#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PANK4	55229	hgsc.bcm.edu	37	1	2441560	2441560	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:2441560C>T	ENST00000378466.3	-	17	1987	c.1975G>A	c.(1975-1977)Gac>Aac	p.D659N	PANK4_ENST00000435556.3_Missense_Mutation_p.D620N	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	659					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TGGGTCACGTCGTTCAGGGCG	0.652																																					p.D659N		Atlas-SNP	.											.	PANK4	64	.	0			c.G1975A						.						65.0	53.0	57.0					1																	2441560		2193	4297	6490	SO:0001583	missense	55229	exon17			TCACGTCGTTCAG	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1975G>A	chr1.hg19:g.2441560C>T	ENSP00000367727:p.Asp659Asn	231.0	0.0		119.0	24.0	NM_018216	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	ENST00000378466.3	hg19	CCDS42.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420714	0.62622	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	T;T	0.72725	-0.68;-0.68	5.03	5.03	0.67393	Domain of unknown function DUF89 (2);	0.101757	0.64402	D	0.000004	D	0.86272	0.5893	M	0.89968	3.075	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89015	0.3431	10	0.87932	D	0	-33.8443	13.9394	0.64046	0.1523:0.8477:0.0:0.0	.	620;659	E9PHT6;Q9NVE7	.;PANK4_HUMAN	N	659;620	ENSP00000367727:D659N;ENSP00000421433:D620N	ENSP00000367727:D659N	D	-	1	0	PANK4	2431420	1.000000	0.71417	0.978000	0.43139	0.895000	0.52256	5.330000	0.65899	2.334000	0.79466	0.561000	0.74099	GAC	.	.		0.652	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002082.1		
ESPN	83715	hgsc.bcm.edu	37	1	6488312	6488312	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:6488312C>T	ENST00000377828.1	+	2	489	c.321C>T	c.(319-321)gtC>gtT	p.V107V	MIR4252_ENST00000585139.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	107					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GTGCCACAGTCTTGCATCTGG	0.642																																					p.V107V		Atlas-SNP	.											.	ESPN	32	.	0			c.C321T						.						79.0	83.0	82.0					1																	6488312		2203	4300	6503	SO:0001819	synonymous_variant	83715	exon2			CACAGTCTTGCAT	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.321C>T	chr1.hg19:g.6488312C>T		201.0	0.0		104.0	25.0	NM_031475	Q6XYB2|Q9H0A2|Q9Y329	Silent	SNP	ENST00000377828.1	hg19	CCDS70.1																																																																																			.	.		0.642	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475	
DNAJC11	55735	hgsc.bcm.edu	37	1	6698364	6698364	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:6698364C>T	ENST00000377577.5	-	12	1437	c.1314G>A	c.(1312-1314)gcG>gcA	p.A438A	DNAJC11_ENST00000542246.1_Silent_p.A400A|DNAJC11_ENST00000377573.5_Silent_p.A348A|DNAJC11_ENST00000294401.7_Silent_p.A386A|DNAJC11_ENST00000465508.1_5'UTR|DNAJC11_ENST00000349363.6_Intron	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	438						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCGGACTCCGCCTCTTGCT	0.612																																					p.A438A		Atlas-SNP	.											.	DNAJC11	93	.	0			c.G1314A						.						86.0	74.0	78.0					1																	6698364		2203	4300	6503	SO:0001819	synonymous_variant	55735	exon12			GGACTCCGCCTCT	AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.1314G>A	chr1.hg19:g.6698364C>T		58.0	0.0		24.0	4.0	NM_018198	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Silent	SNP	ENST00000377577.5	hg19	CCDS87.1																																																																																			.	.		0.612	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004216.3	NM_018198	
PTCHD2	57540	hgsc.bcm.edu	37	1	11561132	11561132	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:11561132T>A	ENST00000294484.6	+	2	221	c.83T>A	c.(82-84)tTt>tAt	p.F28Y	PTCHD2_ENST00000389575.3_Missense_Mutation_p.F28Y	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	28					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGTGAAACCTTTTTAGGGGCC	0.637																																					p.F28Y		Atlas-SNP	.											.	PTCHD2	193	.	0			c.T83A						.						47.0	53.0	51.0					1																	11561132		1918	4113	6031	SO:0001583	missense	57540	exon2			AAACCTTTTTAGG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.83T>A	chr1.hg19:g.11561132T>A	ENSP00000294484:p.Phe28Tyr	158.0	0.0		67.0	9.0	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	hg19	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	T	4.052	0.007321	0.07866	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.24908	1.83;1.83	5.78	-4.55	0.03441	.	3.256700	0.03411	U	0.204722	T	0.11452	0.0279	N	0.19112	0.55	0.09310	N	1	B	0.24533	0.105	B	0.16722	0.016	T	0.23190	-1.0195	10	0.02654	T	1	0.3108	4.6848	0.12752	0.1045:0.3852:0.3658:0.1445	.	28	Q9P2K9	PTHD2_HUMAN	Y	28	ENSP00000294484:F28Y;ENSP00000374226:F28Y	ENSP00000294484:F28Y	F	+	2	0	PTCHD2	11483719	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.639000	0.05446	-0.386000	0.07821	0.460000	0.39030	TTT	.	.		0.637	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
EPHA2	1969	hgsc.bcm.edu	37	1	16464921	16464921	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:16464921G>T	ENST00000358432.5	-	4	982	c.828C>A	c.(826-828)tgC>tgA	p.C276*		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	276	Cys-rich.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	ATCCAGGCGAGCAGGCTGGTG	0.587																																					p.C276X		Atlas-SNP	.											.	EPHA2	102	.	0			c.C828A						.						45.0	46.0	45.0					1																	16464921		2203	4300	6503	SO:0001587	stop_gained	1969	exon4			AGGCGAGCAGGCT	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.828C>A	chr1.hg19:g.16464921G>T	ENSP00000351209:p.Cys276*	84.0	0.0		53.0	9.0	NM_004431	B5A968|Q8N3Z2	Nonsense_Mutation	SNP	ENST00000358432.5	hg19	CCDS169.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982965	0.93044	.	.	ENSG00000142627	ENST00000358432	.	.	.	5.12	3.06	0.35304	.	0.000000	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5627	0.27860	0.2563:0.0:0.7437:0.0	.	.	.	.	X	276	.	ENSP00000351209:C276X	C	-	3	2	EPHA2	16337508	0.043000	0.20138	0.981000	0.43875	0.559000	0.35586	0.304000	0.19228	0.985000	0.38656	0.561000	0.74099	TGC	.	.		0.587	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026322.1	NM_004431	
PRPF38A	84950	hgsc.bcm.edu	37	1	52871471	52871471	+	Nonsense_Mutation	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:52871471A>T	ENST00000257181.9	+	2	436	c.250A>T	c.(250-252)Aag>Tag	p.K84*	ORC1_ENST00000371568.3_5'Flank|PRPF38A_ENST00000474048.1_Intron|ORC1_ENST00000371566.1_5'Flank	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A	84					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						TCAACCCGAGAAGGATATCAT	0.388																																					p.K84X		Atlas-SNP	.											.	PRPF38A	36	.	0			c.A250T						.						87.0	86.0	87.0					1																	52871471		2203	4300	6503	SO:0001587	stop_gained	84950	exon2			CCCGAGAAGGATA	AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.250A>T	chr1.hg19:g.52871471A>T	ENSP00000257181:p.Lys84*	132.0	0.0		106.0	8.0	NM_032864	Q96JW1|Q9BVZ8	Nonsense_Mutation	SNP	ENST00000257181.9	hg19	CCDS567.1	.	.	.	.	.	.	.	.	.	.	A	37	6.427268	0.97559	.	.	ENSG00000134748	ENST00000257181	.	.	.	5.72	5.72	0.89469	.	0.093222	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.0753	15.9967	0.80256	1.0:0.0:0.0:0.0	.	.	.	.	X	84	.	ENSP00000257181:K84X	K	+	1	0	PRPF38A	52644059	1.000000	0.71417	0.998000	0.56505	0.780000	0.44128	9.260000	0.95568	2.181000	0.69327	0.477000	0.44152	AAG	.	.		0.388	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022459.2	NM_032864	
DNAJC6	9829	hgsc.bcm.edu	37	1	65830467	65830467	+	Splice_Site	SNP	A	A	T	rs369490833		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:65830467A>T	ENST00000395325.3	+	2	329	c.172A>T	c.(172-174)Agc>Tgc	p.S58C	DNAJC6_ENST00000371069.4_Splice_Site_p.S115C|DNAJC6_ENST00000263441.7_Splice_Site_p.S45C	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	58	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						ATCTGTGACCAGGTACGCACA	0.448																																					p.S115C		Atlas-SNP	.											.	DNAJC6	104	.	0			c.A343T						.						177.0	160.0	166.0					1																	65830467		2203	4300	6503	SO:0001630	splice_region_variant	9829	exon2			GTGACCAGGTACG	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.173+1A>T	chr1.hg19:g.65830467A>T		44.0	0.0		93.0	16.0	NM_001256864	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	ENST00000395325.3	hg19	CCDS30739.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.256889	0.80246	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	D;D;D	0.94000	-3.3;-3.31;-3.33	5.07	5.07	0.68467	Phosphatase tensin type (1);	0.296394	0.36409	N	0.002616	D	0.94434	0.8209	M	0.61703	1.905	0.58432	D	0.999993	D;D;D	0.76494	0.999;0.996;0.996	P;P;P	0.61328	0.887;0.647;0.717	D	0.94990	0.8133	10	0.66056	D	0.02	.	15.0537	0.71894	1.0:0.0:0.0:0.0	.	115;58;45	O75061-2;O75061;D3DQ66	.;AUXI_HUMAN;.	C	45;58;115	ENSP00000263441:S45C;ENSP00000378735:S58C;ENSP00000360108:S115C	ENSP00000263441:S45C	S	+	1	0	DNAJC6	65603055	1.000000	0.71417	0.996000	0.52242	0.382000	0.30200	8.552000	0.90682	2.141000	0.66446	0.524000	0.50904	AGC	.	.		0.448	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		Missense_Mutation
RPE65	6121	hgsc.bcm.edu	37	1	68910485	68910485	+	Silent	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:68910485T>C	ENST00000262340.5	-	4	380	c.327A>G	c.(325-327)ccA>ccG	p.P109P		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	109					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						TGCAGGGATCTGGGAAAGCAC	0.403																																					p.P109P		Atlas-SNP	.											.	RPE65	87	.	0			c.A327G						.						92.0	91.0	91.0					1																	68910485		2203	4300	6503	SO:0001819	synonymous_variant	6121	exon4			GGGATCTGGGAAA	U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.327A>G	chr1.hg19:g.68910485T>C		137.0	0.0		110.0	21.0	NM_000329	A8K1L0|Q5T9U3	Silent	SNP	ENST00000262340.5	hg19	CCDS643.1																																																																																			.	.		0.403	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025509.1	NM_000329	
IFI44L	10964	hgsc.bcm.edu	37	1	79102796	79102796	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:79102796T>C	ENST00000370751.5	+	6	1135	c.956T>C	c.(955-957)gTg>gCg	p.V319A	IFI44L_ENST00000476521.1_3'UTR|IFI44L_ENST00000342282.3_Missense_Mutation_p.V61A	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	319					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						ATTCACTGTGTGGCTTATGTC	0.363																																					p.V319A		Atlas-SNP	.											.	IFI44L	93	.	0			c.T956C						.						166.0	169.0	168.0					1																	79102796		2203	4300	6503	SO:0001583	missense	10964	exon6			ACTGTGTGGCTTA	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.956T>C	chr1.hg19:g.79102796T>C	ENSP00000359787:p.Val319Ala	80.0	0.0		86.0	21.0	NM_006820	Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	ENST00000370751.5	hg19	CCDS687.2	.	.	.	.	.	.	.	.	.	.	T	19.24	3.788759	0.70337	.	.	ENSG00000137959	ENST00000370751;ENST00000342282	T;T	0.42513	2.62;0.97	4.08	4.08	0.47627	.	0.218465	0.30593	N	0.009281	T	0.47655	0.1457	M	0.63428	1.95	0.37145	D	0.901897	D	0.71674	0.998	D	0.68353	0.957	T	0.51490	-0.8699	10	0.49607	T	0.09	-14.041	11.2061	0.48771	0.0:0.0:0.0:1.0	.	319	Q53G44	IF44L_HUMAN	A	319;61	ENSP00000359787:V319A;ENSP00000342833:V61A	ENSP00000342833:V61A	V	+	2	0	IFI44L	78875384	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.130000	0.64745	1.790000	0.52503	0.377000	0.23210	GTG	.	.		0.363	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820	
COL11A1	1301	hgsc.bcm.edu	37	1	103444973	103444973	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:103444973C>A	ENST00000370096.3	-	32	2887	c.2575G>T	c.(2575-2577)Ggg>Tgg	p.G859W	COL11A1_ENST00000353414.4_Missense_Mutation_p.G820W|COL11A1_ENST00000358392.2_Missense_Mutation_p.G871W|COL11A1_ENST00000512756.1_Missense_Mutation_p.G743W	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	859	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTGGAAACCCAGGGAATCCA	0.348																																					p.G871W		Atlas-SNP	.											.	COL11A1	972	.	0			c.G2611T						.						42.0	45.0	44.0					1																	103444973		2203	4300	6503	SO:0001583	missense	1301	exon32			GAAACCCAGGGAA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2575G>T	chr1.hg19:g.103444973C>A	ENSP00000359114:p.Gly859Trp	150.0	0.0		133.0	11.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.371545	0.82573	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.97994	-4.65;-4.65;-4.65;-4.65	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.99302	0.9756	H	0.97635	4.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	D	0.98789	1.0735	10	0.87932	D	0	.	18.5374	0.91015	0.0:1.0:0.0:0.0	.	743;820;871;859;79	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	W	859;871;820;79;743	ENSP00000359114:G859W;ENSP00000351163:G871W;ENSP00000302551:G820W;ENSP00000426533:G743W	ENSP00000302551:G820W	G	-	1	0	COL11A1	103217561	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.133000	0.77259	2.612000	0.88384	0.655000	0.94253	GGG	.	.		0.348	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
HIPK1	204851	hgsc.bcm.edu	37	1	114483828	114483828	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:114483828T>G	ENST00000369558.1	+	2	1055	c.823T>G	c.(823-825)Tta>Gta	p.L275V	HIPK1_ENST00000426820.2_Missense_Mutation_p.L275V|HIPK1_ENST00000369555.2_Missense_Mutation_p.L275V|HIPK1_ENST00000369559.4_Missense_Mutation_p.L275V|HIPK1_ENST00000369554.2_Missense_Mutation_p.L275V|HIPK1_ENST00000369561.4_Missense_Mutation_p.L275V			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	275	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGAGCAGAACTTATATGATTT	0.408																																					p.L275V		Atlas-SNP	.											.	HIPK1	195	.	0			c.T823G						.						82.0	81.0	82.0					1																	114483828		2203	4300	6503	SO:0001583	missense	204851	exon2			CAGAACTTATATG	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.823T>G	chr1.hg19:g.114483828T>G	ENSP00000358571:p.Leu275Val	103.0	0.0		78.0	12.0	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	hg19	CCDS867.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.267975	0.59540	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561	T;T;T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24;0.24;0.24	5.81	1.98	0.26296	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000177	T	0.60379	0.2264	M	0.67700	2.07	0.80722	D	1	D;D	0.69078	0.997;0.974	D;D	0.76071	0.987;0.969	T	0.63620	-0.6596	10	0.87932	D	0	.	8.5641	0.33530	0.0:0.3049:0.0:0.6951	.	275;275	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	V	346;275;275;275;275;275;275	ENSP00000407442:L346V;ENSP00000358572:L275V;ENSP00000409673:L275V;ENSP00000358567:L275V;ENSP00000358568:L275V;ENSP00000358571:L275V;ENSP00000358574:L275V	ENSP00000358567:L275V	L	+	1	2	HIPK1	114285351	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.551000	0.36233	0.384000	0.24942	0.455000	0.32223	TTA	.	.		0.408	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
PDZK1	5174	hgsc.bcm.edu	37	1	145748506	145748506	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:145748506G>A	ENST00000344770.2	+	3	452	c.379G>A	c.(379-381)Gtg>Atg	p.V127M	PDZK1_ENST00000451928.2_Missense_Mutation_p.V127M|PDZK1_ENST00000417171.1_Missense_Mutation_p.V127M	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	127					carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			GAATGGAGGTGTGCAAACTTG	0.483																																					p.V127M		Atlas-SNP	.											.	PDZK1	15	.	0			c.G379A						.						34.0	40.0	38.0					1																	145748506		2203	4298	6501	SO:0001583	missense	5174	exon4			GGAGGTGTGCAAA	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.379G>A	chr1.hg19:g.145748506G>A	ENSP00000342143:p.Val127Met	383.0	0.0		378.0	120.0	NM_002614	B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Missense_Mutation	SNP	ENST00000344770.2	hg19	CCDS924.1	.	.	.	.	.	.	.	.	.	.	G	9.823	1.186342	0.21870	.	.	ENSG00000174827	ENST00000443667;ENST00000417171;ENST00000451928;ENST00000344770	T;T;T;T	0.32753	1.44;1.52;1.57;1.52	5.84	3.98	0.46160	PDZ/DHR/GLGF (1);	1.045830	0.07476	N	0.902950	T	0.20901	0.0503	M	0.70275	2.135	0.09310	N	1	P;B	0.44090	0.826;0.375	B;B	0.42738	0.191;0.396	T	0.24870	-1.0148	10	0.48119	T	0.1	-13.7977	9.3114	0.37908	0.1663:0.0:0.8337:0.0	.	127;127	E7EU02;Q5T2W1	.;NHRF3_HUMAN	M	127	ENSP00000409291:V127M;ENSP00000394485:V127M;ENSP00000403422:V127M;ENSP00000342143:V127M	ENSP00000342143:V127M	V	+	1	0	PDZK1	144459863	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	0.762000	0.26503	0.817000	0.34445	0.591000	0.81541	GTG	.	.		0.483	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038502.2	NM_002614	
FLG	2312	hgsc.bcm.edu	37	1	152282251	152282251	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:152282251G>T	ENST00000368799.1	-	3	5146	c.5111C>A	c.(5110-5112)tCt>tAt	p.S1704Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1704	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCGACTACAGATGAATCTTG	0.572									Ichthyosis																												p.S1704Y		Atlas-SNP	.											.	FLG	900	.	0			c.C5111A						.						245.0	249.0	248.0					1																	152282251		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACTACAGATGAAT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5111C>A	chr1.hg19:g.152282251G>T	ENSP00000357789:p.Ser1704Tyr	88.0	0.0		81.0	12.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	9.539	1.112979	0.20795	.	.	ENSG00000143631	ENST00000368799	T	0.04049	3.72	2.51	-0.85	0.10720	.	.	.	.	.	T	0.03651	0.0104	M	0.66939	2.045	0.09310	N	1	D	0.65815	0.995	D	0.76071	0.987	T	0.21314	-1.0249	9	0.02654	T	1	.	4.3855	0.11314	0.0:0.2424:0.4459:0.3116	.	1704	P20930	FILA_HUMAN	Y	1704	ENSP00000357789:S1704Y	ENSP00000357789:S1704Y	S	-	2	0	FLG	150548875	0.001000	0.12720	0.001000	0.08648	0.037000	0.13140	0.578000	0.23773	-0.154000	0.11118	0.306000	0.20318	TCT	.	.		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
ASTN1	460	hgsc.bcm.edu	37	1	176992547	176992547	+	Silent	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:176992547G>A	ENST00000367654.3	-	7	1642	c.1431C>T	c.(1429-1431)ccC>ccT	p.P477P	ASTN1_ENST00000424564.2_Silent_p.P477P|ASTN1_ENST00000367657.3_Silent_p.P477P|ASTN1_ENST00000361833.2_Silent_p.P477P|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	477	EGF-like 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TACCAGTTTCGGGGTCACATT	0.597																																					p.P477P		Atlas-SNP	.											.	ASTN1	314	.	0			c.C1431T						.						23.0	22.0	22.0					1																	176992547		2202	4300	6502	SO:0001819	synonymous_variant	460	exon7			AGTTTCGGGGTCA	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1431C>T	chr1.hg19:g.176992547G>A		203.0	0.0		166.0	14.0	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	hg19																																																																																				.	.		0.597	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
RALGPS2	55103	hgsc.bcm.edu	37	1	178871314	178871314	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:178871314C>A	ENST00000367635.3	+	18	1936	c.1598C>A	c.(1597-1599)cCt>cAt	p.P533H	RALGPS2_ENST00000367634.2_Missense_Mutation_p.P507H	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	533	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Required for stimulation of nucleotide exchange by RALA. {ECO:0000250}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						CCTGAACATCCTGATCTCTTC	0.393																																					p.P533H		Atlas-SNP	.											.	RALGPS2	69	.	0			c.C1598A						.						221.0	192.0	202.0					1																	178871314		2203	4300	6503	SO:0001583	missense	55103	exon18			AACATCCTGATCT	AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.1598C>A	chr1.hg19:g.178871314C>A	ENSP00000356607:p.Pro533His	44.0	0.0		85.0	9.0	NM_152663	B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	ENST00000367635.3	hg19	CCDS1325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.4|27.4	4.825067|4.825067	0.90955|0.90955	.|.	.|.	ENSG00000116191|ENSG00000116191	ENST00000367632|ENST00000367635;ENST00000367634;ENST00000324778;ENST00000535251	.|T;T;T	.|0.80994	.|-1.44;-1.44;-1.44	5.69|5.69	5.69|5.69	0.88448|0.88448	.|Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89037|0.89037	0.6601|0.6601	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.69479	.|0.927;0.964	D|D	0.87911|0.87911	0.2697|0.2697	5|10	.|0.44086	.|T	.|0.13	.|.	19.4161|19.4161	0.94700|0.94700	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|507;533	.|B7Z7B1;Q86X27	.|.;RGPS2_HUMAN	M|H	124|533;507;498;182	.|ENSP00000356607:P533H;ENSP00000356606:P507H;ENSP00000313613:P498H	.|ENSP00000313613:P498H	L|P	+|+	1|2	2|0	RALGPS2|RALGPS2	177137937|177137937	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.962000|0.962000	0.63368|0.63368	7.452000|7.452000	0.80683|0.80683	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	CTG|CCT	.	.		0.393	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084926.2	NM_152663	
ABL2	27	hgsc.bcm.edu	37	1	179077338	179077338	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:179077338C>T	ENST00000502732.1	-	12	3267	c.3064G>A	c.(3064-3066)Gga>Aga	p.G1022R	ABL2_ENST00000344730.3_Missense_Mutation_p.G904R|ABL2_ENST00000512653.1_Missense_Mutation_p.G1007R|ABL2_ENST00000507173.1_Missense_Mutation_p.G898R|ABL2_ENST00000367623.4_Missense_Mutation_p.G1001R|ABL2_ENST00000511413.1_Missense_Mutation_p.G919R|ABL2_ENST00000504405.1_Missense_Mutation_p.G883R|ABL2_ENST00000408940.3_Missense_Mutation_p.G986R	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	1022	F-actin-binding. {ECO:0000250}.|Pro-rich.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GCCTTCTTTCCTCCTTCCTGT	0.567			T	ETV6	AML																																p.G1022R		Atlas-SNP	.		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	ABL2	307	.	0			c.G3064A						.						108.0	104.0	106.0					1																	179077338		2203	4300	6503	SO:0001583	missense	27	exon12			TCTTTCCTCCTTC	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.3064G>A	chr1.hg19:g.179077338C>T	ENSP00000427562:p.Gly1022Arg	81.0	0.0		71.0	13.0	NM_007314	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	hg19	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954531	0.34471	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.74421	-0.82;-0.83;-0.84;-0.83;-0.83;-0.82;-0.83;-0.84	5.5	5.5	0.81552	F-actin binding (1);	0.128338	0.35615	N	0.003089	T	0.70281	0.3206	L	0.34521	1.04	0.32177	N	0.580821	P;B;B;P;P;P;P;P	0.50272	0.813;0.001;0.001;0.933;0.921;0.879;0.901;0.933	B;B;B;P;P;P;P;P	0.55577	0.373;0.007;0.007;0.646;0.779;0.595;0.607;0.646	T	0.68580	-0.5371	10	0.15066	T	0.55	.	7.7932	0.29133	0.0:0.7449:0.1662:0.0889	.	1001;898;919;883;1022;1007;986;904	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	R	1022;986;904;1007;883;1001;898;919	ENSP00000427562:G1022R;ENSP00000386152:G986R;ENSP00000339209:G904R;ENSP00000423578:G1007R;ENSP00000426831:G883R;ENSP00000356595:G1001R;ENSP00000423413:G898R;ENSP00000424697:G919R	ENSP00000339209:G904R	G	-	1	0	ABL2	177343961	0.424000	0.25490	1.000000	0.80357	0.882000	0.50991	0.646000	0.24797	2.735000	0.93741	0.655000	0.94253	GGA	.	.		0.567	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158	
CEP350	9857	hgsc.bcm.edu	37	1	179989802	179989802	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:179989802G>A	ENST00000367607.3	+	12	3311	c.2893G>A	c.(2893-2895)Gcc>Acc	p.A965T		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	965					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TGATATGCAAGCCTGTTCTCA	0.468																																					p.A965T		Atlas-SNP	.											.	CEP350	418	.	0			c.G2893A						.						122.0	126.0	124.0					1																	179989802		2203	4300	6503	SO:0001583	missense	9857	exon12			ATGCAAGCCTGTT	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2893G>A	chr1.hg19:g.179989802G>A	ENSP00000356579:p.Ala965Thr	191.0	0.0		199.0	61.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	hg19	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.538635	0.27475	.	.	ENSG00000135837	ENST00000367607	T	0.13657	2.57	6.02	-0.966	0.10320	.	0.854746	0.09906	N	0.740485	T	0.05960	0.0155	N	0.19112	0.55	0.09310	N	1	B;B	0.28713	0.001;0.22	B;B	0.19148	0.001;0.024	T	0.38908	-0.9639	9	.	.	.	.	1.6551	0.02780	0.2391:0.2743:0.361:0.1257	.	965;965	E7EU22;Q5VT06	.;CE350_HUMAN	T	965	ENSP00000356579:A965T	.	A	+	1	0	CEP350	178256425	0.630000	0.27155	0.594000	0.28785	0.920000	0.55202	0.520000	0.22878	-0.117000	0.11872	-0.345000	0.07892	GCC	.	.		0.468	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
NVL	4931	hgsc.bcm.edu	37	1	224482050	224482050	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:224482050G>A	ENST00000281701.6	-	12	1503	c.1244C>T	c.(1243-1245)tCg>tTg	p.S415L	NVL_ENST00000340871.4_Missense_Mutation_p.S226L|NVL_ENST00000391875.2_Missense_Mutation_p.S309L|NVL_ENST00000482491.1_Missense_Mutation_p.S139L|NVL_ENST00000361463.3_Missense_Mutation_p.S309L|NVL_ENST00000469075.1_Missense_Mutation_p.S324L	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	415						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		AGGGTCTAACGAGTCTGGTCG	0.458																																					p.S415L		Atlas-SNP	.											.	NVL	74	.	0			c.C1244T						.						90.0	84.0	86.0					1																	224482050		2203	4300	6503	SO:0001583	missense	4931	exon12			TCTAACGAGTCTG	U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.1244C>T	chr1.hg19:g.224482050G>A	ENSP00000281701:p.Ser415Leu	85.0	0.0		71.0	5.0	NM_002533	B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	ENST00000281701.6	hg19	CCDS1541.1	.	.	.	.	.	.	.	.	.	.	G	36	5.760521	0.96906	.	.	ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871;ENST00000361463	D;D;D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13;-3.13	5.65	5.65	0.86999	ATPase, AAA-type, conserved site (1);ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.91838	0.7417	N	0.13327	0.33	0.80722	D	1	D;P;D	0.60160	0.987;0.948;0.975	P;P;P	0.60236	0.686;0.7;0.871	D	0.93190	0.6582	10	0.87932	D	0	-10.3576	20.0752	0.97739	0.0:0.0:1.0:0.0	.	226;324;415	B4DMC4;B4DP98;O15381	.;.;NVL_HUMAN	L	415;309;324;139;226;309	ENSP00000281701:S415L;ENSP00000375747:S309L;ENSP00000417826:S324L;ENSP00000417213:S139L;ENSP00000341362:S226L;ENSP00000354779:S309L	ENSP00000281701:S415L	S	-	2	0	NVL	222548673	1.000000	0.71417	0.955000	0.39395	0.894000	0.52154	9.582000	0.98214	2.826000	0.97356	0.491000	0.48974	TCG	.	.		0.458	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091453.2	NM_002533	
DISC1	27185	hgsc.bcm.edu	37	1	231885681	231885681	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:231885681T>C	ENST00000602281.1	+	4	1180	c.1127T>C	c.(1126-1128)tTa>tCa	p.L376S	DISC1_ENST00000439617.2_Missense_Mutation_p.L376S|TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000535983.1_Missense_Mutation_p.L376S|DISC1_ENST00000537876.1_Missense_Mutation_p.L376S|DISC1_ENST00000539444.1_Missense_Mutation_p.L376S|DISC1_ENST00000602873.1_Missense_Mutation_p.L26S|DISC1_ENST00000366636.4_Missense_Mutation_p.L376S|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000366633.3_Missense_Mutation_p.L376S	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	376	Interaction with TRAF3IP1.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GCTGAGACGTTACAACAAAGA	0.443																																					p.L408S		Atlas-SNP	.											.	DISC1	207	.	0			c.T1223C						.						90.0	91.0	91.0					1																	231885681		2203	4300	6503	SO:0001583	missense	27185	exon5			AGACGTTACAACA	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.1127T>C	chr1.hg19:g.231885681T>C	ENSP00000473425:p.Leu376Ser	129.0	0.0		235.0	25.0	NM_001164537	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000602281.1	hg19	CCDS59205.1	.	.	.	.	.	.	.	.	.	.	.	12.82	2.051985	0.36181	.	.	ENSG00000162946	ENST00000439617;ENST00000366637;ENST00000366636;ENST00000366638;ENST00000532576;ENST00000535983;ENST00000537876;ENST00000366633;ENST00000539444;ENST00000295051;ENST00000535944	T;T;T;T;T;T;T;T	0.18657	2.64;2.45;2.44;2.23;2.63;2.24;2.24;2.2	4.75	4.75	0.60458	.	0.376283	0.24983	N	0.034054	T	0.40932	0.1137	.	.	.	0.09310	N	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.999;0.996;0.998;0.993;0.997;0.993;0.98;0.997;0.989;0.996;0.996;0.98;0.996;0.996;0.999;0.996;0.999;0.996;0.98	D;P;D;P;D;P;P;D;P;D;D;P;D;D;D;D;D;D;P	0.67231	0.95;0.893;0.95;0.827;0.911;0.857;0.773;0.911;0.839;0.931;0.931;0.731;0.931;0.931;0.95;0.918;0.95;0.918;0.731	T	0.22208	-1.0223	9	0.87932	D	0	-0.0869	10.5642	0.45163	0.0:0.0:0.0:1.0	.	408;376;408;376;376;376;376;376;26;376;376;376;376;376;376;376;376;376;376	C4P096;C4P094;E2QRA4;C4P0A3;C4P098;C4P0A1;C4P0A4;A6NLH2;C4P0C1;C4P0A5;C4P095;C4P0B6;C4P0C4;C4P0B1;A7E2W8;Q5T409;Q9NRI5-2;Q9NRI5;Q9NRI5-3	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;DISC1_HUMAN;.	S	376;376;376;408;376;376;376;376;376;376;376	ENSP00000403888:L376S;ENSP00000355596:L376S;ENSP00000443996:L376S;ENSP00000440909:L376S;ENSP00000355593:L376S;ENSP00000440953:L376S;ENSP00000295051:L376S;ENSP00000441193:L376S	ENSP00000295051:L376S	L	+	2	0	DISC1	229952304	0.048000	0.20356	0.002000	0.10522	0.367000	0.29736	3.707000	0.54838	1.977000	0.57605	0.533000	0.62120	TTA	.	.		0.443	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467451.1	NM_018662	
ARID4B	51742	hgsc.bcm.edu	37	1	235345805	235345805	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:235345805T>C	ENST00000264183.3	-	20	2926	c.2429A>G	c.(2428-2430)gAc>gGc	p.D810G	ARID4B_ENST00000366603.2_Missense_Mutation_p.D810G|ARID4B_ENST00000349213.3_Missense_Mutation_p.D724G|ARID4B_ENST00000494543.1_5'Flank	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	810					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			ATCTGTTGTGTCCTTCTTGAC	0.333																																					p.D810G		Atlas-SNP	.											.	ARID4B	142	.	0			c.A2429G						.						184.0	165.0	171.0					1																	235345805		2203	4300	6503	SO:0001583	missense	51742	exon20			GTTGTGTCCTTCT	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.2429A>G	chr1.hg19:g.235345805T>C	ENSP00000264183:p.Asp810Gly	104.0	0.0		79.0	5.0	NM_016374	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	hg19	CCDS31061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.09|14.09	2.432637|2.432637	0.43224|0.43224	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183|ENST00000444620	T;T;T|.	0.25085|.	1.87;1.82;1.82|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.387174|.	0.32473|.	N|.	0.006051|.	T|T	0.49592|0.49592	0.1566|0.1566	N|N	0.14661|0.14661	0.345|0.345	0.49915|0.49915	D|D	0.999838|0.999838	P;B;D;B|.	0.56521|.	0.873;0.001;0.976;0.002|.	B;B;P;B|.	0.44811|.	0.367;0.002;0.461;0.002|.	T|T	0.47222|0.47222	-0.9134|-0.9134	10|5	0.59425|.	D|.	0.04|.	-21.0593|-21.0593	16.4311|16.4311	0.83844|0.83844	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	491;810;724;810|.	Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39|.	.;.;.;ARI4B_HUMAN|.	G|A	810;724;810;810|210	ENSP00000264184:D724G;ENSP00000355562:D810G;ENSP00000264183:D810G|.	ENSP00000264183:D810G|.	D|T	-|-	2|1	0|0	ARID4B|ARID4B	233412428|233412428	1.000000|1.000000	0.71417|0.71417	0.940000|0.940000	0.37924|0.37924	0.991000|0.991000	0.79684|0.79684	4.010000|4.010000	0.57117|0.57117	2.277000|2.277000	0.76020|0.76020	0.528000|0.528000	0.53228|0.53228	GAC|ACA	.	.		0.333	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
HEATR1	55127	hgsc.bcm.edu	37	1	236757400	236757400	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:236757400C>T	ENST00000366582.3	-	9	1219	c.1105G>A	c.(1105-1107)Gga>Aga	p.G369R	HEATR1_ENST00000366581.2_Missense_Mutation_p.G369R|HEATR1_ENST00000483073.1_5'Flank	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	369					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CCATCCATTCCTTCAGTTTCT	0.294																																					p.G369R		Atlas-SNP	.											.	HEATR1	197	.	0			c.G1105A						.						140.0	138.0	139.0					1																	236757400		2203	4295	6498	SO:0001583	missense	55127	exon9			CCATTCCTTCAGT	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1105G>A	chr1.hg19:g.236757400C>T	ENSP00000355541:p.Gly369Arg	69.0	0.0		84.0	10.0	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	hg19	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871108	0.72065	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66995	3.5;-0.24	5.54	5.54	0.83059	Armadillo-type fold (1);	0.558966	0.18889	N	0.128365	T	0.56352	0.1979	L	0.33485	1.01	0.80722	D	1	B	0.23735	0.09	B	0.24006	0.05	T	0.51655	-0.8678	10	0.09084	T	0.74	.	18.4263	0.90610	0.0:1.0:0.0:0.0	.	369	Q9H583	HEAT1_HUMAN	R	369	ENSP00000355541:G369R;ENSP00000355540:G369R	ENSP00000355540:G369R	G	-	1	0	HEATR1	234824023	0.993000	0.37304	0.960000	0.40013	0.836000	0.47400	4.691000	0.61738	2.777000	0.95525	0.591000	0.81541	GGA	.	.		0.294	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
ACTN2	88	hgsc.bcm.edu	37	1	236911058	236911058	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:236911058A>G	ENST00000366578.4	+	13	1664	c.1498A>G	c.(1498-1500)Agg>Ggg	p.R500G	ACTN2_ENST00000546208.1_5'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.R500G	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	500					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TACTCAGAAGAGGAGAGAAGC	0.408																																					p.R500G		Atlas-SNP	.											.	ACTN2	191	.	0			c.A1498G						.						43.0	46.0	45.0					1																	236911058		2203	4300	6503	SO:0001583	missense	88	exon13			CAGAAGAGGAGAG	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1498A>G	chr1.hg19:g.236911058A>G	ENSP00000355537:p.Arg500Gly	203.0	0.0		211.0	21.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	hg19	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.524628	0.64747	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.61392	0.11;0.11	5.73	3.21	0.36854	.	0.000000	0.85682	D	0.000000	T	0.81588	0.4854	H	0.95365	3.66	0.80722	D	1	D;D;D;D	0.89917	0.989;1.0;0.999;0.992	D;D;D;D	0.97110	0.971;1.0;1.0;0.995	D	0.86445	0.1769	10	0.87932	D	0	.	12.9108	0.58179	0.627:0.373:0.0:0.0	.	285;500;270;500	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	G	500;500;269	ENSP00000443495:R500G;ENSP00000355537:R500G	ENSP00000355537:R500G	R	+	1	2	ACTN2	234977681	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.142000	0.42177	1.061000	0.40601	0.533000	0.62120	AGG	.	.		0.408	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
AHCTF1	25909	hgsc.bcm.edu	37	1	247016531	247016531	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:247016531C>T	ENST00000391829.2	-	32	4548	c.4425G>A	c.(4423-4425)gaG>gaA	p.E1475E	AHCTF1_ENST00000326225.3_Silent_p.E1484E|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_Silent_p.E1510E			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1475	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TAAGCCTGCGCTCAGAGACAA	0.408																																					p.E1484E	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.G4452A						.						45.0	42.0	43.0					1																	247016531		2203	4300	6503	SO:0001819	synonymous_variant	25909	exon32			CCTGCGCTCAGAG		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4425G>A	chr1.hg19:g.247016531C>T		350.0	0.0		377.0	39.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	ENST00000391829.2	hg19																																																																																				.	.		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
OR2T6	254879	hgsc.bcm.edu	37	1	248550917	248550917	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr1:248550917A>G	ENST00000355728.2	+	1	8	c.8A>G	c.(7-9)gAa>gGa	p.E3G		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCATGAATGAAAACAATGAA	0.388																																					p.E3G		Atlas-SNP	.											.	OR2T6	101	.	0			c.A8G						.						92.0	93.0	93.0					1																	248550917		2203	4300	6503	SO:0001583	missense	254879	exon1			TGAATGAAAACAA	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.8A>G	chr1.hg19:g.248550917A>G	ENSP00000347965:p.Glu3Gly	51.0	0.0		96.0	6.0	NM_001005471	A6NE36	Missense_Mutation	SNP	ENST00000355728.2	hg19	CCDS31114.1	.	.	.	.	.	.	.	.	.	.	A	5.682	0.310393	0.10733	.	.	ENSG00000198104	ENST00000355728	T	0.20332	2.08	4.9	-3.04	0.05412	.	0.992297	0.08173	N	0.986694	T	0.10121	0.0248	N	0.10733	0.035	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38457	-0.9660	10	0.22706	T	0.39	.	11.371	0.49699	0.6188:0.0:0.3812:0.0	.	3	Q8NHC8	OR2T6_HUMAN	G	3	ENSP00000347965:E3G	ENSP00000347965:E3G	E	+	2	0	OR2T6	246617540	0.000000	0.05858	0.004000	0.12327	0.010000	0.07245	-0.042000	0.12063	-0.953000	0.03645	-0.288000	0.09946	GAA	.	.		0.388	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
ADCY3	109	hgsc.bcm.edu	37	2	25045489	25045489	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:25045489T>A	ENST00000260600.5	-	18	3745	c.2894A>T	c.(2893-2895)aAt>aTt	p.N965I	RP11-443B20.1_ENST00000606114.1_RNA|ADCY3_ENST00000405392.1_Missense_Mutation_p.N552I	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	965					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GAACTTGGGATTGTCCAGGAG	0.527																																					p.N965I		Atlas-SNP	.											.	ADCY3	114	.	0			c.A2894T						.						109.0	95.0	100.0					2																	25045489		2203	4300	6503	SO:0001583	missense	109	exon18			TTGGGATTGTCCA	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2894A>T	chr2.hg19:g.25045489T>A	ENSP00000260600:p.Asn965Ile	93.0	0.0		63.0	6.0	NM_004036	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	hg19	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.900165	0.52227	.	.	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879	D;D	0.81499	-1.5;-1.5	5.55	5.55	0.83447	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.360765	0.32473	N	0.006060	T	0.67730	0.2924	N	0.11364	0.135	0.34767	D	0.733385	B;B;B	0.30146	0.27;0.27;0.077	B;B;B	0.33121	0.158;0.158;0.021	T	0.74990	-0.3475	10	0.44086	T	0.13	.	14.8147	0.70024	0.0:0.0:0.0:1.0	.	966;965;552	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	I	965;552;940	ENSP00000260600:N965I;ENSP00000384484:N552I	ENSP00000260600:N965I	N	-	2	0	ADCY3	24898993	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.962000	0.70364	2.333000	0.79357	0.533000	0.62120	AAT	.	.		0.527	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
PLB1	151056	hgsc.bcm.edu	37	2	28785968	28785968	+	Splice_Site	SNP	T	T	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:28785968T>G	ENST00000327757.5	+	18	1250		c.e18+2		PLB1_ENST00000329020.6_Splice_Site|PLB1_ENST00000422425.2_Splice_Site	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1						glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TCTCTCACGGTAAGTGACCCT	0.498																																					.		Atlas-SNP	.											.	PLB1	255	.	0			c.1206+2T>G						.						62.0	62.0	62.0					2																	28785968		2203	4300	6503	SO:0001630	splice_region_variant	151056	exon18			TCACGGTAAGTGA		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1206+2T>G	chr2.hg19:g.28785968T>G		95.0	0.0		102.0	13.0	NM_153021	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Splice_Site	SNP	ENST00000327757.5	hg19	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	T	18.05	3.537514	0.65085	.	.	ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000404858;ENST00000436544;ENST00000329020	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5302	0.50604	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLB1	28639472	1.000000	0.71417	0.581000	0.28614	0.908000	0.53690	4.372000	0.59530	2.038000	0.60285	0.459000	0.35465	.	.	.		0.498	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		Intron
KCNG3	170850	hgsc.bcm.edu	37	2	42671524	42671524	+	Silent	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:42671524G>C	ENST00000306078.1	-	2	1456	c.861C>G	c.(859-861)acC>acG	p.T287T	KCNG3_ENST00000394973.4_Silent_p.T276T	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	287					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						GTACCCTCAAGGTGACTCCAG	0.453																																					p.T287T		Atlas-SNP	.											.	KCNG3	19	.	0			c.C861G						.						98.0	92.0	94.0					2																	42671524		2203	4300	6503	SO:0001819	synonymous_variant	170850	exon2			CCTCAAGGTGACT	AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.861C>G	chr2.hg19:g.42671524G>C		112.0	0.0		132.0	19.0	NM_133329	Q53SC1	Silent	SNP	ENST00000306078.1	hg19	CCDS1809.1																																																																																			.	.		0.453	KCNG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250464.2	NM_172344	
XPO1	7514	hgsc.bcm.edu	37	2	61726983	61726983	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:61726983T>A	ENST00000401558.2	-	7	1182	c.455A>T	c.(454-456)gAt>gTt	p.D152V	XPO1_ENST00000404992.2_Missense_Mutation_p.D152V|XPO1_ENST00000406957.1_Missense_Mutation_p.D152V	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	152	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TCCAACAATATCACTGATAAA	0.353			Mis		CLL																																p.D152V		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1	108	.	0			c.A455T						.						83.0	84.0	84.0					2																	61726983		2203	4300	6503	SO:0001583	missense	7514	exon7			ACAATATCACTGA	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.455A>T	chr2.hg19:g.61726983T>A	ENSP00000384863:p.Asp152Val	268.0	0.0		244.0	39.0	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	hg19	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.363474	0.82353	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957;ENST00000451765	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.84	5.84	0.93424	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.74574	0.3734	M	0.90759	3.145	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.80663	-0.1282	10	0.87932	D	0	-13.7935	16.2091	0.82146	0.0:0.0:0.0:1.0	.	152	O14980	XPO1_HUMAN	V	152	ENSP00000384863:D152V;ENSP00000385942:D152V;ENSP00000385559:D152V;ENSP00000413853:D152V	ENSP00000384863:D152V	D	-	2	0	XPO1	61580487	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.027000	0.88791	2.223000	0.72356	0.533000	0.62120	GAT	.	.		0.353	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
DNAH6	1768	hgsc.bcm.edu	37	2	84822866	84822866	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:84822866A>C	ENST00000237449.6	+	17	2829	c.2821A>C	c.(2821-2823)Agt>Cgt	p.S941R	DNAH6_ENST00000398278.2_Missense_Mutation_p.S941R|DNAH6_ENST00000389394.3_Missense_Mutation_p.S941R			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	941	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GCCACCCAACAGTGTAGTGCC	0.383																																					p.S941R		Atlas-SNP	.											.	DNAH6	194	.	0			c.A2821C						.						100.0	94.0	95.0					2																	84822866		692	1591	2283	SO:0001583	missense	1768	exon18			CCCAACAGTGTAG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2821A>C	chr2.hg19:g.84822866A>C	ENSP00000237449:p.Ser941Arg	102.0	0.0		68.0	10.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.562288	0.45694	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.60797	0.16;0.16;0.16	5.82	5.82	0.92795	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.40322	0.1112	N	0.11724	0.165	0.36169	D	0.848663	B	0.11235	0.004	B	0.16722	0.016	T	0.43327	-0.9398	9	0.18710	T	0.47	.	15.159	0.72767	1.0:0.0:0.0:0.0	.	941	Q9C0G6	DYH6_HUMAN	R	941	ENSP00000374045:S941R;ENSP00000381326:S941R;ENSP00000237449:S941R	ENSP00000237449:S941R	S	+	1	0	DNAH6	84676377	1.000000	0.71417	0.993000	0.49108	0.963000	0.63663	7.151000	0.77411	2.215000	0.71742	0.528000	0.53228	AGT	.	.		0.383	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
ACOXL	55289	hgsc.bcm.edu	37	2	111850452	111850452	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:111850452T>C	ENST00000389811.4	+	18	1765	c.1541T>C	c.(1540-1542)tTg>tCg	p.L514S	ACOXL_ENST00000439055.1_Missense_Mutation_p.L484S			Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	514					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						TTTTGTCTGTTGTATGGAACC	0.413																																					p.L484S		Atlas-SNP	.											.	ACOXL	93	.	0			c.T1451C						.						111.0	111.0	111.0					2																	111850452		2203	4300	6503	SO:0001583	missense	55289	exon17			GTCTGTTGTATGG		CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000389811.4:c.1541T>C	chr2.hg19:g.111850452T>C	ENSP00000374461:p.Leu514Ser	68.0	0.0		91.0	6.0	NM_001142807	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Missense_Mutation	SNP	ENST00000389811.4	hg19		.	.	.	.	.	.	.	.	.	.	T	15.61	2.884952	0.51908	.	.	ENSG00000153093	ENST00000389811;ENST00000439055;ENST00000422487;ENST00000417074	T;T;T	0.70516	-0.49;-0.49;-0.49	5.87	5.87	0.94306	Acyl-CoA oxidase, C-terminal (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.000000	0.47852	D	0.000204	D	0.84875	0.5569	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.993;0.988;0.997	D	0.87073	0.2161	10	0.87932	D	0	-26.6067	14.2209	0.65826	0.0:0.0:0.0:1.0	.	484;484;514	E9PB20;Q9NUZ1-2;Q9NUZ1	.;.;ACOXL_HUMAN	S	514;484;335;322	ENSP00000374461:L514S;ENSP00000407761:L484S;ENSP00000387832:L322S	ENSP00000374461:L514S	L	+	2	0	ACOXL	111566923	0.996000	0.38824	0.116000	0.21606	0.515000	0.34225	4.519000	0.60517	2.244000	0.73946	0.533000	0.62120	TTG	.	.		0.413	ACOXL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000254024.2	NM_018308	
SCN7A	6332	hgsc.bcm.edu	37	2	167266356	167266357	+	Missense_Mutation	DNP	GG	GG	TA	rs573169902		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:167266356_167266357GG>TA	ENST00000409855.1	-	24	3926_3927	c.3800_3801CC>TA	c.(3799-3801)gCC>gTA	p.A1267V		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1267					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CTATCATCATGGCTATTGCTTG	0.351																																					p.A1267A|p.A1267V		Atlas-SNP	.											.	SCN7A	410	.	0			c.C3801A|c.C3800T						.																																			SO:0001583	missense	6332	exon24			CATCATGGCTATT|ATCATGGCTATTG	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3800_3801delinsTA	chr2.hg19:g.167266356_167266357delinsTA	ENSP00000386796:p.Ala1267Val	118.0|116.0	0.0		178.0|179.0	22.0	NM_002976		Silent|Missense_Mutation	SNP	ENST00000409855.1	hg19	CCDS46442.1																																																																																			.	.		0.351	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
TTN	7273	hgsc.bcm.edu	37	2	179417552	179417552	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:179417552C>T	ENST00000591111.1	-	285	85376	c.85152G>A	c.(85150-85152)gtG>gtA	p.V28384V	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592600.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000460472.2_Silent_p.V20960V|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Silent_p.V30025V|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Silent_p.V21152V|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.V27457V|TTN_ENST00000359218.5_Silent_p.V21085V			Q8WZ42	TITIN_HUMAN	titin	28384	Fibronectin type-III 106. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCAGCCTTCACTGGCTCTG	0.438																																					p.V30025V		Atlas-SNP	.											.	TTN	18412	.	0			c.G90075A						.						61.0	57.0	58.0					2																	179417552		1907	4128	6035	SO:0001819	synonymous_variant	7273	exon335			AGCCTTCACTGGC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.85152G>A	chr2.hg19:g.179417552C>T		76.0	0.0		175.0	13.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179531559	179531559	+	Intron	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:179531559G>A	ENST00000591111.1	-	153	34489				TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S11956L|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTGTTGGTGATGGTGTTTT	0.313																																					p.S11956L		Atlas-SNP	.											.	TTN	18412	.	0			c.C35867T						.						11.0	11.0	11.0					2																	179531559		873	1982	2855	SO:0001627	intron_variant	7273	exon163			GTTGGTGATGGTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34264+3385C>T	chr2.hg19:g.179531559G>A		74.0	0.0		86.0	15.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.73|13.73	2.325162|2.325162	0.41197|0.41197	.|.	.|.	ENSG00000155657|ENSG00000155657	ENST00000425332|ENST00000541862;ENST00000392423	.|.	.|.	.|.	5.07|5.07	4.18|4.18	0.49190|0.49190	.|.	.|.	.|.	.|.	.|.	T|T	0.27063|0.27063	0.0663|0.0663	.|.	.|.	.|.	0.19575|0.19575	N|N	0.999969|0.999969	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.14309|0.14309	-1.0477|-1.0477	4|7	.|0.27785	.|T	.|0.31	.|.	7.4417|7.4417	0.27187|0.27187	0.0902:0.0:0.743:0.1668|0.0902:0.0:0.743:0.1668	.|.	.|258	.|Q71S18	.|.	Y|L	48|258;110	.|.	.|ENSP00000376219:S110L	H|S	-|-	1|2	0|0	TTN|TTN	179239804|179239804	0.049000|0.049000	0.20398|0.20398	0.042000|0.042000	0.18584|0.18584	0.591000|0.591000	0.36615|0.36615	1.934000|1.934000	0.40163|0.40163	1.344000|1.344000	0.45657|0.45657	0.467000|0.467000	0.42956|0.42956	CAC|TCA	.	.		0.313	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CPS1	1373	hgsc.bcm.edu	37	2	211442191	211442191	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:211442191G>A	ENST00000233072.5	+	4	624	c.428G>A	c.(427-429)tGg>tAg	p.W143*	CPS1_ENST00000430249.2_Nonsense_Mutation_p.W149*	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	143	Anthranilate phosphoribosyltransferase homolog.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TACAACCACTGGCTGGCTACC	0.418																																					p.W149X		Atlas-SNP	.											.	CPS1	485	.	0			c.G446A						.						154.0	154.0	154.0					2																	211442191		2203	4300	6503	SO:0001587	stop_gained	1373	exon5			ACCACTGGCTGGC	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.428G>A	chr2.hg19:g.211442191G>A	ENSP00000233072:p.Trp143*	89.0	0.0		106.0	9.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Nonsense_Mutation	SNP	ENST00000233072.5	hg19	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.038542	0.93630	.	.	ENSG00000021826	ENST00000523702;ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.227	19.3439	0.94356	0.0:0.0:1.0:0.0	.	.	.	.	X	149;149;151;143;143	.	ENSP00000233072:W143X	W	+	2	0	CPS1	211150436	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.650000	0.91073	2.638000	0.89438	0.585000	0.79938	TGG	.	.		0.418	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
CPS1	1373	hgsc.bcm.edu	37	2	211527868	211527868	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:211527868C>T	ENST00000233072.5	+	33	4145	c.3949C>T	c.(3949-3951)Cgg>Tgg	p.R1317W	CPS1_ENST00000430249.2_Missense_Mutation_p.R1323W|CPS1_ENST00000451903.2_Missense_Mutation_p.R866W	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1317					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTCCTGGCCCCGGTTGAGGGA	0.383																																					p.R1323W		Atlas-SNP	.											CPS1_ENST00000430249,NS,carcinoma,0,4	CPS1	485	.	0			c.C3967T						.						47.0	51.0	50.0					2																	211527868		2203	4300	6503	SO:0001583	missense	1373	exon34			TGGCCCCGGTTGA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3949C>T	chr2.hg19:g.211527868C>T	ENSP00000233072:p.Arg1317Trp	114.0	0.0		121.0	20.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	hg19	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604266	0.66445	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	T;T;T	0.70749	-0.51;-0.51;-0.51	5.43	4.53	0.55603	ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.88179	0.6367	H	0.96748	3.875	0.52099	D	0.999941	D;D	0.71674	0.998;0.994	P;P	0.62740	0.906;0.906	D	0.92127	0.5709	10	0.87932	D	0	-8.4052	14.7296	0.69372	0.2627:0.7373:0.0:0.0	.	1327;1317	Q59HF8;P31327	.;CPSM_HUMAN	W	1323;1325;1317;866	ENSP00000402608:R1323W;ENSP00000233072:R1317W;ENSP00000406136:R866W	ENSP00000233072:R1317W	R	+	1	2	CPS1	211236113	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.600000	0.54052	1.377000	0.46286	0.655000	0.94253	CGG	.	.		0.383	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
ERBB4	2066	hgsc.bcm.edu	37	2	212522515	212522515	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:212522515G>T	ENST00000342788.4	-	16	2220	c.1910C>A	c.(1909-1911)cCa>cAa	p.P637Q	ERBB4_ENST00000402597.1_Intron|ERBB4_ENST00000436443.1_Missense_Mutation_p.P637Q	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	637					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GCCCGTCCATGGGTAGTAAAT	0.433										TSP Lung(8;0.080)																											p.P637Q		Atlas-SNP	.											.	ERBB4	480	.	0			c.C1910A						.						276.0	214.0	235.0					2																	212522515		2203	4300	6503	SO:0001583	missense	2066	exon16			GTCCATGGGTAGT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1910C>A	chr2.hg19:g.212522515G>T	ENSP00000342235:p.Pro637Gln	174.0	0.0		93.0	11.0	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	hg19	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.374971	0.24857	.	.	ENSG00000178568	ENST00000342788;ENST00000436443	T;T	0.75367	-0.93;-0.92	5.14	4.25	0.50352	.	0.267053	0.37761	N	0.001951	T	0.52741	0.1753	N	0.13098	0.295	0.80722	D	1	B;P;P	0.39116	0.004;0.66;0.529	B;B;B	0.35727	0.002;0.209;0.103	T	0.49862	-0.8894	10	0.12430	T	0.62	.	11.0488	0.47874	0.089:0.0:0.911:0.0	.	496;637;637	Q53QS8;Q15303-3;Q15303	.;.;ERBB4_HUMAN	Q	637	ENSP00000342235:P637Q;ENSP00000403204:P637Q	ENSP00000342235:P637Q	P	-	2	0	ERBB4	212230760	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.958000	0.63660	1.258000	0.44101	0.650000	0.86243	CCA	.	.		0.433	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
EPHA4	2043	hgsc.bcm.edu	37	2	222428899	222428899	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:222428899G>T	ENST00000281821.2	-	3	416	c.375C>A	c.(373-375)taC>taA	p.Y125*	EPHA4_ENST00000409854.1_Nonsense_Mutation_p.Y125*|EPHA4_ENST00000392071.4_Nonsense_Mutation_p.Y74*|EPHA4_ENST00000409938.1_Nonsense_Mutation_p.Y125*	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	125	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		ATTCATAGTAGTACAGGTTAA	0.458																																					p.Y125X		Atlas-SNP	.											.	EPHA4	263	.	0			c.C375A						.						159.0	147.0	151.0					2																	222428899		2203	4300	6503	SO:0001587	stop_gained	2043	exon3			ATAGTAGTACAGG	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.375C>A	chr2.hg19:g.222428899G>T	ENSP00000281821:p.Tyr125*	98.0	0.0		99.0	17.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Nonsense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116416	0.77323	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071;ENST00000419964;ENST00000541600	.	.	.	6.17	4.4	0.53042	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4782	0.27390	0.3432:0.0:0.6568:0.0	.	.	.	.	X	125;125;125;74;66;125	.	ENSP00000281821:Y125X	Y	-	3	2	EPHA4	222137143	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.507000	0.45442	0.952000	0.37798	0.655000	0.94253	TAC	.	.		0.458	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
PAX3	5077	hgsc.bcm.edu	37	2	223066833	223066833	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:223066833C>G	ENST00000350526.4	-	8	1386	c.1250G>C	c.(1249-1251)gGg>gCg	p.G417A	PAX3_ENST00000344493.4_Intron|PAX3_ENST00000392070.2_Missense_Mutation_p.G417A|PAX3_ENST00000409551.3_Missense_Mutation_p.G416A|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000392069.2_Missense_Mutation_p.G417A|PAX3_ENST00000336840.6_Intron	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	417					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCCAGACCCCCGGTGAGAGG	0.552			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.G417A		Atlas-SNP	.		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	PAX3	106	.	0			c.G1250C						.						80.0	75.0	77.0					2																	223066833		2203	4300	6503	SO:0001583	missense	5077	exon8			AGACCCCCGGTGA		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1250G>C	chr2.hg19:g.223066833C>G	ENSP00000343052:p.Gly417Ala	86.0	0.0		121.0	12.0	NM_181457	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	hg19	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278856	0.80692	.	.	ENSG00000135903	ENST00000392069;ENST00000350526;ENST00000392070;ENST00000409551;ENST00000464706	D;D;D;D	0.93906	-3.28;-3.28;-3.3;-3.31	5.81	5.81	0.92471	.	0.051938	0.85682	D	0.000000	D	0.94499	0.8229	L	0.54323	1.7	0.80722	D	1	D;P;P	0.60160	0.987;0.908;0.944	P;B;P	0.53360	0.724;0.344;0.545	D	0.93768	0.7072	10	0.46703	T	0.11	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	417;416;417	P23760;Q494Z4;G5E9C1	PAX3_HUMAN;.;.	A	417;417;417;416;134	ENSP00000375921:G417A;ENSP00000343052:G417A;ENSP00000375922:G417A;ENSP00000386750:G416A	ENSP00000343052:G417A	G	-	2	0	PAX3	222775077	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	7.294000	0.78760	2.736000	0.93811	0.655000	0.94253	GGG	.	.		0.552	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
CNTN6	27255	hgsc.bcm.edu	37	3	1444079	1444079	+	Silent	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr3:1444079A>G	ENST00000446702.2	+	22	3522	c.2895A>G	c.(2893-2895)ccA>ccG	p.P965P	CNTN6_ENST00000539053.1_Silent_p.P893P|CNTN6_ENST00000350110.2_Silent_p.P965P			Q9UQ52	CNTN6_HUMAN	contactin 6	965	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TTCTGGTTCCATTTGAAGAAG	0.363																																					p.P965P		Atlas-SNP	.											.	CNTN6	245	.	0			c.A2895G						.						104.0	105.0	105.0					3																	1444079		2203	4299	6502	SO:0001819	synonymous_variant	27255	exon22			GGTTCCATTTGAA	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2895A>G	chr3.hg19:g.1444079A>G		209.0	0.0		241.0	30.0	NM_014461	Q2KHM2	Silent	SNP	ENST00000446702.2	hg19	CCDS2557.1																																																																																			.	.		0.363	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
IFT57	55081	hgsc.bcm.edu	37	3	107881360	107881360	+	Silent	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr3:107881360G>A	ENST00000264538.3	-	11	1501	c.1254C>T	c.(1252-1254)gcC>gcT	p.A418A	IFT57_ENST00000468021.1_5'Flank	NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	418	pDED.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			GAATAACTGTGGCATGCATGT	0.368																																					p.A418A		Atlas-SNP	.											.	IFT57	44	.	0			c.C1254T						.						219.0	184.0	196.0					3																	107881360		2203	4300	6503	SO:0001819	synonymous_variant	55081	exon11			AACTGTGGCATGC	AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.1254C>T	chr3.hg19:g.107881360G>A		68.0	0.0		109.0	19.0	NM_018010	Q96DA9	Silent	SNP	ENST00000264538.3	hg19	CCDS2951.1																																																																																			.	.		0.368	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353918.1	NM_018010	
RHO	6010	hgsc.bcm.edu	37	3	129251433	129251433	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr3:129251433C>A	ENST00000296271.3	+	4	848	c.754C>A	c.(754-756)Cgc>Agc	p.R252S		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	252					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)			breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	GGAGGTCACCCGCATGGTCAT	0.622																																					p.R252S	Esophageal Squamous(118;214 1623 30842 43234 46940)	Atlas-SNP	.											.	RHO	57	.	0			c.C754A						.						203.0	144.0	164.0					3																	129251433		2203	4300	6503	SO:0001583	missense	6010	exon4			GTCACCCGCATGG	AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.754C>A	chr3.hg19:g.129251433C>A	ENSP00000296271:p.Arg252Ser	95.0	0.0		58.0	10.0	NM_000539	Q16414|Q2M249	Missense_Mutation	SNP	ENST00000296271.3	hg19	CCDS3063.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325952	0.81580	.	.	ENSG00000163914	ENST00000296271	T	0.37411	1.2	5.51	5.51	0.81932	GPCR, rhodopsin-like superfamily (1);	0.099731	0.64402	D	0.000002	T	0.70605	0.3243	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.79412	-0.1814	10	0.87932	D	0	.	13.9377	0.64034	0.152:0.848:0.0:0.0	.	252	P08100	OPSD_HUMAN	S	252	ENSP00000296271:R252S	ENSP00000296271:R252S	R	+	1	0	RHO	130734123	1.000000	0.71417	0.968000	0.41197	0.742000	0.42306	4.811000	0.62606	2.595000	0.87683	0.561000	0.74099	CGC	.	.		0.622	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356101.1	NM_000539	
LRCH3	84859	hgsc.bcm.edu	37	3	197518150	197518150	+	Start_Codon_SNP	SNP	A	A	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr3:197518150A>C	ENST00000425562.2	+	1	1	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	LRCH3_ENST00000414675.2_Start_Codon_SNP_p.M1L|LRCH3_ENST00000441090.2_Start_Codon_SNP_p.M1L|RP11-803P9.1_ENST00000610089.1_lincRNA|LRCH3_ENST00000438796.2_Start_Codon_SNP_p.M1L|LRCH3_ENST00000334859.4_Start_Codon_SNP_p.M1L			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	1						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		CGGCTGGGAAATGGCGGCCGC	0.706																																					p.M1L		Atlas-SNP	.											.	LRCH3	96	.	0			c.A1C						.						11.0	13.0	12.0					3																	197518150		1945	3906	5851	SO:0001582	initiator_codon_variant	84859	exon1			TGGGAAATGGCGG	AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1A>C	chr3.hg19:g.197518150A>C	ENSP00000393579:p.Met1Leu	228.0	0.0		114.0	23.0	NM_032773	B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	ENST00000425562.2	hg19		.	.	.	.	.	.	.	.	.	.	A	14.51	2.558415	0.45590	.	.	ENSG00000186001	ENST00000438796;ENST00000441090;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T;T	0.59364	2.2;0.27;2.27;2.46;2.23	4.3	4.3	0.51218	.	0.439705	0.21193	N	0.078608	T	0.49474	0.1559	.	.	.	0.80722	D	1	B;B;B;P	0.36712	0.246;0.246;0.361;0.566	B;B;B;B	0.38264	0.095;0.071;0.15;0.269	T	0.54977	-0.8212	9	0.87932	D	0	-17.0227	7.5168	0.27606	0.9019:0.0:0.0981:0.0	.	1;1;1;1	E9PD99;B4E0T7;Q96II8-2;Q96II8-3	.;.;.;.	L	1	ENSP00000399751:M1L;ENSP00000394609:M1L;ENSP00000394965:M1L;ENSP00000334375:M1L;ENSP00000393579:M1L	ENSP00000334375:M1L	M	+	1	0	LRCH3	199002547	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.274000	0.43390	1.825000	0.53177	0.472000	0.43445	ATG	.	.		0.706	LRCH3-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000339965.1	NM_032773	Missense_Mutation
OTOP1	133060	hgsc.bcm.edu	37	4	4199209	4199209	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:4199209G>A	ENST00000296358.4	-	5	1376	c.1352C>T	c.(1351-1353)cCt>cTt	p.P451L		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	451					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GAGTTTTTCAGGCTCTCGGTG	0.542																																					p.P451L		Atlas-SNP	.											.	OTOP1	118	.	0			c.C1352T						.						56.0	60.0	58.0					4																	4199209		2203	4300	6503	SO:0001583	missense	133060	exon5			TTTTCAGGCTCTC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1352C>T	chr4.hg19:g.4199209G>A	ENSP00000296358:p.Pro451Leu	85.0	0.0		116.0	15.0	NM_177998	A1L476	Missense_Mutation	SNP	ENST00000296358.4	hg19	CCDS3372.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837079	0.50951	.	.	ENSG00000163982	ENST00000296358	T	0.20332	2.08	4.66	4.66	0.58398	.	0.170162	0.52532	D	0.000076	T	0.36026	0.0952	M	0.73962	2.25	0.48288	D	0.999621	P	0.50528	0.936	P	0.52627	0.704	T	0.19679	-1.0298	10	0.72032	D	0.01	-0.1733	11.4055	0.49896	0.0:0.0:0.688:0.312	.	451	Q7RTM1	OTOP1_HUMAN	L	451	ENSP00000296358:P451L	ENSP00000296358:P451L	P	-	2	0	OTOP1	4250110	1.000000	0.71417	0.907000	0.35723	0.359000	0.29487	3.907000	0.56348	2.306000	0.77630	0.195000	0.17529	CCT	.	.		0.542	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
BOD1L1	259282	hgsc.bcm.edu	37	4	13603610	13603610	+	Silent	SNP	G	G	T	rs561052858		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:13603610G>T	ENST00000040738.5	-	10	5049	c.4914C>A	c.(4912-4914)atC>atA	p.I1638I		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1638						nucleus (GO:0005634)	DNA binding (GO:0003677)										CATTGGCTTCGATTTTAACTG	0.473																																					p.I1638I		Atlas-SNP	.											BOD1L,NS,carcinoma,0,1	.	.	.	0			c.C4914A						.						162.0	166.0	165.0					4																	13603610		2203	4300	6503	SO:0001819	synonymous_variant	259282	exon10			GGCTTCGATTTTA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.4914C>A	chr4.hg19:g.13603610G>T		34.0	0.0		67.0	4.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	hg19	CCDS3411.2																																																																																			.	.		0.473	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
SEPSECS	51091	hgsc.bcm.edu	37	4	25160666	25160666	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:25160666T>A	ENST00000382103.2	-	2	250	c.178A>T	c.(178-180)Atc>Ttc	p.I60F	SEPSECS_ENST00000302922.3_Intron|PI4K2B_ENST00000512921.1_5'Flank	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	60					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)	p.I60F(1)		endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				CTGTCCATGATTGCAAGTTCA	0.388																																					p.I60F		Atlas-SNP	.											SEPSECS_ENST00000382103,NS,carcinoma,0,1	SEPSECS	55	.	1	Substitution - Missense(1)	lung(1)	c.A178T						.						147.0	148.0	148.0					4																	25160666		1904	4130	6034	SO:0001583	missense	51091	exon2			CCATGATTGCAAG	AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.178A>T	chr4.hg19:g.25160666T>A	ENSP00000371535:p.Ile60Phe	208.0	1.0		151.0	15.0	NM_016955	A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Missense_Mutation	SNP	ENST00000382103.2	hg19	CCDS3432.2	.	.	.	.	.	.	.	.	.	.	T	16.33	3.092505	0.55968	.	.	ENSG00000109618	ENST00000382103;ENST00000513285	T;T	0.76709	-1.04;-1.04	5.71	0.466	0.16716	Pyridoxal phosphate-dependent transferase, major domain (1);	0.249250	0.39909	N	0.001227	T	0.59959	0.2232	N	0.22421	0.69	0.80722	D	1	B;B	0.26975	0.165;0.029	B;B	0.24974	0.057;0.003	T	0.42565	-0.9444	10	0.29301	T	0.29	-9.8897	9.4102	0.38487	0.0:0.3505:0.0:0.6495	.	59;60	Q9HD40-3;Q9HD40	.;SPCS_HUMAN	F	60;145	ENSP00000371535:I60F;ENSP00000423361:I145F	ENSP00000371535:I60F	I	-	1	0	SEPSECS	24769764	0.628000	0.27138	0.151000	0.22473	0.983000	0.72400	1.076000	0.30729	-0.148000	0.11234	0.528000	0.53228	ATC	.	.		0.388	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250414.2	NM_016955	
KDR	3791	hgsc.bcm.edu	37	4	55974019	55974019	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:55974019C>A	ENST00000263923.4	-	10	1592	c.1297G>T	c.(1297-1299)Gat>Tat	p.D433Y		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	433	Ig-like C2-type 5.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGGTAGGAATCCACAGGAGAG	0.473			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.D433Y		Atlas-SNP	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	307	.	0			c.G1297T						.						198.0	171.0	180.0					4																	55974019		2203	4300	6503	SO:0001583	missense	3791	exon10			AGGAATCCACAGG	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1297G>T	chr4.hg19:g.55974019C>A	ENSP00000263923:p.Asp433Tyr	70.0	0.0		137.0	18.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	hg19	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595579	0.66219	.	.	ENSG00000128052	ENST00000263923	T	0.12569	2.67	4.89	4.89	0.63831	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.101606	0.64402	D	0.000003	T	0.37652	0.1011	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.983;0.995	T	0.15492	-1.0435	10	0.87932	D	0	.	18.2227	0.89906	0.0:1.0:0.0:0.0	.	433;433	P35968-2;P35968	.;VGFR2_HUMAN	Y	433	ENSP00000263923:D433Y	ENSP00000263923:D433Y	D	-	1	0	KDR	55668776	1.000000	0.71417	0.945000	0.38365	0.555000	0.35460	5.185000	0.65076	2.542000	0.85734	0.462000	0.41574	GAT	.	.		0.473	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
PPAT	5471	hgsc.bcm.edu	37	4	57272854	57272854	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:57272854A>G	ENST00000264220.2	-	3	346	c.209T>C	c.(208-210)gTa>gCa	p.V70A	PPAT_ENST00000507648.1_5'UTR	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	70	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	GACGTGATTTACAAGACCCAT	0.373																																					p.V70A		Atlas-SNP	.											.	PPAT	41	.	0			c.T209C						.						38.0	36.0	36.0					4																	57272854		2203	4300	6503	SO:0001583	missense	5471	exon3			TGATTTACAAGAC		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.209T>C	chr4.hg19:g.57272854A>G	ENSP00000264220:p.Val70Ala	57.0	0.0		57.0	5.0	NM_002703		Missense_Mutation	SNP	ENST00000264220.2	hg19	CCDS3505.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.728146	0.89390	.	.	ENSG00000128059	ENST00000264220	T	0.77358	-1.09	5.63	5.63	0.86233	Glutamine amidotransferase, type II (1);	0.052926	0.85682	D	0.000000	D	0.87063	0.6084	M	0.80847	2.515	0.80722	D	1	P	0.39831	0.69	P	0.54544	0.755	D	0.88276	0.2933	10	0.72032	D	0.01	-18.9665	15.8422	0.78857	1.0:0.0:0.0:0.0	.	70	Q06203	PUR1_HUMAN	A	70	ENSP00000264220:V70A	ENSP00000264220:V70A	V	-	2	0	PPAT	56967611	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.910000	0.92685	2.141000	0.66446	0.482000	0.46254	GTA	.	.		0.373	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
ARHGAP24	83478	hgsc.bcm.edu	37	4	86898763	86898763	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:86898763A>G	ENST00000395184.1	+	8	1313	c.847A>G	c.(847-849)Atg>Gtg	p.M283V	ARHGAP24_ENST00000395183.2_Missense_Mutation_p.M188V|ARHGAP24_ENST00000264343.4_Missense_Mutation_p.M190V	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	283	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		AGTTAACAAAATGAGTGTGCA	0.398																																					p.M283V		Atlas-SNP	.											.	ARHGAP24	116	.	0			c.A847G						.						125.0	111.0	116.0					4																	86898763		2203	4300	6503	SO:0001583	missense	83478	exon8			AACAAAATGAGTG	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.847A>G	chr4.hg19:g.86898763A>G	ENSP00000378611:p.Met283Val	129.0	0.0		136.0	25.0	NM_001025616	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	hg19	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.554364	0.86231	.	.	ENSG00000138639	ENST00000395184;ENST00000395183;ENST00000514229;ENST00000264343	T;T;T;T	0.39592	1.07;1.07;1.07;1.07	5.95	4.77	0.60923	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.075193	0.85682	N	0.000000	T	0.75250	0.3824	H	0.98786	4.33	0.80722	D	1	D;P;P	0.54047	0.964;0.929;0.858	P;P;B	0.60789	0.792;0.879;0.366	D	0.83475	0.0061	10	0.87932	D	0	.	11.9284	0.52833	0.9324:0.0:0.0676:0.0	.	188;190;283	Q8N264-3;Q8N264-2;Q8N264	.;.;RHG24_HUMAN	V	283;188;198;190	ENSP00000378611:M283V;ENSP00000378610:M188V;ENSP00000425589:M198V;ENSP00000264343:M190V	ENSP00000264343:M190V	M	+	1	0	ARHGAP24	87117787	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	1.081000	0.41110	0.460000	0.39030	ATG	.	.		0.398	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
MAML3	55534	hgsc.bcm.edu	37	4	140811090	140811090	+	Silent	SNP	C	C	T	rs553194721|rs544518608|rs58287721	byFrequency	TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:140811090C>T	ENST00000509479.2	-	2	2356	c.1500G>A	c.(1498-1500)caG>caA	p.Q500Q	MAML3_ENST00000327122.5_Silent_p.Q344Q|MAML3_ENST00000398940.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.532													c|||	54	0.0107827	0.0363	0.0058	5008	,	,		15647	0.0		0.0	False		,,,				2504	0.002				p.Q500Q		Atlas-SNP	.											.	MAML3	192	.	0			c.G1500A						.						16.0	24.0	22.0					4																	140811090		2138	4277	6415	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1500G>A	chr4.hg19:g.140811090C>T		25.0	0.0		42.0	19.0	NM_018717		Silent	SNP	ENST00000509479.2	hg19	CCDS54805.1																																																																																			.	.		0.532	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
MAML3	55534	hgsc.bcm.edu	37	4	140811102	140811102	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:140811102C>T	ENST00000509479.2	-	2	2344	c.1488G>A	c.(1486-1488)caG>caA	p.Q496Q	MAML3_ENST00000327122.5_Silent_p.Q340Q|MAML3_ENST00000398940.1_Silent_p.Q35Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.542																																					p.Q496Q		Atlas-SNP	.											.	MAML3	192	.	0			c.G1488A						.						13.0	19.0	17.0					4																	140811102		2124	4242	6366	SO:0001819	synonymous_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1488G>A	chr4.hg19:g.140811102C>T		73.0	0.0		43.0	11.0	NM_018717		Silent	SNP	ENST00000509479.2	hg19	CCDS54805.1																																																																																			.	.		0.542	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
MAML3	55534	hgsc.bcm.edu	37	4	140811104	140811104	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:140811104G>T	ENST00000509479.2	-	2	2342	c.1486C>A	c.(1486-1488)Cag>Aag	p.Q496K	MAML3_ENST00000327122.5_Missense_Mutation_p.Q340K|MAML3_ENST00000398940.1_Missense_Mutation_p.Q35K	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					tgctgctgctgctgctgctgc	0.542																																					p.Q496K		Atlas-SNP	.											.	MAML3	192	.	0			c.C1486A						.						13.0	18.0	17.0					4																	140811104		2145	4254	6399	SO:0001583	missense	55534	exon2			GCTGCTGCTGCTG	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1486C>A	chr4.hg19:g.140811104G>T	ENSP00000421180:p.Gln496Lys	74.0	0.0		42.0	10.0	NM_018717		Missense_Mutation	SNP	ENST00000509479.2	hg19	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	g	6.502	0.460780	0.12342	.	.	ENSG00000196782	ENST00000509479;ENST00000327122;ENST00000398940	T;T	0.64260	0.89;-0.09	4.53	4.53	0.55603	.	0.116387	0.37577	N	0.002035	T	0.39937	0.1097	N	0.08118	0	0.32507	N	0.538137	B	0.22276	0.067	B	0.19391	0.025	T	0.35025	-0.9805	10	0.06494	T	0.89	.	17.2683	0.87093	0.0:0.0:1.0:0.0	.	496	Q96JK9	MAML3_HUMAN	K	496;340;35	ENSP00000421180:Q496K;ENSP00000313316:Q340K	ENSP00000313316:Q340K	Q	-	1	0	MAML3	141030554	0.998000	0.40836	0.988000	0.46212	0.665000	0.39181	0.180000	0.16860	2.038000	0.60285	0.455000	0.32223	CAG	.	.		0.542	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
TBC1D9	23158	hgsc.bcm.edu	37	4	141590109	141590109	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:141590109G>A	ENST00000442267.2	-	9	1624	c.1550C>T	c.(1549-1551)cCg>cTg	p.P517L		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	517	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CATGCTCTCCGGGATGCCCTT	0.597																																					p.P517L		Atlas-SNP	.											.	TBC1D9	198	.	0			c.C1550T						.						43.0	51.0	49.0					4																	141590109		2181	4279	6460	SO:0001583	missense	23158	exon9			CTCTCCGGGATGC	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.1550C>T	chr4.hg19:g.141590109G>A	ENSP00000411197:p.Pro517Leu	66.0	0.0		57.0	8.0	NM_015130	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	hg19	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	G	35	5.549106	0.96488	.	.	ENSG00000109436	ENST00000442267	T	0.08984	3.03	5.61	5.61	0.85477	Rab-GAP/TBC domain (3);	0.000000	0.85682	D	0.000000	T	0.49626	0.1568	H	0.98664	4.295	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.69907	-0.5018	10	0.87932	D	0	-5.8246	20.0018	0.97417	0.0:0.0:1.0:0.0	.	517	Q6ZT07	TBCD9_HUMAN	L	517	ENSP00000411197:P517L	ENSP00000411197:P517L	P	-	2	0	TBC1D9	141809559	1.000000	0.71417	0.968000	0.41197	0.983000	0.72400	9.771000	0.98977	2.793000	0.96121	0.655000	0.94253	CCG	.	.		0.597	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
LRBA	987	hgsc.bcm.edu	37	4	151656474	151656474	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:151656474T>A	ENST00000357115.3	-	36	5933	c.5690A>T	c.(5689-5691)aAt>aTt	p.N1897I	LRBA_ENST00000510413.1_Missense_Mutation_p.N1897I|LRBA_ENST00000507224.1_Missense_Mutation_p.N1897I|LRBA_ENST00000535741.1_Missense_Mutation_p.N1897I	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1897						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TTCAGCTTCATTTGCTACTCT	0.378																																					p.N1897I		Atlas-SNP	.											.	LRBA	253	.	0			c.A5690T						.						300.0	262.0	275.0					4																	151656474		2203	4300	6503	SO:0001583	missense	987	exon36			GCTTCATTTGCTA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.5690A>T	chr4.hg19:g.151656474T>A	ENSP00000349629:p.Asn1897Ile	66.0	0.0		108.0	15.0	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.4|24.4	4.529422|4.529422	0.85706|0.85706	.|.	.|.	ENSG00000198589|ENSG00000198589	ENST00000509835|ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	.|T;T;T;T	.|0.58652	.|0.32;0.32;0.32;0.32	5.06|5.06	5.06|5.06	0.68205|0.68205	.|Domain of unknown function DUF1088 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76863|0.76863	0.4047|0.4047	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.997	.|D;D	.|0.91635	.|0.999;0.962	T|T	0.80865|0.80865	-0.1191|-0.1191	5|10	.|0.87932	.|D	.|0	.|.	14.7996|14.7996	0.69903|0.69903	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1897;1897	.|P50851;P50851-2	.|LRBA_HUMAN;.	L|I	550|1897	.|ENSP00000446299:N1897I;ENSP00000421552:N1897I;ENSP00000349629:N1897I;ENSP00000422180:N1897I	.|ENSP00000349629:N1897I	M|N	-|-	1|2	0|0	LRBA|LRBA	151875924|151875924	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.294000|7.294000	0.78760|0.78760	2.025000|2.025000	0.59659|0.59659	0.528000|0.528000	0.53228|0.53228	ATG|AAT	.	.		0.378	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
GRIA2	2891	hgsc.bcm.edu	37	4	158257008	158257008	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:158257008G>A	ENST00000264426.9	+	10	1731	c.1452G>A	c.(1450-1452)atG>atA	p.M484I	GRIA2_ENST00000296526.7_Missense_Mutation_p.M484I|GRIA2_ENST00000393815.2_Missense_Mutation_p.M437I|GRIA2_ENST00000507898.1_Missense_Mutation_p.M437I|GRIA2_ENST00000449365.1_Missense_Mutation_p.M437I	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	484					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GGAATGGGATGGTTGGAGAAC	0.418																																					p.M484I		Atlas-SNP	.											.	GRIA2	358	.	0			c.G1452A						.						172.0	154.0	160.0					4																	158257008		2203	4300	6503	SO:0001583	missense	2891	exon10			TGGGATGGTTGGA		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1452G>A	chr4.hg19:g.158257008G>A	ENSP00000264426:p.Met484Ile	92.0	0.0		168.0	32.0	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	hg19	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466383	0.63625	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34	5.86	5.86	0.93980	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.89291	0.6673	M	0.69358	2.11	0.80722	D	1	P;D;P	0.60575	0.86;0.988;0.86	P;D;P	0.73708	0.542;0.981;0.844	D	0.87880	0.2677	10	0.51188	T	0.08	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	484;484;437	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	I	437;437;484;484;437	ENSP00000426845:M437I;ENSP00000377403:M437I;ENSP00000296526:M484I;ENSP00000264426:M484I;ENSP00000389837:M437I	ENSP00000264426:M484I	M	+	3	0	GRIA2	158476458	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.937000	0.99478	0.650000	0.86243	ATG	.	.		0.418	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
ADAM29	11086	hgsc.bcm.edu	37	4	175897786	175897786	+	Silent	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:175897786T>C	ENST00000359240.3	+	5	1780	c.1110T>C	c.(1108-1110)agT>agC	p.S370S	ADAM29_ENST00000514159.1_Silent_p.S370S|ADAM29_ENST00000445694.1_Silent_p.S370S|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Silent_p.S370S	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	370	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GCAATTGTAGTTATGGTGATT	0.393																																					p.S370S	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											.	ADAM29	262	.	0			c.T1110C						.						125.0	124.0	125.0					4																	175897786		2203	4300	6503	SO:0001819	synonymous_variant	11086	exon4			TTGTAGTTATGGT	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1110T>C	chr4.hg19:g.175897786T>C		75.0	0.0		108.0	25.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	ENST00000359240.3	hg19	CCDS3823.1																																																																																			.	.		0.393	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
VEGFC	7424	hgsc.bcm.edu	37	4	177608548	177608548	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:177608548T>C	ENST00000280193.2	-	6	1353	c.938A>G	c.(937-939)aAc>aGc	p.N313S	VEGFC_ENST00000507638.1_5'Flank|RP11-313E19.2_ENST00000504017.1_RNA|RP11-313E19.2_ENST00000509194.1_RNA	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	313	4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)			biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		CTGGCATGAGTTTCTGTCTAG	0.502																																					p.N313S		Atlas-SNP	.											.	VEGFC	94	.	0			c.A938G						.						175.0	156.0	162.0					4																	177608548		1914	4142	6056	SO:0001583	missense	7424	exon6			CATGAGTTTCTGT	BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.938A>G	chr4.hg19:g.177608548T>C	ENSP00000280193:p.Asn313Ser	62.0	0.0		78.0	7.0	NM_005429	B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	hg19	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336071	0.41398	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.87	4.63	0.57726	.	0.322731	0.33670	N	0.004671	T	0.38134	0.1029	N	0.24115	0.695	0.33565	D	0.597894	B	0.23735	0.09	B	0.28385	0.089	T	0.48305	-0.9047	9	0.25751	T	0.34	-3.9507	11.36	0.49638	0.0:0.0:0.3247:0.6753	.	313	P49767	VEGFC_HUMAN	S	313	.	ENSP00000280193:N313S	N	-	2	0	VEGFC	177845542	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	3.444000	0.52914	2.242000	0.73789	0.528000	0.53228	AAC	.	.		0.502	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429	
C5orf38	153571	hgsc.bcm.edu	37	5	2752404	2752404	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:2752404T>C	ENST00000334000.3	+	1	143	c.26T>C	c.(25-27)tTc>tCc	p.F9S	C5orf38_ENST00000457752.2_Missense_Mutation_p.F9S|IRX2_ENST00000502957.1_Intron|IRX2_ENST00000302057.5_5'Flank|IRX2_ENST00000382611.6_5'Flank|C5orf38_ENST00000397835.4_Missense_Mutation_p.F9S|C5orf38_ENST00000505778.1_Missense_Mutation_p.F9S|C5orf38_ENST00000515640.1_Missense_Mutation_p.F9S	NM_178569.2	NP_848664.1	Q86SI9	CEI_HUMAN	chromosome 5 open reading frame 38	9						extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(1)	4				GBM - Glioblastoma multiforme(108;0.205)		GCTCGGGTCTTCCTCCGGGCA	0.731																																					p.F9S		Atlas-SNP	.											.	C5orf38	20	.	0			c.T26C						.						8.0	11.0	10.0					5																	2752404		2121	4175	6296	SO:0001583	missense	153571	exon1			GGGTCTTCCTCCG	AY249324	CCDS34131.1	5p15.33	2014-06-02			ENSG00000186493	ENSG00000186493			24226	protein-coding gene	gene with protein product	"""coordinated expression to IRX2"", ""IRX2 neighbor"""	610522				16515847, 16750006	Standard	XM_005248256		Approved	CEI, IRX2NB	uc003jdc.3	Q86SI9	OTTHUMG00000161741	ENST00000334000.3:c.26T>C	chr5.hg19:g.2752404T>C	ENSP00000334267:p.Phe9Ser	228.0	0.0		157.0	30.0	NM_178569		Missense_Mutation	SNP	ENST00000334000.3	hg19	CCDS34131.1	.	.	.	.	.	.	.	.	.	.	T	7.175	0.588333	0.13812	.	.	ENSG00000186493	ENST00000457752;ENST00000397835;ENST00000334000;ENST00000505778;ENST00000515640	.	.	.	1.57	0.28	0.15682	.	.	.	.	.	T	0.16557	0.0398	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20706	-1.0267	8	0.87932	D	0	.	3.5138	0.07717	0.4002:0.0:0.0:0.5998	.	9	Q86SI9	CEI_HUMAN	S	9	.	ENSP00000334267:F9S	F	+	2	0	C5orf38	2805404	0.000000	0.05858	0.041000	0.18516	0.034000	0.12701	0.022000	0.13511	0.074000	0.16767	0.379000	0.24179	TTC	.	.		0.731	C5orf38-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365956.2	NM_178569	
EGFLAM	133584	hgsc.bcm.edu	37	5	38431349	38431349	+	Silent	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:38431349T>C	ENST00000354891.3	+	15	2471	c.2125T>C	c.(2125-2127)Tta>Cta	p.L709L	EGFLAM_ENST00000322350.5_Silent_p.L709L|EGFLAM_ENST00000397202.2_Silent_p.L75L|EGFLAM_ENST00000336740.6_Silent_p.L475L	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	709	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GAATGGAATCTTACAGGTGGA	0.453																																					p.L709L	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.T2125C						.						150.0	128.0	135.0					5																	38431349		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon15			GGAATCTTACAGG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2125T>C	chr5.hg19:g.38431349T>C		79.0	0.0		129.0	10.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	hg19	CCDS56363.1																																																																																			.	.		0.453	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
GPR98	84059	hgsc.bcm.edu	37	5	90449149	90449149	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:90449149C>T	ENST00000405460.2	+	89	18832	c.18736C>T	c.(18736-18738)Cag>Tag	p.Q6246*	GPR98_ENST00000425867.2_Nonsense_Mutation_p.Q1907*	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	6246					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGATATGGCCAGGGGTCACT	0.483																																					p.Q6246X		Atlas-SNP	.											.	GPR98	605	.	0			c.C18736T						.						65.0	65.0	65.0					5																	90449149		1891	4110	6001	SO:0001587	stop_gained	84059	exon89			TATGGCCAGGGGT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.18736C>T	chr5.hg19:g.90449149C>T	ENSP00000384582:p.Gln6246*	98.0	0.0		115.0	11.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	58	31.195922	0.99978	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	.	.	.	5.55	5.55	0.83447	.	0.215223	0.45361	D	0.000368	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.287	0.54797	0.2784:0.7215:0.0:0.0	.	.	.	.	X	6246;6246;1907	.	.	Q	+	1	0	GPR98	90484905	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.727000	0.54984	2.885000	0.99019	0.655000	0.94253	CAG	.	.		0.483	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
FAM81B	153643	hgsc.bcm.edu	37	5	94749835	94749835	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:94749835C>T	ENST00000283357.5	+	4	524	c.478C>T	c.(478-480)Ctg>Ttg	p.L160L		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	160						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		CAGGAAGTTACTGGAAAGCCA	0.433																																					p.L160L		Atlas-SNP	.											.	FAM81B	51	.	0			c.C478T						.						100.0	100.0	100.0					5																	94749835		1975	4163	6138	SO:0001819	synonymous_variant	153643	exon4			AAGTTACTGGAAA		CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.478C>T	chr5.hg19:g.94749835C>T		95.0	0.0		140.0	7.0	NM_152548		Silent	SNP	ENST00000283357.5	hg19	CCDS43341.1																																																																																			.	.		0.433	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370690.1	NM_152548	
FBN2	2201	hgsc.bcm.edu	37	5	127645693	127645693	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:127645693C>A	ENST00000508053.1	-	46	6156	c.5182G>T	c.(5182-5184)Gga>Tga	p.G1728*	FBN2_ENST00000262464.4_Nonsense_Mutation_p.G1728*			P35556	FBN2_HUMAN	fibrillin 2	1728	EGF-like 28; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TTGTGGCCTCCATTGACCTGC	0.458																																					p.G1728X		Atlas-SNP	.											.	FBN2	858	.	0			c.G5182T						.						105.0	95.0	98.0					5																	127645693		2203	4300	6503	SO:0001587	stop_gained	2201	exon40			GGCCTCCATTGAC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5182G>T	chr5.hg19:g.127645693C>A	ENSP00000424571:p.Gly1728*	129.0	0.0		216.0	59.0	NM_001999	B4DU01|Q59ES6	Nonsense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	49	15.361092	0.99831	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	.	.	.	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.1954	0.93686	0.0:1.0:0.0:0.0	.	.	.	.	X	1728	.	ENSP00000262464:G1728X	G	-	1	0	FBN2	127673592	1.000000	0.71417	0.981000	0.43875	0.993000	0.82548	4.804000	0.62554	2.772000	0.95346	0.650000	0.86243	GGA	.	.		0.458	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FBN2	2201	hgsc.bcm.edu	37	5	127681186	127681186	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:127681186C>A	ENST00000508053.1	-	30	4054	c.3080G>T	c.(3079-3081)tGt>tTt	p.C1027F	FBN2_ENST00000508989.1_Missense_Mutation_p.C994F|FBN2_ENST00000262464.4_Missense_Mutation_p.C1027F			P35556	FBN2_HUMAN	fibrillin 2	1027	TB 5.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCCGACAGCACAGCAGCAGGC	0.587																																					p.C1027F		Atlas-SNP	.											FBN2_ENST00000508053,NS,carcinoma,0,4	FBN2	858	.	0			c.G3080T						.						88.0	84.0	85.0					5																	127681186		2203	4300	6503	SO:0001583	missense	2201	exon24			ACAGCACAGCAGC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3080G>T	chr5.hg19:g.127681186C>A	ENSP00000424571:p.Cys1027Phe	204.0	0.0		192.0	18.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534334	0.85812	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.97404	-4.37;-4.37;-4.37	4.22	4.22	0.49857	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.64402	D	0.000001	D	0.98833	0.9606	M	0.93898	3.47	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.996	D	0.99289	1.0898	10	0.87932	D	0	.	17.9071	0.88921	0.0:1.0:0.0:0.0	.	994;1027	D6RJI3;P35556	.;FBN2_HUMAN	F	1027;1027;994	ENSP00000262464:C1027F;ENSP00000424571:C1027F;ENSP00000425596:C994F	ENSP00000262464:C1027F	C	-	2	0	FBN2	127709085	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.609000	0.82925	2.654000	0.90174	0.563000	0.77884	TGT	.	.		0.587	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
RAD50	10111	hgsc.bcm.edu	37	5	131953889	131953889	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:131953889C>T	ENST00000265335.6	+	21	3679	c.3292C>T	c.(3292-3294)Cgg>Tgg	p.R1098W	RAD50_ENST00000378823.3_Missense_Mutation_p.R959W			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	1098					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACCACAATTTCGGGATGCTGA	0.328								Homologous recombination																													p.R1098W		Atlas-SNP	.											RAD50_ENST00000265335,NS,carcinoma,0,2	RAD50	246	.	0			c.C3292T						.						105.0	119.0	114.0					5																	131953889		2203	4299	6502	SO:0001583	missense	10111	exon21			CAATTTCGGGATG	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.3292C>T	chr5.hg19:g.131953889C>T	ENSP00000265335:p.Arg1098Trp	405.0	0.0		359.0	44.0	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	hg19	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342217	0.61073	.	.	ENSG00000113522	ENST00000378823;ENST00000265335	T;T	0.05382	3.45;3.68	5.4	1.48	0.22813	.	0.604969	0.18076	N	0.152449	T	0.05914	0.0154	N	0.14661	0.345	0.09310	N	1	D	0.58620	0.983	P	0.50934	0.654	T	0.30736	-0.9968	10	0.87932	D	0	-1.4383	6.8185	0.23845	0.4855:0.3703:0.0:0.1442	.	1098	Q92878	RAD50_HUMAN	W	959;1098	ENSP00000368100:R959W;ENSP00000265335:R1098W	ENSP00000265335:R1098W	R	+	1	2	RAD50	131981788	0.997000	0.39634	0.994000	0.49952	0.995000	0.86356	1.163000	0.31798	0.316000	0.23135	0.655000	0.94253	CGG	.	.		0.328	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
JADE2	23338	hgsc.bcm.edu	37	5	133902158	133902158	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:133902158A>T	ENST00000402835.1	+	9	1577	c.1322A>T	c.(1321-1323)cAg>cTg	p.Q441L	PHF15_ENST00000395003.1_Missense_Mutation_p.Q441L|PHF15_ENST00000361895.2_Missense_Mutation_p.Q441L|PHF15_ENST00000282605.4_Missense_Mutation_p.Q441L																NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AATGCCAACCAGCCGCTGCTG	0.632																																					p.Q441L		Atlas-SNP	.											.	PHF15	60	.	0			c.A1322T						.						50.0	45.0	47.0					5																	133902158		2203	4300	6503	SO:0001583	missense	23338	exon9			CCAACCAGCCGCT																												ENST00000402835.1:c.1322A>T	chr5.hg19:g.133902158A>T	ENSP00000384671:p.Gln441Leu	173.0	0.0		117.0	36.0	NM_015288		Missense_Mutation	SNP	ENST00000402835.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.36	3.100802	0.56183	.	.	ENSG00000043143	ENST00000413974;ENST00000448712;ENST00000282605;ENST00000361895;ENST00000432594;ENST00000402835;ENST00000395003	T;T;T;T	0.44083	0.93;0.95;0.95;0.96	5.63	5.63	0.86233	.	0.108387	0.64402	D	0.000008	T	0.37348	0.1000	L	0.35854	1.095	0.35177	D	0.77213	B;B;B;B;B;B	0.32051	0.354;0.133;0.04;0.133;0.064;0.133	B;B;B;B;B;B	0.31946	0.138;0.09;0.045;0.09;0.098;0.119	T	0.53337	-0.8453	10	0.87932	D	0	.	15.8202	0.78633	1.0:0.0:0.0:0.0	.	441;441;441;441;441;457	B4DFY8;Q9NQC1;B5MBX1;D3DQA3;Q9NQC1-3;B3KPL2	.;JADE2_HUMAN;.;.;.;.	L	441;457;441;441;441;441;441	ENSP00000282605:Q441L;ENSP00000354425:Q441L;ENSP00000384671:Q441L;ENSP00000378451:Q441L	ENSP00000282605:Q441L	Q	+	2	0	PHF15	133930057	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	4.053000	0.57427	2.146000	0.66826	0.482000	0.46254	CAG	.	.		0.632	PHF15-007	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000318543.1		
PCDHA5	56143	hgsc.bcm.edu	37	5	140203048	140203048	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:140203048C>T	ENST00000529859.1	+	1	1688	c.1688C>T	c.(1687-1689)gCg>gTg	p.A563V	PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.A563V|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.A563V|PCDHA1_ENST00000504120.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	563	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A563V(2)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGCGCCGGCGCTGCTGGTG	0.716																																					p.A563V		Atlas-SNP	.											PCDHA5_ENST00000529859,colon,carcinoma,0,2	PCDHA5	361	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1688T						.						49.0	55.0	53.0					5																	140203048		2202	4297	6499	SO:0001583	missense	56143	exon1			CGCCGGCGCTGCT	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1688C>T	chr5.hg19:g.140203048C>T	ENSP00000436557:p.Ala563Val	121.0	0.0		91.0	27.0	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	hg19	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	C	0.453	-0.892821	0.02491	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.34667	1.35;1.35;1.35	4.0	0.435	0.16544	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.09774	0.0240	N	0.01086	-1.025	0.09310	N	1	B;B;B	0.17038	0.008;0.02;0.016	B;B;B	0.15484	0.005;0.013;0.013	T	0.35051	-0.9804	9	0.12103	T	0.63	.	4.1093	0.10052	0.0:0.3937:0.1791:0.4272	.	563;563;563	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	V	563	ENSP00000433416:A563V;ENSP00000436557:A563V;ENSP00000367366:A563V	ENSP00000367366:A563V	A	+	2	0	PCDHA5	140183232	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.911000	0.01583	0.268000	0.21939	0.461000	0.40582	GCG	.	.		0.716	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
PCDHB4	56131	hgsc.bcm.edu	37	5	140501987	140501987	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:140501987A>T	ENST00000194152.1	+	1	407	c.407A>T	c.(406-408)gAa>gTa	p.E136V	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	136					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGAAAGGGAAGTGCTCTTG	0.413																																					p.E136V		Atlas-SNP	.											.	PCDHB4	177	.	0			c.A407T						.						53.0	59.0	57.0					5																	140501987		2203	4300	6503	SO:0001583	missense	56131	exon1			AAAGGGAAGTGCT	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.407A>T	chr5.hg19:g.140501987A>T	ENSP00000194152:p.Glu136Val	156.0	0.0		163.0	53.0	NM_018938	Q4V761	Missense_Mutation	SNP	ENST00000194152.1	hg19	CCDS4246.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446108	0.25987	.	.	ENSG00000081818	ENST00000194152	T	0.19532	2.14	4.56	4.56	0.56223	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.38799	0.1054	M	0.73753	2.245	0.09310	N	1	B	0.33103	0.397	P	0.50825	0.651	T	0.41448	-0.9508	9	0.72032	D	0.01	.	5.9918	0.19470	0.7452:0.1677:0.087:0.0	.	136	Q9Y5E5	PCDB4_HUMAN	V	136	ENSP00000194152:E136V	ENSP00000194152:E136V	E	+	2	0	PCDHB4	140482171	0.000000	0.05858	0.557000	0.28306	0.747000	0.42532	0.156000	0.16382	2.033000	0.60031	0.533000	0.62120	GAA	.	.		0.413	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
ZNF300	91975	hgsc.bcm.edu	37	5	150275988	150275988	+	Silent	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:150275988A>G	ENST00000274599.5	-	6	1233	c.813T>C	c.(811-813)tgT>tgC	p.C271C	ZNF300_ENST00000418587.2_Silent_p.C235C|ZNF300_ENST00000446148.2_Silent_p.C287C|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Silent_p.C271C	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACATGTAACACATACACAGC	0.343																																					p.C287C		Atlas-SNP	.											.	ZNF300	69	.	0			c.T861C						.						133.0	132.0	133.0					5																	150275988		2203	4299	6502	SO:0001819	synonymous_variant	91975	exon7			TGTAACACATACA	AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.813T>C	chr5.hg19:g.150275988A>G		53.0	0.0		110.0	28.0	NM_001172831	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Silent	SNP	ENST00000274599.5	hg19	CCDS4311.2																																																																																			.	.		0.343	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_052860	
NMUR2	56923	hgsc.bcm.edu	37	5	151771949	151771949	+	Missense_Mutation	SNP	A	A	T	rs368060763		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:151771949A>T	ENST00000255262.3	-	4	1216	c.1051T>A	c.(1051-1053)Tcc>Acc	p.S351T		NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	351					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			TCATGCTGGGAGTGCCACTGT	0.522																																					p.S351T		Atlas-SNP	.											.	NMUR2	111	.	0			c.T1051A						.	A	THR/SER	0,4406		0,0,2203	147.0	135.0	139.0		1051	-8.4	0.0	5		139	1,8599	1.2+/-3.3	0,1,4299	no	missense	NMUR2	NM_020167.4	58	0,1,6502	TT,TA,AA		0.0116,0.0,0.0077	benign	351/416	151771949	1,13005	2203	4300	6503	SO:0001583	missense	56923	exon4			GCTGGGAGTGCCA	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.1051T>A	chr5.hg19:g.151771949A>T	ENSP00000255262:p.Ser351Thr	108.0	0.0		175.0	17.0	NM_020167	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	ENST00000255262.3	hg19	CCDS4321.1	.	.	.	.	.	.	.	.	.	.	A	4.530	0.098363	0.08681	0.0	1.16E-4	ENSG00000132911	ENST00000255262	T	0.38077	1.16	4.57	-8.43	0.00953	.	0.764422	0.11426	N	0.565311	T	0.21022	0.0506	L	0.54323	1.7	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33240	-0.9876	10	0.10636	T	0.68	-7.6408	5.5988	0.17341	0.1832:0.0986:0.5222:0.196	.	351	Q9GZQ4	NMUR2_HUMAN	T	351	ENSP00000255262:S351T	ENSP00000255262:S351T	S	-	1	0	NMUR2	151752142	0.000000	0.05858	0.000000	0.03702	0.195000	0.23768	-0.300000	0.08243	-1.754000	0.01321	0.383000	0.25322	TCC	.	.		0.522	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252439.1	NM_020167	
NSD1	64324	hgsc.bcm.edu	37	5	176722371	176722371	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:176722371G>A	ENST00000439151.2	+	23	8047	c.8002G>A	c.(8002-8004)Ggg>Agg	p.G2668R	NSD1_ENST00000347982.4_Missense_Mutation_p.G2399R|NSD1_ENST00000354179.4_Missense_Mutation_p.G2399R|NSD1_ENST00000361032.4_Missense_Mutation_p.G2565R	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2668					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCTTGGAAGAGGGCAAGACCC	0.517			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.G2668R		Atlas-SNP	.		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	NSD1	416	.	0			c.G8002A						.						65.0	68.0	67.0					5																	176722371		2203	4300	6503	SO:0001583	missense	64324	exon23	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	GGAAGAGGGCAAG	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.8002G>A	chr5.hg19:g.176722371G>A	ENSP00000395929:p.Gly2668Arg	268.0	0.0		243.0	25.0	NM_022455	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	hg19	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162393	0.57368	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.96041	-3.82;-3.83;-3.82;-3.89	5.04	4.15	0.48705	.	0.218016	0.32753	N	0.005700	D	0.92315	0.7562	N	0.19112	0.55	0.31791	N	0.629659	D;D	0.54047	0.961;0.964	P;P	0.48141	0.568;0.459	D	0.92994	0.6417	10	0.87932	D	0	.	13.4593	0.61219	0.0:0.0:0.8433:0.1567	.	2399;2668	Q96L73-2;Q96L73	.;NSD1_HUMAN	R	2399;2668;2399;2565	ENSP00000346111:G2399R;ENSP00000395929:G2668R;ENSP00000343209:G2399R;ENSP00000354310:G2565R	ENSP00000343209:G2399R	G	+	1	0	NSD1	176654977	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.108000	0.57817	1.456000	0.47831	0.655000	0.94253	GGG	.	.		0.517	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253412.2	NM_172349	
MXD3	83463	hgsc.bcm.edu	37	5	176734612	176734612	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:176734612G>A	ENST00000439742.2	-	6	1076	c.598C>T	c.(598-600)Cac>Tac	p.H200Y	MXD3_ENST00000427908.2_Intron|MXD3_ENST00000513063.1_Missense_Mutation_p.H200Y|MXD3_ENST00000423571.2_Silent_p.R225R	NM_031300.3	NP_112590.1	Q9BW11	MAD3_HUMAN	MAX dimerization protein 3	200					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGCCGCCGTGCGAGTAGCTG	0.697																																					p.H200Y		Atlas-SNP	.											.	MXD3	13	.	0			c.C598T						.						22.0	25.0	24.0					5																	176734612		2201	4297	6498	SO:0001583	missense	83463	exon6			CGCCGTGCGAGTA	BC000745	CCDS4416.1, CCDS47347.1	5q35.3	2013-03-20			ENSG00000213347	ENSG00000213347		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	14008	protein-coding gene	gene with protein product		609450					Standard	NM_031300		Approved	MAD3, bHLHc13	uc003mgb.2	Q9BW11	OTTHUMG00000130854	ENST00000439742.2:c.598C>T	chr5.hg19:g.176734612G>A	ENSP00000401867:p.His200Tyr	177.0	0.0		105.0	10.0	NM_031300	B4E0J1|Q53HK1|Q7Z4Y0|Q8NDJ7|Q96ME3	Missense_Mutation	SNP	ENST00000439742.2	hg19	CCDS4416.1	.	.	.	.	.	.	.	.	.	.	G	8.824	0.938266	0.18206	.	.	ENSG00000213347	ENST00000439742;ENST00000303165;ENST00000513063	T;T	0.30182	1.54;1.54	5.11	2.1	0.27182	.	0.724938	0.13420	N	0.389241	T	0.16471	0.0396	L	0.36672	1.1	0.23624	N	0.997267	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.36114	-0.9761	10	0.02654	T	1	.	3.5288	0.07769	0.0877:0.1137:0.4668:0.3318	.	191;200	F8W9D2;Q9BW11	.;MAD3_HUMAN	Y	200;191;200	ENSP00000401867:H200Y;ENSP00000421463:H200Y	ENSP00000307720:H191Y	H	-	1	0	MXD3	176667218	0.061000	0.20836	0.125000	0.21846	0.001000	0.01503	0.861000	0.27885	0.525000	0.28522	-0.304000	0.09214	CAC	.	.		0.697	MXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253427.1		
CNOT6	57472	hgsc.bcm.edu	37	5	179980384	179980384	+	Splice_Site	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:179980384A>G	ENST00000393356.1	+	6	723		c.e6-1		CNOT6_ENST00000502447.1_Intron|CNOT6_ENST00000261951.4_Splice_Site			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		TTACATCAACAGGGAGCTCCA	0.358																																					.		Atlas-SNP	.											.	CNOT6	47	.	0			c.300-2A>G						.						87.0	85.0	85.0					5																	179980384		2203	4300	6503	SO:0001630	splice_region_variant	57472	exon4			ATCAACAGGGAGC	AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.300-1A>G	chr5.hg19:g.179980384A>G		138.0	0.0		164.0	15.0	NM_015455	A7MD46|D3DWR0	Splice_Site	SNP	ENST00000393356.1	hg19	CCDS4455.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421877	0.83559	.	.	ENSG00000113300	ENST00000261951;ENST00000393356	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2919	0.66284	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNOT6	179912990	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.157000	0.94714	2.181000	0.69327	0.460000	0.39030	.	.	.		0.358	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253532.1	NM_015455	Intron
BTNL9	153579	hgsc.bcm.edu	37	5	180475133	180475133	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:180475133T>A	ENST00000327705.9	+	3	547	c.316T>A	c.(316-318)Ttg>Atg	p.L106M	BTNL9_ENST00000376841.2_Missense_Mutation_p.L106M|BTNL9_ENST00000376842.3_Missense_Mutation_p.L106M|BTNL9_ENST00000515271.1_Missense_Mutation_p.L37M	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	106	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGGACCAAGTTGGTCAAGGA	0.597																																					p.L106M		Atlas-SNP	.											.	BTNL9	58	.	0			c.T316A						.						69.0	57.0	61.0					5																	180475133		2203	4299	6502	SO:0001583	missense	153579	exon3			ACCAAGTTGGTCA	AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.316T>A	chr5.hg19:g.180475133T>A	ENSP00000330200:p.Leu106Met	189.0	0.0		153.0	30.0	NM_152547	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	ENST00000327705.9	hg19	CCDS4460.2	.	.	.	.	.	.	.	.	.	.	T	15.81	2.943454	0.53079	.	.	ENSG00000165810	ENST00000376841;ENST00000327705;ENST00000376842;ENST00000376850;ENST00000515271	T;T;T;T	0.68765	-0.35;-0.35;-0.35;4.07	5.01	1.95	0.26073	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.235442	0.21467	N	0.074065	T	0.76912	0.4054	M	0.78344	2.41	0.09310	N	1	D;D	0.76494	0.999;0.985	D;D	0.74348	0.983;0.926	T	0.64351	-0.6428	10	0.66056	D	0.02	.	5.9993	0.19511	0.0:0.5363:0.0:0.4637	.	37;106	B7Z4Y8;Q6UXG8	.;BTNL9_HUMAN	M	106;106;106;106;37	ENSP00000366037:L106M;ENSP00000330200:L106M;ENSP00000366038:L106M;ENSP00000427345:L37M	ENSP00000330200:L106M	L	+	1	2	BTNL9	180407739	0.026000	0.19158	0.005000	0.12908	0.000000	0.00434	0.191000	0.17076	0.633000	0.30452	-0.417000	0.06048	TTG	.	.		0.597	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157342.3	NM_152547	
CPNE5	57699	hgsc.bcm.edu	37	6	36710255	36710255	+	Silent	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:36710255G>A	ENST00000244751.2	-	21	2196	c.1572C>T	c.(1570-1572)ccC>ccT	p.P524P	CPNE5_ENST00000459703.1_5'UTR|CPNE5_ENST00000393189.2_Silent_p.P232P	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	524	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						AGTCCCGGAAGGGTACAAACT	0.652																																					p.P524P		Atlas-SNP	.											.	CPNE5	56	.	0			c.C1572T						.						75.0	70.0	71.0					6																	36710255		2203	4300	6503	SO:0001819	synonymous_variant	57699	exon21			CCGGAAGGGTACA	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1572C>T	chr6.hg19:g.36710255G>A		68.0	0.0		33.0	6.0	NM_020939	Q7Z6C8	Silent	SNP	ENST00000244751.2	hg19	CCDS4825.1																																																																																			.	.		0.652	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
DNAH8	1769	hgsc.bcm.edu	37	6	38840728	38840728	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:38840728G>T	ENST00000359357.3	+	49	6887	c.6633G>T	c.(6631-6633)tgG>tgT	p.W2211C	DNAH8_ENST00000441566.1_Missense_Mutation_p.W2175C|DNAH8_ENST00000449981.2_Missense_Mutation_p.W2428C			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2211	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ATGCCATCTGGATTGAGAACT	0.363																																					p.W2428C		Atlas-SNP	.											DNAH8_ENST00000359357,NS,carcinoma,0,2	DNAH8	1239	.	0			c.G7284T						.						73.0	74.0	73.0					6																	38840728		2203	4300	6503	SO:0001583	missense	1769	exon51			CATCTGGATTGAG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6633G>T	chr6.hg19:g.38840728G>T	ENSP00000352312:p.Trp2211Cys	101.0	0.0		141.0	28.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	G	23.6	4.433592	0.83776	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	D;D;D	0.98747	-5.11;-5.11;-5.11	5.78	5.78	0.91487	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	D	0.99616	0.9860	H	0.98314	4.2	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97807	1.0248	10	0.87932	D	0	.	20.0114	0.97452	0.0:0.0:1.0:0.0	.	2211	Q96JB1	DYH8_HUMAN	C	2416;2416;2211;2175	ENSP00000333363:W2416C;ENSP00000352312:W2211C;ENSP00000402294:W2175C	ENSP00000333363:W2416C	W	+	3	0	DNAH8	38948706	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.843000	0.99491	2.745000	0.94114	0.655000	0.94253	TGG	.	.		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
COL21A1	81578	hgsc.bcm.edu	37	6	55924015	55924015	+	Silent	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:55924015T>C	ENST00000244728.5	-	29	3031	c.2634A>G	c.(2632-2634)aaA>aaG	p.K878K	COL21A1_ENST00000535941.1_Silent_p.K878K|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370808.2_Silent_p.K244K|COL21A1_ENST00000370819.1_Silent_p.K875K	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	878	Collagen-like 6.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTTGGCTCCCTTTTTCCCCAT	0.443																																					p.K878K		Atlas-SNP	.											.	COL21A1	201	.	0			c.A2634G						.						79.0	83.0	82.0					6																	55924015		1838	4087	5925	SO:0001819	synonymous_variant	81578	exon29			GCTCCCTTTTTCC	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2634A>G	chr6.hg19:g.55924015T>C		53.0	0.0		110.0	5.0	NM_030820	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	hg19	CCDS55025.1																																																																																			.	.		0.443	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
EYS	346007	hgsc.bcm.edu	37	6	65301778	65301778	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:65301778T>A	ENST00000370621.3	-	26	4508	c.3982A>T	c.(3982-3984)Att>Ttt	p.I1328F	EYS_ENST00000503581.1_Missense_Mutation_p.I1328F|EYS_ENST00000370616.2_Missense_Mutation_p.I1328F			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1328					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CTAGTGACAATCAGTTCTTGG	0.428																																					p.I1328F		Atlas-SNP	.											.	EYS	527	.	0			c.A3982T						.						116.0	103.0	107.0					6																	65301778		692	1590	2282	SO:0001583	missense	346007	exon26			TGACAATCAGTTC		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.3982A>T	chr6.hg19:g.65301778T>A	ENSP00000359655:p.Ile1328Phe	56.0	0.0		98.0	11.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	T	14.10	2.433459	0.43224	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.82526	-1.62;-1.6;-1.6	5.62	5.62	0.85841	.	.	.	.	.	T	0.60064	0.2240	N	0.14661	0.345	0.26662	N	0.971899	P;P	0.50272	0.933;0.89	P;B	0.50049	0.629;0.286	T	0.52268	-0.8598	9	0.10111	T	0.7	.	10.2438	0.43328	0.1475:0.0:0.0:0.8525	.	1328;1328	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	F	1328	ENSP00000424243:I1328F;ENSP00000359655:I1328F;ENSP00000359650:I1328F	ENSP00000359650:I1328F	I	-	1	0	EYS	65358499	0.999000	0.42202	0.455000	0.27031	0.018000	0.09664	4.661000	0.61518	2.150000	0.67090	0.533000	0.62120	ATT	.	.		0.428	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
COL12A1	1303	hgsc.bcm.edu	37	6	75904566	75904566	+	Silent	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:75904566T>A	ENST00000322507.8	-	3	480	c.171A>T	c.(169-171)atA>atT	p.I57I	COL12A1_ENST00000483888.2_Silent_p.I57I|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Silent_p.I57I	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	57	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GGTCCACCGTTATTCTGTAAC	0.398																																					p.I57I		Atlas-SNP	.											.	COL12A1	385	.	0			c.A171T						.						117.0	114.0	115.0					6																	75904566		1837	4092	5929	SO:0001819	synonymous_variant	1303	exon3			CACCGTTATTCTG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.171A>T	chr6.hg19:g.75904566T>A		65.0	0.0		97.0	16.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	.		0.398	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
SNAP91	9892	hgsc.bcm.edu	37	6	84269864	84269864	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:84269864T>C	ENST00000439399.2	-	28	2906	c.2590A>G	c.(2590-2592)Atg>Gtg	p.M864V	SNAP91_ENST00000521485.1_Missense_Mutation_p.M859V|SNAP91_ENST00000437520.1_Missense_Mutation_p.M557V|SNAP91_ENST00000428679.2_Missense_Mutation_p.M864V|SNAP91_ENST00000369694.2_Missense_Mutation_p.M864V|SNAP91_ENST00000521743.1_Missense_Mutation_p.M864V|SNAP91_ENST00000520302.1_Missense_Mutation_p.M834V|SNAP91_ENST00000520213.1_Missense_Mutation_p.M557V|SNAP91_ENST00000195649.6_Missense_Mutation_p.M859V	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	864	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GGGGGCCTCATCATGGGCTGT	0.522																																					p.M864V		Atlas-SNP	.											.	SNAP91	199	.	0			c.A2590G						.						71.0	72.0	71.0					6																	84269864		1964	4151	6115	SO:0001583	missense	9892	exon27			GCCTCATCATGGG	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2590A>G	chr6.hg19:g.84269864T>C	ENSP00000400459:p.Met864Val	172.0	0.0		258.0	36.0	NM_001242792	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	hg19	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	T	16.74	3.207561	0.58343	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448	T;T;T;T;T;T;T;T;T;T	0.26373	2.32;2.34;2.34;2.32;2.33;2.38;2.3;2.34;2.38;1.74	5.75	5.75	0.90469	.	0.114692	0.85682	D	0.000000	T	0.23410	0.0566	L	0.46157	1.445	0.23473	N	0.997601	B;B;P;P;P	0.36392	0.009;0.452;0.551;0.551;0.551	B;P;P;P;P	0.47786	0.004;0.557;0.448;0.448;0.448	T	0.13495	-1.0507	10	0.59425	D	0.04	-4.7975	16.0623	0.80847	0.0:0.0:0.0:1.0	.	740;557;834;864;862	B7Z2N2;O60641-3;E5RI02;O60641;E1P549	.;.;.;AP180_HUMAN;.	V	859;864;864;859;864;557;834;864;557;205	ENSP00000429776:M859V;ENSP00000358708:M864V;ENSP00000400459:M864V;ENSP00000195649:M859V;ENSP00000412492:M864V;ENSP00000413277:M557V;ENSP00000428511:M834V;ENSP00000428215:M864V;ENSP00000428026:M557V;ENSP00000430255:M205V	ENSP00000195649:M859V	M	-	1	0	SNAP91	84326583	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.454000	0.73493	2.195000	0.70347	0.533000	0.62120	ATG	.	.		0.522	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
PRDM13	59336	hgsc.bcm.edu	37	6	100057084	100057084	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:100057084G>A	ENST00000369215.4	+	3	603	c.298G>A	c.(298-300)Gac>Aac	p.D100N		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	100	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		AGCATTGCGAGACGTCCAGCC	0.507																																					p.D100N		Atlas-SNP	.											.	PRDM13	65	.	0			c.G298A						.						57.0	63.0	61.0					6																	100057084		2099	4231	6330	SO:0001583	missense	59336	exon3			TTGCGAGACGTCC	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.298G>A	chr6.hg19:g.100057084G>A	ENSP00000358217:p.Asp100Asn	135.0	0.0		119.0	18.0	NM_021620	Q5TGC1|Q5TGC2	Missense_Mutation	SNP	ENST00000369215.4	hg19	CCDS43487.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451688	0.84209	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	D;D	0.87729	-2.29;-2.29	5.51	5.51	0.81932	SET domain (2);	0.000000	0.40728	N	0.001034	D	0.90072	0.6899	L	0.50993	1.605	0.53005	D	0.999966	D	0.76494	0.999	D	0.64144	0.922	D	0.90634	0.4569	10	0.72032	D	0.01	-19.3072	19.0824	0.93187	0.0:0.0:1.0:0.0	.	100	Q9H4Q3	PRD13_HUMAN	N	100;110	ENSP00000358217:D100N;ENSP00000358216:D110N	ENSP00000358216:D110N	D	+	1	0	PRDM13	100163805	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.374000	0.97172	2.620000	0.88729	0.456000	0.33151	GAC	.	.		0.507	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2		
GINM1	116254	hgsc.bcm.edu	37	6	149903658	149903658	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:149903658T>G	ENST00000367419.5	+	7	921	c.800T>G	c.(799-801)tTg>tGg	p.L267W		NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	267						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TTTCAGTTTTTGAACATCATG	0.358																																					p.L267W		Atlas-SNP	.											.	.	.	.	0			c.T800G						.						165.0	165.0	165.0					6																	149903658		2203	4300	6503	SO:0001583	missense	116254	exon7			AGTTTTTGAACAT	BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.800T>G	chr6.hg19:g.149903658T>G	ENSP00000356389:p.Leu267Trp	204.0	0.0		173.0	38.0	NM_138785	B2RDY7|E1P5A2	Missense_Mutation	SNP	ENST00000367419.5	hg19	CCDS5216.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.131893	0.77662	.	.	ENSG00000055211	ENST00000367419	.	.	.	5.59	5.59	0.84812	.	0.050426	0.85682	D	0.000000	T	0.63094	0.2482	L	0.57536	1.79	0.37037	D	0.896968	D	0.76494	0.999	D	0.65443	0.935	T	0.65232	-0.6218	8	.	.	.	-20.0881	14.6283	0.68638	0.0:0.0:0.0:1.0	.	267	Q9NU53	CF072_HUMAN	W	267	.	.	L	+	2	0	C6orf72	149945351	1.000000	0.71417	0.514000	0.27761	0.891000	0.51852	4.478000	0.60230	2.251000	0.74343	0.533000	0.62120	TTG	.	.		0.358	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042644.1	NM_138785	
KIF25	3834	hgsc.bcm.edu	37	6	168434666	168434666	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr6:168434666A>T	ENST00000443060.2	+	5	663	c.272A>T	c.(271-273)cAg>cTg	p.Q91L	KIF25_ENST00000351261.3_Missense_Mutation_p.Q91L|KIF25_ENST00000354419.2_Missense_Mutation_p.Q91L			Q9UIL4	KIF25_HUMAN	kinesin family member 25	91	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CTTGACCCACAGAGTGACTTA	0.552																																					p.Q91L		Atlas-SNP	.											.	KIF25	75	.	0			c.A272T						.						92.0	82.0	85.0					6																	168434666		2203	4300	6503	SO:0001583	missense	3834	exon4			ACCCACAGAGTGA	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.272A>T	chr6.hg19:g.168434666A>T	ENSP00000388878:p.Gln91Leu	219.0	0.0		147.0	18.0	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	hg19	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.016275	0.35606	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.75367	-0.93;-0.93;-0.93	4.11	-1.94	0.07571	Kinesin, motor domain (4);	0.974427	0.08388	N	0.953475	T	0.30665	0.0772	N	0.13272	0.32	0.09310	N	1	B;B	0.32918	0.39;0.091	B;B	0.35353	0.201;0.005	T	0.31943	-0.9925	10	0.52906	T	0.07	-7.8083	0.6664	0.00851	0.4451:0.1681:0.224:0.1628	.	91;91	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	L	91	ENSP00000388878:Q91L;ENSP00000346401:Q91L;ENSP00000252688:Q91L	ENSP00000252688:Q91L	Q	+	2	0	KIF25	168177515	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.966000	0.29331	-0.550000	0.06183	0.459000	0.35465	CAG	.	.		0.552	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
ISPD	729920	hgsc.bcm.edu	37	7	16460814	16460814	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr7:16460814T>G	ENST00000407010.2	-	1	133	c.134A>C	c.(133-135)cAa>cCa	p.Q45P	ISPD_ENST00000399310.3_Missense_Mutation_p.Q45P	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	45					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						TGCCACGGCTTGCGGGTGGCG	0.731										Multiple Myeloma(15;0.18)																											p.Q45P		Atlas-SNP	.											.	ISPD	63	.	0			c.A134C						.						2.0	3.0	3.0					7																	16460814		1150	2487	3637	SO:0001583	missense	729920	exon1			ACGGCTTGCGGGT	AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.134A>C	chr7.hg19:g.16460814T>G	ENSP00000385478:p.Gln45Pro	964.0	0.0		536.0	67.0	NM_001101426	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	hg19		.	.	.	.	.	.	.	.	.	.	T	8.348	0.830249	0.16749	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.86030	-2.06;-2.04	3.43	-5.93	0.02254	.	6.733810	0.01257	U	0.009067	T	0.65544	0.2701	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54715	-0.8252	10	0.30854	T	0.27	-11.129	1.788	0.03046	0.4958:0.201:0.1094:0.1938	.	45	A4D126	ISPD_HUMAN	P	45	ENSP00000385478:Q45P;ENSP00000382249:Q45P	ENSP00000382249:Q45P	Q	-	2	0	ISPD	16427339	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-1.607000	0.02070	-1.231000	0.02557	-0.958000	0.02645	CAA	.	.		0.731	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426	
NFE2L3	9603	hgsc.bcm.edu	37	7	26224237	26224237	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr7:26224237C>T	ENST00000056233.3	+	4	1178	c.919C>T	c.(919-921)Cag>Tag	p.Q307*		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	307					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						AAACTTCAGCCAGGCTATAAG	0.428																																					p.Q307X		Atlas-SNP	.											.	NFE2L3	77	.	0			c.C919T						.						122.0	115.0	118.0					7																	26224237		2203	4300	6503	SO:0001587	stop_gained	9603	exon4			TTCAGCCAGGCTA	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.919C>T	chr7.hg19:g.26224237C>T	ENSP00000056233:p.Gln307*	173.0	0.0		222.0	13.0	NM_004289	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Nonsense_Mutation	SNP	ENST00000056233.3	hg19	CCDS5396.1	.	.	.	.	.	.	.	.	.	.	C	35	5.520676	0.96416	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	.	.	.	5.06	4.17	0.49024	.	0.584329	0.17952	N	0.156477	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-5.4925	14.3057	0.66384	0.0:0.717:0.283:0.0	.	.	.	.	X	307;13	.	ENSP00000056233:Q307X	Q	+	1	0	NFE2L3	26190762	0.799000	0.28903	0.989000	0.46669	0.764000	0.43329	2.441000	0.44864	1.258000	0.44101	0.467000	0.42956	CAG	.	.		0.428	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
HOXA2	3199	hgsc.bcm.edu	37	7	27142050	27142050	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr7:27142050A>T	ENST00000222718.5	-	1	380	c.70T>A	c.(70-72)Tct>Act	p.S24T	HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000593300.1_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	24					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						GGGGGAAAAGATGTCAGGCAC	0.483																																					p.S24T		Atlas-SNP	.											.	HOXA2	56	.	0			c.T70A						.						117.0	124.0	122.0					7																	27142050		2203	4300	6503	SO:0001583	missense	3199	exon1			GAAAAGATGTCAG		CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.70T>A	chr7.hg19:g.27142050A>T	ENSP00000222718:p.Ser24Thr	985.0	0.0		516.0	64.0	NM_006735	A1L4K3|B2RMW3	Missense_Mutation	SNP	ENST00000222718.5	hg19	CCDS5403.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.144818	0.57044	.	.	ENSG00000105996	ENST00000222718	T	0.09255	3.0	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.36880	0.0983	M	0.84511	2.7	0.53688	D	0.999977	D	0.76494	0.999	D	0.68765	0.96	T	0.33752	-0.9856	10	0.66056	D	0.02	.	15.3211	0.74124	1.0:0.0:0.0:0.0	.	24	O43364	HXA2_HUMAN	T	24	ENSP00000222718:S24T	ENSP00000222718:S24T	S	-	1	0	HOXA2	27108575	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.873000	0.92357	2.019000	0.59389	0.482000	0.46254	TCT	.	.		0.483	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358508.2		
PDE1C	5137	hgsc.bcm.edu	37	7	31918662	31918662	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr7:31918662C>T	ENST00000396191.1	-	4	827	c.372G>A	c.(370-372)aaG>aaA	p.K124K	PDE1C_ENST00000396182.2_Silent_p.K124K|PDE1C_ENST00000396193.1_Silent_p.K184K|PDE1C_ENST00000396184.3_Silent_p.K124K|PDE1C_ENST00000321453.7_Silent_p.K124K	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	124					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TGAACCGGGGCTTCTCGTCGC	0.532																																					p.K184K		Atlas-SNP	.											.	PDE1C	465	.	0			c.G552A						.						146.0	130.0	135.0					7																	31918662		2203	4300	6503	SO:0001819	synonymous_variant	5137	exon5			CCGGGGCTTCTCG	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.372G>A	chr7.hg19:g.31918662C>T		67.0	0.0		65.0	12.0	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	ENST00000396191.1	hg19	CCDS55099.1																																																																																			.	.		0.532	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
GLI3	2737	hgsc.bcm.edu	37	7	42011935	42011935	+	Splice_Site	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr7:42011935C>A	ENST00000395925.3	-	13	2188		c.e13+1		GLI3_ENST00000479210.1_Splice_Site	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3						anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GAATGACATACCATTGGCTTC	0.542									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												.		Atlas-SNP	.											.	GLI3	312	.	0			c.2103+1G>T						.						171.0	177.0	175.0					7																	42011935		2203	4300	6503	SO:0001630	splice_region_variant	2737	exon14	Familial Cancer Database	;	GACATACCATTGG		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2103+1G>T	chr7.hg19:g.42011935C>A		83.0	0.0		116.0	6.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Splice_Site	SNP	ENST00000395925.3	hg19	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756699	0.89843	.	.	ENSG00000106571	ENST00000395925	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3214	0.98679	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GLI3	41978460	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.804000	0.96469	0.655000	0.94253	.	.	.		0.542	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	Intron
KIAA1549	57670	hgsc.bcm.edu	37	7	138603038	138603038	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr7:138603038C>T	ENST00000422774.1	-	2	1382	c.1334G>A	c.(1333-1335)gGg>gAg	p.G445E	KIAA1549_ENST00000242365.4_Missense_Mutation_p.G395E|KIAA1549_ENST00000440172.1_Missense_Mutation_p.G445E			Q9HCM3	K1549_HUMAN	KIAA1549	445						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						GGCACCATCCCCTGATCCCAC	0.532			O	BRAF	pilocytic astrocytoma																																p.G445E	NSCLC(119;1534 1718 44213 46230 50068)	Atlas-SNP	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	314	.	0			c.G1334A						.						76.0	75.0	75.0					7																	138603038		2092	4217	6309	SO:0001583	missense	57670	exon2			CCATCCCCTGATC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1334G>A	chr7.hg19:g.138603038C>T	ENSP00000416040:p.Gly445Glu	101.0	0.0		94.0	13.0	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	hg19	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625850	0.46840	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.61859	0.07;0.1;0.08	4.75	4.75	0.60458	.	0.000000	0.56097	D	0.000026	T	0.64080	0.2566	L	0.34521	1.04	0.32408	N	0.551066	D;D	0.71674	0.997;0.998	P;D	0.66979	0.888;0.948	T	0.67971	-0.5532	10	0.35671	T	0.21	.	15.0735	0.72059	0.0:1.0:0.0:0.0	.	445;445	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	E	445;395;445	ENSP00000406661:G445E;ENSP00000242365:G395E;ENSP00000416040:G445E	ENSP00000242365:G395E	G	-	2	0	KIAA1549	138253578	0.379000	0.25123	0.118000	0.21660	0.097000	0.18754	2.429000	0.44758	2.471000	0.83476	0.655000	0.94253	GGG	.	.		0.532	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
ACTR3B	57180	hgsc.bcm.edu	37	7	152457013	152457013	+	Splice_Site	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr7:152457013T>A	ENST00000256001.8	+	1	178		c.e1+2		ACTR3B_ENST00000377776.3_Splice_Site|RN7SL845P_ENST00000484385.2_RNA|ACTR3B_ENST00000397282.2_Splice_Site|ACTR3B_ENST00000537264.1_Splice_Site	NM_020445.5	NP_065178.1	Q9P1U1	ARP3B_HUMAN	ARP3 actin-related protein 3 homolog B (yeast)							cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	13		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)		TGGCACCGGGTAAGAGCAGCT	0.791																																					.		Atlas-SNP	.											.	ACTR3B	50	.	0			c.44+2T>A						.						2.0	4.0	3.0					7																	152457013		1712	3554	5266	SO:0001630	splice_region_variant	57180	exon1			ACCGGGTAAGAGC		CCDS5934.1, CCDS34782.1	7q36.1	2010-07-20			ENSG00000133627	ENSG00000133627			17256	protein-coding gene	gene with protein product						10806390	Standard	NM_001040135		Approved	ARP11, ARP3beta	uc003wle.2	Q9P1U1	OTTHUMG00000151463	ENST00000256001.8:c.44+2T>A	chr7.hg19:g.152457013T>A		50.0	0.0		44.0	14.0	NM_001040135	A8MTG1|B4DFW4|Q7Z526|Q96BT2	Splice_Site	SNP	ENST00000256001.8	hg19	CCDS5934.1	.	.	.	.	.	.	.	.	.	.	T	18.71	3.681758	0.68042	.	.	ENSG00000133627	ENST00000377776;ENST00000256001	.	.	.	3.31	3.31	0.37934	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.245	0.31682	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACTR3B	152087946	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	1.589000	0.36644	1.505000	0.48720	0.254000	0.18369	.	.	.		0.791	ACTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322803.1	NM_020445	Intron
FABP4	2167	hgsc.bcm.edu	37	8	82391106	82391106	+	Silent	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr8:82391106T>C	ENST00000256104.4	-	4	488	c.393A>G	c.(391-393)agA>agG	p.R131R	RP11-157I4.4_ENST00000524085.2_RNA|FABP4_ENST00000518669.1_5'UTR	NM_001442.2	NP_001433.1	P15090	FABP4_HUMAN	fatty acid binding protein 4, adipocyte	131					brown fat cell differentiation (GO:0050873)|cellular response to lithium ion (GO:0071285)|cholesterol homeostasis (GO:0042632)|cytokine production (GO:0001816)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of inflammatory response (GO:0050729)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|nucleus (GO:0005634)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|large_intestine(1)|ovary(1)|skin(1)	6			Epithelial(68;0.213)			TGGCTTATGCTCTCTCATAAA	0.383																																					p.R131R	NSCLC(35;550 1252 19644 48360)	Atlas-SNP	.											.	FABP4	17	.	0			c.A393G						.						189.0	158.0	168.0					8																	82391106		2203	4300	6503	SO:0001819	synonymous_variant	2167	exon4			TTATGCTCTCTCA	J02874	CCDS6230.1	8q21.13	2013-03-01			ENSG00000170323	ENSG00000170323		"""Fatty acid binding protein family"""	3559	protein-coding gene	gene with protein product		600434				2481498	Standard	NM_001442		Approved	A-FABP, aP2	uc003ycd.2	P15090	OTTHUMG00000164602	ENST00000256104.4:c.393A>G	chr8.hg19:g.82391106T>C		65.0	0.0		108.0	15.0	NM_001442	Q6IBA1	Silent	SNP	ENST00000256104.4	hg19	CCDS6230.1																																																																																			.	.		0.383	FABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379368.1	NM_001442	
CPNE3	8895	hgsc.bcm.edu	37	8	87557040	87557040	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr8:87557040C>G	ENST00000521271.1	+	9	868	c.706C>G	c.(706-708)Ctg>Gtg	p.L236V	CPNE3_ENST00000198765.4_Missense_Mutation_p.L236V	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	236					lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						CATGACAAAACTGAAAGAAGC	0.318																																					p.L236V		Atlas-SNP	.											.	CPNE3	65	.	0			c.C706G						.						148.0	135.0	140.0					8																	87557040		2203	4300	6503	SO:0001583	missense	8895	exon9			ACAAAACTGAAAG	AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.706C>G	chr8.hg19:g.87557040C>G	ENSP00000430934:p.Leu236Val	31.0	0.0		53.0	12.0	NM_003909	A8KA47|Q8IYA1	Missense_Mutation	SNP	ENST00000521271.1	hg19	CCDS6243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.46|16.46	3.128810|3.128810	0.56721|0.56721	.|.	.|.	ENSG00000085719|ENSG00000085719	ENST00000198765;ENST00000521271|ENST00000517391	T;T|.	0.49139|.	0.79;0.79|.	5.8|5.8	5.8|5.8	0.92144|0.92144	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);|.	0.069915|.	0.64402|.	D|.	0.000016|.	T|T	0.76104|0.76104	0.3941|0.3941	M|M	0.77486|0.77486	2.375|2.375	0.58432|0.58432	D|D	0.999996|0.999996	P|.	0.38455|.	0.632|.	B|.	0.35899|.	0.213|.	T|T	0.75929|0.75929	-0.3144|-0.3144	10|5	0.56958|.	D|.	0.05|.	-0.0272|-0.0272	15.6367|15.6367	0.76961|0.76961	0.1379:0.8621:0.0:0.0|0.1379:0.8621:0.0:0.0	.|.	236|.	O75131|.	CPNE3_HUMAN|.	V|K	236|124	ENSP00000198765:L236V;ENSP00000430934:L236V|.	ENSP00000198765:L236V|.	L|N	+|+	1|3	2|2	CPNE3|CPNE3	87626156|87626156	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.222000|2.222000	0.42926|0.42926	2.737000|2.737000	0.93849|0.93849	0.650000|0.650000	0.86243|0.86243	CTG|AAC	.	.		0.318	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1		
AZIN1	51582	hgsc.bcm.edu	37	8	103851904	103851904	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr8:103851904C>G	ENST00000337198.5	-	4	1413	c.250G>C	c.(250-252)Gga>Cga	p.G84R	AZIN1_ENST00000522311.1_5'UTR|AZIN1_ENST00000347770.4_Missense_Mutation_p.G84R	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1	84					cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			AATCCGGTTCCAAGAGCTGCC	0.373																																					p.G84R		Atlas-SNP	.											.	AZIN1	26	.	0			c.G250C						.						117.0	101.0	106.0					8																	103851904		2203	4300	6503	SO:0001583	missense	51582	exon5			CGGTTCCAAGAGC	AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.250G>C	chr8.hg19:g.103851904C>G	ENSP00000337180:p.Gly84Arg	242.0	0.0		274.0	14.0	NM_015878	A6NCD5|Q6IBQ7|Q96D20	Missense_Mutation	SNP	ENST00000337198.5	hg19	CCDS6295.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.865186	0.91511	.	.	ENSG00000155096	ENST00000337198;ENST00000347770;ENST00000520402	T;T	0.64618	-0.11;-0.11	5.6	5.6	0.85130	Orn/DAP/Arg decarboxylase 2, N-terminal (1);	0.052031	0.85682	D	0.000000	D	0.82802	0.5116	M	0.93550	3.43	0.80722	D	1	D	0.76494	0.999	D	0.68483	0.958	D	0.86653	0.1899	10	0.87932	D	0	-10.0944	12.9068	0.58156	0.0:0.926:0.0:0.074	.	84	O14977	AZIN1_HUMAN	R	84	ENSP00000337180:G84R;ENSP00000321507:G84R	ENSP00000337180:G84R	G	-	1	0	AZIN1	103921080	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.048000	0.71046	2.642000	0.89623	0.650000	0.86243	GGA	.	.		0.373	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380133.1		
CDKN2B	1030	hgsc.bcm.edu	37	9	22008820	22008820	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr9:22008820G>T	ENST00000276925.6	-	1	542	c.133C>A	c.(133-135)Cgt>Agt	p.R45S	CDKN2B-AS1_ENST00000582072.1_RNA|CDKN2B-AS1_ENST00000584020.1_RNA|CDKN2B-AS1_ENST00000577551.1_RNA|CDKN2B_ENST00000380142.4_Missense_Mutation_p.R45S|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B_ENST00000539462.1_Missense_Mutation_p.R45S|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2B-AS1_ENST00000584816.1_RNA|CDKN2B-AS1_ENST00000580576.1_RNA|CDKN2B-AS1_ENST00000580467.1_RNA|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2B-AS1_ENST00000584637.1_RNA|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2B-AS1_ENST00000455933.2_RNA|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000584351.1_RNA	NM_004936.3|NM_078487.2	NP_004927.2|NP_511042.1	P42772	CDN2B_HUMAN	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	45					aging (GO:0007568)|cell cycle arrest (GO:0007050)|cellular response to extracellular stimulus (GO:0031668)|cellular response to nutrient (GO:0031670)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|liver development (GO:0001889)|megakaryocyte differentiation (GO:0030219)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to cytokine (GO:0034097)|response to organic cyclic compound (GO:0014070)|spleen development (GO:0048536)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0(1)|p.0?(1)		lung(2)	2		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;1.31e-280)|Lung NSC(2;2.28e-131)|all_lung(2;2.11e-123)|Glioma(2;5.66e-57)|all_neural(2;3.05e-50)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;8.01e-33)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00369)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;3.29e-71)|Epithelial(2;9.08e-60)|LUSC - Lung squamous cell carcinoma(2;5.8e-46)|LUAD - Lung adenocarcinoma(2;1.43e-25)|BRCA - Breast invasive adenocarcinoma(2;5.37e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;6.92e-07)|KIRC - Kidney renal clear cell carcinoma(2;8.63e-07)|OV - Ovarian serous cystadenocarcinoma(39;0.014)|COAD - Colon adenocarcinoma(8;0.143)		CTCCCGAAACGGTTGACTCCG	0.751											OREG0019127	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R45S		Atlas-SNP	.											.	CDKN2B	12	.	2	Whole gene deletion(2)	lung(2)	c.C133A						.						8.0	10.0	9.0					9																	22008820		2177	4233	6410	SO:0001583	missense	1030	exon1			CGAAACGGTTGAC	AB060808	CCDS6512.1, CCDS6513.1	9p21	2008-07-21			ENSG00000147883	ENSG00000147883			1788	protein-coding gene	gene with protein product		600431				8078588	Standard	NM_004936		Approved	P15, MTS2, INK4B, TP15, CDK4I, p15INK4b	uc003zpo.3	P42772	OTTHUMG00000019691	ENST00000276925.6:c.133C>A	chr9.hg19:g.22008820G>T	ENSP00000276925:p.Arg45Ser	181.0	0.0	752	100.0	5.0	NM_078487	O15125|Q6FI09	Missense_Mutation	SNP	ENST00000276925.6	hg19	CCDS6512.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571555	0.28003	.	.	ENSG00000147883	ENST00000276925;ENST00000380142;ENST00000539462	T;T;T	0.78816	-1.21;1.59;1.59	5.86	-1.71	0.08133	Ankyrin repeat-containing domain (3);	0.762297	0.13007	N	0.421239	T	0.47469	0.1447	N	0.10837	0.055	0.30740	N	0.746244	B;B	0.23735	0.006;0.09	B;B	0.23419	0.011;0.046	T	0.42799	-0.9430	10	0.07325	T	0.83	-0.8145	1.3886	0.02246	0.2845:0.234:0.3586:0.123	.	45;45	P42772;O15125	CDN2B_HUMAN;.	S	45	ENSP00000276925:R45S;ENSP00000369487:R45S;ENSP00000445136:R45S	ENSP00000276925:R45S	R	-	1	0	CDKN2B	21998820	0.010000	0.17322	0.918000	0.36340	0.905000	0.53344	-1.412000	0.02476	-0.656000	0.05380	0.650000	0.86243	CGT	.	.		0.751	CDKN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051932.2	NM_004936	
SPATA31D1	389763	hgsc.bcm.edu	37	9	84606758	84606758	+	Missense_Mutation	SNP	T	T	C	rs201640408		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr9:84606758T>C	ENST00000344803.2	+	4	1420	c.1373T>C	c.(1372-1374)aTt>aCt	p.I458T		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	458					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TTAACCTCAATTGCTGTTAAG	0.423													T|||	1	0.000199681	0.0008	0.0	5008	,	,		21068	0.0		0.0	False		,,,				2504	0.0				p.I458T		Atlas-SNP	.											.	.	.	.	0			c.T1373C						.	T	THR/ILE	5,3897		0,5,1946	92.0	85.0	87.0		1373	-1.5	0.0	9		87	1,8275		0,1,4137	no	missense	FAM75D1	NM_001001670.2	89	0,6,6083	CC,CT,TT		0.0121,0.1281,0.0493	benign	458/1577	84606758	6,12172	1951	4138	6089	SO:0001583	missense	389763	exon4			CCTCAATTGCTGT		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1373T>C	chr9.hg19:g.84606758T>C	ENSP00000341988:p.Ile458Thr	155.0	0.0		183.0	22.0	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	hg19	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	T	0.062	-1.221669	0.01530	0.001281	1.21E-4	ENSG00000214929	ENST00000344803	T	0.04706	3.57	2.41	-1.55	0.08558	.	2.368510	0.02041	N	0.049316	T	0.04588	0.0125	L	0.39633	1.23	0.09310	N	1	B	0.24882	0.113	B	0.26517	0.07	T	0.38067	-0.9678	10	0.18276	T	0.48	15.7014	2.1098	0.03700	0.2442:0.3116:0.0:0.4442	.	458	Q6ZQQ2	F75D1_HUMAN	T	458	ENSP00000341988:I458T	ENSP00000341988:I458T	I	+	2	0	FAM75D1	83796578	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.642000	0.02006	-0.344000	0.08338	0.416000	0.27883	ATT	.	.		0.423	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
NR5A1	2516	hgsc.bcm.edu	37	9	127265483	127265483	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr9:127265483G>A	ENST00000373588.4	-	3	315	c.119C>T	c.(118-120)aCg>aTg	p.T40M		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	40					adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						GTTCTGCACCGTGCGCTTGAA	0.652																																					p.T40M		Atlas-SNP	.											.	NR5A1	32	.	0			c.C119T						.						59.0	51.0	53.0					9																	127265483		2197	4296	6493	SO:0001583	missense	2516	exon3			TGCACCGTGCGCT	D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.119C>T	chr9.hg19:g.127265483G>A	ENSP00000362690:p.Thr40Met	97.0	0.0		43.0	7.0	NM_004959	O15196|Q5T6F5	Missense_Mutation	SNP	ENST00000373588.4	hg19	CCDS6856.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267180	0.80469	.	.	ENSG00000136931	ENST00000373588;ENST00000455734	D;D	0.97731	-4.51;-4.51	4.57	3.68	0.42216	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.98495	0.9498	M	0.83118	2.625	0.53688	D	0.999975	D	0.89917	1.0	D	0.97110	1.0	D	0.99007	1.0813	10	0.87932	D	0	.	11.9196	0.52785	0.086:0.0:0.914:0.0	.	40	Q13285	STF1_HUMAN	M	40	ENSP00000362690:T40M;ENSP00000393245:T40M	ENSP00000362690:T40M	T	-	2	0	NR5A1	126305304	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.906000	0.87423	1.024000	0.39682	0.455000	0.32223	ACG	.	.		0.652	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054029.1	NM_004959	
OLFML2A	169611	hgsc.bcm.edu	37	9	127570169	127570169	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr9:127570169C>T	ENST00000373580.3	+	7	1278	c.1278C>T	c.(1276-1278)gaC>gaT	p.D426D	OLFML2A_ENST00000288815.5_Silent_p.D212D	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	426	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						CAGCTCGAGACGACAGGATCT	0.607																																					p.D426D		Atlas-SNP	.											.	OLFML2A	61	.	0			c.C1278T						.						85.0	85.0	85.0					9																	127570169		2203	4300	6503	SO:0001819	synonymous_variant	169611	exon7			TCGAGACGACAGG	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.1278C>T	chr9.hg19:g.127570169C>T		186.0	0.0		87.0	12.0	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Silent	SNP	ENST00000373580.3	hg19	CCDS6857.2																																																																																			.	.		0.607	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
SPTAN1	6709	hgsc.bcm.edu	37	9	131339545	131339545	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr9:131339545A>G	ENST00000372731.4	+	7	1033	c.923A>G	c.(922-924)gAa>gGa	p.E308G	SPTAN1_ENST00000372739.3_Missense_Mutation_p.E308G|SPTAN1_ENST00000358161.5_Missense_Mutation_p.E308G	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	308					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GCTGCTCTAGAAGACAAGGTG	0.483																																					p.E308G	NSCLC(120;833 1744 2558 35612 37579)	Atlas-SNP	.											.	SPTAN1	266	.	0			c.A923G						.						112.0	111.0	111.0					9																	131339545		2203	4300	6503	SO:0001583	missense	6709	exon7			CTCTAGAAGACAA	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.923A>G	chr9.hg19:g.131339545A>G	ENSP00000361816:p.Glu308Gly	74.0	0.0		102.0	10.0	NM_003127	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	hg19	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.829482	0.50845	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.53857	0.6;0.6;0.6	6.17	6.17	0.99709	.	0.202954	0.52532	D	0.000068	T	0.52869	0.1761	L	0.28504	0.86	0.80722	D	1	B;B;B;B;B	0.29862	0.01;0.173;0.259;0.126;0.005	B;B;B;B;B	0.42625	0.009;0.122;0.393;0.049;0.006	T	0.53837	-0.8382	10	0.51188	T	0.08	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	308;308;308;308;308	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	G	308	ENSP00000350882:E308G;ENSP00000361816:E308G;ENSP00000361824:E308G	ENSP00000350882:E308G	E	+	2	0	SPTAN1	130379366	1.000000	0.71417	0.998000	0.56505	0.503000	0.33858	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	GAA	.	.		0.483	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
TSC1	7248	hgsc.bcm.edu	37	9	135779815	135779815	+	Missense_Mutation	SNP	T	T	C	rs118203620		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr9:135779815T>C	ENST00000298552.3	-	16	2245	c.2024A>G	c.(2023-2025)gAc>gGc	p.D675G	TSC1_ENST00000545250.1_Missense_Mutation_p.D624G|TSC1_ENST00000440111.2_Missense_Mutation_p.D675G	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	675					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GTGGGTCCAGTCGACAGACTT	0.443			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.D675G		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	TSC1	167	.	1	Unknown(1)	bone(1)	c.A2024G						.						68.0	64.0	65.0					9																	135779815		2203	4300	6503	SO:0001583	missense	7248	exon16	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GTCCAGTCGACAG	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2024A>G	chr9.hg19:g.135779815T>C	ENSP00000298552:p.Asp675Gly	107.0	0.0		103.0	10.0	NM_000368	B7Z897|Q5VVN5	Missense_Mutation	SNP	ENST00000298552.3	hg19	CCDS6956.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.311024	0.81358	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;D	0.88741	-2.42;-2.42;-2.42	5.5	4.34	0.51931	.	0.088458	0.85682	D	0.000000	D	0.93197	0.7833	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77004	0.989;0.984	D	0.92618	0.6105	10	0.59425	D	0.04	-22.2566	11.0075	0.47644	0.1396:0.0:0.0:0.8604	.	624;675	B7Z897;Q92574	.;TSC1_HUMAN	G	675;675;624	ENSP00000298552:D675G;ENSP00000394524:D675G;ENSP00000444017:D624G	ENSP00000298552:D675G	D	-	2	0	TSC1	134769636	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	0.877000	0.35895	0.533000	0.62120	GAC	.	.		0.443	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
FAM13C	220965	hgsc.bcm.edu	37	10	61029804	61029804	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr10:61029804C>G	ENST00000373868.2	-	7	745	c.658G>C	c.(658-660)Gtg>Ctg	p.V220L	FAM13C_ENST00000419214.2_Missense_Mutation_p.V220L|FAM13C_ENST00000422313.2_Missense_Mutation_p.V220L|FAM13C_ENST00000435852.2_Missense_Mutation_p.V220L|FAM13C_ENST00000468840.2_Missense_Mutation_p.V137L|FAM13C_ENST00000373867.3_Missense_Mutation_p.V137L|FAM13C_ENST00000442566.3_Missense_Mutation_p.V241L|FAM13C_ENST00000277705.6_Missense_Mutation_p.V241L	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	220										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CTGGTCCCCACAGAGTGGAGG	0.517																																					p.V220L		Atlas-SNP	.											.	FAM13C	124	.	0			c.G658C						.						106.0	96.0	100.0					10																	61029804		2203	4300	6503	SO:0001583	missense	220965	exon7			TCCCCACAGAGTG	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.658G>C	chr10.hg19:g.61029804C>G	ENSP00000362975:p.Val220Leu	58.0	0.0		76.0	8.0	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	hg19	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	C	4.735	0.136632	0.09032	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;1.03;-1.13;-1.13;-1.13	5.53	-3.52	0.04682	.	0.727883	0.12602	N	0.454628	T	0.53514	0.1801	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.09022	0.0;0.0;0.002;0.0;0.0	B;B;B;B;B	0.08055	0.002;0.0;0.003;0.001;0.001	T	0.36114	-0.9761	10	0.13470	T	0.59	-0.1347	0.8453	0.01160	0.3254:0.1425:0.3086:0.2234	.	220;137;220;220;220	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	L	137;220;241;241;220;137;220;220	ENSP00000362974:V137L;ENSP00000362975:V220L;ENSP00000395661:V241L;ENSP00000277705:V241L;ENSP00000391993:V220L;ENSP00000423896:V137L;ENSP00000392302:V220L;ENSP00000400241:V220L	ENSP00000277705:V241L	V	-	1	0	FAM13C	60699810	0.001000	0.12720	0.010000	0.14722	0.982000	0.71751	-0.490000	0.06482	-0.237000	0.09739	0.655000	0.94253	GTG	.	.		0.517	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
ANK3	288	hgsc.bcm.edu	37	10	61847908	61847908	+	Silent	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr10:61847908G>T	ENST00000280772.2	-	29	3728	c.3537C>A	c.(3535-3537)ctC>ctA	p.L1179L	ANK3_ENST00000355288.2_Silent_p.L313L|ANK3_ENST00000503366.1_Silent_p.L1180L|ANK3_ENST00000373827.2_Silent_p.L1173L	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1179	ZU5 2. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ACATTACCTGGAGGCCCACTC	0.458																																					p.L1180L		Atlas-SNP	.											.	ANK3	703	.	0			c.C3540A						.						93.0	95.0	94.0					10																	61847908		2203	4300	6503	SO:0001819	synonymous_variant	288	exon30			TACCTGGAGGCCC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3537C>A	chr10.hg19:g.61847908G>T		73.0	0.0		60.0	8.0	NM_001204404	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	hg19	CCDS7258.1																																																																																			.	.		0.458	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
CDH23	64072	hgsc.bcm.edu	37	10	73567129	73567129	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr10:73567129G>T	ENST00000224721.6	+	57	8294	c.8289G>T	c.(8287-8289)gaG>gaT	p.E2763D	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.E518D	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2758	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						ATGCAGATGAGGGCCCCAACG	0.612																																					p.E2758D		Atlas-SNP	.											.	CDH23	365	.	0			c.G8274T						.						38.0	45.0	43.0					10																	73567129		2119	4231	6350	SO:0001583	missense	64072	exon56			AGATGAGGGCCCC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.8289G>T	chr10.hg19:g.73567129G>T	ENSP00000224721:p.Glu2763Asp	213.0	0.0		120.0	6.0	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	hg19		.	.	.	.	.	.	.	.	.	.	G	16.69	3.191983	0.58017	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.53206	0.63	4.77	1.87	0.25490	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.55178	0.1904	L	0.48935	1.535	0.53688	D	0.999974	D;D	0.89917	1.0;0.996	D;D	0.91635	0.999;0.953	T	0.45977	-0.9224	10	0.32370	T	0.25	.	8.4233	0.32714	0.309:0.0:0.691:0.0	.	2758;2758	E9PEX1;Q9H251	.;CAD23_HUMAN	D	2763;2758;2761;518	ENSP00000381768:E518D	ENSP00000224721:E2763D	E	+	3	2	CDH23	73237135	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	1.451000	0.35145	0.226000	0.20979	0.551000	0.68910	GAG	.	.		0.612	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
PNLIPRP3	119548	hgsc.bcm.edu	37	10	118202687	118202687	+	Splice_Site	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr10:118202687G>C	ENST00000369230.3	+	3	470		c.e3+1			NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3						lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		CATGTGCAATGTATGACATGA	0.378																																					.		Atlas-SNP	.											.	PNLIPRP3	101	.	0			c.324+1G>C						.						130.0	114.0	119.0					10																	118202687		2203	4300	6503	SO:0001630	splice_region_variant	119548	exon3			TGCAATGTATGAC	BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.324+1G>C	chr10.hg19:g.118202687G>C		67.0	0.0		91.0	7.0	NM_001011709		Splice_Site	SNP	ENST00000369230.3	hg19	CCDS31292.1	.	.	.	.	.	.	.	.	.	.	G	7.452	0.642850	0.14451	.	.	ENSG00000203837	ENST00000369230	.	.	.	4.64	2.71	0.32032	.	.	.	.	.	.	.	.	.	.	.	0.20821	N	0.999842	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9681	0.24635	0.1022:0.1803:0.7175:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PNLIPRP3	118192677	1.000000	0.71417	0.003000	0.11579	0.019000	0.09904	3.807000	0.55591	1.050000	0.40346	0.650000	0.86243	.	.	.		0.378	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404	Intron
OR51G1	79324	hgsc.bcm.edu	37	11	4944890	4944890	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr11:4944890A>G	ENST00000321961.2	-	1	747	c.680T>C	c.(679-681)gTg>gCg	p.V227A	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AATGCTGAGCACGGTGCGAAG	0.537																																					p.V227A		Atlas-SNP	.											.	OR51G1	74	.	0			c.T680C						.						127.0	101.0	110.0					11																	4944890		2201	4298	6499	SO:0001583	missense	79324	exon1			CTGAGCACGGTGC	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.680T>C	chr11.hg19:g.4944890A>G	ENSP00000322546:p.Val227Ala	71.0	0.0		90.0	19.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	hg19	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.370337	0.42003	.	.	ENSG00000176879	ENST00000321961	T	0.00316	8.13	4.28	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35525	U	0.003159	T	0.00754	0.0025	M	0.91972	3.26	0.18873	N	0.999988	P	0.49447	0.924	P	0.60415	0.874	T	0.11767	-1.0574	10	0.72032	D	0.01	.	12.3688	0.55244	1.0:0.0:0.0:0.0	.	227	Q8NGK1	O51G1_HUMAN	A	227	ENSP00000322546:V227A	ENSP00000322546:V227A	V	-	2	0	OR51G1	4901466	0.094000	0.21725	0.011000	0.14972	0.009000	0.06853	3.629000	0.54266	1.808000	0.52836	0.374000	0.22700	GTG	.	.		0.537	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
CSNK2A3	283106	hgsc.bcm.edu	37	11	11374643	11374643	+	Missense_Mutation	SNP	C	C	A	rs566174971	byFrequency	TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr11:11374643C>A	ENST00000528848.2	-	1	261	c.24G>T	c.(22-24)agG>agT	p.R8S	GALNT18_ENST00000227756.4_Intron|RP11-567I13.1_ENST00000526867.1_RNA	NM_001256686.1	NP_001243615.1	Q8NEV1	CSK23_HUMAN	casein kinase 2, alpha 3 polypeptide	8					positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)										AAACTCTGGCCCTGCTTGGCA	0.512																																					p.R8S		Atlas-SNP	.											.	.	.	.	0			c.G24T						.																																			SO:0001583	missense	283106	exon1			TCTGGCCCTGCTT	X64692	CCDS59224.1	11p15.3	2013-01-18	2013-01-17	2013-01-17	ENSG00000254598	ENSG00000254598			2458	protein-coding gene	gene with protein product			"""casein kinase 2, alpha 1 polypeptide pseudogene"""	CSNK2A1P		12102635, 1610905, 20625391	Standard	NM_001256686		Approved		uc001mjp.4	Q8NEV1	OTTHUMG00000165708	ENST00000528848.2:c.24G>T	chr11.hg19:g.11374643C>A	ENSP00000473553:p.Arg8Ser	120.0	0.0		113.0	9.0	NM_001256686		Missense_Mutation	SNP	ENST00000528848.2	hg19	CCDS59224.1																																																																																			.	.		0.512	CSNK2A3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385850.3	NM_001256686	
NOX4	50507	hgsc.bcm.edu	37	11	89173873	89173873	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr11:89173873T>A	ENST00000263317.4	-	6	696	c.458A>T	c.(457-459)aAa>aTa	p.K153I	NOX4_ENST00000343727.5_Missense_Mutation_p.K129I|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000534731.1_Missense_Mutation_p.K153I|NOX4_ENST00000525196.1_Missense_Mutation_p.K153I|NOX4_ENST00000535633.1_Missense_Mutation_p.K129I|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000542487.1_Missense_Mutation_p.K129I|NOX4_ENST00000532825.1_Missense_Mutation_p.K129I|NOX4_ENST00000527956.1_Missense_Mutation_p.K129I|NOX4_ENST00000528341.1_Missense_Mutation_p.K128I|NOX4_ENST00000413594.2_Missense_Mutation_p.K174I|NOX4_ENST00000424319.1_Missense_Mutation_p.K129I			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	153	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				GAAGAGAAGTTTTCTAGGATC	0.333																																					p.K153I		Atlas-SNP	.											NOX4,NS,carcinoma,0,1	NOX4	101	.	0			c.A458T						.						39.0	39.0	39.0					11																	89173873		2201	4299	6500	SO:0001583	missense	50507	exon6			AGAAGTTTTCTAG	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.458A>T	chr11.hg19:g.89173873T>A	ENSP00000263317:p.Lys153Ile	294.0	0.0		248.0	34.0	NM_001143836	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	hg19	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	T	13.22	2.172610	0.38413	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000528341;ENST00000413594	D;D;D;D;D;D;D;D;D;D;D	0.95622	-3.69;-3.69;-3.69;-3.67;-3.69;-3.62;-3.76;-3.69;-3.69;-3.67;-3.73	5.92	4.79	0.61399	Flavoprotein transmembrane component (1);	0.392618	0.28933	N	0.013670	D	0.94335	0.8179	L	0.39147	1.195	0.45161	D	0.998174	B;P;D;B;B	0.65815	0.04;0.8;0.995;0.074;0.091	B;P;P;B;B	0.54815	0.05;0.474;0.761;0.039;0.19	D	0.92367	0.5902	9	.	.	.	-17.5217	9.8969	0.41324	0.0:0.0784:0.0:0.9216	.	129;128;153;153;153	E9PMY6;E9PPP2;E9PI95;Q9NPH5-6;Q9NPH5	.;.;.;.;NOX4_HUMAN	I	129;129;129;153;153;153;129;129;129;128;174	ENSP00000412446:K129I;ENSP00000440172:K129I;ENSP00000344747:K129I;ENSP00000436892:K153I;ENSP00000436716:K153I;ENSP00000263317:K153I;ENSP00000434924:K129I;ENSP00000433797:K129I;ENSP00000439373:K129I;ENSP00000436970:K128I;ENSP00000405705:K174I	.	K	-	2	0	NOX4	88813521	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.125000	0.42016	1.060000	0.40578	-0.290000	0.09829	AAA	.	.		0.333	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
LAYN	143903	hgsc.bcm.edu	37	11	111431016	111431016	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr11:111431016T>C	ENST00000375615.3	+	8	1167	c.982T>C	c.(982-984)Tct>Cct	p.S328P	LAYN_ENST00000525126.1_3'UTR|LAYN_ENST00000436913.2_Missense_Mutation_p.S175P|LAYN_ENST00000533265.1_3'UTR|LAYN_ENST00000375614.2_Missense_Mutation_p.S320P	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	328						cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	CGATGACATGTCTTGTGACTA	0.468																																					p.S328P	Ovarian(17;551 586 12136 22082 22900)	Atlas-SNP	.											.	LAYN	35	.	0			c.T982C						.						140.0	120.0	126.0					11																	111431016		2201	4297	6498	SO:0001583	missense	143903	exon8			GACATGTCTTGTG		CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.982T>C	chr11.hg19:g.111431016T>C	ENSP00000364765:p.Ser328Pro	162.0	0.0		167.0	33.0	NM_001258390	A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	ENST00000375615.3	hg19	CCDS58178.1	.	.	.	.	.	.	.	.	.	.	T	10.61	1.399070	0.25291	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000436913;ENST00000541011	T;T	0.05717	3.81;3.4	6.03	4.91	0.64330	.	0.142643	0.48286	D	0.000182	T	0.07818	0.0196	L	0.43701	1.375	0.37041	D	0.897144	B;B;B	0.21905	0.062;0.029;0.058	B;B;B	0.31101	0.124;0.023;0.022	T	0.25152	-1.0140	10	0.27785	T	0.31	-16.5524	11.3556	0.49613	0.0:0.0708:0.0:0.9292	.	175;328;320	B4DJU0;Q6UX15;Q6UX15-2	.;LAYN_HUMAN;.	P	320;328;175;283	ENSP00000364764:S320P;ENSP00000364765:S328P	ENSP00000364764:S320P	S	+	1	0	LAYN	110936226	0.981000	0.34729	0.933000	0.37362	0.257000	0.26127	1.498000	0.35660	2.308000	0.77769	0.533000	0.62120	TCT	.	.		0.468	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391187.1	NM_178834	
AMICA1	120425	hgsc.bcm.edu	37	11	118071326	118071326	+	Splice_Site	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr11:118071326T>C	ENST00000356289.5	-	7	947	c.774A>G	c.(772-774)acA>acG	p.T258T	AMICA1_ENST00000292067.7_Splice_Site_p.T248T|AMICA1_ENST00000526620.1_Splice_Site_p.T219T|AMICA1_ENST00000533261.1_Splice_Site_p.T247T	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	258					blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GGGTCACCAGTGCTTGGGAAA	0.542																																					p.T258T		Atlas-SNP	.											.	AMICA1	49	.	0			c.A774G						.						66.0	69.0	68.0					11																	118071326		2200	4296	6496	SO:0001630	splice_region_variant	120425	exon7			CACCAGTGCTTGG	AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.773-1A>G	chr11.hg19:g.118071326T>C		89.0	0.0		76.0	12.0	NM_001098526	B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Silent	SNP	ENST00000356289.5	hg19	CCDS41723.1																																																																																			.	.		0.542	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392105.2	NM_153206	Silent
ITFG2	55846	hgsc.bcm.edu	37	12	2932026	2932026	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:2932026C>T	ENST00000228799.2	+	10	1154	c.1015C>T	c.(1015-1017)Cgc>Tgc	p.R339C	ITFG2_ENST00000419778.2_Missense_Mutation_p.R162C|ITFG2_ENST00000542548.1_Missense_Mutation_p.R227C	NM_018463.3	NP_060933.3	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	339					germinal center B cell differentiation (GO:0002314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)	19			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGATCACAACCGCACCGTCGT	0.512																																					p.R339C		Atlas-SNP	.											.	ITFG2	38	.	0			c.C1015T						.						145.0	111.0	123.0					12																	2932026		2203	4300	6503	SO:0001583	missense	55846	exon10			CACAACCGCACCG	AF220048	CCDS8513.1	12p13.33	2006-11-29		2006-07-25	ENSG00000111203	ENSG00000111203			30879	protein-coding gene	gene with protein product						12477932	Standard	NM_018463		Approved	MDS028	uc001qlb.2	Q969R8	OTTHUMG00000130617	ENST00000228799.2:c.1015C>T	chr12.hg19:g.2932026C>T	ENSP00000228799:p.Arg339Cys	150.0	0.0		85.0	5.0	NM_018463	A8K4Z5|D3DUQ2|Q6PKU5|Q96SX6	Missense_Mutation	SNP	ENST00000228799.2	hg19	CCDS8513.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575724	0.86645	.	.	ENSG00000111203	ENST00000228799;ENST00000419778;ENST00000542548	T;T;T	0.70869	-0.52;2.26;2.26	5.08	5.08	0.68730	.	0.055569	0.64402	D	0.000001	D	0.83557	0.5280	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.64506	0.926	D	0.86116	0.1565	10	0.87932	D	0	-8.6533	17.476	0.87659	0.0:1.0:0.0:0.0	.	339	Q969R8	ITFG2_HUMAN	C	339;162;227	ENSP00000228799:R339C;ENSP00000401103:R162C;ENSP00000437870:R227C	ENSP00000228799:R339C	R	+	1	0	ITFG2	2802287	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	4.684000	0.61686	2.375000	0.81037	0.561000	0.74099	CGC	.	.		0.512	ITFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253091.1	NM_018463	
ATF7IP	55729	hgsc.bcm.edu	37	12	14578068	14578068	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:14578068G>A	ENST00000540793.1	+	1	1374	c.1219G>A	c.(1219-1221)Gta>Ata	p.V407I	ATF7IP_ENST00000261168.4_Missense_Mutation_p.V407I|ATF7IP_ENST00000543189.1_Missense_Mutation_p.V407I|ATF7IP_ENST00000544627.1_Missense_Mutation_p.V415I|ATF7IP_ENST00000536444.1_Missense_Mutation_p.V407I|ATF7IP_ENST00000541654.1_3'UTR			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	407	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						TGCAGATCTTGTAGAAACGAT	0.328																																					p.V407I		Atlas-SNP	.											.	ATF7IP	136	.	0			c.G1219A						.						56.0	59.0	58.0					12																	14578068		2203	4300	6503	SO:0001583	missense	55729	exon2			GATCTTGTAGAAA	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1219G>A	chr12.hg19:g.14578068G>A	ENSP00000444589:p.Val407Ile	105.0	0.0		110.0	16.0	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	hg19	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	G	4.125	0.021496	0.08006	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.24538	2.18;2.18;2.18;2.17;1.85;2.18	5.36	-4.75	0.03239	.	1.318910	0.05130	N	0.492347	T	0.17323	0.0416	L	0.44542	1.39	0.09310	N	1	B;B;B;B;B;B;B	0.16802	0.019;0.004;0.0;0.0;0.0;0.001;0.002	B;B;B;B;B;B;B	0.12837	0.008;0.003;0.0;0.001;0.001;0.002;0.002	T	0.27905	-1.0060	10	0.27785	T	0.31	0.5134	3.5649	0.07896	0.4759:0.2744:0.1556:0.0942	.	415;407;415;407;407;407;18	B4E2A2;B4DRL6;F5GX74;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;.;MCAF1_HUMAN;.;.	I	407;407;407;415;407;407	ENSP00000261168:V407I;ENSP00000443179:V407I;ENSP00000445955:V407I;ENSP00000440440:V415I;ENSP00000379575:V407I;ENSP00000444589:V407I	ENSP00000261168:V407I	V	+	1	0	ATF7IP	14469335	0.000000	0.05858	0.000000	0.03702	0.295000	0.27426	-0.961000	0.03845	-0.601000	0.05783	0.591000	0.81541	GTA	.	.		0.328	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
FGD4	121512	hgsc.bcm.edu	37	12	32729344	32729344	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:32729344G>C	ENST00000427716.2	+	3	477	c.53G>C	c.(52-54)aGt>aCt	p.S18T	FGD4_ENST00000472289.1_Missense_Mutation_p.S18T|FGD4_ENST00000534526.2_Missense_Mutation_p.S155T|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000546442.1_Intron|FGD4_ENST00000531134.1_Missense_Mutation_p.S103T|FGD4_ENST00000473513.1_3'UTR|FGD4_ENST00000525053.1_Missense_Mutation_p.S130T	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	18	Actin filament-binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GAAAAACCCAGTAAGGTATCA	0.418																																					p.S18T		Atlas-SNP	.											.	FGD4	86	.	0			c.G53C						.						94.0	90.0	91.0					12																	32729344		2203	4300	6503	SO:0001583	missense	121512	exon3			AACCCAGTAAGGT	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.53G>C	chr12.hg19:g.32729344G>C	ENSP00000394487:p.Ser18Thr	181.0	0.0		121.0	19.0	NM_139241	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	hg19	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664198	0.29604	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000472289;ENST00000427716;ENST00000525053	T;T;T;T	0.72942	-0.7;-0.65;-0.7;-0.66	5.51	4.62	0.57501	.	0.000000	0.64402	D	0.000018	T	0.71239	0.3316	N	0.19112	0.55	0.80722	D	1	B;B;B;D	0.89917	0.077;0.077;0.016;1.0	B;B;B;D	0.72982	0.015;0.015;0.015;0.979	T	0.73965	-0.3816	10	0.72032	D	0.01	-10.954	9.7655	0.40559	0.0735:0.1402:0.7863:0.0	.	130;103;18;18	E9PJX4;B7Z493;Q96M96;E9PQT1	.;.;FGD4_HUMAN;.	T	155;103;18;18;130	ENSP00000449273:S155T;ENSP00000431323:S103T;ENSP00000394487:S18T;ENSP00000433666:S130T	ENSP00000379089:S18T	S	+	2	0	FGD4	32620611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.763000	0.38461	1.328000	0.45358	0.591000	0.81541	AGT	.	.		0.418	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
NCKAP5L	57701	hgsc.bcm.edu	37	12	50189083	50189083	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:50189083C>T	ENST00000335999.6	-	8	2761	c.2560G>A	c.(2560-2562)Ggt>Agt	p.G854S		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	850	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						GTGGTACTACCACAGTCTGCC	0.642																																					p.G854S		Atlas-SNP	.											.	NCKAP5L	142	.	0			c.G2560A						.						89.0	93.0	92.0					12																	50189083		1934	4127	6061	SO:0001583	missense	57701	exon8			TACTACCACAGTC	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.2560G>A	chr12.hg19:g.50189083C>T	ENSP00000337998:p.Gly854Ser	76.0	0.0		46.0	4.0	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	ENST00000335999.6	hg19	CCDS41781.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.520|4.520	0.096470|0.096470	0.08681|0.08681	.|.	.|.	ENSG00000167566|ENSG00000167566	ENST00000335999;ENST00000354423|ENST00000433948	T|.	0.41758|.	0.99|.	4.5|4.5	1.6|1.6	0.23607|0.23607	.|.	0.161340|.	0.29814|.	N|.	0.011126|.	T|.	0.26412|.	0.0645|.	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B;B;B|.	0.06786|.	0.0;0.0;0.001|.	B;B;B|.	0.13407|.	0.002;0.001;0.009|.	T|.	0.21999|.	-1.0229|.	10|.	0.15952|.	T|.	0.53|.	-2.1028|-2.1028	3.5867|3.5867	0.07973|0.07973	0.1747:0.5436:0.0:0.2817|0.1747:0.5436:0.0:0.2817	.|.	828;850;850|.	E2QRB5;Q9HCH0;Q9HCH0-2|.	.;NCK5L_HUMAN;.|.	S|X	854;828|568	ENSP00000337998:G854S|.	ENSP00000337998:G854S|.	G|W	-|-	1|2	0|0	NCKAP5L|NCKAP5L	48475350|48475350	0.001000|0.001000	0.12720|0.12720	0.155000|0.155000	0.22561|0.22561	0.780000|0.780000	0.44128|0.44128	0.225000|0.225000	0.17757|0.17757	0.225000|0.225000	0.20959|0.20959	0.561000|0.561000	0.74099|0.74099	GGT|TGG	.	.		0.642	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
MAP3K12	7786	hgsc.bcm.edu	37	12	53895919	53895919	+	5'Flank	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:53895919C>A	ENST00000267079.2	-	0	0				MAP3K12_ENST00000547488.1_5'Flank|TARBP2_ENST00000266987.2_Missense_Mutation_p.H58Q|RP11-793H13.11_ENST00000602306.1_RNA|TARBP2_ENST00000549028.1_3'UTR|TARBP2_ENST00000456234.2_Missense_Mutation_p.H37Q|TARBP2_ENST00000394357.2_Missense_Mutation_p.H37Q|TARBP2_ENST00000552857.1_Intron|MAP3K12_ENST00000547151.1_5'Flank	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12						histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GCCAAGCCCACCAGCCTAATT	0.602																																					p.H58Q		Atlas-SNP	.											.	TARBP2	35	.	0			c.C174A						.						86.0	73.0	78.0					12																	53895919		2203	4300	6503	SO:0001631	upstream_gene_variant	6895	exon2			AGCCCACCAGCCT	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854		chr12.hg19:g.53895919C>A	Exception_encountered	127.0	0.0		84.0	18.0	NM_134323	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	hg19	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278904	0.59758	.	.	ENSG00000139546	ENST00000266987;ENST00000456234;ENST00000549610;ENST00000394357	T;T;T	0.80033	-1.33;-1.33;-1.33	3.95	2.63	0.31362	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.053041	0.64402	D	0.000001	D	0.91277	0.7250	H	0.96576	3.845	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.81914	0.986;0.995;0.992	D	0.89643	0.3864	10	0.87932	D	0	-3.2345	6.7823	0.23652	0.0:0.7193:0.0:0.2807	.	58;58;58	F8VWR8;A8K3X2;Q15633	.;.;TRBP2_HUMAN	Q	58;37;58;37	ENSP00000266987:H58Q;ENSP00000416077:H37Q;ENSP00000377885:H37Q	ENSP00000266987:H58Q	H	+	3	2	TARBP2	52182186	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.796000	0.38794	0.634000	0.30469	0.467000	0.42956	CAC	.	.		0.602	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
AGAP2	116986	hgsc.bcm.edu	37	12	58131312	58131312	+	Missense_Mutation	SNP	C	C	T	rs561812307		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:58131312C>T	ENST00000547588.1	-	1	717	c.718G>A	c.(718-720)Gcc>Acc	p.A240T	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	240					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						gcggcggcggcggtggcggcg	0.706																																					p.A240T		Atlas-SNP	.											AGAP2_ENST00000547588,NS,carcinoma,0,1	AGAP2	167	.	0			c.G718A						.						4.0	6.0	5.0					12																	58131312		1428	3301	4729	SO:0001583	missense	116986	exon1			CGGCGGCGGTGGC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.718G>A	chr12.hg19:g.58131312C>T	ENSP00000449241:p.Ala240Thr	114.0	1.0		60.0	3.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	ENST00000547588.1	hg19	CCDS44932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.24|10.24	1.294811|1.294811	0.23564|0.23564	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000547588|ENST00000328568	T|.	0.39997|.	1.05|.	3.81|3.81	-1.14|-1.14	0.09741|0.09741	.|.	1.354790|.	0.05448|.	N|.	0.548952|.	T|T	0.10508|0.10508	0.0257|0.0257	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.14012|.	0.009;0.005|.	B;B|.	0.06405|.	0.002;0.001|.	T|T	0.24548|0.24548	-1.0157|-1.0157	10|5	0.56958|.	D|.	0.05|.	.|.	0.5619|0.5619	0.00680|0.00680	0.1874:0.3561:0.184:0.2724|0.1874:0.3561:0.184:0.2724	.|.	240;240|.	F8VVT9;Q99490|.	.;AGAP2_HUMAN|.	T|H	240|103	ENSP00000449241:A240T|.	ENSP00000449241:A240T|.	A|R	-|-	1|2	0|0	AGAP2|AGAP2	56417579|56417579	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.016000|0.016000	0.09150|0.09150	0.086000|0.086000	0.14935|0.14935	-0.555000|-0.555000	0.06142|0.06142	0.455000|0.455000	0.32223|0.32223	GCC|CGC	.	.		0.706	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
SLC35E3	55508	hgsc.bcm.edu	37	12	69145812	69145812	+	Splice_Site	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:69145812T>C	ENST00000398004.2	+	3	786	c.514T>C	c.(514-516)Tgg>Cgg	p.W172R		NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	172						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			TAATTTTCAGTGGGTAGGAGC	0.433																																					p.W172R		Atlas-SNP	.											.	SLC35E3	23	.	0			c.T514C						.						146.0	133.0	137.0					12																	69145812		1931	4145	6076	SO:0001630	splice_region_variant	55508	exon3			TTTCAGTGGGTAG	AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.514-1T>C	chr12.hg19:g.69145812T>C		101.0	0.0		66.0	8.0	NM_018656	A8K0T0|Q0P5Y5|Q9P0V1	Missense_Mutation	SNP	ENST00000398004.2	hg19	CCDS41808.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.275390	0.80580	.	.	ENSG00000175782	ENST00000398004	T	0.62788	-0.0	5.59	5.59	0.84812	Domain of unknown function DUF250 (1);	0.114780	0.64402	D	0.000005	T	0.81688	0.4875	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.84423	0.0572	9	.	.	.	-1.6076	16.0729	0.80948	0.0:0.0:0.0:1.0	.	172	Q7Z769	S35E3_HUMAN	R	172	ENSP00000381089:W172R	.	W	+	1	0	SLC35E3	67432079	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.586000	0.82596	2.266000	0.75297	0.454000	0.30748	TGG	.	.		0.433	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403241.1	NM_018656	Missense_Mutation
KCNC2	3747	hgsc.bcm.edu	37	12	75601611	75601611	+	Silent	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:75601611G>A	ENST00000549446.1	-	2	833	c.153C>T	c.(151-153)ggC>ggT	p.G51G	KCNC2_ENST00000341669.3_Silent_p.G51G|KCNC2_ENST00000540018.1_Silent_p.G51G|KCNC2_ENST00000393288.2_Silent_p.G51G|KCNC2_ENST00000350228.2_Silent_p.G51G|KCNC2_ENST00000298972.1_Silent_p.G51G|KCNC2_ENST00000550433.1_Silent_p.G51G|KCNC2_ENST00000548513.1_Silent_p.G51G	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	51					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	gcagcTTGTCGCCCGCCGTGG	0.731																																					p.G51G		Atlas-SNP	.											.	KCNC2	239	.	0			c.C153T						.						14.0	13.0	13.0					12																	75601611		1899	3767	5666	SO:0001819	synonymous_variant	3747	exon2			CTTGTCGCCCGCC	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.153C>T	chr12.hg19:g.75601611G>A		96.0	0.0		47.0	9.0	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Silent	SNP	ENST00000549446.1	hg19	CCDS9007.1																																																																																			.	.		0.731	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85546802	85546802	+	Splice_Site	SNP	A	A	T	rs202153512		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:85546802A>T	ENST00000393217.2	+	21	4481	c.4420A>T	c.(4420-4422)Att>Ttt	p.I1474F		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1474										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TTGTGAAAAGATTCCTGGAAA	0.294																																					p.I1474F		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.A4420T						.						55.0	53.0	54.0					12																	85546802		1791	4046	5837	SO:0001630	splice_region_variant	84125	exon21			GAAAAGATTCCTG	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4420-1A>T	chr12.hg19:g.85546802A>T		136.0	0.0		220.0	13.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	hg19	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	1.256	-0.617269	0.03663	.	.	ENSG00000133640	ENST00000393217	T	0.52526	0.66	5.47	0.239	0.15484	.	.	.	.	.	T	0.18882	0.0453	N	0.03608	-0.345	0.22552	N	0.998994	B	0.02656	0.0	B	0.01281	0.0	T	0.23226	-1.0194	8	.	.	.	.	4.0577	0.09824	0.4164:0.1872:0.0:0.3965	.	1474	Q96JM4	LRIQ1_HUMAN	F	1474	ENSP00000376910:I1474F	.	I	+	1	0	LRRIQ1	84070933	0.539000	0.26402	0.315000	0.25238	0.161000	0.22273	0.675000	0.25232	0.376000	0.24707	0.477000	0.44152	ATT	.	.		0.294	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	Missense_Mutation
APAF1	317	hgsc.bcm.edu	37	12	99042536	99042536	+	Missense_Mutation	SNP	A	A	G	rs139951279		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:99042536A>G	ENST00000551964.1	+	3	1007	c.271A>G	c.(271-273)Att>Gtt	p.I91V	APAF1_ENST00000550527.1_Missense_Mutation_p.I91V|APAF1_ENST00000359972.2_Missense_Mutation_p.I91V|APAF1_ENST00000357310.1_Missense_Mutation_p.I91V|APAF1_ENST00000547045.1_Missense_Mutation_p.I91V|APAF1_ENST00000547743.1_Missense_Mutation_p.I91V|APAF1_ENST00000333991.1_Missense_Mutation_p.I91V|APAF1_ENST00000552268.1_Missense_Mutation_p.I91V|APAF1_ENST00000339433.3_Missense_Mutation_p.I91V|APAF1_ENST00000549007.1_Missense_Mutation_p.I91V	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	91					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CCATGATGGCATTCCTGTTGT	0.343																																					p.I91V		Atlas-SNP	.											.	APAF1	111	.	0			c.A271G						.						198.0	196.0	197.0					12																	99042536		2203	4300	6503	SO:0001583	missense	317	exon3			GATGGCATTCCTG	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.271A>G	chr12.hg19:g.99042536A>G	ENSP00000448165:p.Ile91Val	129.0	0.0		101.0	33.0	NM_001160	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	hg19	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	A	13.81	2.349366	0.41599	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000333991;ENST00000547743;ENST00000552268;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.59772	0.24;0.41;0.32;0.43;0.28;0.32;0.43	5.64	-5.07	0.02938	DEATH-like (2);	0.588283	0.19479	N	0.113265	T	0.35770	0.0943	L	0.29908	0.895	0.09310	N	0.999998	B;B;B;B;B	0.10296	0.0;0.003;0.0;0.0;0.0	B;B;B;B;B	0.19946	0.001;0.027;0.0;0.005;0.0	T	0.16988	-1.0384	10	0.28530	T	0.3	-4.3016	7.7624	0.28959	0.2537:0.4848:0.2616:0.0	.	91;91;91;91;91	O14727-6;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	V	91	ENSP00000448165:I91V;ENSP00000353059:I91V;ENSP00000349862:I91V;ENSP00000341830:I91V;ENSP00000448449:I91V;ENSP00000449791:I91V;ENSP00000448161:I91V	ENSP00000334558:I91V	I	+	1	0	APAF1	97566667	0.011000	0.17503	0.025000	0.17156	0.990000	0.78478	0.228000	0.17814	-0.711000	0.04995	0.533000	0.62120	ATT	.	A|1.000;T|0.000		0.343	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	
SLC5A8	160728	hgsc.bcm.edu	37	12	101577959	101577959	+	Silent	SNP	T	T	C	rs367557492		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:101577959T>C	ENST00000536262.2	-	8	1563	c.1005A>G	c.(1003-1005)ccA>ccG	p.P335P		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAGGAAGTCCTGGATAATCTT	0.358																																					p.P335P	GBM(60;420 1056 13605 22380 47675)	Atlas-SNP	.											.	SLC5A8	102	.	0			c.A1005G						.	T		0,4406		0,0,2203	79.0	77.0	78.0		1005	-6.0	0.6	12		78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC5A8	NM_145913.3		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		335/611	101577959	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	160728	exon8			AAGTCCTGGATAA	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.1005A>G	chr12.hg19:g.101577959T>C		190.0	0.0		203.0	16.0	NM_145913		Silent	SNP	ENST00000536262.2	hg19	CCDS9080.1																																																																																			.	.		0.358	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913	
HCAR2	338442	hgsc.bcm.edu	37	12	123187336	123187336	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr12:123187336C>T	ENST00000328880.5	-	1	554	c.495G>A	c.(493-495)aaG>aaA	p.K165K	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	165					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	TCGGCATCTTCTTCTTCAGGA	0.542																																					p.K165K		Atlas-SNP	.											.	HCAR2	36	.	0			c.G495A						.						107.0	93.0	98.0					12																	123187336		2203	4300	6503	SO:0001819	synonymous_variant	338442	exon1			CATCTTCTTCTTC	AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.495G>A	chr12.hg19:g.123187336C>T		66.0	0.0		79.0	7.0	NM_177551	A0PJL5|A7LGG3	Silent	SNP	ENST00000328880.5	hg19	CCDS9235.1																																																																																			.	.		0.542	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370202.1	NM_177551	
CCNA1	8900	hgsc.bcm.edu	37	13	37011796	37011796	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr13:37011796T>C	ENST00000255465.4	+	3	592	c.328T>C	c.(328-330)Tca>Cca	p.S110P	CCNA1_ENST00000463403.1_3'UTR|CCNA1_ENST00000418263.1_Missense_Mutation_p.S109P|CCNA1_ENST00000449823.1_Missense_Mutation_p.S66P|CCNA1_ENST00000440264.1_Missense_Mutation_p.S66P			P78396	CCNA1_HUMAN	cyclin A1	110					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		TTATTCTGGATCAGAAAATGC	0.468																																					p.S110P		Atlas-SNP	.											.	CCNA1	91	.	0			c.T328C						.						106.0	115.0	112.0					13																	37011796		2203	4300	6503	SO:0001583	missense	8900	exon3			TCTGGATCAGAAA	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.328T>C	chr13.hg19:g.37011796T>C	ENSP00000255465:p.Ser110Pro	128.0	0.0		133.0	18.0	NM_003914	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	hg19	CCDS9357.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.035451	0.35893	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.16196	2.4;2.4;2.36;2.36	5.47	3.07	0.35406	.	0.885835	0.10148	N	0.710001	T	0.16471	0.0396	M	0.62723	1.935	0.30723	N	0.748076	B;B	0.16166	0.003;0.016	B;B	0.11329	0.005;0.006	T	0.30504	-0.9976	10	0.45353	T	0.12	.	1.7545	0.02979	0.135:0.1476:0.1403:0.5772	.	109;110	P78396-2;P78396	.;CCNA1_HUMAN	P	66;66;109;110	ENSP00000400666:S66P;ENSP00000409873:S66P;ENSP00000396479:S109P;ENSP00000255465:S110P	ENSP00000255465:S110P	S	+	1	0	CCNA1	35909796	1.000000	0.71417	0.991000	0.47740	0.917000	0.54804	0.908000	0.28545	0.391000	0.25143	0.374000	0.22700	TCA	.	.		0.468	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2	NM_003914	
FREM2	341640	hgsc.bcm.edu	37	13	39261494	39261494	+	Missense_Mutation	SNP	G	G	C	rs374997939		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr13:39261494G>C	ENST00000280481.7	+	1	229	c.13G>C	c.(13-15)Ggg>Cgg	p.G5R		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	5					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GCACTCAGCCGGGACTCCCGG	0.662																																					p.G5R		Atlas-SNP	.											.	FREM2	385	.	0			c.G13C						.						16.0	17.0	17.0					13																	39261494		2199	4298	6497	SO:0001583	missense	341640	exon1			TCAGCCGGGACTC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.13G>C	chr13.hg19:g.39261494G>C	ENSP00000280481:p.Gly5Arg	341.0	0.0		234.0	24.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	5.293	0.239495	0.10023	.	.	ENSG00000150893	ENST00000280481	T	0.18016	2.24	5.29	-1.42	0.08913	.	0.510248	0.17723	N	0.164177	T	0.05960	0.0155	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.24548	-1.0157	10	0.34782	T	0.22	.	2.0579	0.03585	0.2874:0.3276:0.2742:0.1109	.	5	Q5SZK8	FREM2_HUMAN	R	5	ENSP00000280481:G5R	ENSP00000280481:G5R	G	+	1	0	FREM2	38159494	0.001000	0.12720	0.001000	0.08648	0.075000	0.17131	0.082000	0.14847	-0.405000	0.07599	0.655000	0.94253	GGG	.	.		0.662	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
COG6	57511	hgsc.bcm.edu	37	13	40256306	40256306	+	Splice_Site	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr13:40256306A>T	ENST00000455146.3	+	8	744		c.e8-1		COG6_ENST00000416691.1_Splice_Site|COG6_ENST00000465775.1_Splice_Site	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6						glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ATTATTTTTCAGGTGAATGCA	0.368																																					.		Atlas-SNP	.											.	COG6	49	.	0			c.695-2A>T						.						61.0	63.0	62.0					13																	40256306		2203	4300	6503	SO:0001630	splice_region_variant	57511	exon8			TTTTTCAGGTGAA	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.695-1A>T	chr13.hg19:g.40256306A>T		354.0	0.0		352.0	20.0	NM_001145079	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Splice_Site	SNP	ENST00000455146.3	hg19	CCDS9370.1	.	.	.	.	.	.	.	.	.	.	A	18.75	3.690036	0.68271	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000455146	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0304	0.71701	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COG6	39154306	1.000000	0.71417	0.992000	0.48379	0.790000	0.44656	6.863000	0.75489	2.199000	0.70637	0.533000	0.62120	.	.	.		0.368	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3		Intron
VWA8	23078	hgsc.bcm.edu	37	13	42263626	42263626	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr13:42263626G>A	ENST00000379310.3	-	34	4063	c.3995C>T	c.(3994-3996)cCt>cTt	p.P1332L	VWA8_ENST00000478987.1_5'UTR	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1332						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										AATTTTATGAGGTATGCTGAA	0.353																																					p.P1332L		Atlas-SNP	.											.	.	.	.	0			c.C3995T						.						89.0	81.0	83.0					13																	42263626		1822	4087	5909	SO:0001583	missense	23078	exon34			TTATGAGGTATGC	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3995C>T	chr13.hg19:g.42263626G>A	ENSP00000368612:p.Pro1332Leu	22.0	0.0		61.0	5.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	hg19	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031538	0.75504	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000478987	T	0.09350	2.99	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.12860	0.0312	L	0.56769	1.78	0.80722	D	1	P	0.42456	0.78	B	0.34138	0.176	T	0.03524	-1.1028	10	0.42905	T	0.14	.	17.2985	0.87175	0.0:0.0:1.0:0.0	.	1332	A3KMH1	K0564_HUMAN	L	1236;1332;103	ENSP00000368612:P1332L	ENSP00000251030:P1236L	P	-	2	0	KIAA0564	41161626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.253000	0.78320	2.600000	0.87896	0.650000	0.86243	CCT	.	.		0.353	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
PHF11	51131	hgsc.bcm.edu	37	13	50097317	50097317	+	Missense_Mutation	SNP	G	G	A	rs368988100		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr13:50097317G>A	ENST00000378319.3	+	7	618	c.577G>A	c.(577-579)Gaa>Aaa	p.E193K	PHF11_ENST00000488958.1_Missense_Mutation_p.E154K|PHF11_ENST00000357596.3_Missense_Mutation_p.E154K|PHF11_ENST00000460489.1_3'UTR	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		CTAGCCACCCGAAACAATGAA	0.353																																					p.E193K		Atlas-SNP	.											.	PHF11	20	.	0			c.G577A						.	G	LYS/GLU,LYS/GLU	0,4406		0,0,2203	78.0	71.0	74.0		460,577	0.0	0.0	13		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PHF11	NM_001040444.1,NM_001040443.1	56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	154/293,193/332	50097317	1,13005	2203	4300	6503	SO:0001583	missense	51131	exon7			CCACCCGAAACAA	AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.577G>A	chr13.hg19:g.50097317G>A	ENSP00000367570:p.Glu193Lys	221.0	0.0		223.0	17.0	NM_001040443	Q5W0A4|Q5W0A6|Q9Y5A2	Missense_Mutation	SNP	ENST00000378319.3	hg19	CCDS31975.1	.	.	.	.	.	.	.	.	.	.	G	7.036	0.561595	0.13498	0.0	1.16E-4	ENSG00000136147	ENST00000378319;ENST00000496612;ENST00000357596;ENST00000442195;ENST00000488958	T;T;T;T;T	0.72835	-0.69;-0.27;-0.68;-0.67;-0.68	4.15	0.0112	0.14086	.	1.187720	0.06174	N	0.678183	T	0.52549	0.1741	L	0.28115	0.83	0.09310	N	1	B	0.17268	0.021	B	0.08055	0.003	T	0.25710	-1.0124	10	0.10902	T	0.67	-4.0635	6.6859	0.23144	0.4992:0.0:0.5008:0.0	.	193	Q9UIL8	PHF11_HUMAN	K	193;125;154;154;154	ENSP00000367570:E193K;ENSP00000419229:E125K;ENSP00000350209:E154K;ENSP00000405227:E154K;ENSP00000417539:E154K	ENSP00000350209:E154K	E	+	1	0	PHF11	48995318	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.279000	0.08479	-0.146000	0.11274	0.462000	0.41574	GAA	.	.		0.353	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044915.1	NM_016119	
NALCN	259232	hgsc.bcm.edu	37	13	101755543	101755543	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr13:101755543C>T	ENST00000251127.6	-	26	3118	c.3037G>A	c.(3037-3039)Ggc>Agc	p.G1013S		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1013					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.G1013C(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCTTGAAGCCGCTGAAAAGT	0.453																																					p.G1013S		Atlas-SNP	.											NALCN,NS,carcinoma,0,1	NALCN	431	.	1	Substitution - Missense(1)	lung(1)	c.G3037A						.						107.0	114.0	112.0					13																	101755543		2203	4300	6503	SO:0001583	missense	259232	exon26			TGAAGCCGCTGAA	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3037G>A	chr13.hg19:g.101755543C>T	ENSP00000251127:p.Gly1013Ser	53.0	0.0		94.0	11.0	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	hg19	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.989463	0.93106	.	.	ENSG00000102452	ENST00000251127	D	0.97752	-4.52	5.03	5.03	0.67393	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97084	0.9047	N	0.16201	0.385	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.98750	1.0720	10	0.62326	D	0.03	.	18.7562	0.91833	0.0:1.0:0.0:0.0	.	1013	Q8IZF0	NALCN_HUMAN	S	1013	ENSP00000251127:G1013S	ENSP00000251127:G1013S	G	-	1	0	NALCN	100553544	1.000000	0.71417	0.978000	0.43139	0.924000	0.55760	7.345000	0.79337	2.488000	0.83962	0.650000	0.86243	GGC	.	.		0.453	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
EFNB2	1948	hgsc.bcm.edu	37	13	107145464	107145464	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr13:107145464C>T	ENST00000245323.4	-	5	1075	c.926G>A	c.(925-927)gGc>gAc	p.G309D		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	309					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					CCCGTAGTCGCCGCTGACCTT	0.602																																					p.G309D		Atlas-SNP	.											.	EFNB2	39	.	0			c.G926A						.						90.0	73.0	79.0					13																	107145464		2203	4300	6503	SO:0001583	missense	1948	exon5			TAGTCGCCGCTGA	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.926G>A	chr13.hg19:g.107145464C>T	ENSP00000245323:p.Gly309Asp	58.0	0.0		43.0	7.0	NM_004093	Q5JV56	Missense_Mutation	SNP	ENST00000245323.4	hg19	CCDS9507.1	.	.	.	.	.	.	.	.	.	.	C	35	5.465393	0.96257	.	.	ENSG00000125266	ENST00000245323	D	0.94092	-3.35	5.81	5.81	0.92471	.	0.044394	0.85682	D	0.000000	D	0.96574	0.8882	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.96537	0.9397	10	0.87932	D	0	.	20.0826	0.97783	0.0:1.0:0.0:0.0	.	309	P52799	EFNB2_HUMAN	D	309	ENSP00000245323:G309D	ENSP00000245323:G309D	G	-	2	0	EFNB2	105943465	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.755000	0.85180	2.746000	0.94184	0.655000	0.94253	GGC	.	.		0.602	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
RIPK3	11035	hgsc.bcm.edu	37	14	24808688	24808688	+	Missense_Mutation	SNP	C	C	T	rs571257852		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr14:24808688C>T	ENST00000216274.5	-	2	354	c.136G>A	c.(136-138)Gat>Aat	p.D46N	RIPK3_ENST00000554338.1_5'UTR|RP11-934B9.3_ENST00000555591.1_5'Flank	NM_006871.3	NP_006862.2	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	46	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|amyloid fibril formation (GO:1990000)|apoptotic signaling pathway (GO:0097190)|cellular protein modification process (GO:0006464)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of ligase activity (GO:0051351)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein deacetylation (GO:0090312)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of activated T cell proliferation (GO:0046006)|regulation of activation-induced cell death of T cells (GO:0070235)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000452)|regulation of interferon-gamma production (GO:0032649)|regulation of T cell mediated cytotoxicity (GO:0001914)|signal transduction (GO:0007165)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|NF-kappaB-inducing kinase activity (GO:0004704)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				GBM - Glioblastoma multiforme(265;0.0181)		ACCGCCACATCGTAGCCCCAC	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		15851	0.0		0.0	False		,,,				2504	0.001				p.D46N	Pancreas(58;918 1191 4668 13304 15331)	Atlas-SNP	.											RIPK3,NS,carcinoma,0,1	RIPK3	43	.	0			c.G136A						.						124.0	125.0	125.0					14																	24808688		2203	4300	6503	SO:0001583	missense	11035	exon2			CCACATCGTAGCC	AF156884	CCDS9628.1	14q12	2006-05-15			ENSG00000129465	ENSG00000129465			10021	protein-coding gene	gene with protein product		605817				10339433, 10358032	Standard	NM_006871		Approved	RIP3	uc001wpb.3	Q9Y572	OTTHUMG00000029349	ENST00000216274.5:c.136G>A	chr14.hg19:g.24808688C>T	ENSP00000216274:p.Asp46Asn	122.0	0.0		80.0	21.0	NM_006871	B4DJL9|C4AM87|Q5J795|Q5J796|Q6P5Y1	Missense_Mutation	SNP	ENST00000216274.5	hg19	CCDS9628.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321257	0.41096	.	.	ENSG00000129465	ENST00000216274	T	0.64618	-0.11	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.433153	0.19700	N	0.108043	T	0.51432	0.1674	L	0.33093	0.98	0.23572	N	0.997389	P;P	0.49090	0.919;0.668	B;B	0.40825	0.341;0.082	T	0.53613	-0.8414	10	0.56958	D	0.05	-7.4261	13.339	0.60535	0.0:1.0:0.0:0.0	.	46;46	B4DJZ5;Q9Y572	.;RIPK3_HUMAN	N	46	ENSP00000216274:D46N	ENSP00000216274:D46N	D	-	1	0	RIPK3	23878528	0.009000	0.17119	0.381000	0.26106	0.233000	0.25261	0.888000	0.28268	2.518000	0.84900	0.561000	0.74099	GAT	.	.		0.612	RIPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073203.4	NM_006871	
LRFN5	145581	hgsc.bcm.edu	37	14	42355944	42355944	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr14:42355944A>T	ENST00000298119.4	+	3	1305	c.116A>T	c.(115-117)aAg>aTg	p.K39M	LRFN5_ENST00000554171.1_Missense_Mutation_p.K39M|LRFN5_ENST00000554120.1_Missense_Mutation_p.K39M	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	39	LRRNT.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTTTGTGCCAAGAAAGGGCTT	0.393										HNSCC(30;0.082)																											p.K39M		Atlas-SNP	.											.	LRFN5	269	.	0			c.A116T						.						75.0	67.0	70.0					14																	42355944		2203	4300	6503	SO:0001583	missense	145581	exon3			GTGCCAAGAAAGG	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.116A>T	chr14.hg19:g.42355944A>T	ENSP00000298119:p.Lys39Met	163.0	0.0		151.0	22.0	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	hg19	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	A	17.26	3.344562	0.61073	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.53640	0.61;0.61;0.61	5.56	5.56	0.83823	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.64402	D	0.000013	T	0.66036	0.2749	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.67382	0.951;0.94	T	0.69829	-0.5039	10	0.72032	D	0.01	.	13.6661	0.62396	1.0:0.0:0.0:0.0	.	39;39	G3V364;Q96NI6	.;LRFN5_HUMAN	M	39	ENSP00000298119:K39M;ENSP00000451897:K39M;ENSP00000451067:K39M	ENSP00000298119:K39M	K	+	2	0	LRFN5	41425694	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.098000	0.63641	0.528000	0.53228	AAG	.	.		0.393	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
FAM179B	23116	hgsc.bcm.edu	37	14	45535866	45535866	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr14:45535866G>T	ENST00000361577.3	+	16	4700	c.4486G>T	c.(4486-4488)Ggc>Tgc	p.G1496C	FAM179B_ENST00000361462.2_Missense_Mutation_p.G1549C|FAM179B_ENST00000382233.2_3'UTR	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1496										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						ACTCATAACTGGCTTATTAAA	0.353																																					p.G1496C		Atlas-SNP	.											.	FAM179B	115	.	0			c.G4486T						.						119.0	119.0	119.0					14																	45535866		2203	4300	6503	SO:0001583	missense	23116	exon16			ATAACTGGCTTAT	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4486G>T	chr14.hg19:g.45535866G>T	ENSP00000355045:p.Gly1496Cys	82.0	0.0		87.0	8.0	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	hg19	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.517018	0.64634	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.19250	2.16;2.16	5.59	1.79	0.24919	Armadillo-like helical (1);Armadillo-type fold (1);	0.402536	0.30401	N	0.009714	T	0.31263	0.0791	L	0.56769	1.78	0.80722	D	1	P;D	0.54207	0.877;0.965	P;P	0.55455	0.605;0.776	T	0.02075	-1.1218	10	0.72032	D	0.01	-2.9216	8.7175	0.34421	0.3721:0.0:0.6279:0.0	.	1549;1496	G3XAE9;Q9Y4F4	.;F179B_HUMAN	C	1496;1549	ENSP00000355045:G1496C;ENSP00000354917:G1549C	ENSP00000354917:G1549C	G	+	1	0	FAM179B	44605616	0.998000	0.40836	0.873000	0.34254	0.985000	0.73830	0.522000	0.22909	0.063000	0.16370	0.561000	0.74099	GGC	.	.		0.353	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
SNURF	8926	hgsc.bcm.edu	37	15	25213176	25213176	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr15:25213176G>C	ENST00000577949.1	+	3	271	c.208G>C	c.(208-210)Ggt>Cgt	p.G70R	SNRPN_ENST00000554227.2_5'UTR|SNRPN_ENST00000400100.1_5'UTR|SNRPN_ENST00000400098.1_5'UTR|SNURF_ENST00000551312.2_Missense_Mutation_p.G70R|SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNURF_ENST00000338094.6_Missense_Mutation_p.G70R|SNURF_ENST00000338327.4_Missense_Mutation_p.G70R|SNRPN_ENST00000390687.4_5'UTR|SNRPN_ENST00000346403.6_5'UTR			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	70						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		GACACCAAGAGGTGGTTAAAG	0.453																																					p.G70R		Atlas-SNP	.											.	SNURF	17	.	0			c.G208C						.						105.0	93.0	97.0					15																	25213176		2203	4300	6503	SO:0001583	missense	8926	exon3			CCAAGAGGTGGTT		CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.208G>C	chr15.hg19:g.25213176G>C	ENSP00000463201:p.Gly70Arg	67.0	0.0		78.0	22.0	NM_005678	A6NCW2	Missense_Mutation	SNP	ENST00000577949.1	hg19	CCDS10016.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.476122	0.44044	.	.	ENSG00000214265	ENST00000338094;ENST00000338327	.	.	.	3.52	3.52	0.40303	.	.	.	.	.	T	0.68393	0.2996	.	.	.	0.32900	D	0.513065	D	0.76494	0.999	D	0.81914	0.995	T	0.74456	-0.3659	7	0.56958	D	0.05	-1.2974	10.871	0.46883	0.0:0.0:1.0:0.0	.	70	Q9Y675	SNURF_HUMAN	R	70	.	ENSP00000336543:G70R	G	+	1	0	SNURF	22764269	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.955000	0.49121	2.253000	0.74438	0.655000	0.94253	GGT	.	.		0.453	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446300.1	NM_005678	
BTBD1	53339	hgsc.bcm.edu	37	15	83686886	83686886	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr15:83686886G>C	ENST00000261721.4	-	8	1584	c.1382C>G	c.(1381-1383)tCc>tGc	p.S461C	RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.7_ENST00000570202.1_RNA|BTBD1_ENST00000379403.2_3'UTR	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	461					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		ATTGCCAGGGGAACTAAAAAA	0.343																																					p.S461C		Atlas-SNP	.											.	BTBD1	32	.	0			c.C1382G						.						58.0	63.0	61.0					15																	83686886		2203	4299	6502	SO:0001583	missense	53339	exon8			CCAGGGGAACTAA	AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.1382C>G	chr15.hg19:g.83686886G>C	ENSP00000261721:p.Ser461Cys	207.0	0.0		190.0	12.0	NM_025238	A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	ENST00000261721.4	hg19	CCDS10322.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684081	0.68157	.	.	ENSG00000064726	ENST00000261721	T	0.80123	-1.34	5.95	5.95	0.96441	PHR (1);	0.121135	0.64402	D	0.000017	D	0.83078	0.5176	M	0.75884	2.315	0.80722	D	1	B	0.17038	0.02	B	0.21546	0.035	T	0.78937	-0.2007	10	0.87932	D	0	-20.0928	20.3931	0.98965	0.0:0.0:1.0:0.0	.	461	Q9H0C5	BTBD1_HUMAN	C	461	ENSP00000261721:S461C	ENSP00000261721:S461C	S	-	2	0	BTBD1	81477890	1.000000	0.71417	0.989000	0.46669	0.976000	0.68499	9.755000	0.98912	2.824000	0.97209	0.655000	0.94253	TCC	.	.		0.343	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304008.1		
POLG	5428	hgsc.bcm.edu	37	15	89867412	89867412	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr15:89867412G>A	ENST00000268124.5	-	11	2329	c.1996C>T	c.(1996-1998)Cag>Tag	p.Q666*	POLG_ENST00000442287.2_Nonsense_Mutation_p.Q666*	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	666					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ATCAGCTGCTGCTTCCCCTGT	0.597								DNA polymerases (catalytic subunits)																													p.Q666X	Colon(73;648 1203 11348 18386 27782)	Atlas-SNP	.											.	POLG	75	.	0			c.C1996T						.						67.0	60.0	62.0					15																	89867412		2200	4299	6499	SO:0001587	stop_gained	5428	exon11			GCTGCTGCTTCCC	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.1996C>T	chr15.hg19:g.89867412G>A	ENSP00000268124:p.Gln666*	44.0	0.0		33.0	13.0	NM_002693	Q8NFM2|Q92515	Nonsense_Mutation	SNP	ENST00000268124.5	hg19	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	G	42	9.297219	0.99128	.	.	ENSG00000140521	ENST00000268124;ENST00000442287;ENST00000526314	.	.	.	5.13	4.15	0.48705	.	0.309685	0.33309	N	0.005044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-9.133	14.0226	0.64565	0.0:0.2965:0.7035:0.0	.	.	.	.	X	666;666;122	.	ENSP00000268124:Q666X	Q	-	1	0	POLG	87668416	1.000000	0.71417	0.993000	0.49108	0.886000	0.51366	3.245000	0.51407	2.384000	0.81235	0.491000	0.48974	CAG	.	.		0.597	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
IQGAP1	8826	hgsc.bcm.edu	37	15	90986673	90986673	+	Silent	SNP	G	G	A	rs375134287		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr15:90986673G>A	ENST00000268182.5	+	9	1000	c.876G>A	c.(874-876)acG>acA	p.T292T	IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	292					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AGCTGCTCACGCAAGCTGAAA	0.358																																					p.T292T		Atlas-SNP	.											.	IQGAP1	140	.	0			c.G876A						.	G		0,4396		0,0,2198	87.0	84.0	85.0		876	-2.8	1.0	15		85	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	IQGAP1	NM_003870.3		0,1,6495	AA,AG,GG		0.0116,0.0,0.0077		292/1658	90986673	1,12991	2198	4298	6496	SO:0001819	synonymous_variant	8826	exon9			GCTCACGCAAGCT	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.876G>A	chr15.hg19:g.90986673G>A		177.0	0.0		244.0	53.0	NM_003870	A7MBM3	Silent	SNP	ENST00000268182.5	hg19	CCDS10362.1																																																																																			.	.		0.358	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
IGF1R	3480	hgsc.bcm.edu	37	15	99434825	99434825	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr15:99434825G>A	ENST00000268035.6	+	3	1523	c.912G>A	c.(910-912)atG>atA	p.M304I	IGF1R_ENST00000560432.1_3'UTR|RP11-654A16.1_ENST00000558736.1_RNA|IGF1R_ENST00000558762.1_Missense_Mutation_p.M304I	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	304					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCGAGTGCATGCAGGAGTGCC	0.662																																					p.M304I		Atlas-SNP	.											.	IGF1R	147	.	0			c.G912A						.						44.0	41.0	42.0					15																	99434825		2197	4297	6494	SO:0001583	missense	3480	exon3			GTGCATGCAGGAG	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.912G>A	chr15.hg19:g.99434825G>A	ENSP00000268035:p.Met304Ile	1200.0	1.0		874.0	225.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	hg19	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446814	0.63178	.	.	ENSG00000140443	ENST00000268035	D	0.97186	-4.28	5.01	5.01	0.66863	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	0.087654	0.49916	D	0.000128	D	0.92951	0.7757	L	0.35793	1.09	0.58432	D	0.999998	B;B	0.19935	0.04;0.002	B;B	0.20577	0.03;0.003	D	0.87913	0.2698	10	0.02654	T	1	.	13.638	0.62233	0.0:0.0:0.8451:0.1549	.	304;304	C9J5X1;P08069	.;IGF1R_HUMAN	I	304	ENSP00000268035:M304I	ENSP00000268035:M304I	M	+	3	0	IGF1R	97252348	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.440000	0.66563	2.477000	0.83638	0.555000	0.69702	ATG	.	.		0.662	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
FBXL16	146330	hgsc.bcm.edu	37	16	744414	744414	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr16:744414A>C	ENST00000397621.1	-	6	1632	c.1301T>G	c.(1300-1302)cTg>cGg	p.L434R	FBXL16_ENST00000562585.1_5'Flank|LA16c-313D11.12_ENST00000566927.1_RNA|FBXL16_ENST00000562563.1_Missense_Mutation_p.L222R|FBXL16_ENST00000324361.5_Missense_Mutation_p.L434R	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	434										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				GGTGGTGAGCAGCGGGCAGCC	0.751																																					p.L434R		Atlas-SNP	.											.	FBXL16	25	.	0			c.T1301G						.						5.0	7.0	7.0					16																	744414		2029	4051	6080	SO:0001583	missense	146330	exon6			GTGAGCAGCGGGC	BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.1301T>G	chr16.hg19:g.744414A>C	ENSP00000380746:p.Leu434Arg	198.0	0.0		113.0	16.0	NM_153350	B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	Missense_Mutation	SNP	ENST00000397621.1	hg19	CCDS10421.1	.	.	.	.	.	.	.	.	.	.	a	8.900	0.956136	0.18507	.	.	ENSG00000127585	ENST00000397621;ENST00000324361	T;T	0.02323	4.34;4.34	4.49	4.49	0.54785	.	0.204953	0.35040	N	0.003487	T	0.02727	0.0082	N	0.13003	0.285	0.52099	D	0.999946	D	0.54772	0.968	P	0.47251	0.542	T	0.67825	-0.5570	10	0.15499	T	0.54	.	12.8013	0.57588	1.0:0.0:0.0:0.0	.	434	Q8N461	FXL16_HUMAN	R	434	ENSP00000380746:L434R;ENSP00000318674:L434R	ENSP00000318674:L434R	L	-	2	0	FBXL16	684415	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	8.279000	0.89901	1.897000	0.54924	0.450000	0.29827	CTG	.	.		0.751	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206851.2	NM_153350	
PKD1	5310	hgsc.bcm.edu	37	16	2161188	2161188	+	Missense_Mutation	SNP	T	T	G	rs559786831	byFrequency	TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr16:2161188T>G	ENST00000262304.4	-	15	4188	c.3980A>C	c.(3979-3981)gAc>gCc	p.D1327A	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.D1327A	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1327	PKD 8. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GAAGGTCCAGTCGAAGAGGTA	0.697																																					p.D1327A		Atlas-SNP	.											.	PKD1	184	.	0			c.A3980C						.						27.0	29.0	28.0					16																	2161188		2187	4295	6482	SO:0001583	missense	5310	exon15			GTCCAGTCGAAGA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3980A>C	chr16.hg19:g.2161188T>G	ENSP00000262304:p.Asp1327Ala	83.0	0.0		63.0	9.0	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	hg19	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	t	14.16	2.453112	0.43531	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.66280	-0.2;-0.2	5.72	5.72	0.89469	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (4);	0.434188	0.25954	N	0.027240	T	0.74764	0.3759	M	0.75447	2.3	0.34926	D	0.748896	P;P	0.48640	0.913;0.755	P;P	0.55055	0.767;0.61	T	0.82345	-0.0503	10	0.46703	T	0.11	.	16.0066	0.80367	0.0:0.0:0.0:1.0	.	1327;1327	P98161-3;P98161	.;PKD1_HUMAN	A	1327;1327;1008	ENSP00000262304:D1327A;ENSP00000399501:D1327A	ENSP00000262304:D1327A	D	-	2	0	PKD1	2101189	1.000000	0.71417	0.835000	0.33067	0.058000	0.15608	5.681000	0.68175	2.183000	0.69458	0.451000	0.29950	GAC	.	.		0.697	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
DNAH3	55567	hgsc.bcm.edu	37	16	21139036	21139036	+	Silent	SNP	G	G	A	rs370177232		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr16:21139036G>A	ENST00000261383.3	-	8	1179	c.1180C>T	c.(1180-1182)Ctg>Ttg	p.L394L	CTC-508F8.1_ENST00000575612.1_RNA|DNAH3_ENST00000415178.1_Silent_p.L394L	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	394	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGTGCCTCCAGGCAGTGTTTC	0.483																																					p.L394L		Atlas-SNP	.											.	DNAH3	1142	.	0			c.C1180T						.						136.0	126.0	130.0					16																	21139036		2201	4300	6501	SO:0001819	synonymous_variant	55567	exon8			CCTCCAGGCAGTG	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1180C>T	chr16.hg19:g.21139036G>A		84.0	0.0		67.0	14.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	hg19	CCDS10594.1																																																																																			.	.		0.483	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
ERN2	10595	hgsc.bcm.edu	37	16	23706194	23706194	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr16:23706194C>G	ENST00000457008.2	-	16	1837	c.1799G>C	c.(1798-1800)gGc>gCc	p.G600A	ERN2_ENST00000256797.4_Missense_Mutation_p.G700A					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TCTGCCCAGGCCCTGGCTGTC	0.632																																					p.G700A		Atlas-SNP	.											.	ERN2	131	.	0			c.G2099C						.						39.0	39.0	39.0					16																	23706194		2196	4300	6496	SO:0001583	missense	10595	exon17			CCCAGGCCCTGGC	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1799G>C	chr16.hg19:g.23706194C>G	ENSP00000413812:p.Gly600Ala	130.0	0.0		71.0	8.0	NM_033266		Missense_Mutation	SNP	ENST00000457008.2	hg19		.	.	.	.	.	.	.	.	.	.	C	15.17	2.754856	0.49362	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.56275	0.47;0.47	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.69833	0.3155	L	0.58810	1.83	0.80722	D	1	D;P	0.89917	1.0;0.904	D;P	0.87578	0.998;0.68	T	0.71217	-0.4658	10	0.66056	D	0.02	.	16.9969	0.86370	0.0:1.0:0.0:0.0	.	600;652	E7ETG2;A5YM65	.;.	A	700;600	ENSP00000256797:G700A;ENSP00000413812:G600A	ENSP00000256797:G700A	G	-	2	0	ERN2	23613695	1.000000	0.71417	0.972000	0.41901	0.045000	0.14185	7.384000	0.79751	2.676000	0.91093	0.655000	0.94253	GGC	.	.		0.632	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
PFAS	5198	hgsc.bcm.edu	37	17	8168227	8168227	+	Silent	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr17:8168227G>T	ENST00000314666.6	+	18	2197	c.2064G>T	c.(2062-2064)gtG>gtT	p.V688V	PFAS_ENST00000545834.1_Silent_p.V264V	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	688					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	ACCGCTCTGTGGGAGGCCTGG	0.642																																					p.V688V		Atlas-SNP	.											.	PFAS	91	.	0			c.G2064T						.						10.0	10.0	10.0					17																	8168227		2182	4287	6469	SO:0001819	synonymous_variant	5198	exon18			CTCTGTGGGAGGC	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.2064G>T	chr17.hg19:g.8168227G>T		116.0	0.0		100.0	10.0	NM_012393	A6H8V8	Silent	SNP	ENST00000314666.6	hg19	CCDS11136.1																																																																																			.	.		0.642	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2		
GPR179	440435	hgsc.bcm.edu	37	17	36491002	36491002	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr17:36491002G>T	ENST00000342292.4	-	7	1579	c.1559C>A	c.(1558-1560)gCa>gAa	p.A520E		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	520					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CACCAGAGGTGCGTGCTGGAT	0.662																																					p.A520E		Atlas-SNP	.											.	GPR179	170	.	0			c.C1559A						.						18.0	22.0	21.0					17																	36491002		2144	4242	6386	SO:0001583	missense	440435	exon7			AGAGGTGCGTGCT		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.1559C>A	chr17.hg19:g.36491002G>T	ENSP00000345060:p.Ala520Glu	302.0	0.0		163.0	25.0	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	hg19	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656990	0.47467	.	.	ENSG00000188888	ENST00000342292	D	0.87729	-2.29	4.24	2.24	0.28232	GPCR, family 3, C-terminal (2);	0.425014	0.21203	N	0.078422	T	0.76779	0.4035	L	0.29908	0.895	0.09310	N	1	B	0.33413	0.411	B	0.37015	0.239	T	0.63084	-0.6716	10	0.27082	T	0.32	0.1157	3.9058	0.09182	0.2952:0.1809:0.5239:0.0	.	520	Q6PRD1	GP179_HUMAN	E	520	ENSP00000345060:A520E	ENSP00000345060:A520E	A	-	2	0	GPR179	33744528	0.293000	0.24371	0.159000	0.22649	0.956000	0.61745	3.509000	0.53386	0.431000	0.26258	0.313000	0.20887	GCA	.	.		0.662	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
BRIP1	83990	hgsc.bcm.edu	37	17	59763365	59763365	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr17:59763365A>C	ENST00000259008.2	-	19	3004	c.2737T>G	c.(2737-2739)Tct>Gct	p.S913A	BRIP1_ENST00000577598.1_Missense_Mutation_p.S913A	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	913	Interaction with BRCA1.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						TACTTTAAAGAGGTCACTTCA	0.368			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.S913A		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	BRIP1	237	.	0			c.T2737G						.						184.0	183.0	183.0					17																	59763365		2203	4300	6503	SO:0001583	missense	83990	exon19			TTAAAGAGGTCAC	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.2737T>G	chr17.hg19:g.59763365A>C	ENSP00000259008:p.Ser913Ala	150.0	0.0		184.0	32.0	NM_032043	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	hg19	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	A	3.735	-0.054737	0.07362	.	.	ENSG00000136492	ENST00000259008	T	0.73363	-0.74	5.81	2.96	0.34315	.	0.951389	0.08798	N	0.892176	T	0.57770	0.2076	N	0.22421	0.69	0.09310	N	1	B;B	0.14438	0.002;0.01	B;B	0.09377	0.002;0.004	T	0.41574	-0.9501	9	.	.	.	-0.0019	5.6996	0.17875	0.7544:0.0:0.1052:0.1404	.	913;913	C9JGZ0;Q9BX63	.;FANCJ_HUMAN	A	913	ENSP00000259008:S913A	.	S	-	1	0	BRIP1	57118147	0.012000	0.17670	0.082000	0.20525	0.070000	0.16714	0.184000	0.16939	0.408000	0.25621	0.533000	0.62120	TCT	.	.		0.368	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
EFCAB3	146779	hgsc.bcm.edu	37	17	60464701	60464701	+	Splice_Site	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr17:60464701G>A	ENST00000305286.3	+	3	153	c.75G>A	c.(73-75)agG>agA	p.R25R	EFCAB3_ENST00000450662.2_Splice_Site_p.R77R	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	25							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			CTTTCCTCAGGGATAGAGACT	0.363																																					p.R77R		Atlas-SNP	.											.	EFCAB3	71	.	0			c.G231A						.						91.0	83.0	86.0					17																	60464701		2203	4300	6503	SO:0001630	splice_region_variant	146779	exon5			CCTCAGGGATAGA	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.75-1G>A	chr17.hg19:g.60464701G>A		97.0	0.0		71.0	5.0	NM_001144933	J3KQM8	Silent	SNP	ENST00000305286.3	hg19	CCDS11632.1																																																																																			.	.		0.363	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379114.1	NM_173503	Silent
LAMA1	284217	hgsc.bcm.edu	37	18	6949123	6949123	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr18:6949123A>G	ENST00000389658.3	-	59	8626	c.8533T>C	c.(8533-8535)Tac>Cac	p.Y2845H		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2845	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTGGCCTGGTACTGGGAGGGC	0.498																																					p.Y2845H		Atlas-SNP	.											.	LAMA1	458	.	0			c.T8533C						.						93.0	76.0	82.0					18																	6949123		2203	4300	6503	SO:0001583	missense	284217	exon59			CCTGGTACTGGGA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8533T>C	chr18.hg19:g.6949123A>G	ENSP00000374309:p.Tyr2845His	150.0	0.0		117.0	17.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	hg19	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	A	14.02	2.409572	0.42715	.	.	ENSG00000101680	ENST00000389658	T	0.75704	-0.96	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.070739	0.56097	D	0.000022	D	0.83908	0.5356	M	0.74881	2.28	0.47621	D	0.999474	P;P	0.47302	0.889;0.893	P;P	0.60012	0.536;0.867	T	0.82678	-0.0338	10	0.32370	T	0.25	.	15.5204	0.75862	1.0:0.0:0.0:0.0	.	2845;175	P25391;B3KSD8	LAMA1_HUMAN;.	H	2845	ENSP00000374309:Y2845H	ENSP00000374309:Y2845H	Y	-	1	0	LAMA1	6939123	1.000000	0.71417	0.921000	0.36526	0.090000	0.18270	5.962000	0.70364	2.140000	0.66376	0.454000	0.30748	TAC	.	.		0.498	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ASXL3	80816	hgsc.bcm.edu	37	18	31323005	31323005	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr18:31323005C>G	ENST00000269197.5	+	12	3193	c.3193C>G	c.(3193-3195)Cgg>Ggg	p.R1065G		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1065	Ala-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CCAACAAGCTCGGGCCCAGCG	0.612																																					p.R1065G		Atlas-SNP	.											.	ASXL3	405	.	0			c.C3193G						.						24.0	26.0	25.0					18																	31323005		1871	4084	5955	SO:0001583	missense	80816	exon12			CAAGCTCGGGCCC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3193C>G	chr18.hg19:g.31323005C>G	ENSP00000269197:p.Arg1065Gly	66.0	0.0		60.0	9.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	hg19	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.752247	0.49362	.	.	ENSG00000141431	ENST00000269197	T	0.53206	0.63	5.9	2.38	0.29361	.	0.560508	0.16050	N	0.232022	T	0.66025	0.2748	M	0.64404	1.975	0.30137	N	0.804248	D	0.89917	1.0	D	0.85130	0.997	T	0.68405	-0.5417	10	0.87932	D	0	.	16.0065	0.80367	0.4585:0.5415:0.0:0.0	.	1065	Q9C0F0	ASXL3_HUMAN	G	1065	ENSP00000269197:R1065G	ENSP00000269197:R1065G	R	+	1	2	ASXL3	29577003	0.912000	0.30974	0.815000	0.32552	0.991000	0.79684	1.923000	0.40055	0.638000	0.30545	0.650000	0.86243	CGG	.	.		0.612	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
SLC14A2	8170	hgsc.bcm.edu	37	18	43248313	43248313	+	Splice_Site	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr18:43248313G>C	ENST00000255226.6	+	15	2723		c.e15-1		SLC14A2_ENST00000589658.1_Splice_Site|SLC14A2_ENST00000586448.1_Splice_Site|RP11-116O18.3_ENST00000589510.1_RNA	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2						transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCTCCTGCCAGGTCGGCCATC	0.562																																					.		Atlas-SNP	.											.	SLC14A2	121	.	0			c.1908-1G>C						.						90.0	87.0	88.0					18																	43248313		2203	4300	6503	SO:0001630	splice_region_variant	8170	exon16			CTGCCAGGTCGGC	X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.1908-1G>C	chr18.hg19:g.43248313G>C		71.0	0.0		66.0	15.0	NM_001242692	A8K8Q7|Q2TBD6|Q96PH5	Splice_Site	SNP	ENST00000255226.6	hg19	CCDS11924.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292428	0.40594	.	.	ENSG00000132874	ENST00000255226	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1372	0.89623	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC14A2	41502311	1.000000	0.71417	0.935000	0.37517	0.129000	0.20672	8.890000	0.92477	2.503000	0.84419	0.563000	0.77884	.	.	.		0.562	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255858.1		Intron
SERPINB7	8710	hgsc.bcm.edu	37	18	61460472	61460472	+	Silent	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr18:61460472G>C	ENST00000398019.2	+	4	622	c.297G>C	c.(295-297)gtG>gtC	p.V99V	SERPINB7_ENST00000336429.2_Silent_p.V99V|SERPINB7_ENST00000540675.1_Silent_p.V82V|SERPINB7_ENST00000546027.1_Silent_p.V99V	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	99					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				TCAGCATTGTGAATGGGCTTT	0.348																																					p.V99V		Atlas-SNP	.											.	SERPINB7	66	.	0			c.G297C						.						117.0	106.0	110.0					18																	61460472		2203	4300	6503	SO:0001819	synonymous_variant	8710	exon4			CATTGTGAATGGG	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.297G>C	chr18.hg19:g.61460472G>C		122.0	0.0		94.0	12.0	NM_001261830	B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Silent	SNP	ENST00000398019.2	hg19	CCDS11988.1																																																																																			.	.		0.348	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784	
DAZAP1	26528	hgsc.bcm.edu	37	19	1434870	1434870	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:1434870C>T	ENST00000233078.4	+	12	1344	c.1183C>T	c.(1183-1185)Cag>Tag	p.Q395*	DAZAP1_ENST00000336761.6_3'UTR	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	395					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGACGAGGGCAGAACCACAA	0.697																																					p.Q395X		Atlas-SNP	.											.	DAZAP1	52	.	0			c.C1183T						.						13.0	15.0	14.0					19																	1434870		2186	4270	6456	SO:0001587	stop_gained	26528	exon12			CGAGGGCAGAACC		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.1183C>T	chr19.hg19:g.1434870C>T	ENSP00000233078:p.Gln395*	129.0	0.0		75.0	13.0	NM_018959	Q96MJ3|Q9NRR9	Nonsense_Mutation	SNP	ENST00000233078.4	hg19	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	C	39	7.307424	0.98200	.	.	ENSG00000071626	ENST00000233078	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	17.8389	0.88709	0.0:1.0:0.0:0.0	.	.	.	.	X	395	.	ENSP00000233078:Q395X	Q	+	1	0	DAZAP1	1385870	1.000000	0.71417	0.985000	0.45067	0.971000	0.66376	7.493000	0.81493	2.454000	0.82982	0.561000	0.74099	CAG	.	.		0.697	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
ICAM5	7087	hgsc.bcm.edu	37	19	10403481	10403481	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:10403481C>T	ENST00000221980.4	+	5	1218	c.1155C>T	c.(1153-1155)gcC>gcT	p.A385A		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	385	Ig-like C2-type 4.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TCTGCGACGCCACCCTCGATG	0.622																																					p.A385A		Atlas-SNP	.											.	ICAM5	53	.	0			c.C1155T						.						51.0	55.0	54.0					19																	10403481		2203	4300	6503	SO:0001819	synonymous_variant	7087	exon5			CGACGCCACCCTC	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1155C>T	chr19.hg19:g.10403481C>T		169.0	0.0		97.0	15.0	NM_003259	Q9Y6F3	Silent	SNP	ENST00000221980.4	hg19	CCDS12233.1																																																																																			.	.		0.622	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
KEAP1	9817	hgsc.bcm.edu	37	19	10597429	10597429	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:10597429T>C	ENST00000171111.5	-	6	2321	c.1774A>G	c.(1774-1776)Agc>Ggc	p.S592G	KEAP1_ENST00000393623.2_Missense_Mutation_p.S592G	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	592					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GTCACCTCGCTCCAGGTGTCT	0.587																																					p.S592G		Atlas-SNP	.											.	KEAP1	182	.	0			c.A1774G						.						110.0	99.0	102.0					19																	10597429		2203	4300	6503	SO:0001583	missense	9817	exon6			CCTCGCTCCAGGT	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1774A>G	chr19.hg19:g.10597429T>C	ENSP00000171111:p.Ser592Gly	99.0	0.0		70.0	11.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	hg19	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	T	9.096	1.002982	0.19121	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.79247	-1.25;-1.25	5.9	4.88	0.63580	Kelch-type beta propeller (1);	0.378221	0.30126	N	0.010347	T	0.79545	0.4464	M	0.87456	2.885	0.35613	D	0.808806	B	0.27971	0.196	B	0.29663	0.105	T	0.81309	-0.0991	10	0.51188	T	0.08	.	9.9583	0.41680	0.0:0.0796:0.0:0.9204	.	592	Q14145	KEAP1_HUMAN	G	592	ENSP00000171111:S592G;ENSP00000377245:S592G	ENSP00000171111:S592G	S	-	1	0	KEAP1	10458429	1.000000	0.71417	0.972000	0.41901	0.012000	0.07955	2.206000	0.42779	1.075000	0.40932	0.454000	0.30748	AGC	.	.		0.587	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
CPAMD8	27151	hgsc.bcm.edu	37	19	17086047	17086047	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:17086047A>C	ENST00000443236.1	-	17	2102	c.2071T>G	c.(2071-2073)Tat>Gat	p.Y691D	CPAMD8_ENST00000388925.4_Missense_Mutation_p.Y430D	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	644						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GAAACATCATAATCTTCCAGT	0.552																																					p.Y691D		Atlas-SNP	.											.	CPAMD8	192	.	0			c.T2071G						.						38.0	39.0	39.0					19																	17086047		2038	4190	6228	SO:0001583	missense	27151	exon17			CATCATAATCTTC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.2071T>G	chr19.hg19:g.17086047A>C	ENSP00000402505:p.Tyr691Asp	206.0	0.0		105.0	12.0	NM_015692	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	hg19	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.40|15.40	2.822480|2.822480	0.50739|0.50739	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440;ENST00000388925	.|T	.|0.64438	.|-0.1	2.78|2.78	2.78|2.78	0.32641|0.32641	.|.	.|0.093976	.|0.45867	.|U	.|0.000322	T|T	0.70360|0.70360	0.3215|0.3215	L|L	0.59436|0.59436	1.845|1.845	0.35766|0.35766	D|D	0.820543|0.820543	.|D	.|0.71674	.|0.998	.|P	.|0.62014	.|0.897	T|T	0.77608|0.77608	-0.2524|-0.2524	5|10	.|0.59425	.|D	.|0.04	.|.	11.0433|11.0433	0.47844|0.47844	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|644	.|Q8IZJ3	.|CPMD8_HUMAN	M|D	701|691;430	.|ENSP00000373577:Y430D	.|ENSP00000291440:Y691D	I|Y	-|-	3|1	3|0	CPAMD8|CPAMD8	16947047|16947047	1.000000|1.000000	0.71417|0.71417	0.120000|0.120000	0.21714|0.21714	0.644000|0.644000	0.38419|0.38419	7.627000|7.627000	0.83176|0.83176	1.059000|1.059000	0.40554|0.40554	0.454000|0.454000	0.30748|0.30748	ATT|TAT	.	.		0.552	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
SLC7A10	56301	hgsc.bcm.edu	37	19	33703796	33703796	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:33703796G>T	ENST00000253188.4	-	3	615	c.469C>A	c.(469-471)Ccc>Acc	p.P157T		NM_019849.2	NP_062823.1	Q9NS82	AAA1_HUMAN	solute carrier family 7 (neutral amino acid transporter light chain, asc system), member 10	157					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|D-alanine transport (GO:0042941)|D-serine transport (GO:0042942)|ion transport (GO:0006811)|L-serine transport (GO:0015825)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)|neutral amino acid transmembrane transporter activity (GO:0015175)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	18	Esophageal squamous(110;0.137)					GCTGTGGTGGGGGGGATGCAG	0.637																																					p.P157T		Atlas-SNP	.											.	SLC7A10	43	.	0			c.C469A						.						61.0	63.0	62.0					19																	33703796		2203	4300	6503	SO:0001583	missense	56301	exon3			TGGTGGGGGGGAT	AB037670	CCDS12431.1	19q13.11	2013-05-28	2011-07-12		ENSG00000130876	ENSG00000130876		"""Solute carriers"""	11058	protein-coding gene	gene with protein product		607959				10734121, 10863037	Standard	NM_019849		Approved	asc-1	uc002num.2	Q9NS82	OTTHUMG00000180344	ENST00000253188.4:c.469C>A	chr19.hg19:g.33703796G>T	ENSP00000253188:p.Pro157Thr	154.0	0.0		109.0	9.0	NM_019849	B2RE84	Missense_Mutation	SNP	ENST00000253188.4	hg19	CCDS12431.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.108997	0.56398	.	.	ENSG00000130876	ENST00000253188	D	0.88431	-2.38	4.34	4.34	0.51931	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.94719	0.8296	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95619	0.8679	10	0.72032	D	0.01	.	15.8308	0.78749	0.0:0.0:1.0:0.0	.	157	Q9NS82	AAA1_HUMAN	T	157	ENSP00000253188:P157T	ENSP00000253188:P157T	P	-	1	0	SLC7A10	38395636	1.000000	0.71417	0.973000	0.42090	0.152000	0.21847	6.657000	0.74402	1.963000	0.57068	0.462000	0.41574	CCC	.	.		0.637	SLC7A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450846.2	NM_019849	
PDCD2L	84306	hgsc.bcm.edu	37	19	34916924	34916924	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:34916924G>A	ENST00000246535.3	+	7	1023	c.976G>A	c.(976-978)Gtt>Att	p.V326I	UBA2_ENST00000246548.4_5'Flank|UBA2_ENST00000439527.2_5'Flank|PDCD2L_ENST00000587065.2_Missense_Mutation_p.V24I|CTD-2588C8.8_ENST00000592220.1_RNA	NM_032346.1	NP_115722.1	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	326					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			AACAATTCTAGTTTACACATG	0.358																																					p.V326I		Atlas-SNP	.											.	PDCD2L	27	.	0			c.G976A						.						99.0	101.0	100.0					19																	34916924		2203	4300	6503	SO:0001583	missense	84306	exon7			ATTCTAGTTTACA	BC006146	CCDS12438.1	19q13.11	2008-02-05				ENSG00000126249			28194	protein-coding gene	gene with protein product		615661				16311922	Standard	NM_032346		Approved	MGC13096	uc002nvj.3	Q9BRP1		ENST00000246535.3:c.976G>A	chr19.hg19:g.34916924G>A	ENSP00000246535:p.Val326Ile	77.0	0.0		67.0	11.0	NM_032346		Missense_Mutation	SNP	ENST00000246535.3	hg19	CCDS12438.1	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735870	0.30774	.	.	ENSG00000126249	ENST00000246535	.	.	.	5.56	3.47	0.39725	Programmed cell death protein 2, C-terminal (1);	0.118674	0.56097	N	0.000023	T	0.38348	0.1037	N	0.24115	0.695	0.45250	D	0.998252	B	0.20887	0.049	B	0.25405	0.06	T	0.11641	-1.0579	9	0.19590	T	0.45	-9.8948	7.0095	0.24855	0.2874:0.0:0.7126:0.0	.	326	Q9BRP1	PDD2L_HUMAN	I	326	.	ENSP00000246535:V326I	V	+	1	0	PDCD2L	39608764	0.902000	0.30710	0.997000	0.53966	0.963000	0.63663	1.389000	0.34453	1.160000	0.42584	0.650000	0.86243	GTT	.	.		0.358	PDCD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459251.3	NM_032346	
PSG11	5680	hgsc.bcm.edu	37	19	43522945	43522945	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:43522945T>C	ENST00000401740.1	-	3	789	c.686A>G	c.(685-687)gAc>gGc	p.D229G	PSG11_ENST00000403486.1_Missense_Mutation_p.D107G|PSG11_ENST00000320078.7_Missense_Mutation_p.D229G|PSG11_ENST00000306322.7_Missense_Mutation_p.D107G|PSG11_ENST00000595312.1_5'UTR			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	229	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GGTGACTGGGTCACTGCGGCT	0.522																																					p.D229G		Atlas-SNP	.											.	PSG11	57	.	0			c.A686G						.						198.0	207.0	204.0					19																	43522945		2201	4298	6499	SO:0001583	missense	5680	exon3			ACTGGGTCACTGC	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.686A>G	chr19.hg19:g.43522945T>C	ENSP00000384995:p.Asp229Gly	37.0	0.0		64.0	8.0	NM_002785	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	hg19	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	t	11.27	1.589418	0.28357	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.00986	5.47;5.47;5.47;5.47	1.13	1.13	0.20643	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.04543	0.0124	M	0.85710	2.77	0.09310	N	1	D;P	0.89917	1.0;0.929	D;P	0.97110	1.0;0.895	T	0.28902	-1.0029	9	0.72032	D	0.01	.	4.3746	0.11263	0.0:0.0:0.0:1.0	.	107;229	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	G	229;107;107;229	ENSP00000319140:D229G;ENSP00000385427:D107G;ENSP00000304913:D107G;ENSP00000384995:D229G	ENSP00000304913:D107G	D	-	2	0	PSG11	48214785	0.128000	0.22383	0.018000	0.16275	0.013000	0.08279	0.650000	0.24858	0.477000	0.27464	0.155000	0.16302	GAC	.	.		0.522	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
EXOC3L2	90332	hgsc.bcm.edu	37	19	45721458	45721458	+	Silent	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:45721458G>A	ENST00000252482.3	-	6	687	c.660C>T	c.(658-660)taC>taT	p.Y220Y	EXOC3L2_ENST00000413988.1_Silent_p.Y220Y			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	220					exocytosis (GO:0006887)	exocyst (GO:0000145)				endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		GGTGCACCTGGTAAGGCTCGT	0.677																																					p.Y220Y		Atlas-SNP	.											.	EXOC3L2	30	.	0			c.C660T						.						11.0	9.0	9.0					19																	45721458		2160	4221	6381	SO:0001819	synonymous_variant	90332	exon7			CACCTGGTAAGGC	AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.660C>T	chr19.hg19:g.45721458G>A		141.0	0.0		107.0	12.0	NM_138568	Q8N9W2|Q96GV2	Silent	SNP	ENST00000252482.3	hg19	CCDS12657.1																																																																																			.	.		0.677	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568	
PPP1R13L	10848	hgsc.bcm.edu	37	19	45895303	45895303	+	Silent	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:45895303G>A	ENST00000418234.2	-	8	1728	c.1650C>T	c.(1648-1650)ctC>ctT	p.L550L	PPP1R13L_ENST00000360957.5_Silent_p.L550L	NM_001142502.1	NP_001135974.1	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13 like	550	Pro-rich.				apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic camera-type eye development (GO:0031076)|hair cycle (GO:0042633)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle tissue development (GO:0003229)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GACGATGGAAGAGGCGGCTGA	0.692																																					p.L550L	Pancreas(61;1447 1663 31419 50578)	Atlas-SNP	.											.	PPP1R13L	66	.	0			c.C1650T						.						38.0	46.0	43.0					19																	45895303		2203	4299	6502	SO:0001819	synonymous_variant	10848	exon8			ATGGAAGAGGCGG	AF078036	CCDS33050.1	19q13.32	2013-01-10	2011-10-04		ENSG00000104881	ENSG00000104881		"""Ankyrin repeat domain containing"""	18838	protein-coding gene	gene with protein product		607463	"""protein phosphatase 1, regulatory (inhibitor) subunit 13 like"""			10336463	Standard	NM_006663		Approved	RAI, IASPP	uc002pbo.3	Q8WUF5		ENST00000418234.2:c.1650C>T	chr19.hg19:g.45895303G>A		214.0	0.0		155.0	9.0	NM_001142502	Q2PNZ9|Q5DU71|Q5I1X4|Q6P1R7|Q6PKF8|Q9Y290	Silent	SNP	ENST00000418234.2	hg19	CCDS33050.1																																																																																			.	.		0.692	PPP1R13L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457586.1	NM_006663	
VASP	7408	hgsc.bcm.edu	37	19	46032653	46032653	+	IGR	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:46032653G>C	ENST00000245932.6	+	0	2305				OPA3_ENST00000323060.3_Missense_Mutation_p.I68M	NM_003370.3	NP_003361.1	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein						actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|neural tube closure (GO:0001843)|positive regulation of actin filament polymerization (GO:0030838)|protein homotetramerization (GO:0051289)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	profilin binding (GO:0005522)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)	18		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		TCAGCGGCTTGATGGCAGCGG	0.602																																					p.I68M		Atlas-SNP	.											.	OPA3	19	.	0			c.C204G						.						81.0	88.0	85.0					19																	46032653		2203	4300	6503	SO:0001628	intergenic_variant	80207	exon2			CGGCTTGATGGCA		CCDS33051.1	19q13.32	2012-02-22			ENSG00000125753	ENSG00000125753			12652	protein-coding gene	gene with protein product		601703				8812448	Standard	XM_005259199		Approved		uc002pcg.3	P50552			chr19.hg19:g.46032653G>C		339.0	0.0		229.0	14.0	NM_001017989	B2RBT9|Q6PIZ1|Q93035	Missense_Mutation	SNP	ENST00000245932.6	hg19	CCDS33051.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666876	0.47677	.	.	ENSG00000125741	ENST00000323060	D	0.84660	-1.88	3.66	-7.15	0.01521	.	0.436137	0.21993	N	0.066130	D	0.85588	0.5731	.	.	.	0.80722	D	1	P	0.47962	0.903	P	0.55545	0.778	D	0.85229	0.1031	9	0.59425	D	0.04	-23.7572	10.4475	0.44503	0.1355:0.6938:0.1707:0.0	.	68	Q9H6K4-2	.	M	68	ENSP00000319817:I68M	ENSP00000319817:I68M	I	-	3	3	OPA3	50724493	0.804000	0.28969	0.078000	0.20375	0.402000	0.30811	-0.275000	0.08525	-0.879000	0.04002	0.555000	0.69702	ATC	.	.		0.602	VASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459589.1		
PPP5C	5536	hgsc.bcm.edu	37	19	46893576	46893576	+	Silent	SNP	C	C	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:46893576C>T	ENST00000012443.4	+	13	1576	c.1473C>T	c.(1471-1473)aaC>aaT	p.N491N	PPP5C_ENST00000391919.1_Silent_p.N363N|AC007193.8_ENST00000598616.1_RNA	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	491	Catalytic.				cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CCTATGCCAACACGCTGCTGC	0.662																																					p.N491N		Atlas-SNP	.											.	PPP5C	44	.	0			c.C1473T						.						89.0	63.0	72.0					19																	46893576		2202	4298	6500	SO:0001819	synonymous_variant	5536	exon13			TGCCAACACGCTG		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.1473C>T	chr19.hg19:g.46893576C>T		113.0	0.0		107.0	28.0	NM_006247	Q16722|Q53XV2	Silent	SNP	ENST00000012443.4	hg19	CCDS12684.1																																																																																			.	.		0.662	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
CCDC155	147872	hgsc.bcm.edu	37	19	49920284	49920284	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:49920284G>C	ENST00000447857.3	+	18	1592	c.1387G>C	c.(1387-1389)Gtc>Ctc	p.V463L		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	463						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						TGATCTCCCTGTCCCTCTAGG	0.587																																					p.V463L		Atlas-SNP	.											.	CCDC155	46	.	0			c.G1387C						.						28.0	29.0	29.0					19																	49920284		1984	4158	6142	SO:0001583	missense	147872	exon18			CTCCCTGTCCCTC		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1387G>C	chr19.hg19:g.49920284G>C	ENSP00000404220:p.Val463Leu	107.0	0.0		74.0	5.0	NM_144688	Q96MC3	Missense_Mutation	SNP	ENST00000447857.3	hg19	CCDS46140.1	.	.	.	.	.	.	.	.	.	.	a	5.686	0.311173	0.10789	.	.	ENSG00000161609	ENST00000447857	T	0.30981	1.51	2.92	-0.569	0.11756	.	1.269890	0.05402	N	0.540950	T	0.10637	0.0260	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22103	-1.0226	10	0.15952	T	0.53	-22.8556	4.0118	0.09626	0.4385:0.1976:0.3639:0.0	.	463;463	C9JGW3;Q8N6L0	.;CC155_HUMAN	L	463	ENSP00000404220:V463L	ENSP00000404220:V463L	V	+	1	0	CCDC155	54612096	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-0.047000	0.11963	-0.566000	0.06054	-0.420000	0.06012	GTC	.	.		0.587	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465436.2	NM_144688	
ZNF577	84765	hgsc.bcm.edu	37	19	52375853	52375853	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:52375853T>C	ENST00000301399.5	-	7	1755	c.1390A>G	c.(1390-1392)Aat>Gat	p.N464D	ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000420592.1_Missense_Mutation_p.N405D|ZNF577_ENST00000451628.2_Missense_Mutation_p.N405D	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	464					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TTCACTTCATTTGTGAGGCTT	0.363																																					p.N464D		Atlas-SNP	.											.	ZNF577	63	.	0			c.A1390G						.						59.0	57.0	58.0					19																	52375853		2203	4300	6503	SO:0001583	missense	84765	exon7			CTTCATTTGTGAG	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.1390A>G	chr19.hg19:g.52375853T>C	ENSP00000301399:p.Asn464Asp	52.0	0.0		57.0	15.0	NM_032679	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	hg19	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	12.10	1.836364	0.32421	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.06528	3.29;3.34;3.34;3.29	3.04	3.04	0.35103	.	.	.	.	.	T	0.12603	0.0306	L	0.52573	1.65	0.21445	N	0.999688	D;D	0.76494	0.998;0.999	P;P	0.59948	0.739;0.866	T	0.12708	-1.0537	9	0.12430	T	0.62	.	9.1055	0.36696	0.0:0.0:0.0:1.0	.	464;405	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	D	464;405;405;464	ENSP00000301399:N464D;ENSP00000413476:N405D;ENSP00000389652:N405D;ENSP00000404509:N464D	ENSP00000301399:N464D	N	-	1	0	ZNF577	57067665	0.002000	0.14202	0.063000	0.19743	0.015000	0.08874	0.340000	0.19892	1.369000	0.46134	0.533000	0.62120	AAT	.	.		0.363	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679	
PPP2R1A	5518	hgsc.bcm.edu	37	19	52716305	52716305	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:52716305A>T	ENST00000322088.6	+	6	807	c.749A>T	c.(748-750)cAg>cTg	p.Q250L	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.Q71L|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.Q195L	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	250	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		ACTCTGCGCCAGGCCGCTGAA	0.632			Mis		clear cell ovarian carcinoma																																p.Q250L		Atlas-SNP	.		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	PPP2R1A	187	.	0			c.A749T						.						38.0	36.0	37.0					19																	52716305		2203	4300	6503	SO:0001583	missense	5518	exon6			TGCGCCAGGCCGC		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.749A>T	chr19.hg19:g.52716305A>T	ENSP00000324804:p.Gln250Leu	69.0	0.0		50.0	26.0	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	hg19	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.265590	0.59431	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.06449	3.3;3.3	4.48	4.48	0.54585	Armadillo-like helical (1);Armadillo-type fold (1);	0.106858	0.40302	N	0.001133	T	0.08758	0.0217	L	0.60455	1.87	0.58432	D	0.999999	B;B;B	0.11235	0.004;0.003;0.003	B;B;B	0.09377	0.004;0.001;0.001	T	0.05937	-1.0855	10	0.46703	T	0.11	-19.9349	12.0821	0.53677	1.0:0.0:0.0:0.0	.	195;250;250	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	L	240;170;250;195	ENSP00000324804:Q250L;ENSP00000415067:Q195L	ENSP00000324804:Q250L	Q	+	2	0	PPP2R1A	57408117	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.949000	0.87791	2.017000	0.59298	0.533000	0.62120	CAG	.	.		0.632	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
ZNF766	90321	hgsc.bcm.edu	37	19	52793824	52793824	+	Silent	SNP	A	A	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:52793824A>C	ENST00000439461.1	+	4	823	c.780A>C	c.(778-780)cgA>cgC	p.R260R	CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Silent_p.R275R|ZNF766_ENST00000593612.1_Silent_p.R275R|ZNF766_ENST00000599581.1_3'UTR	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		ACCTTGCACGACACGAGAAAG	0.423																																					p.R260R		Atlas-SNP	.											.	ZNF766	45	.	0			c.A780C						.						41.0	43.0	42.0					19																	52793824		2190	4297	6487	SO:0001819	synonymous_variant	90321	exon4			TGCACGACACGAG	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.780A>C	chr19.hg19:g.52793824A>C		140.0	0.0		113.0	27.0	NM_001010851	B2RNE0|Q7Z326	Silent	SNP	ENST00000439461.1	hg19	CCDS46163.1																																																																																			.	.		0.423	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851	
ZNF611	81856	hgsc.bcm.edu	37	19	53217352	53217352	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:53217352C>A	ENST00000319783.1	-	6	422	c.106G>T	c.(106-108)Gca>Tca	p.A36S	ZNF611_ENST00000600943.1_Intron|ZNF611_ENST00000543227.1_Missense_Mutation_p.A36S|ZNF611_ENST00000596702.1_Intron|ZNF611_ENST00000595798.1_Intron|ZNF611_ENST00000540744.1_Missense_Mutation_p.A36S|ZNF611_ENST00000453741.2_Intron|ZNF611_ENST00000602162.1_Intron	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	36	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TTCCACTCTGCCAATGAGAAT	0.453																																					p.A36S		Atlas-SNP	.											.	ZNF611	72	.	0			c.G106T						.						141.0	146.0	144.0					19																	53217352		2203	4300	6503	SO:0001583	missense	81856	exon6			ACTCTGCCAATGA	AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.106G>T	chr19.hg19:g.53217352C>A	ENSP00000322427:p.Ala36Ser	56.0	0.0		80.0	11.0	NM_030972	B3KRD5|Q69YG9	Missense_Mutation	SNP	ENST00000319783.1	hg19	CCDS12855.1	.	.	.	.	.	.	.	.	.	.	.	5.314	0.243311	0.10077	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000319783	T;T;T	0.01665	4.7;4.7;4.7	3.03	3.03	0.35002	Krueppel-associated box (4);	.	.	.	.	T	0.02304	0.0071	L	0.45137	1.4	0.28593	N	0.909529	B	0.06786	0.001	B	0.21546	0.035	T	0.21518	-1.0243	9	0.87932	D	0	.	7.3157	0.26499	0.0:0.8691:0.0:0.1309	.	36	Q8N823	ZN611_HUMAN	S	36	ENSP00000437616:A36S;ENSP00000439211:A36S;ENSP00000322427:A36S	ENSP00000322427:A36S	A	-	1	0	ZNF611	57909164	0.034000	0.19679	0.159000	0.22649	0.010000	0.07245	0.772000	0.26647	1.534000	0.49203	0.298000	0.19748	GCA	.	.		0.453	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1	NM_030972	
ZNF677	342926	hgsc.bcm.edu	37	19	53740801	53740801	+	Silent	SNP	A	A	G	rs566157588	byFrequency	TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:53740801A>G	ENST00000598513.1	-	5	1329	c.1179T>C	c.(1177-1179)caT>caC	p.H393H	ZNF677_ENST00000333952.4_Silent_p.H393H	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		GGATTCTCTTATGTTGGGTAA	0.408																																					p.H393H		Atlas-SNP	.											.	ZNF677	94	.	0			c.T1179C						.						99.0	87.0	91.0					19																	53740801		2203	4300	6503	SO:0001819	synonymous_variant	342926	exon5			TCTCTTATGTTGG	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.1179T>C	chr19.hg19:g.53740801A>G		129.0	0.0		114.0	12.0	NM_182609		Silent	SNP	ENST00000598513.1	hg19	CCDS12861.1																																																																																			.	.		0.408	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
LENG9	94059	hgsc.bcm.edu	37	19	54974120	54974120	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:54974120C>A	ENST00000333834.4	-	1	774	c.656G>T	c.(655-657)tGc>tTc	p.C219F		NM_198988.1	NP_945339.2	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	219							catalytic activity (GO:0003824)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)	11	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		GTGCCCTGTGCAGAGCGGCCT	0.706																																					p.C219F		Atlas-SNP	.											.	LENG9	46	.	0			c.G656T						.						18.0	19.0	19.0					19																	54974120		2121	4161	6282	SO:0001583	missense	94059	exon1			CCTGTGCAGAGCG	AF211976		19q13.4	2014-05-06			ENSG00000182909	ENSG00000275183			16306	protein-coding gene	gene with protein product						10941842	Standard	NM_198988		Approved		uc010yez.2	Q96B70	OTTHUMG00000188273	ENST00000333834.4:c.656G>T	chr19.hg19:g.54974120C>A	ENSP00000331647:p.Cys219Phe	125.0	0.0		82.0	8.0	NM_198988	B2VAM3	Missense_Mutation	SNP	ENST00000333834.4	hg19	CCDS12895.2	.	.	.	.	.	.	.	.	.	.	C	0.694	-0.793242	0.02862	.	.	ENSG00000182909	ENST00000333834	T	0.29655	1.56	4.18	-1.03	0.10102	.	1.917040	0.03439	U	0.209091	T	0.18964	0.0455	N	0.19112	0.55	0.09310	N	1	B	0.14805	0.011	B	0.06405	0.002	T	0.19910	-1.0291	10	0.48119	T	0.1	6.0093	3.1507	0.06486	0.1662:0.4113:0.3241:0.0985	.	219	Q96B70	LENG9_HUMAN	F	219	ENSP00000331647:C219F	ENSP00000331647:C219F	C	-	2	0	LENG9	59665932	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.199000	0.03032	-0.279000	0.09167	-0.519000	0.04390	TGC	.	.		0.706	LENG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140806.3	NM_198988	
SSC5D	284297	hgsc.bcm.edu	37	19	56011328	56011328	+	Silent	SNP	C	C	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:56011328C>A	ENST00000389623.6	+	10	1874	c.1851C>A	c.(1849-1851)acC>acA	p.T617T	SSC5D_ENST00000587166.1_Silent_p.T617T	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	617	Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						AGAAAACAACCACGAAGGCCC	0.547																																					p.T617T		Atlas-SNP	.											.	SSC5D	65	.	0			c.C1851A						.						111.0	124.0	120.0					19																	56011328		692	1591	2283	SO:0001819	synonymous_variant	284297	exon10			AACAACCACGAAG		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.1851C>A	chr19.hg19:g.56011328C>A		135.0	0.0		108.0	11.0	NM_001195267	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	hg19	CCDS46196.1																																																																																			.	.		0.547	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZNF8	7554	hgsc.bcm.edu	37	19	58806125	58806125	+	Silent	SNP	A	A	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr19:58806125A>G	ENST00000196548.5	+	4	1082	c.951A>G	c.(949-951)gaA>gaG	p.E317E	ZNF8_ENST00000608843.1_Silent_p.E317E|AC010642.1_ENST00000591325.1_3'UTR			P17098	ZNF8_HUMAN	zinc finger protein 8	317					BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		AGTGTGCCGAATGTGGGAAGT	0.542																																					p.E317E		Atlas-SNP	.											.	ZNF8	60	.	0			c.A951G						.						98.0	101.0	100.0					19																	58806125		2203	4300	6503	SO:0001819	synonymous_variant	7554	exon4			TGCCGAATGTGGG	M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.951A>G	chr19.hg19:g.58806125A>G		119.0	0.0		110.0	8.0	NM_021089	Q6PI99	Silent	SNP	ENST00000196548.5	hg19	CCDS12974.1																																																																																			.	.		0.542	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000459135.1	NM_021089	
LAMP5	24141	hgsc.bcm.edu	37	20	9496915	9496915	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr20:9496915A>C	ENST00000246070.2	+	4	874	c.382A>C	c.(382-384)Atg>Ctg	p.M128L	RP5-1119D9.4_ENST00000443469.1_RNA|LAMP5_ENST00000427562.2_Missense_Mutation_p.M84L	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	128						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											AAGCCACAACATGTCCAAGGG	0.582																																					p.M128L		Atlas-SNP	.											.	.	.	.	0			c.A382C						.						90.0	84.0	86.0					20																	9496915		2203	4300	6503	SO:0001583	missense	24141	exon4			CACAACATGTCCA	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.382A>C	chr20.hg19:g.9496915A>C	ENSP00000246070:p.Met128Leu	125.0	0.0		90.0	24.0	NM_012261	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	hg19	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	A	13.12	2.140808	0.37825	.	.	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.39997	1.64;1.05	5.98	4.87	0.63330	.	0.412890	0.29152	N	0.012992	T	0.21186	0.0510	N	0.08118	0	0.19300	N	0.999977	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.17776	-1.0358	9	.	.	.	-3.1146	9.3835	0.38329	0.9164:0.0:0.0836:0.0	.	84;128	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	L	128;84	ENSP00000246070:M128L;ENSP00000406360:M84L	.	M	+	1	0	C20orf103	9444915	1.000000	0.71417	0.989000	0.46669	0.980000	0.70556	3.636000	0.54317	1.073000	0.40885	0.482000	0.46254	ATG	.	.		0.582	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261	
BPIFB1	92747	hgsc.bcm.edu	37	20	31877770	31877770	+	Missense_Mutation	SNP	C	C	A	rs114635109	byFrequency	TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr20:31877770C>A	ENST00000253354.1	+	4	498	c.337C>A	c.(337-339)Ccc>Acc	p.P113T		NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1	113					innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										AGTCAAGATCCCCCTGGACAT	0.582																																					p.P113T		Atlas-SNP	.											.	.	.	.	0			c.C337A						.						124.0	95.0	105.0					20																	31877770		2203	4300	6503	SO:0001583	missense	92747	exon4			AAGATCCCCCTGG	BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.337C>A	chr20.hg19:g.31877770C>A	ENSP00000253354:p.Pro113Thr	121.0	0.0		93.0	7.0	NM_033197	A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	Missense_Mutation	SNP	ENST00000253354.1	hg19	CCDS13218.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648141	0.67358	.	.	ENSG00000125999	ENST00000423645;ENST00000253354	T;T	0.06142	3.34;3.66	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000008	T	0.26919	0.0659	M	0.80847	2.515	0.39560	D	0.969115	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00842	-1.1544	10	0.56958	D	0.05	-35.2487	15.0609	0.71951	0.0:1.0:0.0:0.0	.	113;113	B2R7Z6;Q8TDL5	.;BPIB1_HUMAN	T	113	ENSP00000390471:P113T;ENSP00000253354:P113T	ENSP00000253354:P113T	P	+	1	0	BPIFB1	31341431	0.958000	0.32768	0.987000	0.45799	0.713000	0.41058	3.494000	0.53273	2.722000	0.93159	0.655000	0.94253	CCC	.	C|0.988;T|0.012		0.582	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106499.2	NM_033197	
ZNF831	128611	hgsc.bcm.edu	37	20	57769710	57769710	+	Silent	SNP	T	T	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr20:57769710T>C	ENST00000371030.2	+	1	3636	c.3636T>C	c.(3634-3636)ccT>ccC	p.P1212P		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1212							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TGCACTTTCCTGGTAGCAGCC	0.642																																					p.P1212P		Atlas-SNP	.											.	ZNF831	287	.	0			c.T3636C						.						29.0	34.0	33.0					20																	57769710		2090	4212	6302	SO:0001819	synonymous_variant	128611	exon1			CTTTCCTGGTAGC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3636T>C	chr20.hg19:g.57769710T>C		160.0	0.0		104.0	23.0	NM_178457	Q5TDR4|Q8TCP0	Silent	SNP	ENST00000371030.2	hg19	CCDS42894.1																																																																																			.	.		0.642	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
CLTCL1	8218	hgsc.bcm.edu	37	22	19187289	19187289	+	Missense_Mutation	SNP	C	C	T	rs201881044		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr22:19187289C>T	ENST00000263200.10	-	24	3901	c.3829G>A	c.(3829-3831)Gtc>Atc	p.V1277I	CLTCL1_ENST00000442042.2_5'UTR|CLTCL1_ENST00000427926.1_Missense_Mutation_p.V1277I|CLTCL1_ENST00000353891.5_Missense_Mutation_p.V1277I	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1277	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					GCATGAATGACGATGTGAAGA	0.532			T	?	ALCL																																p.V1277I		Atlas-SNP	.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1	115	.	0			c.G3829A						.	C	ILE/VAL,ILE/VAL	0,4308		0,0,2154	54.0	56.0	55.0		3829,3829	1.9	0.7	22		55	5,8509		0,5,4252	yes	missense,missense	CLTCL1	NM_001835.3,NM_007098.3	29,29	0,5,6406	TT,TC,CC		0.0587,0.0,0.039	possibly-damaging,possibly-damaging	1277/1584,1277/1641	19187289	5,12817	2154	4257	6411	SO:0001583	missense	8218	exon24			GAATGACGATGTG		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.3829G>A	chr22.hg19:g.19187289C>T	ENSP00000445677:p.Val1277Ile	81.0	0.0		42.0	10.0	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	hg19	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	C	5.123	0.208343	0.09757	0.0	5.87E-4	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.20200	2.09;2.09;2.09	3.99	1.88	0.25563	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.163547	0.39985	N	0.001207	T	0.18257	0.0438	L	0.33668	1.02	0.53005	D	0.999961	B;P;B;B	0.42961	0.143;0.795;0.303;0.303	B;P;B;B	0.50231	0.175;0.635;0.318;0.154	T	0.09378	-1.0677	10	0.02654	T	1	-14.0934	9.4942	0.38978	0.0:0.8254:0.0:0.1746	.	1277;100;100;1277	P53675-2;B7Z1Z7;B7Z2Y4;P53675	.;.;.;CLH2_HUMAN	I	1277	ENSP00000439662:V1277I;ENSP00000445677:V1277I;ENSP00000441158:V1277I	ENSP00000445677:V1277I	V	-	1	0	CLTCL1	17567289	0.999000	0.42202	0.708000	0.30435	0.703000	0.40648	4.215000	0.58534	0.345000	0.23873	0.591000	0.81541	GTC	.	.		0.532	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
PI4KA	5297	hgsc.bcm.edu	37	22	21098986	21098986	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr22:21098986G>A	ENST00000572273.1	-	30	3442	c.3212C>T	c.(3211-3213)cCg>cTg	p.P1071L	PI4KA_ENST00000255882.6_Missense_Mutation_p.P1129L			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1071					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CACACAGGCCGGGCGCTCGCT	0.542																																					p.P1129L	GBM(136;1332 1831 3115 23601 50806)	Atlas-SNP	.											.	PI4KA	313	.	0			c.C3386T						.						103.0	86.0	92.0					22																	21098986		2203	4300	6503	SO:0001583	missense	5297	exon30			CAGGCCGGGCGCT	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3212C>T	chr22.hg19:g.21098986G>A	ENSP00000458238:p.Pro1071Leu	66.0	0.0		44.0	9.0	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	hg19		.	.	.	.	.	.	.	.	.	.	G	36	5.703062	0.96812	.	.	ENSG00000241973	ENST00000255882	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.78227	0.4250	M	0.79926	2.475	0.80722	D	1	D	0.69078	0.997	P	0.56474	0.799	T	0.80344	-0.1422	9	0.72032	D	0.01	-24.274	20.1434	0.98067	0.0:0.0:1.0:0.0	.	1071	P42356	PI4KA_HUMAN	L	1071	.	ENSP00000255882:P1071L	P	-	2	0	PI4KA	19428986	1.000000	0.71417	0.973000	0.42090	0.968000	0.65278	9.863000	0.99569	2.769000	0.95229	0.563000	0.77884	CCG	.	.		0.542	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
SUSD2	56241	hgsc.bcm.edu	37	22	24583419	24583419	+	Splice_Site	SNP	G	G	C			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr22:24583419G>C	ENST00000358321.3	+	11	2152		c.e11+1			NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2						immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						GGGGCCAACTGTGAGTGACCG	0.647																																					.		Atlas-SNP	.											.	SUSD2	68	.	0			c.1891+1G>C						.						60.0	60.0	60.0					22																	24583419		2203	4300	6503	SO:0001630	splice_region_variant	56241	exon11			CCAACTGTGAGTG	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1891+1G>C	chr22.hg19:g.24583419G>C		51.0	0.0		33.0	5.0	NM_019601	Q9H5Y6	Splice_Site	SNP	ENST00000358321.3	hg19	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.946401	0.34377	.	.	ENSG00000099994	ENST00000358321	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3376	0.74269	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SUSD2	22913419	1.000000	0.71417	0.997000	0.53966	0.027000	0.11550	7.435000	0.80391	2.274000	0.75844	0.555000	0.69702	.	.	.		0.647	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	Intron
TRIOBP	11078	hgsc.bcm.edu	37	22	38121679	38121679	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr22:38121679C>G	ENST00000406386.3	+	7	3371	c.3116C>G	c.(3115-3117)cCc>cGc	p.P1039R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1039					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GACCCCTTCCCCTTCTTCCCA	0.652																																					p.P1039R		Atlas-SNP	.											.	TRIOBP	262	.	0			c.C3116G						.						74.0	84.0	81.0					22																	38121679		1947	4122	6069	SO:0001583	missense	11078	exon7			CCTTCCCCTTCTT	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3116C>G	chr22.hg19:g.38121679C>G	ENSP00000384312:p.Pro1039Arg	203.0	0.0		112.0	24.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	hg19	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463200	0.63513	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.24151	1.87	4.86	4.86	0.63082	.	.	.	.	.	T	0.36771	0.0979	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	D	0.64237	0.923	T	0.08493	-1.0719	9	0.62326	D	0.03	.	13.4136	0.60956	0.0:1.0:0.0:0.0	.	1039	Q9H2D6	TARA_HUMAN	R	1039	ENSP00000384312:P1039R	ENSP00000384312:P1039R	P	+	2	0	TRIOBP	36451625	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	3.740000	0.55082	2.534000	0.85438	0.456000	0.33151	CCC	.	.		0.652	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
DDX17	10521	hgsc.bcm.edu	37	22	38890726	38890726	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr22:38890726T>A	ENST00000396821.3	-	8	1222	c.1123A>T	c.(1123-1125)Acc>Tcc	p.T375S	DDX17_ENST00000381633.3_Missense_Mutation_p.T296S|DDX17_ENST00000432525.1_5'UTR	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	375	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					TTGATCTGGGTGTAATCACGA	0.458																																					p.T375S	Ovarian(55;1085 1454 6392 21425)	Atlas-SNP	.											.	DDX17	73	.	0			c.A1123T						.						187.0	160.0	169.0					22																	38890726		2203	4300	6503	SO:0001583	missense	10521	exon8			TCTGGGTGTAATC	U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.1123A>T	chr22.hg19:g.38890726T>A	ENSP00000380033:p.Thr375Ser	159.0	0.0		111.0	10.0	NM_006386	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	ENST00000396821.3	hg19	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	T	16.88	3.243570	0.58995	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.04454	3.62;3.62;3.62	5.83	5.83	0.93111	DEAD-like helicase (2);	0.222296	0.49305	D	0.000155	T	0.04952	0.0133	L	0.38692	1.165	0.80722	D	1	B;B;B	0.19583	0.001;0.037;0.022	B;B;B	0.23150	0.001;0.02;0.044	T	0.32268	-0.9913	10	0.72032	D	0.01	-13.0587	6.2361	0.20764	0.0:0.192:0.0:0.808	.	296;377;375	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	S	375;296;375;377	ENSP00000380033:T375S;ENSP00000371046:T296S;ENSP00000385536:T375S	ENSP00000371046:T296S	T	-	1	0	DDX17	37220672	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.074000	0.50065	2.236000	0.73375	0.533000	0.62120	ACC	.	.		0.458	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881	
TAF1	6872	hgsc.bcm.edu	37	X	70617187	70617187	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chrX:70617187G>A	ENST00000373790.4	+	23	3539	c.3488G>A	c.(3487-3489)cGc>cAc	p.R1163H	TAF1_ENST00000276072.3_Missense_Mutation_p.R1184H|TAF1_ENST00000449580.1_Missense_Mutation_p.R1163H|TAF1_ENST00000423759.1_Missense_Mutation_p.R1184H	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1163					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R1163H(1)|p.R1184H(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GCCACTGGACGCTGTCTCAAG	0.502																																					p.R1184H		Atlas-SNP	.											.	TAF1	439	.	2	Substitution - Missense(2)	endometrium(2)	c.G3551A						.						165.0	109.0	128.0					X																	70617187		2203	4300	6503	SO:0001583	missense	6872	exon23			CTGGACGCTGTCT		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.3488G>A	chrX.hg19:g.70617187G>A	ENSP00000362895:p.Arg1163His	218.0	0.0		175.0	38.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	hg19	CCDS35325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	16.69|16.69	3.192034|3.192034	0.58017|0.58017	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000483985|ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	.|T;T;T;T	.|0.18502	.|2.21;2.21;2.21;2.21	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	.|0.115711	.|0.64402	.|D	.|0.000015	T|T	0.24624|0.24624	0.0597|0.0597	M|M	0.67397|0.67397	2.05|2.05	0.51233|0.51233	D|D	0.99991|0.99991	.|B;B;B	.|0.18741	.|0.03;0.017;0.03	.|B;B;B	.|0.23419	.|0.046;0.016;0.035	T|T	0.04708|0.04708	-1.0932|-1.0932	5|10	.|0.54805	.|T	.|0.06	.|.	17.5217|17.5217	0.87789|0.87789	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1163;1163;1184	.|P21675-4;P21675;P21675-2	.|.;TAF1_HUMAN;.	T|H	74|1163;1163;1184;1184	.|ENSP00000362895:R1163H;ENSP00000389000:R1163H;ENSP00000406549:R1184H;ENSP00000276072:R1184H	.|ENSP00000276072:R1184H	A|R	+|+	1|2	0|0	TAF1|TAF1	70533912|70533912	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.336000|7.336000	0.79245|0.79245	2.322000|2.322000	0.78497|0.78497	0.449000|0.449000	0.29647|0.29647	GCT|CGC	.	.		0.502	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
PGK1	5230	hgsc.bcm.edu	37	X	77359873	77359873	+	Silent	SNP	G	G	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chrX:77359873G>A	ENST00000373316.4	+	1	203	c.36G>A	c.(34-36)ctG>ctA	p.L12L	PGK1_ENST00000537456.1_5'Flank|PGK1_ENST00000442431.1_Silent_p.L12L	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	12					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	TGGACAAGCTGGACGTTAAAG	0.552																																					p.L12L		Atlas-SNP	.											.	PGK1	34	.	0			c.G36A						.						112.0	70.0	84.0					X																	77359873		2203	4296	6499	SO:0001819	synonymous_variant	5230	exon1			CAAGCTGGACGTT	L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.36G>A	chrX.hg19:g.77359873G>A		51.0	0.0		39.0	21.0	NM_000291	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Silent	SNP	ENST00000373316.4	hg19	CCDS14438.1																																																																																			.	.		0.552	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1		
TENM1	10178	hgsc.bcm.edu	37	X	123526164	123526164	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chrX:123526164T>A	ENST00000371130.3	-	27	5468	c.5405A>T	c.(5404-5406)gAt>gTt	p.D1802V	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.D1809V	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1802					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGTTATATGATCAAAATCTAT	0.423																																					p.D1809V		Atlas-SNP	.											.	.	.	.	0			c.A5426T						.						129.0	121.0	124.0					X																	123526164		2203	4299	6502	SO:0001583	missense	10178	exon28			ATATGATCAAAAT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.5405A>T	chrX.hg19:g.123526164T>A	ENSP00000360171:p.Asp1802Val	44.0	0.0		67.0	31.0	NM_001163278	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	hg19	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.935625	0.73442	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.90900	-2.75;-2.71	5.54	5.54	0.83059	.	0.099413	0.64402	D	0.000001	D	0.93452	0.7911	M	0.79123	2.44	0.80722	D	1	D;D;D	0.59767	0.986;0.986;0.969	P;P;P	0.53954	0.617;0.738;0.643	D	0.94162	0.7415	10	0.87932	D	0	.	14.7475	0.69499	0.0:0.0:0.0:1.0	.	1808;1809;1802	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	V	1802;1809	ENSP00000360171:D1802V;ENSP00000403954:D1809V	ENSP00000360171:D1802V	D	-	2	0	ODZ1	123353845	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.258000	0.72487	1.863000	0.54032	0.486000	0.48141	GAT	.	.		0.423	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
SCN7A	6332	hgsc.bcm.edu	37	2	167266354	167266355	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:167266354_167266355insT	ENST00000409855.1	-	24	3928_3929	c.3802_3803insA	c.(3802-3804)atgfs	p.M1268fs		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1268					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GTCTATCATCATGGCTATTGCT	0.356																																					p.M1268fs		Atlas-INDEL	.											.	SCN7A	410	.	0			c.3803_3804insA						.																																			SO:0001589	frameshift_variant	6332	exon24			.	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3803dupA	chr2.hg19:g.167266355_167266355dupT	ENSP00000386796:p.Met1268fs	120.0	0.0		183.0	23.0	NM_002976		Frame_Shift_Ins	INS	ENST00000409855.1	hg19	CCDS46442.1																																																																																			.	.		0.356	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
BAP1	8314	hgsc.bcm.edu	37	3	52436677	52436708	+	Splice_Site	DEL	CTCTGGTCATCAATCTGTAGGAGAGAAGAAGA	CTCTGGTCATCAATCTGTAGGAGAGAAGAAGA	-			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	CTCTGGTCATCAATCTGTAGGAGAGAAGAAGA	CTCTGGTCATCAATCTGTAGGAGAGAAGAAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr3:52436677_52436708delCTCTGGTCATCAATCTGTAGGAGAGAAGAAGA	ENST00000460680.1	-	16	2455_2468	c.1984_1997delTCTTCTTCTCTCCTACAGATTGATGACCAGAG	c.(1984-1998)tcttcttctctccta>a	p.SSSLL662fs	BAP1_ENST00000296288.5_Splice_Site_p.SSSLL644fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R666_H669>N(1)|p.?(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GTGGGTCCTTCTCTGGTCATCAATCTGTAGGAGAGAAGAAGACTGAGAGCAC	0.534			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.662_666del	GBM(101;493 1458 7992 21037 25532)	Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	2	Unknown(1)|Complex - deletion inframe(1)	eye(2)	c.1984_1998del						.																																			SO:0001630	splice_region_variant	8314	exon16			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1984-1TCTTCTTCTCTCCTACAGATTGATGACCAGAG>-	chr3.hg19:g.52436677_52436708delCTCTGGTCATCAATCTGTAGGAGAGAAGAAGA		137.0	0.0		73.0	10.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	In_Frame_Del	DEL	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.		0.534	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		Frame_Shift_Del
IDH2	3418	hgsc.bcm.edu	37	15	90628312	90628313	+	Frame_Shift_Ins	INS	-	-	G	rs202014285		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr15:90628312_90628313insG	ENST00000330062.3	-	9	1211_1212	c.1098_1099insC	c.(1096-1101)accaacfs	p.N367fs	IDH2_ENST00000539790.1_Frame_Shift_Ins_p.N237fs|IDH2_ENST00000540499.2_Frame_Shift_Ins_p.N315fs|IDH2_ENST00000559482.1_Frame_Shift_Ins_p.N258fs|RP11-617F23.1_ENST00000558334.1_RNA	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	367					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			GCGATGGGGTTGGTGCTGGTGG	0.663			M		GBM																																p.N367fs		Atlas-INDEL	.		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	.	IDH2	1372	.	0			c.1099_1100insC						.																																			SO:0001589	frameshift_variant	3418	exon9			.		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.1099dupC	chr15.hg19:g.90628314_90628314dupG	ENSP00000331897:p.Asn367fs	77.0	0.0		43.0	12.0	NM_002168	B2R6L6|B4DFL2|Q96GT3	Frame_Shift_Ins	INS	ENST00000330062.3	hg19	CCDS10359.1																																																																																			.	.		0.663	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
ADAMTS2	9509	hgsc.bcm.edu	37	5	178554970	178554970	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr5:178554970delG	ENST00000251582.7	-	17	2708	c.2607delC	c.(2605-2607)cccfs	p.P869fs		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	869	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CTCCGCCACAGGGCTTGGAGC	0.612																																					p.C870fs		Atlas-Indel,Pindel	.											.	ADAMTS2	190	.	0			c.2608delT						.						145.0	126.0	132.0					5																	178554970		2203	4300	6503	SO:0001589	frameshift_variant	9509	exon17			.	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2607delC	chr5.hg19:g.178554970delG	ENSP00000251582:p.Pro869fs	68.0	0.0		42.0	10.0	NM_014244		Frame_Shift_Del	DEL	ENST00000251582.7	hg19	CCDS4444.1																																																																																			.	.		0.612	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
DKK2	27123	hgsc.bcm.edu	37	4	107847000	107847022	+	Frame_Shift_Del	DEL	CAGCGCTTCTTTTTTCTCCGACA	CAGCGCTTCTTTTTTCTCCGACA	-	rs373542751|rs541386879		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	CAGCGCTTCTTTTTTCTCCGACA	CAGCGCTTCTTTTTTCTCCGACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr4:107847000_107847022delCAGCGCTTCTTTTTTCTCCGACA	ENST00000285311.3	-	2	1012_1034	c.307_329delTGTCGGAGAAAAAAGAAGCGCTG	c.(307-330)tgtcggagaaaaaagaagcgctgcfs	p.CRRKKKRC103fs	DKK2_ENST00000510463.1_Frame_Shift_Del_p.CRRKKKRC57fs|DKK2_ENST00000513208.1_Frame_Shift_Del_p.CRRKKKRC3fs	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	103	DKK-type Cys-1.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		ATCTCGGTGGCAGCGCTTCTTTTTTCTCCGACACACCATGCAG	0.498																																					p.103_110del		Pindel	.											.	DKK2	96	.	0			c.308_330del						.																																			SO:0001589	frameshift_variant	27123	exon2			.	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.307_329delTGTCGGAGAAAAAAGAAGCGCTG	chr4.hg19:g.107847000_107847022delCAGCGCTTCTTTTTTCTCCGACA	ENSP00000285311:p.Cys103fs	58.0	0.0		76.0	12.0	NM_014421	A0AVE9|B2R6S7|Q9UIU3	Frame_Shift_Del	DEL	ENST00000285311.3	hg19	CCDS3675.1																																																																																			.	.		0.498	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4		
SCN7A	6332	hgsc.bcm.edu	37	2	167266356	167266357	+	Frame_Shift_Del	DEL	GG	GG	-	rs573169902		TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr2:167266356_167266357delGG	ENST00000409855.1	-	24	3926_3927	c.3800_3801delCC	c.(3799-3801)gccfs	p.A1267fs		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1267					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CTATCATCATGGCTATTGCTTG	0.351																																					p.1267_1268del		Pindel	.											.	SCN7A	410	.	0			c.3801_3802del						.																																			SO:0001589	frameshift_variant	6332	exon24			.	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3800_3801delCC	chr2.hg19:g.167266356_167266357delGG	ENSP00000386796:p.Ala1267fs	119.0	0.0		180.0	16.0	NM_002976		Frame_Shift_Del	DEL	ENST00000409855.1	hg19	CCDS46442.1																																																																																			.	.		0.351	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SARM1	23098	hgsc.bcm.edu	37	17	26708300	26708318	+	Frame_Shift_Del	DEL	TGGGTCAGGCATCTTGGAG	TGGGTCAGGCATCTTGGAG	-	rs71373646|rs386796348|rs71373647|rs111956698|rs71373645	byFrequency	TCGA-2Y-A9H3-01A-11D-A382-10	TCGA-2Y-A9H3-10A-01D-A385-10	TGGGTCAGGCATCTTGGAG	TGGGTCAGGCATCTTGGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4d274d44-da17-4591-ad59-a37a868e32d8	6e97c9c0-1710-4ff7-8fdc-180aaf2cfd90	g.chr17:26708300_26708318delTGGGTCAGGCATCTTGGAG	ENST00000457710.3	+	2	918_936	c.447_465delTGGGTCAGGCATCTTGGAG	c.(445-465)agtgggtcaggcatcttggagfs	p.SGSGILE149fs	TMEM199_ENST00000509083.1_Frame_Shift_Del_p.WVRHLGA204fs|SARM1_ENST00000379061.4_3'UTR|CTB-96E2.3_ENST00000591482.1_RNA	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	183					innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)				cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TGGCGCGGAGTGGGTCAGGCATCTTGGAGCACATGTTCA	0.667																																					p.182_188del		Pindel	.											.	SARM1	40	.	0			c.545_563del						.																																			SO:0001589	frameshift_variant	23098	exon3			.	AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.447_465delTGGGTCAGGCATCTTGGAG	chr17.hg19:g.26708300_26708318delTGGGTCAGGCATCTTGGAG	ENSP00000406738:p.Ser149fs	303.0	0.0		173.0	13.0	NM_015077	O60277|Q7LGG3|Q9NXY5	Frame_Shift_Del	DEL	ENST00000457710.3	hg19																																																																																				.	.		0.667	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000255679.3	NM_015077	
