP_751943.1	Q8N7A1	KLDC1_HUMAN	kelch domain containing 1	167						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	12	all_epithelial(31;0.00244)|Breast(41;0.00964)					AGATATTCTGGGGATGGCATA	0.284																																					p.W167X		Atlas-SNP	.											.	KLHDC1	24	.	0			c.G501A						.						41.0	41.0	41.0					14																	50192421		2203	4296	6499	SO:0001587	stop_gained	122773	exon6			ATTCTGGGGATGG	AF111806	CCDS9692.1	14q21.3	2007-08-01			ENSG00000197776	ENSG00000197776			19836	protein-coding gene	gene with protein product		611281					Standard	NM_172193		Approved	MST025	uc001www.3	Q8N7A1	OTTHUMG00000140295	ENST00000359332.2:c.501G>A	chr14.hg19:g.50192421G>A	ENSP00000352282:p.Trp167*	562.0	0.0		830.0	302.0	NM_172193	B3KXD9|Q8WYI1	Nonsense_Mutation	SNP	ENST00000359332.2	hg19	CCDS9692.1	.	.	.	.	.	.	.	.	.	.	G	37	6.050918	0.97236	.	.	ENSG00000197776	ENST00000359332;ENST00000557128	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-6.656	19.8454	0.96706	0.0:0.0:1.0:0.0	.	.	.	.	X	167;38	.	ENSP00000352282:W167X	W	+	3	0	KLHDC1	49262171	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.864000	0.69575	2.850000	0.98022	0.650000	0.86243	TGG	.	.		0.284	KLHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276882.2	NM_172193	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493179	77493179	+	Silent	SNP	C	C	A	rs370738204		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr14:77493179C>A	ENST00000238647.3	-	1	1855	c.957G>T	c.(955-957)tcG>tcT	p.S319S		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	319					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						CCTCTGCCACCGACGAAGAGG	0.697																																					p.S319S		Atlas-SNP	.											.	IRF2BPL	40	.	0			c.G957T						.						20.0	21.0	20.0					14																	77493179		2199	4298	6497	SO:0001819	synonymous_variant	64207	exon1			TGCCACCGACGAA	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.957G>T	chr14.hg19:g.77493179C>A		157.0	0.0		64.0	35.0	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	hg19	CCDS9854.1																																																																																			.	.		0.697	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
MAGEL2	54551	hgsc.bcm.edu	37	15	23890281	23890281	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr15:23890281T>C	ENST00000532292.1	-	1	894	c.800A>G	c.(799-801)gAg>gGg	p.E267G		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	150					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTTGGAGGCCTCTTGAGTGGT	0.632																																					p.E870G		Atlas-SNP	.											MAGEL2_ENST00000532292,right_upper_lobe,carcinoma,0,1	MAGEL2	108	.	0			c.A2609G						.						34.0	43.0	40.0					15																	23890281		2175	4284	6459	SO:0001583	missense	54551	exon1			GAGGCCTCTTGAG	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.800A>G	chr15.hg19:g.23890281T>C	ENSP00000433433:p.Glu267Gly	100.0	0.0		139.0	47.0	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.89	1.478001	0.26511	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.22	0.501	0.16925	.	.	.	.	.	T	0.19248	0.0462	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	T	0.21552	-1.0242	5	.	.	.	.	0.7122	0.00926	0.169:0.1728:0.1743:0.4839	.	.	.	.	G	299	.	.	R	-	1	2	MAGEL2	21441374	0.783000	0.28701	0.017000	0.16124	0.139000	0.21198	0.209000	0.17435	0.064000	0.16427	0.533000	0.62120	AGG	.	.		0.632	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
HERC2	8924	hgsc.bcm.edu	37	15	28419679	28419679	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr15:28419679C>T	ENST00000261609.7	-	65	10027	c.9919G>A	c.(9919-9921)Gaa>Aaa	p.E3307K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTCTGGCCTTCTAAGCCTTGC	0.597																																					p.E3307K		Atlas-SNP	.											.	HERC2	501	.	0			c.G9919A						.						101.0	67.0	79.0					15																	28419679		2203	4300	6503	SO:0001583	missense	8924	exon65			GGCCTTCTAAGCC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9919G>A	chr15.hg19:g.28419679C>T	ENSP00000261609:p.Glu3307Lys	495.0	0.0		499.0	138.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409551	0.83340	.	.	ENSG00000128731	ENST00000261609	T	0.80480	-1.38	5.72	4.79	0.61399	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.81394	0.4813	N	0.11698	0.16	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.84236	0.0469	10	0.49607	T	0.09	.	16.5463	0.84446	0.0:0.8691:0.1309:0.0	.	3307	O95714	HERC2_HUMAN	K	3307	ENSP00000261609:E3307K	ENSP00000261609:E3307K	E	-	1	0	HERC2	26093274	1.000000	0.71417	0.656000	0.29637	0.398000	0.30690	6.079000	0.71291	1.380000	0.46344	0.591000	0.81541	GAA	.	.		0.597	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
CHD2	1106	hgsc.bcm.edu	37	15	93496619	93496619	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr15:93496619G>C	ENST00000394196.4	+	14	2603	c.1535G>C	c.(1534-1536)gGc>gCc	p.G512A	CHD2_ENST00000557381.1_Missense_Mutation_p.G512A	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	512	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GATGAAATGGGCCTAGGAAAG	0.388																																					p.G512A		Atlas-SNP	.											.	CHD2	280	.	0			c.G1535C						.						110.0	100.0	103.0					15																	93496619		2197	4298	6495	SO:0001583	missense	1106	exon14			AAATGGGCCTAGG	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1535G>C	chr15.hg19:g.93496619G>C	ENSP00000377747:p.Gly512Ala	95.0	0.0		131.0	43.0	NM_001271	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	hg19	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922732	0.92319	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.99811	-6.87;-6.87	5.41	5.41	0.78517	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.34853	U	0.003640	D	0.99912	0.9958	H	0.99820	4.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.95857	0.8880	10	0.87932	D	0	-14.9863	19.195	0.93684	0.0:0.0:1.0:0.0	.	512;512	O14647;O14647-2	CHD2_HUMAN;.	A	512	ENSP00000377747:G512A;ENSP00000451366:G512A	ENSP00000377747:G512A	G	+	2	0	CHD2	91297623	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.537000	0.85549	0.563000	0.77884	GGC	.	.		0.388	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
CHD2	1106	hgsc.bcm.edu	37	15	93567763	93567763	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr15:93567763A>G	ENST00000394196.4	+	39	6383	c.5315A>G	c.(5314-5316)gAa>gGa	p.E1772G		NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1772					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AAACTGGGGGAATATAAACAG	0.542																																					p.E1772G		Atlas-SNP	.											.	CHD2	280	.	0			c.A5315G						.						91.0	95.0	94.0					15																	93567763		1916	4130	6046	SO:0001583	missense	1106	exon39			TGGGGGAATATAA	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.5315A>G	chr15.hg19:g.93567763A>G	ENSP00000377747:p.Glu1772Gly	135.0	0.0		165.0	8.0	NM_001271	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	hg19	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370148	0.61624	.	.	ENSG00000173575	ENST00000394196	D	0.90004	-2.6	5.64	5.64	0.86602	.	.	.	.	.	T	0.79718	0.4494	N	0.08118	0	0.80722	D	1	B	0.14438	0.01	B	0.14023	0.01	T	0.74708	-0.3574	9	0.40728	T	0.16	-7.5698	16.1492	0.81602	1.0:0.0:0.0:0.0	.	1772	O14647	CHD2_HUMAN	G	1772	ENSP00000377747:E1772G	ENSP00000377747:E1772G	E	+	2	0	CHD2	91368767	1.000000	0.71417	0.935000	0.37517	0.930000	0.56654	6.361000	0.73070	2.272000	0.75746	0.460000	0.39030	GAA	.	.		0.542	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
MRPL28	10573	hgsc.bcm.edu	37	16	419990	419990	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr16:419990G>A	ENST00000199706.8	-	2	264	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W	MRPL28_ENST00000389675.2_Missense_Mutation_p.R77W|MRPL28_ENST00000429738.1_5'Flank	NM_006428.4	NP_006419.2	Q13084	RM28_HUMAN	mitochondrial ribosomal protein L28	77					translation (GO:0006412)	cytoplasm (GO:0005737)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)	5		Hepatocellular(16;0.000105)|Lung NSC(18;0.0324)|all_lung(18;0.064)				CACAACCCCCGCTGGGATTCG	0.627																																					p.R77W		Atlas-SNP	.											.	MRPL28	15	.	0			c.C229T						.						63.0	64.0	63.0					16																	419990		2200	4300	6500	SO:0001583	missense	10573	exon2			ACCCCCGCTGGGA	U19796	CCDS32349.1	16p13.12	2012-09-26	2002-11-13		ENSG00000086504	ENSG00000086504		"""Mitochondrial ribosomal proteins / large subunits"""	14484	protein-coding gene	gene with protein product		604853	"""melanoma-associated antigen recognised by cytotoxic T lymphocytes"""	MAAT1		11551941, 19753307	Standard	NM_006428		Approved	p15	uc002cgs.2	Q13084	OTTHUMG00000047994	ENST00000199706.8:c.229C>T	chr16.hg19:g.419990G>A	ENSP00000199706:p.Arg77Trp	80.0	0.0		45.0	9.0	NM_006428	B2RCM4|D3DU46|Q4TT39|Q96S26|Q9BQD8|Q9BR04	Missense_Mutation	SNP	ENST00000199706.8	hg19	CCDS32349.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.570957	0.45798	.	.	ENSG00000086504	ENST00000397735;ENST00000199706;ENST00000397734;ENST00000389675;ENST00000441883;ENST00000447696;ENST00000450882	T;T;T;T;T	0.33216	1.83;1.83;1.83;1.42;1.42	4.85	-1.07	0.09968	.	1.314600	0.05174	N	0.500007	T	0.33876	0.0878	L	0.55213	1.73	0.18873	N	0.999985	D;D;D	0.56521	0.976;0.976;0.976	P;P;P	0.49047	0.599;0.599;0.599	T	0.33033	-0.9884	10	0.72032	D	0.01	-7.5072	3.873	0.09044	0.293:0.0:0.3371:0.3699	.	77;77;77	A2IDC6;Q13084;Q4TT38	.;RM28_HUMAN;.	W	77	ENSP00000199706:R77W;ENSP00000374326:R77W;ENSP00000398684:R77W;ENSP00000390399:R77W;ENSP00000395305:R77W	ENSP00000199706:R77W	R	-	1	2	MRPL28	359991	0.041000	0.20044	0.552000	0.28243	0.195000	0.23768	0.405000	0.21015	0.107000	0.17824	0.655000	0.94253	CGG	.	.		0.627	MRPL28-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139285.2		
C16orf71	146562	hgsc.bcm.edu	37	16	4794959	4794959	+	Silent	SNP	G	G	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr16:4794959G>T	ENST00000299320.5	+	6	1468	c.990G>T	c.(988-990)cgG>cgT	p.R330R	C16orf71_ENST00000590191.1_Silent_p.R344R|RP11-127I20.7_ENST00000588099.1_RNA	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	330										breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						CTTGTGCCCGGAAGGTGCCTG	0.632																																					p.R330R		Atlas-SNP	.											.	C16orf71	46	.	0			c.G990T						.						55.0	49.0	51.0					16																	4794959		2197	4300	6497	SO:0001819	synonymous_variant	146562	exon6			TGCCCGGAAGGTG	AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.990G>T	chr16.hg19:g.4794959G>T		114.0	0.0		122.0	42.0	NM_139170	Q8NCV0	Silent	SNP	ENST00000299320.5	hg19	CCDS10521.1																																																																																			.	.		0.632	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251644.1	NM_139170	
TGFB1I1	7041	hgsc.bcm.edu	37	16	31488866	31488866	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr16:31488866G>A	ENST00000394863.3	+	11	1485	c.1355G>A	c.(1354-1356)tGc>tAc	p.C452Y	TGFB1I1_ENST00000567607.1_Missense_Mutation_p.C435Y|TGFB1I1_ENST00000394858.2_Missense_Mutation_p.C435Y|TGFB1I1_ENST00000361773.3_Missense_Mutation_p.C435Y	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	452	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						AAGCCCTACTGCCAGCCCTGC	0.711																																					p.C452Y		Atlas-SNP	.											.	TGFB1I1	60	.	0			c.G1355A						.						17.0	17.0	17.0					16																	31488866		2194	4300	6494	SO:0001583	missense	7041	exon11			CCTACTGCCAGCC	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.1355G>A	chr16.hg19:g.31488866G>A	ENSP00000378332:p.Cys452Tyr	111.0	0.0		91.0	30.0	NM_001042454	B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	hg19	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	G	33	5.221116	0.95139	.	.	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	D;D;D	0.99319	-5.74;-5.74;-5.74	5.11	5.11	0.69529	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.99764	0.9904	H	0.99867	4.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96702	0.9519	10	0.87932	D	0	.	16.3886	0.83524	0.0:0.0:1.0:0.0	.	452	O43294	TGFI1_HUMAN	Y	452;435;435	ENSP00000378332:C452Y;ENSP00000355117:C435Y;ENSP00000378327:C435Y	ENSP00000355117:C435Y	C	+	2	0	TGFB1I1	31396367	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.908000	0.87438	2.539000	0.85634	0.491000	0.48974	TGC	.	.		0.711	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3		
ZDHHC1	29800	hgsc.bcm.edu	37	16	67440191	67440191	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr16:67440191G>A	ENST00000348579.2	-	3	505	c.164C>T	c.(163-165)gCc>gTc	p.A55V		NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	55					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		CAGCAGCCAGGCCACAATCTG	0.657																																					p.A55V		Atlas-SNP	.											.	ZDHHC1	28	.	0			c.C164T						.						49.0	35.0	40.0					16																	67440191		2196	4298	6494	SO:0001583	missense	29800	exon3			AGCCAGGCCACAA	U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.164C>T	chr16.hg19:g.67440191G>A	ENSP00000340299:p.Ala55Val	252.0	0.0		250.0	104.0	NM_013304	O15461	Missense_Mutation	SNP	ENST00000348579.2	hg19	CCDS10836.1	.	.	.	.	.	.	.	.	.	.	G	35	5.556830	0.96514	.	.	ENSG00000159714	ENST00000348579	T	0.40476	1.03	5.25	5.25	0.73442	.	0.089010	0.47852	D	0.000205	T	0.62171	0.2406	L	0.61218	1.895	0.58432	D	0.999992	D	0.67145	0.996	D	0.67725	0.953	T	0.65063	-0.6259	10	0.72032	D	0.01	.	17.8255	0.88664	0.0:0.0:1.0:0.0	.	55	Q8WTX9	ZDHC1_HUMAN	V	55	ENSP00000340299:A55V	ENSP00000340299:A55V	A	-	2	0	ZDHHC1	65997692	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.299000	0.72770	2.463000	0.83235	0.561000	0.74099	GCC	.	.		0.657	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268845.1	NM_013304	
EIF5A	1984	hgsc.bcm.edu	37	17	7212975	7212975	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr17:7212975C>G	ENST00000336458.8	+	2	422	c.21C>G	c.(19-21)ttC>ttG	p.F7L	EIF5A_ENST00000571955.1_Missense_Mutation_p.F7L|EIF5A_ENST00000419711.2_Missense_Mutation_p.F7L|EIF5A_ENST00000416016.2_Missense_Mutation_p.F7L|EIF5A_ENST00000576930.1_Missense_Mutation_p.F7L|EIF5A_ENST00000336452.7_Missense_Mutation_p.F37L|EIF5A_ENST00000573542.1_Missense_Mutation_p.F7L|EIF5A_ENST00000572815.1_Missense_Mutation_p.F7L	NM_001970.4	NP_001961.1	P63241	IF5A1_HUMAN	eukaryotic translation initiation factor 5A	7					apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|mRNA export from nucleus (GO:0006406)|nucleocytoplasmic transport (GO:0006913)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of translational elongation (GO:0045901)|positive regulation of translational termination (GO:0045905)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|translational frameshifting (GO:0006452)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation elongation factor activity (GO:0003746)|U6 snRNA binding (GO:0017070)			endometrium(2)|kidney(1)|large_intestine(2)|urinary_tract(1)	6						ACTTGGACTTCGAGACAGGAG	0.498																																					p.F37L		Atlas-SNP	.											EIF5A_ENST00000336452,NS,carcinoma,0,2	EIF5A	28	.	0			c.C111G						.						182.0	174.0	177.0					17																	7212975		2203	4300	6503	SO:0001583	missense	1984	exon2			GGACTTCGAGACA		CCDS11099.1, CCDS45601.1	17p13-p12	2009-05-01			ENSG00000132507	ENSG00000132507			3300	protein-coding gene	gene with protein product		600187				7759117	Standard	NM_001143760		Approved	EIF5A1, EIF-5A, MGC99547, MGC104255	uc002gfr.3	P63241	OTTHUMG00000102197	ENST00000336458.8:c.21C>G	chr17.hg19:g.7212975C>G	ENSP00000336776:p.Phe7Leu	65.0	0.0		66.0	14.0	NM_001143760	A8K9A0|D3DTP2|P10159|Q16182|Q7L7L3|Q7Z4L1|Q9D0G2	Missense_Mutation	SNP	ENST00000336458.8	hg19	CCDS11099.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.41|17.41	3.383433|3.383433	0.61845|0.61845	.|.	.|.	ENSG00000132507|ENSG00000132507	ENST00000336452;ENST00000336458;ENST00000419711;ENST00000416016|ENST00000355068	T;T;T;T|.	0.60797|.	0.16;0.24;0.24;0.24|.	4.13|4.13	4.13|4.13	0.48395|0.48395	.|.	0.074706|.	0.53938|.	D|.	0.000060|.	D|D	0.84593|0.84593	0.5506|0.5506	M|M	0.92219|0.92219	3.285|3.285	0.58432|0.58432	D|D	0.999999|0.999999	B;B|.	0.28082|.	0.048;0.2|.	B;B|.	0.35470|.	0.06;0.203|.	D|D	0.89063|0.89063	0.3464|0.3464	10|6	0.72032|0.87932	D|D	0.01|0	-13.7541|-13.7541	15.3285|15.3285	0.74186|0.74186	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	7;37|.	P63241;P63241-2|.	IF5A1_HUMAN;.|.	L|W	37;7;7;7|5	ENSP00000336702:F37L;ENSP00000336776:F7L;ENSP00000390677:F7L;ENSP00000396073:F7L|.	ENSP00000336702:F37L|ENSP00000347180:S5W	F|S	+|+	3|2	2|0	EIF5A|EIF5A	7153699|7153699	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	4.359000|4.359000	0.59449|0.59449	2.149000|2.149000	0.67028|0.67028	0.385000|0.385000	0.25706|0.25706	TTC|TCG	.	.		0.498	EIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220047.3	NM_001970	
MYH3	4621	hgsc.bcm.edu	37	17	10535931	10535931	+	Silent	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr17:10535931C>T	ENST00000583535.1	-	34	4905	c.4818G>A	c.(4816-4818)gtG>gtA	p.V1606V	MYH3_ENST00000226209.7_Silent_p.V1606V	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1606					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCCTGCTCCGCACCTCGGCGT	0.567																																					p.V1606V		Atlas-SNP	.											.	MYH3	227	.	0			c.G4818A						.						247.0	240.0	243.0					17																	10535931		2203	4300	6503	SO:0001819	synonymous_variant	4621	exon34			GCTCCGCACCTCG		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4818G>A	chr17.hg19:g.10535931C>T		69.0	0.0		58.0	20.0	NM_002470	Q15492	Silent	SNP	ENST00000583535.1	hg19	CCDS11157.1																																																																																			.	.		0.567	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
COG1	9382	hgsc.bcm.edu	37	17	71197399	71197399	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr17:71197399A>T	ENST00000299886.4	+	7	1513	c.1433A>T	c.(1432-1434)gAg>gTg	p.E478V		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	478					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			CTCTGGTCTGAGAGTCCTAAT	0.532																																					p.E478V		Atlas-SNP	.											.	COG1	46	.	0			c.A1433T						.						166.0	149.0	154.0					17																	71197399		2203	4300	6503	SO:0001583	missense	9382	exon7			GGTCTGAGAGTCC		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1433A>T	chr17.hg19:g.71197399A>T	ENSP00000299886:p.Glu478Val	88.0	0.0		141.0	74.0	NM_018714	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	ENST00000299886.4	hg19	CCDS11692.1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.748012	0.49257	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.43688	0.94;0.96	5.28	5.28	0.74379	.	0.048522	0.85682	D	0.000000	T	0.65450	0.2692	M	0.77616	2.38	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.992;0.992	T	0.68659	-0.5350	10	0.52906	T	0.07	-30.2295	15.5073	0.75750	1.0:0.0:0.0:0.0	.	478;478;478	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	V	478	ENSP00000400111:E478V;ENSP00000299886:E478V	ENSP00000299886:E478V	E	+	2	0	COG1	68708994	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.718000	0.91430	2.120000	0.65058	0.533000	0.62120	GAG	.	.		0.532	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
RECQL5	9400	hgsc.bcm.edu	37	17	73625530	73625530	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr17:73625530C>A	ENST00000317905.5	-	16	2132	c.1973G>T	c.(1972-1974)gGt>gTt	p.G658V	RECQL5_ENST00000423245.2_Missense_Mutation_p.G631V|RECQL5_ENST00000443199.2_5'UTR	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	658	Interaction with RAD51.				chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TTTGGGGAAACCAGCTCCCAC	0.637								Other identified genes with known or suspected DNA repair function																													p.G658V		Atlas-SNP	.											.	RECQL5	77	.	0			c.G1973T						.						24.0	26.0	25.0					17																	73625530		1937	4097	6034	SO:0001583	missense	9400	exon16			GGGAAACCAGCTC	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1973G>T	chr17.hg19:g.73625530C>A	ENSP00000317636:p.Gly658Val	113.0	0.0		152.0	42.0	NM_004259	Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	ENST00000317905.5	hg19	CCDS42380.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.737913	0.49045	.	.	ENSG00000108469	ENST00000443199;ENST00000423245;ENST00000317905	T	0.61980	0.06	4.96	4.96	0.65561	RecQ helicase-like 5 (2);	0.000000	0.85682	D	0.000000	T	0.77850	0.4192	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.78914	-0.2016	10	0.54805	T	0.06	-14.4253	17.3728	0.87383	0.0:1.0:0.0:0.0	.	658;631	O94762;Q6P4G0	RECQ5_HUMAN;.	V	253;658;658	ENSP00000317636:G658V	ENSP00000317636:G658V	G	-	2	0	RECQL5	71137125	0.998000	0.40836	1.000000	0.80357	0.950000	0.60333	3.825000	0.55730	2.564000	0.86499	0.561000	0.74099	GGT	.	.		0.637	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259	
UNC13D	201294	hgsc.bcm.edu	37	17	73831523	73831523	+	Silent	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr17:73831523C>A	ENST00000207549.4	-	20	2194	c.1815G>T	c.(1813-1815)ctG>ctT	p.L605L	UNC13D_ENST00000412096.2_Silent_p.L605L	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	605	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCACCCGCGCCAGGGCCTCGT	0.687									Familial Hemophagocytic Lymphohistiocytosis																												p.L605L		Atlas-SNP	.											.	UNC13D	68	.	0			c.G1815T						.						28.0	30.0	30.0					17																	73831523		2202	4299	6501	SO:0001819	synonymous_variant	201294	exon20	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	CCGCGCCAGGGCC	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.1815G>T	chr17.hg19:g.73831523C>A		97.0	0.0		117.0	52.0	NM_199242	B4DWG9|Q9H7K5	Silent	SNP	ENST00000207549.4	hg19	CCDS11730.1																																																																																			.	.		0.687	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
MFSD11	79157	hgsc.bcm.edu	37	17	74737143	74737143	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr17:74737143A>T	ENST00000588460.1	+	3	2299	c.257A>T	c.(256-258)tAc>tTc	p.Y86F	MFSD11_ENST00000336509.4_Missense_Mutation_p.Y86F|MFSD11_ENST00000586622.1_Missense_Mutation_p.Y86F|MFSD11_ENST00000355954.3_Missense_Mutation_p.Y86F|MFSD11_ENST00000590514.1_Missense_Mutation_p.Y86F|MFSD11_ENST00000593181.1_Missense_Mutation_p.Y86F	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	86						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						GGTTTATTTTACAGGTAAGTA	0.358																																					p.Y86F		Atlas-SNP	.											.	MFSD11	47	.	0			c.A257T						.						182.0	169.0	173.0					17																	74737143		2203	4300	6503	SO:0001583	missense	79157	exon4			TATTTTACAGGTA	BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.257A>T	chr17.hg19:g.74737143A>T	ENSP00000464932:p.Tyr86Phe	76.0	0.0		82.0	18.0	NM_001242536	O43442|Q9NXI5	Missense_Mutation	SNP	ENST00000588460.1	hg19	CCDS11750.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.322317	0.81580	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	T;T	0.46451	0.87;0.87	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);	0.054484	0.85682	D	0.000000	T	0.59211	0.2177	M	0.84585	2.705	0.80722	D	1	B;B	0.34181	0.157;0.44	B;B	0.43575	0.079;0.424	T	0.64542	-0.6383	10	0.87932	D	0	-17.0347	16.1429	0.81539	1.0:0.0:0.0:0.0	.	86;86	O43934-2;O43934	.;MFS11_HUMAN	F	86	ENSP00000337240:Y86F;ENSP00000348225:Y86F	ENSP00000337240:Y86F	Y	+	2	0	MFSD11	72248738	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.952000	0.93031	2.209000	0.71365	0.460000	0.39030	TAC	.	.		0.358	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451516.1	NM_024311	
AATK	9625	hgsc.bcm.edu	37	17	79093268	79093268	+	Silent	SNP	A	A	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr17:79093268A>C	ENST00000326724.4	-	13	4020	c.3996T>G	c.(3994-3996)gcT>gcG	p.A1332A	AATK_ENST00000417379.1_Silent_p.A1229A	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1332			A -> T (in dbSNP:rs55713566). {ECO:0000269|PubMed:17344846}.		brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GCGAGAAGGGAGCGGGCGTGG	0.716																																					p.A1332A		Atlas-SNP	.											.	AATK	102	.	0			c.T3996G						.						16.0	21.0	19.0					17																	79093268		2003	4121	6124	SO:0001819	synonymous_variant	9625	exon13			GAAGGGAGCGGGC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3996T>G	chr17.hg19:g.79093268A>C		94.0	0.0		150.0	9.0	NM_001080395	O75136|Q6ZN31|Q86X28	Silent	SNP	ENST00000326724.4	hg19	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	A	4.811	0.150783	0.09185	.	.	ENSG00000181409	ENST00000417379	.	.	.	3.45	-2.73	0.05950	.	.	.	.	.	T	0.51329	0.1668	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46034	-0.9220	4	.	.	.	.	7.6594	0.28394	0.4346:0.4849:0.0:0.0805	.	.	.	.	R	1285	.	.	L	-	2	0	AATK	76707863	0.000000	0.05858	0.023000	0.16930	0.123000	0.20343	-0.097000	0.11042	-0.530000	0.06349	-1.015000	0.02457	CTC	.	.		0.716	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
TGIF1	7050	hgsc.bcm.edu	37	18	3447754	3447754	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr18:3447754A>G	ENST00000548489.2	+	1	148	c.17A>G	c.(16-18)aAa>aGa	p.K6R	TGIF1_ENST00000401449.1_Intron|TGIF1_ENST00000405385.3_5'Flank|TGIF1_ENST00000551402.1_5'Flank|TGIF1_ENST00000407501.2_5'Flank|TGIF1_ENST00000577543.1_5'Flank|TGIF1_ENST00000343820.5_5'Flank	NM_173207.1	NP_775299.1	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	0					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				TGCTCGGGCAAAAGTTGTGCA	0.478																																					p.K6R		Atlas-SNP	.											.	TGIF1	41	.	0			c.A17G						.						132.0	123.0	126.0					18																	3447754		2203	4300	6503	SO:0001583	missense	7050	exon1			CGGGCAAAAGTTG	X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000548489.2:c.17A>G	chr18.hg19:g.3447754A>G	ENSP00000447747:p.Lys6Arg	108.0	0.0		135.0	51.0	NM_173207	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Missense_Mutation	SNP	ENST00000548489.2	hg19	CCDS11832.1	.	.	.	.	.	.	.	.	.	.	A	1.121	-0.655391	0.03480	.	.	ENSG00000177426	ENST00000548489	T	0.51325	0.71	4.77	-0.678	0.11353	.	.	.	.	.	T	0.24736	0.0600	.	.	.	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.26052	-1.0114	8	0.12430	T	0.62	.	7.8993	0.29725	0.5129:0.0:0.4871:0.0	.	6	F8VZB6	.	R	6	ENSP00000447747:K6R	ENSP00000447747:K6R	K	+	2	0	TGIF1	3437754	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.284000	0.18864	-0.178000	0.10672	-0.874000	0.02982	AAA	.	.		0.478	TGIF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254366.4	NM_170695	
LAMA3	3909	hgsc.bcm.edu	37	18	21441694	21441694	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr18:21441694G>A	ENST00000313654.9	+	35	4748	c.4507G>A	c.(4507-4509)Gtg>Atg	p.V1503M	LAMA3_ENST00000399516.3_Missense_Mutation_p.V1503M	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1503	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CAACAGTATGGTGGCGGATCT	0.582																																					p.V1503M		Atlas-SNP	.											.	LAMA3	397	.	0			c.G4507A						.						45.0	48.0	47.0					18																	21441694		2022	4192	6214	SO:0001583	missense	3909	exon35			AGTATGGTGGCGG	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4507G>A	chr18.hg19:g.21441694G>A	ENSP00000324532:p.Val1503Met	63.0	0.0		85.0	33.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	hg19	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471510	0.63737	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.20200	2.09;2.09	5.5	5.5	0.81552	Laminin B type IV (1);Growth factor, receptor (1);	.	.	.	.	T	0.45397	0.1340	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.67725	0.953;0.915	T	0.14587	-1.0467	9	0.34782	T	0.22	.	19.3976	0.94612	0.0:0.0:1.0:0.0	.	1503;1503	Q6VU67;Q16787	.;LAMA3_HUMAN	M	1503;1503;1501	ENSP00000324532:V1503M;ENSP00000382432:V1503M	ENSP00000324532:V1503M	V	+	1	0	LAMA3	19695692	1.000000	0.71417	0.820000	0.32676	0.356000	0.29392	9.125000	0.94402	2.580000	0.87095	0.555000	0.69702	GTG	.	.		0.582	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
PPAP2C	8612	hgsc.bcm.edu	37	19	287716	287716	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:287716G>A	ENST00000269812.3	-	3	289	c.240C>T	c.(238-240)gaC>gaT	p.D80D	PPAP2C_ENST00000327790.3_Silent_p.D101D|PPAP2C_ENST00000434325.2_Silent_p.D24D	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	80					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AATAGAGCCGGTCTGTGTACA	0.627																																					p.D101D		Atlas-SNP	.											.	PPAP2C	38	.	0			c.C303T						.						158.0	178.0	171.0					19																	287716		2203	4300	6503	SO:0001819	synonymous_variant	8612	exon3			GAGCCGGTCTGTG	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.240C>T	chr19.hg19:g.287716G>A		113.0	0.0		82.0	22.0	NM_177543	A6NLV0|E9PAY8	Silent	SNP	ENST00000269812.3	hg19	CCDS12023.1																																																																																			.	.		0.627	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2		
CAMSAP3	57662	hgsc.bcm.edu	37	19	7670161	7670161	+	Silent	SNP	G	G	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:7670161G>T	ENST00000160298.4	+	2	299	c.198G>T	c.(196-198)gcG>gcT	p.A66A	CAMSAP3_ENST00000446248.2_Silent_p.A66A	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	66					epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						ACCAGTACGCGCAGGAGCATG	0.637																																					p.A66A		Atlas-SNP	.											.	CAMSAP3	131	.	0			c.G198T						.						105.0	114.0	111.0					19																	7670161		1998	4152	6150	SO:0001819	synonymous_variant	57662	exon2			GTACGCGCAGGAG	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.198G>T	chr19.hg19:g.7670161G>T		173.0	0.0		138.0	50.0	NM_020902	Q8NDF1	Silent	SNP	ENST00000160298.4	hg19	CCDS42489.1																																																																																			.	.		0.637	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459300.1	XM_048362	
CACNA1A	773	hgsc.bcm.edu	37	19	13409467	13409467	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:13409467C>G	ENST00000360228.5	-	19	2979	c.2980G>C	c.(2980-2982)Gag>Cag	p.E994Q	CACNA1A_ENST00000573710.2_Missense_Mutation_p.E995Q	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	995					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	tcggggccctcgccctcgccc	0.791																																					p.E995Q		Atlas-SNP	.											.	CACNA1A	715	.	0			c.G2983C						.						12.0	11.0	11.0					19																	13409467		1280	2619	3899	SO:0001583	missense	773	exon19			GGCCCTCGCCCTC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2980G>C	chr19.hg19:g.13409467C>G	ENSP00000353362:p.Glu994Gln	110.0	0.0		158.0	7.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	hg19	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600130	0.28534	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.95980	-3.87	1.91	1.91	0.25777	.	26.724300	0.00714	N	0.000849	D	0.95322	0.8482	L	0.54323	1.7	0.28666	N	0.905881	B;B;D	0.56521	0.199;0.3;0.976	B;B;P	0.51266	0.057;0.079;0.664	D	0.87459	0.2406	10	0.23302	T	0.38	.	9.8436	0.41013	0.0:1.0:0.0:0.0	.	995;998;994	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	Q	994;998;995;995	ENSP00000353362:E994Q	ENSP00000317661:E995Q	E	-	1	0	CACNA1A	13270467	0.000000	0.05858	0.977000	0.42913	0.760000	0.43138	0.548000	0.23314	1.389000	0.46526	0.407000	0.27541	GAG	.	.		0.791	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
NCAN	1463	hgsc.bcm.edu	37	19	19345806	19345806	+	Missense_Mutation	SNP	C	C	G	rs374113750		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:19345806C>G	ENST00000252575.6	+	10	3250	c.3151C>G	c.(3151-3153)Ctc>Gtc	p.L1051V	RNU6-1028P_ENST00000517164.1_RNA|NCAN_ENST00000538881.1_Missense_Mutation_p.L502V	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1051	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	TGATGACTGCCTCTGCAGCCC	0.547																																					p.L1051V		Atlas-SNP	.											.	NCAN	277	.	0			c.C3151G						.						145.0	113.0	124.0					19																	19345806		2203	4300	6503	SO:0001583	missense	1463	exon10			GACTGCCTCTGCA	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3151C>G	chr19.hg19:g.19345806C>G	ENSP00000252575:p.Leu1051Val	59.0	0.0		53.0	16.0	NM_004386	Q9UPK6	Missense_Mutation	SNP	ENST00000252575.6	hg19	CCDS12397.1	.	.	.	.	.	.	.	.	.	.	C	10.42	1.345916	0.24426	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.98437	-4.93;-4.93	4.53	-9.07	0.00724	EGF-like calcium-binding, conserved site (1);EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	2.104420	0.02849	N	0.128956	D	0.93838	0.8029	L	0.43701	1.375	0.09310	N	1	B;B	0.15473	0.013;0.001	B;B	0.04013	0.001;0.001	D	0.87967	0.2734	10	0.12103	T	0.63	-0.8526	3.2716	0.06884	0.3516:0.3929:0.1576:0.0979	.	1065;1051	Q4LE67;O14594	.;NCAN_HUMAN	V	1065;1051;502	ENSP00000252575:L1051V;ENSP00000442202:L502V	ENSP00000252575:L1051V	L	+	1	0	NCAN	19206806	0.000000	0.05858	0.005000	0.12908	0.952000	0.60782	-0.070000	0.11523	-1.346000	0.02211	-0.340000	0.08031	CTC	.	.		0.547	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460111.2	NM_004386	
PLD3	23646	hgsc.bcm.edu	37	19	40875888	40875888	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:40875888C>G	ENST00000409587.1	+	7	900	c.503C>G	c.(502-504)cCc>cGc	p.P168R	PLD3_ENST00000409281.1_Missense_Mutation_p.P168R|PLD3_ENST00000409735.4_Missense_Mutation_p.P168R|PLD3_ENST00000409419.1_Missense_Mutation_p.P168R|PLD3_ENST00000356508.5_Missense_Mutation_p.P168R			Q8IV08	PLD3_HUMAN	phospholipase D family, member 3	168					cell death (GO:0008219)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phospholipase D activity (GO:0004630)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			GTGAGCAAGCCCAGCGGGCCC	0.706																																					p.P168R		Atlas-SNP	.											.	PLD3	71	.	0			c.C503G						.						6.0	7.0	6.0					19																	40875888		2147	4205	6352	SO:0001583	missense	23646	exon7			GCAAGCCCAGCGG	BC000553	CCDS33027.1	19q13.2	2014-03-14	2005-05-20		ENSG00000105223	ENSG00000105223			17158	protein-coding gene	gene with protein product		615698	"""phospholipase D3"""			9140189, 15794758	Standard	XM_005258704		Approved	HU-K4	uc002onj.4	Q8IV08	OTTHUMG00000152736	ENST00000409587.1:c.503C>G	chr19.hg19:g.40875888C>G	ENSP00000387050:p.Pro168Arg	97.0	0.0		95.0	34.0	NM_012268	Q92853|Q9BW87	Missense_Mutation	SNP	ENST00000409587.1	hg19	CCDS33027.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.303947	0.81136	.	.	ENSG00000105223	ENST00000409419;ENST00000409587;ENST00000356508;ENST00000536031;ENST00000409735;ENST00000409281;ENST00000359274	T;T;T;T;T;T	0.62639	0.75;0.75;0.75;0.75;0.75;0.01	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.72645	0.3486	M	0.67700	2.07	0.58432	D	0.999997	P	0.44816	0.844	P	0.53809	0.735	T	0.72537	-0.4263	10	0.49607	T	0.09	-24.985	15.5311	0.75964	0.0:1.0:0.0:0.0	.	168	Q8IV08	PLD3_HUMAN	R	168;168;168;149;168;168;168	ENSP00000386293:P168R;ENSP00000387050:P168R;ENSP00000348901:P168R;ENSP00000386938:P168R;ENSP00000387022:P168R;ENSP00000352220:P168R	ENSP00000348901:P168R	P	+	2	0	PLD3	45567728	0.995000	0.38212	0.985000	0.45067	0.951000	0.60555	3.361000	0.52306	2.728000	0.93425	0.561000	0.74099	CCC	.	.		0.706	PLD3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327721.1	NM_012268	
SIGLEC8	27181	hgsc.bcm.edu	37	19	51958750	51958750	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:51958750C>A	ENST00000321424.3	-	4	1039	c.973G>T	c.(973-975)Gaa>Taa	p.E325*	SIGLEC8_ENST00000430817.1_Nonsense_Mutation_p.E216*|SIGLEC8_ENST00000597352.1_5'UTR|SIGLEC8_ENST00000340550.5_Nonsense_Mutation_p.E232*	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	325	Ig-like C2-type 2.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAGGTGAATTCCCCTTCATCC	0.647																																					p.E325X		Atlas-SNP	.											.	SIGLEC8	130	.	0			c.G973T						.						56.0	54.0	55.0					19																	51958750		2203	4300	6503	SO:0001587	stop_gained	27181	exon4			TGAATTCCCCTTC	AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.973G>T	chr19.hg19:g.51958750C>A	ENSP00000321077:p.Glu325*	125.0	0.0		131.0	41.0	NM_014442	Q7Z728	Nonsense_Mutation	SNP	ENST00000321424.3	hg19	CCDS33086.1	.	.	.	.	.	.	.	.	.	.	.	16.84	3.232812	0.58777	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	.	.	.	2.19	-0.738	0.11125	.	0.417856	0.17378	N	0.176395	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	5.1668	0.15090	0.0:0.648:0.0:0.352	.	.	.	.	X	216;325;232	.	ENSP00000321077:E325X	E	-	1	0	SIGLEC8	56650562	0.000000	0.05858	0.000000	0.03702	0.159000	0.22180	-0.585000	0.05794	-0.136000	0.11475	0.502000	0.49764	GAA	.	.		0.647	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463648.2	NM_014442	
ZNF468	90333	hgsc.bcm.edu	37	19	53344837	53344837	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:53344837T>G	ENST00000595646.1	-	4	830	c.710A>C	c.(709-711)cAc>cCc	p.H237P	ZNF468_ENST00000390651.4_Missense_Mutation_p.H184P|ZNF468_ENST00000396409.4_Missense_Mutation_p.H184P|ZNF468_ENST00000243639.4_3'UTR|ZNF28_ENST00000594602.1_Intron			Q5VIY5	ZN468_HUMAN	zinc finger protein 468	237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(3)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(134;0.0358)		CTCTTCTAAGTGAATTATCTG	0.363																																					p.H237P		Atlas-SNP	.											.	ZNF468	46	.	0			c.A710C						.						88.0	78.0	82.0					19																	53344837		2203	4300	6503	SO:0001583	missense	90333	exon4			TCTAAGTGAATTA	AK023558	CCDS33094.1, CCDS62781.1	19q13.41	2013-01-08				ENSG00000204604		"""Zinc fingers, C2H2-type"", ""-"""	33105	protein-coding gene	gene with protein product						16144304	Standard	NM_001277120		Approved		uc002qaf.3	Q5VIY5		ENST00000595646.1:c.710A>C	chr19.hg19:g.53344837T>G	ENSP00000470381:p.His237Pro	52.0	0.0		91.0	33.0	NM_001008801	A8MV20|Q5CZB8|Q5VIY4|Q68DI7	Missense_Mutation	SNP	ENST00000595646.1	hg19	CCDS33094.1	.	.	.	.	.	.	.	.	.	.	t	6.825	0.521427	0.13005	.	.	ENSG00000204604	ENST00000243639;ENST00000396409;ENST00000390651	T;T	0.67698	-0.28;-0.28	1.83	-0.595	0.11660	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.82949	0.5148	H	0.94808	3.585	0.09310	N	1	P	0.52577	0.954	D	0.74674	0.984	T	0.70766	-0.4783	9	0.87932	D	0	.	5.6836	0.17790	0.0:0.2901:0.0:0.7099	.	237	Q5VIY5	ZN468_HUMAN	P	237;184;184	ENSP00000379690:H184P;ENSP00000445669:H184P	ENSP00000243639:H237P	H	-	2	0	ZNF468	58036649	0.938000	0.31826	0.000000	0.03702	0.043000	0.13939	2.470000	0.45119	-0.423000	0.07394	0.341000	0.21757	CAC	.	.		0.363	ZNF468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463098.1	NM_001008801	
ZNF347	84671	hgsc.bcm.edu	37	19	53645787	53645787	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:53645787C>T	ENST00000334197.7	-	5	362	c.294G>A	c.(292-294)atG>atA	p.M98I	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.M99I|ZNF347_ENST00000452676.2_Missense_Mutation_p.M99I	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		GTAAATCTTTCATTACAAATT	0.338																																					p.M99I	Melanoma(64;205 1597 17324 45721)	Atlas-SNP	.											.	ZNF347	87	.	0			c.G297A						.						41.0	38.0	39.0					19																	53645787		2203	4298	6501	SO:0001583	missense	84671	exon5			ATCTTTCATTACA	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.294G>A	chr19.hg19:g.53645787C>T	ENSP00000334146:p.Met98Ile	42.0	0.0		64.0	14.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	hg19	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.739872	0.00675	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.05925	3.37;3.37	3.05	-6.11	0.02131	.	.	.	.	.	T	0.02688	0.0081	N	0.12961	0.28	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.45175	-0.9279	9	0.27785	T	0.31	.	2.3291	0.04231	0.1129:0.4026:0.1984:0.286	.	99;98	G5E9N4;Q96SE7	.;ZN347_HUMAN	I	98;99	ENSP00000334146:M98I;ENSP00000405218:M99I	ENSP00000334146:M98I	M	-	3	0	ZNF347	58337599	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.635000	0.05471	-0.823000	0.04301	-1.058000	0.02302	ATG	.	.		0.338	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
SIRPG	55423	hgsc.bcm.edu	37	20	1629706	1629706	+	Missense_Mutation	SNP	G	G	A	rs370649250		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr20:1629706G>A	ENST00000303415.3	-	2	486	c.422C>T	c.(421-423)gCt>gTt	p.A141V	SIRPG_ENST00000381580.1_Missense_Mutation_p.A108V|SIRPG_ENST00000216927.4_Missense_Mutation_p.A141V|SIRPG_ENST00000381583.2_Missense_Mutation_p.A141V|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000344103.4_Missense_Mutation_p.A141V	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	141					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						ACCACCCAAAGCCATCTCAGT	0.483																																					p.A141V		Atlas-SNP	.											.	SIRPG	61	.	0			c.C422T						.	G	VAL/ALA,VAL/ALA,VAL/ALA	1,4405		0,1,2202	193.0	173.0	180.0		422,422,422	1.9	0.0	20		180	0,8600		0,0,4300	no	missense,missense,missense	SIRPG	NM_001039508.1,NM_018556.3,NM_080816.2	64,64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	141/277,141/388,141/171	1629706	1,13005	2203	4300	6503	SO:0001583	missense	55423	exon2			CCCAAAGCCATCT	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.422C>T	chr20.hg19:g.1629706G>A	ENSP00000305529:p.Ala141Val	51.0	0.0		112.0	40.0	NM_001039508	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	hg19	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	8.940	0.965641	0.18583	2.27E-4	0.0	ENSG00000089012	ENST00000381580;ENST00000344103;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T;T	0.02140	4.43;4.52;4.43;4.43;4.43	1.93	1.93	0.25924	Immunoglobulin-like fold (1);	0.313450	0.27664	N	0.018373	T	0.01124	0.0037	N	0.14661	0.345	0.09310	N	1	P;B;B	0.42973	0.796;0.072;0.005	B;B;B	0.29942	0.109;0.011;0.008	T	0.55755	-0.8091	10	0.30854	T	0.27	.	7.3585	0.26733	0.0:0.0:1.0:0.0	.	141;141;141	Q9P1W8-3;Q9P1W8-4;Q9P1W8	.;.;SIRPG_HUMAN	V	108;141;141;141;141	ENSP00000370992:A108V;ENSP00000342759:A141V;ENSP00000305529:A141V;ENSP00000370995:A141V;ENSP00000216927:A141V	ENSP00000216927:A141V	A	-	2	0	SIRPG	1577706	0.002000	0.14202	0.027000	0.17364	0.160000	0.22226	0.181000	0.16880	1.392000	0.46585	0.195000	0.17529	GCT	.	.		0.483	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
TSHZ2	128553	hgsc.bcm.edu	37	20	51870043	51870043	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr20:51870043G>A	ENST00000371497.5	+	2	933	c.46G>A	c.(46-48)Gcc>Acc	p.A16T	TSHZ2_ENST00000329613.6_Missense_Mutation_p.A13T|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.A13T	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	16					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TGCAGGCTACGCCCaggagga	0.493																																					p.A16T		Atlas-SNP	.											.	TSHZ2	209	.	0			c.G46A						.						31.0	34.0	33.0					20																	51870043		2203	4299	6502	SO:0001583	missense	128553	exon2			GGCTACGCCCAGG	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.46G>A	chr20.hg19:g.51870043G>A	ENSP00000360552:p.Ala16Thr	23.0	0.0		44.0	16.0	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	ENST00000371497.5	hg19	CCDS33490.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768954	0.49680	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.14022	2.54;2.54	5.7	5.7	0.88788	.	0.478642	0.23593	N	0.046538	T	0.09905	0.0243	N	0.22421	0.69	0.58432	D	0.999991	B	0.32382	0.368	B	0.17098	0.017	T	0.08534	-1.0717	10	0.72032	D	0.01	-18.5526	14.6446	0.68751	0.0:0.0:0.8545:0.1455	.	16	Q9NRE2	TSH2_HUMAN	T	16;13	ENSP00000360552:A16T;ENSP00000333114:A13T	ENSP00000333114:A13T	A	+	1	0	TSHZ2	51303450	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	4.076000	0.57591	2.685000	0.91497	0.643000	0.83706	GCC	.	.		0.493	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
ZNF512B	57473	hgsc.bcm.edu	37	20	62592718	62592718	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr20:62592718T>G	ENST00000450537.1	-	16	2431	c.2371A>C	c.(2371-2373)Aag>Cag	p.K791Q	ZNF512B_ENST00000217130.3_Missense_Mutation_p.K791Q|ZNF512B_ENST00000369888.1_Missense_Mutation_p.K791Q			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	791					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CTGAACTCCTTCGGACACAGC	0.622																																					p.K791Q		Atlas-SNP	.											.	ZNF512B	72	.	0			c.A2371C						.						109.0	96.0	101.0					20																	62592718		2202	4300	6502	SO:0001583	missense	57473	exon16			ACTCCTTCGGACA	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2371A>C	chr20.hg19:g.62592718T>G	ENSP00000393795:p.Lys791Gln	33.0	0.0		32.0	12.0	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	hg19	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.616739	0.87359	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.26660	1.72;1.72;1.72	5.23	5.23	0.72850	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.85682	D	0.000000	T	0.46737	0.1408	L	0.55990	1.75	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.42666	-0.9438	10	0.56958	D	0.05	-25.2861	15.1094	0.72343	0.0:0.0:0.0:1.0	.	791	Q96KM6	Z512B_HUMAN	Q	791	ENSP00000358904:K791Q;ENSP00000393795:K791Q;ENSP00000217130:K791Q	ENSP00000217130:K791Q	K	-	1	0	ZNF512B	62063162	1.000000	0.71417	0.968000	0.41197	0.801000	0.45260	5.962000	0.70364	1.981000	0.57761	0.482000	0.46254	AAG	.	.		0.622	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
CLDN14	23562	hgsc.bcm.edu	37	21	37833541	37833541	+	Silent	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr21:37833541C>T	ENST00000399137.1	-	3	1319	c.453G>A	c.(451-453)ctG>ctA	p.L151L	AP000695.6_ENST00000429588.1_RNA|CLDN14_ENST00000399136.1_Silent_p.L151L|CLDN14_ENST00000342108.2_Silent_p.L151L|CLDN14_ENST00000399135.1_Silent_p.L151L|AP000695.4_ENST00000428667.1_RNA|CLDN14_ENST00000399139.1_Silent_p.L151L|AP000695.4_ENST00000454980.1_RNA	NM_144492.2	NP_652763.1	O95500	CLD14_HUMAN	claudin 14	151					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|protein complex assembly (GO:0006461)|tight junction assembly (GO:0070830)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|lung(5)|skin(1)	7						CGCTGGGCAGCAGCGGGTTGT	0.622																																					p.L151L		Atlas-SNP	.											.	CLDN14	25	.	0			c.G453A						.						84.0	78.0	80.0					21																	37833541		2203	4300	6503	SO:0001819	synonymous_variant	23562	exon3			GGGCAGCAGCGGG	AJ132445	CCDS13645.1	21q22.3	2008-07-31			ENSG00000159261	ENSG00000159261		"""Claudins"""	2035	protein-coding gene	gene with protein product		605608		DFNB29		11163249	Standard	NM_144492		Approved		uc002yvk.2	O95500	OTTHUMG00000086638	ENST00000399137.1:c.453G>A	chr21.hg19:g.37833541C>T		75.0	0.0		83.0	25.0	NM_144492		Silent	SNP	ENST00000399137.1	hg19	CCDS13645.1																																																																																			.	.		0.622	CLDN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194697.1	NM_144492	
TRAPPC10	7109	hgsc.bcm.edu	37	21	45451995	45451995	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr21:45451995A>C	ENST00000291574.4	+	2	266	c.91A>C	c.(91-93)Acc>Ccc	p.T31P	TRAPPC10_ENST00000380221.3_Missense_Mutation_p.T31P	NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	31					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						GAATTTATTTACCTCTGTTTA	0.378																																					p.T31P		Atlas-SNP	.											.	TRAPPC10	109	.	0			c.A91C						.						170.0	169.0	169.0					21																	45451995		2203	4300	6503	SO:0001583	missense	7109	exon2			TTATTTACCTCTG	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.91A>C	chr21.hg19:g.45451995A>C	ENSP00000291574:p.Thr31Pro	66.0	0.0		104.0	29.0	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	hg19	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471827	0.63737	.	.	ENSG00000160218	ENST00000380221;ENST00000291574	T;T	0.24538	1.85;1.85	5.5	4.15	0.48705	.	0.171408	0.49916	D	0.000125	T	0.27027	0.0662	L	0.56769	1.78	0.45307	D	0.998302	P;B	0.44478	0.836;0.277	P;B	0.44359	0.447;0.122	T	0.03221	-1.1059	10	0.54805	T	0.06	.	6.9416	0.24496	0.7804:0.0:0.0826:0.137	.	31;31	P48553;Q86SI7	TPC10_HUMAN;.	P	31	ENSP00000369570:T31P;ENSP00000291574:T31P	ENSP00000291574:T31P	T	+	1	0	TRAPPC10	44276423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.432000	0.59922	2.089000	0.63090	0.528000	0.53228	ACC	.	.		0.378	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
GNAZ	2781	hgsc.bcm.edu	37	22	23437953	23437953	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr22:23437953G>C	ENST00000248996.4	+	2	737	c.71G>C	c.(70-72)cGc>cCc	p.R24P	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	24					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		CGCCACCTGCGCTCAGAGAGC	0.602																																					p.R24P		Atlas-SNP	.											.	GNAZ	45	.	0			c.G71C						.						46.0	49.0	48.0					22																	23437953		2203	4300	6503	SO:0001583	missense	2781	exon2			ACCTGCGCTCAGA		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.71G>C	chr22.hg19:g.23437953G>C	ENSP00000248996:p.Arg24Pro	146.0	0.0		96.0	30.0	NM_002073	B2R6C1|Q4QRJ6	Missense_Mutation	SNP	ENST00000248996.4	hg19	CCDS13804.1	.	.	.	.	.	.	.	.	.	.	G	32	5.167556	0.94768	.	.	ENSG00000128266	ENST00000248996	D	0.89415	-2.51	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.95004	0.8383	M	0.87097	2.86	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	D	0.95773	0.8810	10	0.87932	D	0	.	17.55	0.87873	0.0:0.0:1.0:0.0	.	24	P19086	GNAZ_HUMAN	P	24	ENSP00000248996:R24P	ENSP00000248996:R24P	R	+	2	0	GNAZ	21767953	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.531000	0.98054	2.456000	0.83038	0.655000	0.94253	CGC	.	.		0.602	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1	NM_002073	
APOBEC3A	200315	hgsc.bcm.edu	37	22	39357505	39357505	+	Missense_Mutation	SNP	C	C	G	rs373904674		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr22:39357505C>G	ENST00000402255.1	+	4	492	c.288C>G	c.(286-288)atC>atG	p.I96M	APOBEC3A_ENST00000249116.2_Missense_Mutation_p.I96M			P31941	ABC3A_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A	96	CMP/dCMP deaminase zinc-binding.				cellular response to xenobiotic stimulus (GO:0071466)|clearance of foreign intracellular DNA by conversion of DNA cytidine to uridine (GO:0044356)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|DNA demethylation (GO:0080111)|innate immune response (GO:0045087)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5	Melanoma(58;0.04)					CTTGGTTCATCTCCTGGAGCC	0.597																																					p.I96M		Atlas-SNP	.											.	APOBEC3A	20	.	0			c.C288G						.						24.0	28.0	26.0					22																	39357505		2105	4013	6118	SO:0001583	missense	200315	exon3			GTTCATCTCCTGG	U03891	CCDS13981.1	22q13.1-q13.2	2014-01-28			ENSG00000128383	ENSG00000128383		"""Apolipoprotein B mRNA editing enzymes"""	17343	protein-coding gene	gene with protein product	"""phorbolin I"""	607109				11863358, 10469298	Standard	NM_145699		Approved	ARP3, PHRBN		P31941	OTTHUMG00000151004	ENST00000402255.1:c.288C>G	chr22.hg19:g.39357505C>G	ENSP00000384359:p.Ile96Met	111.0	0.0		106.0	30.0	NM_145699	A0AVM1|Q12807|Q5JZ93|Q9UH18	Missense_Mutation	SNP	ENST00000402255.1	hg19	CCDS13981.1	.	.	.	.	.	.	.	.	.	.	.	8.808	0.934451	0.18206	.	.	ENSG00000128383	ENST00000402255;ENST00000249116	T;T	0.67523	-0.27;-0.27	2.35	1.28	0.21552	APOBEC-like, N-terminal (1);APOBEC/CMP deaminase, zinc-binding (1);Cytidine deaminase-like (1);	.	.	.	.	T	0.69106	0.3074	L	0.50993	1.605	0.20638	N	0.99987	B;D	0.55605	0.253;0.972	B;P	0.55871	0.133;0.786	T	0.57711	-0.7764	9	0.59425	D	0.04	.	8.1745	0.31275	0.2409:0.759:0.0:0.0	.	78;96	B7ZLZ1;P31941	.;ABC3A_HUMAN	M	96	ENSP00000384359:I96M;ENSP00000249116:I96M	ENSP00000249116:I96M	I	+	3	3	APOBEC3A	37687451	0.987000	0.35691	0.891000	0.34965	0.012000	0.07955	0.035000	0.13797	0.519000	0.28406	-0.302000	0.09304	ATC	.	.		0.597	APOBEC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320915.2	NM_145699	
SCO2	9997	hgsc.bcm.edu	37	22	50962567	50962567	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr22:50962567C>T	ENST00000543927.1	-	2	480	c.274G>A	c.(274-276)Gaa>Aaa	p.E92K	SCO2_ENST00000395693.3_Missense_Mutation_p.E92K|CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000252785.3_Missense_Mutation_p.E92K|SCO2_ENST00000535425.1_Missense_Mutation_p.E92K	NM_001169109.1	NP_001162580.1	O43819	SCO2_HUMAN	SCO2 cytochrome c oxidase assembly protein	92	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|eye development (GO:0001654)|in utero embryonic development (GO:0001701)|muscle system process (GO:0003012)|oxidation-reduction process (GO:0055114)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			endometrium(1)|lung(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGCAGGGCTTCTGTTCGCTTT	0.672																																					p.E92K		Atlas-SNP	.											.	SCO2	38	.	0			c.G274A						.						27.0	30.0	29.0					22																	50962567		2203	4298	6501	SO:0001583	missense	9997	exon2			GGGCTTCTGTTCG	AL021683	CCDS14095.1	22q13.33	2014-01-30	2012-10-15		ENSG00000130489	ENSG00000130489		"""Mitochondrial respiratory chain complex assembly factors"""	10604	protein-coding gene	gene with protein product		604272	"""SCO (cytochrome oxidase deficient, yeast) homolog 2"", ""SCO cytochrome oxidase deficient homolog 2 (yeast)"", ""myopia 6"""	MYP6		10218584, 16091356, 23643385	Standard	NM_005138		Approved	SCO1L	uc003bma.3	O43819	OTTHUMG00000150251	ENST00000543927.1:c.274G>A	chr22.hg19:g.50962567C>T	ENSP00000444433:p.Glu92Lys	57.0	0.0		58.0	20.0	NM_001169111	Q3T1B5|Q9UK87	Missense_Mutation	SNP	ENST00000543927.1	hg19	CCDS14095.1	.	.	.	.	.	.	.	.	.	.	C	5.086	0.201497	0.09652	.	.	ENSG00000130489	ENST00000395693;ENST00000543927;ENST00000535425;ENST00000252785;ENST00000439934;ENST00000423348	D;D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.42;-3.42	4.43	4.43	0.53597	Thioredoxin-like fold (2);	0.271361	0.29699	N	0.011439	D	0.85427	0.5694	N	0.05158	-0.105	0.43054	D	0.994669	B	0.23316	0.083	B	0.24701	0.055	T	0.81026	-0.1119	10	0.19590	T	0.45	-25.931	10.7393	0.46143	0.0:0.807:0.193:0.0	.	92	O43819	SCO2_HUMAN	K	92	ENSP00000379046:E92K;ENSP00000444433:E92K;ENSP00000444242:E92K;ENSP00000252785:E92K;ENSP00000415642:E92K;ENSP00000403570:E92K	ENSP00000252785:E92K	E	-	1	0	SCO2	49309433	0.895000	0.30542	0.974000	0.42286	0.092000	0.18411	1.996000	0.40776	2.473000	0.83533	0.563000	0.77884	GAA	.	.		0.672	SCO2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317091.1	NM_005138	
WWC3	55841	hgsc.bcm.edu	37	X	10096096	10096096	+	Silent	SNP	G	G	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chrX:10096096G>A	ENST00000380861.4	+	16	2566	c.2175G>A	c.(2173-2175)gtG>gtA	p.V725V	WWC3_ENST00000454666.1_Silent_p.V725V	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	725					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.V725V(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						GGCATTCCGTGCAGGTGTTCA	0.572																																					p.V725V		Atlas-SNP	.											.	WWC3	142	.	1	Substitution - coding silent(1)	endometrium(1)	c.G2175A						.						96.0	86.0	89.0					X																	10096096		2203	4300	6503	SO:0001819	synonymous_variant	55841	exon16			TTCCGTGCAGGTG	AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2175G>A	chrX.hg19:g.10096096G>A		151.0	0.0		148.0	102.0	NM_015691	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	hg19	CCDS14136.1																																																																																			.	.		0.572	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
PCDH11X	27328	hgsc.bcm.edu	37	X	91133725	91133725	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chrX:91133725T>C	ENST00000373094.1	+	2	3331	c.2486T>C	c.(2485-2487)tTc>tCc	p.F829S	PCDH11X_ENST00000504220.2_Missense_Mutation_p.F829S|PCDH11X_ENST00000373097.1_Missense_Mutation_p.F829S|PCDH11X_ENST00000373088.1_Missense_Mutation_p.F829S|PCDH11X_ENST00000361724.1_Missense_Mutation_p.F829S|PCDH11X_ENST00000361655.2_Missense_Mutation_p.F829S|PCDH11X_ENST00000395337.2_Missense_Mutation_p.F829S|PCDH11X_ENST00000298274.8_Missense_Mutation_p.F829S|PCDH11X_ENST00000406881.1_Missense_Mutation_p.F829S	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	829					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GTAGTTATTTTCATCACTGCT	0.458																																					p.F829S	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.T2486C						.						57.0	51.0	53.0					X																	91133725		2203	4297	6500	SO:0001583	missense	27328	exon2			TTATTTTCATCAC	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.2486T>C	chrX.hg19:g.91133725T>C	ENSP00000362186:p.Phe829Ser	206.0	0.0		295.0	14.0	NM_001168363	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	hg19	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	T	0.575	-0.839325	0.02692	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.15	3.98	0.46160	Protocadherin (1);	0.106561	0.64402	N	0.000004	T	0.34366	0.0895	M	0.74258	2.255	0.31032	N	0.717323	B;B;B;B;B;B;B;B	0.09022	0.002;0.001;0.002;0.002;0.002;0.002;0.001;0.001	B;B;B;B;B;B;B;B	0.20767	0.031;0.011;0.011;0.011;0.011;0.031;0.011;0.011	T	0.38993	-0.9635	10	0.87932	D	0	.	9.4868	0.38935	0.0:0.0845:0.0:0.9155	.	829;829;829;829;829;829;829;829	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	S	829	ENSP00000378746:F829S;ENSP00000362186:F829S;ENSP00000362189:F829S;ENSP00000355040:F829S;ENSP00000362180:F829S;ENSP00000423762:F829S;ENSP00000355105:F829S;ENSP00000384758:F829S;ENSP00000298274:F829S	ENSP00000298274:F829S	F	+	2	0	PCDH11X	91020381	1.000000	0.71417	0.858000	0.33744	0.002000	0.02628	4.929000	0.63455	0.618000	0.30179	-0.331000	0.08364	TTC	.	.		0.458	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
GPR112	139378	hgsc.bcm.edu	37	X	135427542	135427542	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chrX:135427542C>A	ENST00000394143.1	+	6	1968	c.1677C>A	c.(1675-1677)ttC>ttA	p.F559L	GPR112_ENST00000287534.4_Missense_Mutation_p.F496L|GPR112_ENST00000394141.1_Missense_Mutation_p.F354L|GPR112_ENST00000412101.1_Missense_Mutation_p.F354L|GPR112_ENST00000370652.1_Missense_Mutation_p.F559L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	559					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CCTTTTCTTTCTTAACATCCT	0.403																																					p.F559L		Atlas-SNP	.											.	GPR112	459	.	0			c.C1677A						.						81.0	76.0	77.0					X																	135427542		2202	4298	6500	SO:0001583	missense	139378	exon6			TTCTTTCTTAACA	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1677C>A	chrX.hg19:g.135427542C>A	ENSP00000377699:p.Phe559Leu	35.0	0.0		68.0	52.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	hg19	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	c	5.636	0.301957	0.10678	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.25579	1.82;1.82;1.79;1.93;1.79	3.42	-0.557	0.11800	.	.	.	.	.	T	0.15869	0.0382	L	0.27053	0.805	0.09310	N	1	B;B;B	0.15141	0.012;0.002;0.0	B;B;B	0.18263	0.021;0.002;0.001	T	0.26087	-1.0113	9	0.46703	T	0.11	.	6.0943	0.20010	0.0:0.4212:0.0:0.5787	.	496;354;559	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	L	559;559;354;496;354	ENSP00000377699:F559L;ENSP00000359686:F559L;ENSP00000416526:F354L;ENSP00000287534:F496L;ENSP00000377697:F354L	ENSP00000287534:F496L	F	+	3	2	GPR112	135255208	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.087000	0.14958	-0.142000	0.11354	0.411000	0.27672	TTC	.	.		0.403	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
GABRE	2564	hgsc.bcm.edu	37	X	151123897	151123897	+	Silent	SNP	C	C	T			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chrX:151123897C>T	ENST00000370328.3	-	8	1133	c.1080G>A	c.(1078-1080)gtG>gtA	p.V360V	GABRE_ENST00000370325.1_Silent_p.V360V|AF274855.1_ENST00000582865.1_RNA|GABRE_ENST00000483564.1_5'UTR	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	360					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGAAGTTGAGCACAGCAAACT	0.493																																					p.V360V		Atlas-SNP	.											.	GABRE	141	.	0			c.G1080A						.						120.0	104.0	110.0					X																	151123897		2203	4300	6503	SO:0001819	synonymous_variant	2564	exon8			GTTGAGCACAGCA	Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.1080G>A	chrX.hg19:g.151123897C>T		73.0	0.0		26.0	7.0	NM_004961	E7ET93|O15345|O15346|Q6PCD2|Q99520	Silent	SNP	ENST00000370328.3	hg19	CCDS14703.1																																																																																			.	.		0.493	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984	
PTPN21	11099	hgsc.bcm.edu	37	14	88983540	88983540	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr14:88983540delT	ENST00000556564.1	-	3	530	c.246delA	c.(244-246)aaafs	p.K82fs	RP11-507K2.2_ENST00000555444.1_RNA|PTPN21_ENST00000328736.3_Frame_Shift_Del_p.K82fs|PTPN21_ENST00000554628.1_5'UTR	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	82	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCTTCAAAGGTTTTTCCAAAT	0.438																																					p.P83fs		Atlas-Indel,Pindel	.											.	PTPN21	113	.	0			c.247delC						.						119.0	113.0	115.0					14																	88983540		2203	4300	6503	SO:0001589	frameshift_variant	11099	exon3			.	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.246delA	chr14.hg19:g.88983540delT	ENSP00000452414:p.Lys82fs	76.0	0.0		92.0	43.0	NM_007039		Frame_Shift_Del	DEL	ENST00000556564.1	hg19	CCDS9884.1																																																																																			.	.		0.438	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
GPR78	27201	hgsc.bcm.edu	37	4	8589017	8589017	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:8589017delC	ENST00000382487.4	+	3	1436	c.1019delC	c.(1018-1020)accfs	p.T340fs	GPR78_ENST00000509216.1_3'UTR	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	340					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						CTGAAGAGAACCCCGCGCCCA	0.647																																					p.T340fs		Atlas-Indel,Pindel	.											.	GPR78	58	.	0			c.1018delA						.						45.0	50.0	49.0					4																	8589017		2203	4300	6503	SO:0001589	frameshift_variant	27201	exon3			.	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.1019delC	chr4.hg19:g.8589017delC	ENSP00000371927:p.Thr340fs	275.0	0.0		239.0	69.0	NM_080819	Q8NGV3	Frame_Shift_Del	DEL	ENST00000382487.4	hg19	CCDS3403.1																																																																																			.	.		0.647	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1		
PCDHB10	56126	hgsc.bcm.edu	37	5	140573599	140573599	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr5:140573599delC	ENST00000239446.4	+	1	1658	c.1474delC	c.(1474-1476)ccgfs	p.P493fs		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	493	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGCTGCTGCCGCCCCAAGA	0.677																																					p.L491fs		Atlas-Indel,Pindel	.											.	PCDHB10	177	.	0			c.1473delG						.						94.0	108.0	103.0					5																	140573599		2203	4297	6500	SO:0001589	frameshift_variant	56126	exon1			.	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1474delC	chr5.hg19:g.140573599delC	ENSP00000239446:p.Pro493fs	135.0	0.0		176.0	36.0	NM_018930	Q96T99	Frame_Shift_Del	DEL	ENST00000239446.4	hg19	CCDS4252.1																																																																																			.	.		0.677	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
INA	9118	hgsc.bcm.edu	37	10	105048343	105048372	+	In_Frame_Del	DEL	ATATTAGAGGAGACAGTAATATCTACTAAG	ATATTAGAGGAGACAGTAATATCTACTAAG	-	rs150252509		TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	ATATTAGAGGAGACAGTAATATCTACTAAG	ATATTAGAGGAGACAGTAATATCTACTAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr10:105048343_105048372delATATTAGAGGAGACAGTAATATCTACTAAG	ENST00000369849.4	+	3	1466_1495	c.1417_1446delATATTAGAGGAGACAGTAATATCTACTAAG	c.(1417-1446)atattagaggagacagtaatatctactaagdel	p.ILEETVISTK473del		NM_032727.3	NP_116116.1	Q16352	AINX_HUMAN	internexin neuronal intermediate filament protein, alpha	473	Tail.				cell differentiation (GO:0030154)|neurofilament cytoskeleton organization (GO:0060052)|substantia nigra development (GO:0021762)	cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular space (GO:0005615)|neurofilament (GO:0005883)	structural constituent of cytoskeleton (GO:0005200)	p.S480Y(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)	13				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TTTTGAAGAAATATTAGAGGAGACAGTAATATCTACTAAGAAAACCGAGA	0.374																																					p.472_482del		Atlas-Indel,Pindel	.											.	INA	34	.	1	Substitution - Missense(1)	large_intestine(1)	c.1416_1445del						.																																			SO:0001651	inframe_deletion	9118	exon3			.	S78296	CCDS7545.1	10q24	2013-01-16			ENSG00000148798	ENSG00000148798		"""Intermediate filaments type IV"""	6057	protein-coding gene	gene with protein product		605338		NEF5		7769995	Standard	NM_032727		Approved	NF-66	uc001kws.3	Q16352	OTTHUMG00000018986	ENST00000369849.4:c.1417_1446delATATTAGAGGAGACAGTAATATCTACTAAG	chr10.hg19:g.105048343_105048372delATATTAGAGGAGACAGTAATATCTACTAAG	ENSP00000358865:p.Ile473_Lys482del	149.0	0.0		183.0	34.0	NM_032727	B1AQK0|Q9BRC5	In_Frame_Del	DEL	ENST00000369849.4	hg19	CCDS7545.1																																																																																			.	.		0.374	INA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050145.1	NM_032727	
WDR87	83889	hgsc.bcm.edu	37	19	38376879	38376883	+	Frame_Shift_Del	DEL	CTTCT	CTTCT	-			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	CTTCT	CTTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr19:38376879_38376883delCTTCT	ENST00000303868.5	-	6	7535_7539	c.7311_7315delAGAAG	c.(7309-7317)agagaagtgfs	p.REV2437fs	WDR87_ENST00000447313.2_Frame_Shift_Del_p.REV2476fs	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	2437										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TTTCCCATCACTTCTCTTTCTTTAT	0.424																																					p.2438_2439del		Atlas-Indel,Pindel	.											.	WDR87	191	.	0			c.7312_7316del						.																																			SO:0001589	frameshift_variant	83889	exon6			.	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.7311_7315delAGAAG	chr19.hg19:g.38376879_38376883delCTTCT	ENSP00000368025:p.Arg2437fs	74.0	0.0		156.0	47.0	NM_031951	Q9BWV9	Frame_Shift_Del	DEL	ENST00000303868.5	hg19	CCDS46063.1																																																																																			.	.		0.424	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
FGB	2244	hgsc.bcm.edu	37	4	155487089	155487090	+	Frame_Shift_Ins	INS	-	-	A			TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr4:155487089_155487090insA	ENST00000302068.4	+	2	307_308	c.244_245insA	c.(244-246)caafs	p.Q82fs	FGB_ENST00000502545.1_3'UTR|FGB_ENST00000509493.1_Intron	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	82			Missing (in New York-1). {ECO:0000269|PubMed:3156856}.		blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AGCTGCCACTCAAAAGAAAGTA	0.574																																					p.Q82fs	NSCLC(106;1133 1613 21870 46110 52656)	Pindel	.											.	FGB	71	.	0			c.244_245insA						.																																			SO:0001589	frameshift_variant	2244	exon2			.		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.248dupA	chr4.hg19:g.155487093_155487093dupA	ENSP00000306099:p.Gln82fs	126.0	0.0		205.0	43.0	NM_005141	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Frame_Shift_Ins	INS	ENST00000302068.4	hg19	CCDS3786.1																																																																																			.	.		0.574	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141	
DEF8	54849	hgsc.bcm.edu	37	16	90028418	90028495	+	Splice_Site	DEL	CTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG	CTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG	-	rs140137747|rs376017026|rs200795246|rs553966074|rs370039650|rs532929203|rs150893049|rs551718366	byFrequency	TCGA-2Y-A9H1-01A-11D-A382-10	TCGA-2Y-A9H1-10A-01D-A385-10	CTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG	CTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	97b30224-993b-47df-ba5f-824fc6e21907	9f0f7a73-8f8c-40b4-a130-b04813913909	g.chr16:90028418_90028495delCTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG	ENST00000268676.7	+	9	1079_1155	c.990_1066delCTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG	c.(988-1068)aactggttgggtgttgcccgctgcacgggccctgggtgggtgtgagaggtgtcacccggccgtgcctggcaggtttctcgt>aagt	p.330_356NWLGVARCTGPGWV*EVSPGRAWQVSR>K	DEF8_ENST00000570182.1_Splice_Site_p.259_285NWLGVARCTGPGWV*EVSPGRAWQVSR>K|DEF8_ENST00000563795.1_Splice_Site_p.269_295NWLGVARCTGPGWV*EVSPGRAWQVSR>K|DEF8_ENST00000567874.1_Splice_Site_p.209_235NWLGVARCTGPGWV*EVSPGRAWQVSR>K|DEF8_ENST00000569453.1_Splice_Site_p.269_295NWLGVARCTGPGWV*EVSPGRAWQVSR>K|DEF8_ENST00000563848.1_3'UTR|DEF8_ENST00000563594.1_Splice_Site_p.269_295NWLGVARCTGPGWV*EVSPGRAWQVSR>K	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	330					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)	p.S335C(1)		central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		CGTGCCTGGCAGGTTTCTCGCTGCAGCATGCGCTACCTGGCGCTGATGGTGTCTCGGCCCGTACTCAGGCTCCGGGAGATCAACCCTCTGCTGTTCAG	0.68																																					p.331_333del		Pindel	.											.	DEF8	28	.	1	Substitution - Missense(1)	lung(1)	c.991_997del						.																																			SO:0001630	splice_region_variant	54849	exon9			.	AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.991-1CTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG>-	chr16.hg19:g.90028418_90028495delCTGGTTGGGTGTTGCCCGCTGCACGGGCCCTGGGTGGGTGTGAGAGGTGTCACCCGGCCGTGCCTGGCAGGTTTCTCG		44.0	0.0		38.0	13.0	NM_207514	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Frame_Shift_Del	DEL	ENST00000268676.7	hg19	CCDS10989.1																																																																																			.	.		0.680	DEF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000272878.1	NM_207514	In_Frame_Del
