#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARHGEF10L	55160	hgsc.bcm.edu	37	1	18014160	18014160	+	Silent	SNP	C	C	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:18014160C>G	ENST00000361221.3	+	27	3261	c.3102C>G	c.(3100-3102)acC>acG	p.T1034T	ARHGEF10L_ENST00000375415.1_Silent_p.T995T|ARHGEF10L_ENST00000434513.1_Silent_p.T1029T|ARHGEF10L_ENST00000375408.3_Silent_p.T807T|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Silent_p.T737T|ARHGEF10L_ENST00000452522.1_Silent_p.T995T	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	1034						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		CCTCCGGCACCTCCATCCGCC	0.632																																					p.T1034T		Atlas-SNP	.											.	ARHGEF10L	219	.	0			c.C3102G						.						82.0	72.0	76.0					1																	18014160		2202	4299	6501	SO:0001819	synonymous_variant	55160	exon27			CGGCACCTCCATC	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.3102C>G	chr1.hg19:g.18014160C>G		146.0	0.0		69.0	18.0	NM_018125	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Silent	SNP	ENST00000361221.3	hg19	CCDS182.1																																																																																			.	.		0.632	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000007147.1	NM_018125	
DOCK7	85440	hgsc.bcm.edu	37	1	63021551	63021551	+	Silent	SNP	T	T	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:63021551T>C	ENST00000340370.5	-	21	2558	c.2541A>G	c.(2539-2541)tcA>tcG	p.S847S	DOCK7_ENST00000251157.5_Silent_p.S847S	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	847					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						AATGAATATATGATGCAAGAA	0.343																																					p.S847S		Atlas-SNP	.											.	DOCK7	184	.	0			c.A2541G						.						176.0	168.0	171.0					1																	63021551		2203	4300	6503	SO:0001819	synonymous_variant	85440	exon21			AATATATGATGCA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.2541A>G	chr1.hg19:g.63021551T>C		30.0	0.0		58.0	18.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Silent	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	T	7.301	0.613127	0.14066	.	.	ENSG00000116641	ENST00000454575	.	.	.	5.45	-10.9	0.00192	.	.	.	.	.	T	0.44159	0.1280	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55147	-0.8186	4	.	.	.	.	7.816	0.29260	0.0668:0.2764:0.4676:0.1892	.	.	.	.	V	19	.	.	I	-	1	0	DOCK7	62794139	0.005000	0.15991	0.433000	0.26760	0.852000	0.48524	-1.505000	0.02273	-2.265000	0.00688	-0.316000	0.08728	ATA	.	.		0.343	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
DOCK7	85440	hgsc.bcm.edu	37	1	63091000	63091000	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:63091000C>T	ENST00000340370.5	-	12	1372	c.1355G>A	c.(1354-1356)aGt>aAt	p.S452N	DOCK7_ENST00000251157.5_Missense_Mutation_p.S452N|DOCK7_ENST00000404627.2_Missense_Mutation_p.S452N	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	452					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						ATCATCTCCACTTGTTGTCCT	0.383																																					p.S452N		Atlas-SNP	.											.	DOCK7	184	.	0			c.G1355A						.						188.0	191.0	190.0					1																	63091000		2203	4300	6503	SO:0001583	missense	85440	exon12			TCTCCACTTGTTG		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.1355G>A	chr1.hg19:g.63091000C>T	ENSP00000340742:p.Ser452Asn	104.0	0.0		155.0	52.0	NM_001272002	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413664	0.83449	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.39229	1.09;1.09;1.09	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.38401	0.1039	L	0.48642	1.525	0.80722	D	1	P;P;P;P;B	0.40332	0.67;0.551;0.713;0.713;0.138	P;B;B;B;B	0.47626	0.552;0.32;0.446;0.446;0.071	T	0.34825	-0.9813	10	0.56958	D	0.05	.	17.6705	0.88216	0.0:1.0:0.0:0.0	.	452;452;452;452;452	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	N	452	ENSP00000251157:S452N;ENSP00000340742:S452N;ENSP00000384446:S452N	ENSP00000251157:S452N	S	-	2	0	DOCK7	62863588	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	7.184000	0.77705	2.386000	0.81285	0.467000	0.42956	AGT	.	.		0.383	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
ZNF644	84146	hgsc.bcm.edu	37	1	91406004	91406004	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:91406004A>G	ENST00000370440.1	-	3	1124	c.907T>C	c.(907-909)Tat>Cat	p.Y303H	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.Y303H			Q9H582	ZN644_HUMAN	zinc finger protein 644	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCCTCGGTATAACGAGTTATC	0.333																																					p.Y303H		Atlas-SNP	.											.	ZNF644	120	.	0			c.T907C						.						90.0	87.0	88.0					1																	91406004		2203	4299	6502	SO:0001583	missense	84146	exon3			CGGTATAACGAGT	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.907T>C	chr1.hg19:g.91406004A>G	ENSP00000359469:p.Tyr303His	44.0	0.0		59.0	22.0	NM_201269	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	hg19	CCDS731.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.42|16.42	3.118885|3.118885	0.56505|0.56505	.|.	.|.	ENSG00000122482|ENSG00000122482	ENST00000541557|ENST00000370440;ENST00000337393	.|T;T	.|0.00626	.|6.13;6.13	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.122258	.|0.64402	.|D	.|0.000019	T|T	0.01029|0.01029	0.0034|0.0034	L|L	0.32530|0.32530	0.975|0.975	0.54753|0.54753	D|D	0.999984|0.999984	.|D	.|0.71674	.|0.998	.|D	.|0.75484	.|0.986	T|T	0.80327|0.80327	-0.1429|-0.1429	6|10	0.87932|0.48119	D|T	0|0.1	-11.6017|-11.6017	15.756|15.756	0.78025|0.78025	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|303	.|Q9H582	.|ZN644_HUMAN	S|H	302|303	.|ENSP00000359469:Y303H;ENSP00000337008:Y303H	ENSP00000442287:L302S|ENSP00000337008:Y303H	L|Y	-|-	2|1	0|0	ZNF644|ZNF644	91178592|91178592	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	4.588000|4.588000	0.60999|0.60999	2.131000|2.131000	0.65755|0.65755	0.533000|0.533000	0.62120|0.62120	TTA|TAT	.	.		0.333	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
FAM20B	9917	hgsc.bcm.edu	37	1	179041061	179041061	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:179041061A>T	ENST00000263733.4	+	8	1348	c.1012A>T	c.(1012-1014)Acc>Tcc	p.T338S		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	338						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						TCGGGTGTCCACCTGGAACAG	0.448																																					p.T338S		Atlas-SNP	.											.	FAM20B	38	.	0			c.A1012T						.						117.0	121.0	119.0					1																	179041061		2203	4300	6503	SO:0001583	missense	9917	exon8			GTGTCCACCTGGA	AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.1012A>T	chr1.hg19:g.179041061A>T	ENSP00000263733:p.Thr338Ser	228.0	0.0		342.0	145.0	NM_014864	Q5W0C3|Q5W0C4	Missense_Mutation	SNP	ENST00000263733.4	hg19	CCDS1328.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638596	0.87760	.	.	ENSG00000116199	ENST00000263733	D	0.81821	-1.54	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.90484	0.7019	M	0.87900	2.915	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.92100	0.5687	10	0.87932	D	0	-26.9284	13.9203	0.63928	1.0:0.0:0.0:0.0	.	338	O75063	XYLK_HUMAN	S	338	ENSP00000263733:T338S	ENSP00000263733:T338S	T	+	1	0	FAM20B	177307684	1.000000	0.71417	0.371000	0.25978	0.940000	0.58332	9.339000	0.96797	2.012000	0.59069	0.533000	0.62120	ACC	.	.		0.448	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	NM_014864	
SMG7	9887	hgsc.bcm.edu	37	1	183519889	183519889	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:183519889A>G	ENST00000347615.2	+	20	3106	c.2987A>G	c.(2986-2988)cAt>cGt	p.H996R	SMG7_ENST00000507469.1_Missense_Mutation_p.H1000R|SMG7_ENST00000367537.3_Missense_Mutation_p.H1029R|SMG7_ENST00000456731.2_Missense_Mutation_p.H908R|SMG7_ENST00000515829.2_Missense_Mutation_p.H950R|SMG7_ENST00000508461.1_Missense_Mutation_p.H1004R	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	996	Ser-rich.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						TTAATAGATCATTCAACACCA	0.388																																					p.H1004R		Atlas-SNP	.											.	SMG7	165	.	0			c.A3011G						.						95.0	92.0	93.0					1																	183519889		2203	4300	6503	SO:0001583	missense	9887	exon20			TAGATCATTCAAC	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2987A>G	chr1.hg19:g.183519889A>G	ENSP00000340766:p.His996Arg	137.0	0.0		437.0	97.0	NM_001174061	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	hg19	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284373	0.80803	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T	0.20881	2.05;2.07;2.05;2.06;2.05;2.04	5.45	5.45	0.79879	.	0.180930	0.52532	D	0.000076	T	0.33294	0.0858	L	0.29908	0.895	0.80722	D	1	D;D;D;D;P	0.71674	0.998;0.998;0.997;0.998;0.915	D;D;D;D;B	0.71184	0.958;0.958;0.972;0.958;0.297	T	0.03157	-1.1066	10	0.30078	T	0.28	-8.5781	15.8223	0.78667	1.0:0.0:0.0:0.0	.	1004;908;950;996;1000	E9PCI0;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;SMG7_HUMAN;.	R	908;1029;1004;996;1000;950	ENSP00000407629:H908R;ENSP00000356507:H1029R;ENSP00000426915:H1004R;ENSP00000340766:H996R;ENSP00000425133:H1000R;ENSP00000421358:H950R	ENSP00000340766:H996R	H	+	2	0	SMG7	181786512	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.451000	0.90343	2.188000	0.69820	0.528000	0.53228	CAT	.	.		0.388	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
PGBD5	79605	hgsc.bcm.edu	37	1	230492978	230492978	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:230492978G>A	ENST00000525115.1	-	2	237	c.214C>T	c.(214-216)Cag>Tag	p.Q72*	PGBD5_ENST00000391860.1_Nonsense_Mutation_p.Q26*|PGBD5_ENST00000321327.2_Nonsense_Mutation_p.Q171*			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	72						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		ATGTTTGTCTGCACCACCATG	0.577																																					p.Q141X		Atlas-SNP	.											.	PGBD5	73	.	0			c.C421T						.						79.0	74.0	76.0					1																	230492978		2203	4300	6503	SO:0001587	stop_gained	79605	exon2			TTGTCTGCACCAC	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.214C>T	chr1.hg19:g.230492978G>A	ENSP00000431404:p.Gln72*	134.0	0.0		154.0	94.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Nonsense_Mutation	SNP	ENST00000525115.1	hg19		.	.	.	.	.	.	.	.	.	.	G	37	6.486591	0.97607	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-44.5156	20.0313	0.97540	0.0:0.0:1.0:0.0	.	.	.	.	X	26;171;72	.	ENSP00000322530:Q171X	Q	-	1	0	PGBD5	228559601	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.848000	0.99507	2.746000	0.94184	0.655000	0.94253	CAG	.	.		0.577	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
RYR2	6262	hgsc.bcm.edu	37	1	237824155	237824155	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:237824155A>G	ENST00000366574.2	+	56	8661	c.8344A>G	c.(8344-8346)Atg>Gtg	p.M2782V	RYR2_ENST00000360064.6_Missense_Mutation_p.M2780V|RYR2_ENST00000542537.1_Missense_Mutation_p.M2766V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2782	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTAAAAACTATGCTGGCTTG	0.383																																					p.M2782V		Atlas-SNP	.											.	RYR2	1273	.	0			c.A8344G						.						42.0	43.0	42.0					1																	237824155		1488	3344	4832	SO:0001583	missense	6262	exon56			AAAACTATGCTGG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8344A>G	chr1.hg19:g.237824155A>G	ENSP00000355533:p.Met2782Val	259.0	0.0		439.0	249.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.485689	0.84854	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91686	-2.89;-2.89;-2.89	5.46	5.46	0.80206	Ryanodine receptor Ryr (1);	0.000000	0.85682	D	0.000000	D	0.93644	0.7970	L	0.58925	1.835	0.80722	D	1	D	0.61697	0.99	P	0.55345	0.774	D	0.94324	0.7556	10	0.87932	D	0	-18.0478	15.8331	0.78773	1.0:0.0:0.0:0.0	.	2782	Q92736	RYR2_HUMAN	V	2782;2780;2766	ENSP00000355533:M2782V;ENSP00000353174:M2780V;ENSP00000443798:M2766V	ENSP00000353174:M2780V	M	+	1	0	RYR2	235890778	1.000000	0.71417	0.927000	0.36925	0.937000	0.57800	8.844000	0.92147	2.192000	0.70111	0.460000	0.39030	ATG	.	.		0.383	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
WDR64	128025	hgsc.bcm.edu	37	1	241875158	241875158	+	Silent	SNP	T	T	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr1:241875158T>G	ENST00000366552.2	+	8	1206	c.999T>G	c.(997-999)gtT>gtG	p.V333V	WDR64_ENST00000437684.2_Silent_p.V333V	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	333										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GCTACTGTGTTAAGGCAAATG	0.408																																					p.V333V		Atlas-SNP	.											.	WDR64	234	.	0			c.T999G						.						118.0	110.0	113.0					1																	241875158		2203	4300	6503	SO:0001819	synonymous_variant	128025	exon8			CTGTGTTAAGGCA	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.999T>G	chr1.hg19:g.241875158T>G		63.0	0.0		157.0	28.0	NM_144625	B1ANT0|Q7Z573|Q96LY9	Silent	SNP	ENST00000366552.2	hg19																																																																																				.	.		0.408	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
SNX17	9784	hgsc.bcm.edu	37	2	27596783	27596783	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr2:27596783G>A	ENST00000233575.2	+	5	599	c.377G>A	c.(376-378)gGg>gAg	p.G126E	SNX17_ENST00000537606.1_Missense_Mutation_p.G101E|SNX17_ENST00000542478.1_5'UTR|SNX17_ENST00000543024.1_5'UTR	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	126	FERM-like.|Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCAGCAACGGGCAGAAAGTT	0.557																																					p.G126E		Atlas-SNP	.											SNX17,NS,carcinoma,0,1	SNX17	40	.	0			c.G377A						.						125.0	106.0	113.0					2																	27596783		2203	4300	6503	SO:0001583	missense	9784	exon5			GCAACGGGCAGAA	D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.377G>A	chr2.hg19:g.27596783G>A	ENSP00000233575:p.Gly126Glu	190.0	0.0		116.0	38.0	NM_014748	B4DQM7|Q53HN7|Q6IAS3	Missense_Mutation	SNP	ENST00000233575.2	hg19	CCDS1750.1	.	.	.	.	.	.	.	.	.	.	G	16.39	3.111183	0.56398	.	.	ENSG00000115234	ENST00000233575;ENST00000537606	T;T	0.78707	-1.2;-1.2	5.2	5.2	0.72013	Ras-association (1);	0.096917	0.64402	D	0.000001	D	0.86585	0.5968	M	0.64997	1.995	0.80722	D	1	P;D;D;D	0.89917	0.858;1.0;1.0;1.0	B;D;D;D	0.76575	0.172;0.988;0.988;0.976	D	0.87378	0.2355	10	0.72032	D	0.01	-16.8695	17.4469	0.87580	0.0:0.0:1.0:0.0	.	101;114;106;126	B4DQM7;B4DTB8;B4DQ37;Q15036	.;.;.;SNX17_HUMAN	E	126;101	ENSP00000233575:G126E;ENSP00000439208:G101E	ENSP00000233575:G126E	G	+	2	0	SNX17	27450287	1.000000	0.71417	0.996000	0.52242	0.947000	0.59692	6.700000	0.74619	2.705000	0.92388	0.561000	0.74099	GGG	.	.		0.557	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215024.1	NM_014748	
MEMO1	51072	hgsc.bcm.edu	37	2	32157198	32157198	+	Silent	SNP	T	T	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr2:32157198T>C	ENST00000295065.5	-	3	459	c.150A>G	c.(148-150)gcA>gcG	p.A50A	DPY30_ENST00000446765.1_5'UTR|MEMO1_ENST00000490459.1_5'UTR|MEMO1_ENST00000379383.3_Silent_p.A53A|MEMO1_ENST00000426310.2_Intron|MEMO1_ENST00000404530.1_Silent_p.A50A|MEMO1_ENST00000407893.3_Silent_p.A50A	NM_015955.2	NP_057039.1	Q9Y316	MEMO1_HUMAN	mediator of cell motility 1	50					regulation of microtubule-based process (GO:0032886)	cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|breast(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	17	Acute lymphoblastic leukemia(172;0.155)					ACGTATATCCTGCATGGCTAC	0.333																																					p.A50A		Atlas-SNP	.											.	MEMO1	36	.	0			c.A150G						.						80.0	79.0	80.0					2																	32157198		2203	4300	6503	SO:0001819	synonymous_variant	51072	exon3			ATATCCTGCATGG	AF132961	CCDS1776.1, CCDS46255.1	2p22-p21	2010-05-24	2007-02-12	2007-02-12	ENSG00000162959	ENSG00000162959			14014	protein-coding gene	gene with protein product		611786	"""chromosome 2 open reading frame 4"""	C2orf4		15156151	Standard	NM_015955		Approved	CGI-27, MEMO	uc002rnx.3	Q9Y316	OTTHUMG00000128453	ENST00000295065.5:c.150A>G	chr2.hg19:g.32157198T>C		244.0	0.0		368.0	141.0	NM_015955	B4DLS0|D6W575|Q5R2V8|Q5R2V9|Q6NSL5	Silent	SNP	ENST00000295065.5	hg19	CCDS1776.1																																																																																			.	.		0.333	MEMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250251.2	NM_015955	
BIRC6	57448	hgsc.bcm.edu	37	2	32822997	32822997	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr2:32822997T>G	ENST00000421745.2	+	69	13926	c.13792T>G	c.(13792-13794)Ttt>Gtt	p.F4598V		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4598	Ubiquitin-conjugating.				apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTCTAGTGTGTTTGTACGCTG	0.448																																					p.F4598V	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.T13792G						.						112.0	91.0	98.0					2																	32822997		2203	4300	6503	SO:0001583	missense	57448	exon69			AGTGTGTTTGTAC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13792T>G	chr2.hg19:g.32822997T>G	ENSP00000393596:p.Phe4598Val	29.0	0.0		40.0	8.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.879279	0.91740	.	.	ENSG00000115760	ENST00000421745	T	0.71817	-0.6	5.15	5.15	0.70609	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.80904	0.4713	L	0.54323	1.7	0.80722	D	1	D	0.67145	0.996	D	0.81914	0.995	T	0.83050	-0.0153	10	0.87932	D	0	.	15.2722	0.73712	0.0:0.0:0.0:1.0	.	4598	Q9NR09	BIRC6_HUMAN	V	4598	ENSP00000393596:F4598V	ENSP00000393596:F4598V	F	+	1	0	BIRC6	32676501	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.997000	0.88414	2.078000	0.62432	0.477000	0.44152	TTT	.	.		0.448	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
EGR4	1961	hgsc.bcm.edu	37	2	73519846	73519846	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr2:73519846C>G	ENST00000545030.1	-	2	583	c.509G>C	c.(508-510)tGc>tCc	p.C170S	EGR4_ENST00000436467.2_Missense_Mutation_p.C67S	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	170					cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTCCAGGAAGCAGGAGTCGGC	0.637																																					p.C170S		Atlas-SNP	.											.	EGR4	52	.	0			c.G509C						.						19.0	22.0	21.0					2																	73519846		2200	4297	6497	SO:0001583	missense	1961	exon2			AGGAAGCAGGAGT		CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.509G>C	chr2.hg19:g.73519846C>G	ENSP00000445626:p.Cys170Ser	268.0	0.0		125.0	28.0	NM_001965	B2RAE3|G3V1T5|Q2Z1P5	Missense_Mutation	SNP	ENST00000545030.1	hg19	CCDS1925.2	.	.	.	.	.	.	.	.	.	.	C	13.91	2.378407	0.42207	.	.	ENSG00000135625	ENST00000545030;ENST00000436467	T;T	0.14391	2.51;2.89	4.2	3.24	0.37175	.	0.277795	0.31134	N	0.008193	T	0.09905	0.0243	N	0.24115	0.695	0.31017	N	0.718565	B;B	0.18013	0.015;0.025	B;B	0.19666	0.011;0.026	T	0.05468	-1.0883	10	0.72032	D	0.01	-18.3002	10.9551	0.47354	0.2772:0.7228:0.0:0.0	.	67;170	Q05215;G3V1T5	EGR4_HUMAN;.	S	170;67	ENSP00000445626:C170S;ENSP00000419687:C67S	ENSP00000419687:C67S	C	-	2	0	EGR4	73373354	0.997000	0.39634	1.000000	0.80357	0.981000	0.71138	0.317000	0.19487	2.182000	0.69389	0.555000	0.69702	TGC	.	.		0.637	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001965	
LRP2	4036	hgsc.bcm.edu	37	2	170099496	170099496	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr2:170099496A>C	ENST00000263816.3	-	24	3922	c.3637T>G	c.(3637-3639)Tgc>Ggc	p.C1213G	LRP2_ENST00000443831.1_Missense_Mutation_p.C1076G	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1213	LDL-receptor class A 12. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTGTCACTGCAATCAAAAACA	0.388																																					p.C1213G		Atlas-SNP	.											.	LRP2	751	.	0			c.T3637G						.						164.0	158.0	160.0					2																	170099496		2203	4300	6503	SO:0001583	missense	4036	exon24			CACTGCAATCAAA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3637T>G	chr2.hg19:g.170099496A>C	ENSP00000263816:p.Cys1213Gly	105.0	0.0		100.0	22.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.824658	0.90955	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.99919	-8.0;-8.0	5.76	5.76	0.90799	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99953	0.9980	H	0.99074	4.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96092	0.9062	10	0.72032	D	0.01	.	16.0843	0.81031	1.0:0.0:0.0:0.0	.	1076;1213	E9PC35;P98164	.;LRP2_HUMAN	G	1213;1076	ENSP00000263816:C1213G;ENSP00000409813:C1076G	ENSP00000263816:C1213G	C	-	1	0	LRP2	169807742	1.000000	0.71417	0.995000	0.50966	0.954000	0.61252	9.281000	0.95811	2.191000	0.70037	0.533000	0.62120	TGC	.	.		0.388	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
CCDC108	255101	hgsc.bcm.edu	37	2	219886575	219886575	+	Silent	SNP	G	G	A	rs552052317		TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr2:219886575G>A	ENST00000341552.5	-	18	3140	c.3057C>T	c.(3055-3057)gaC>gaT	p.D1019D	CCDC108_ENST00000453220.1_Silent_p.D1019D|CCDC108_ENST00000441968.1_Silent_p.D1019D	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	1019						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGCAGTTGCCGTCATTCAGGA	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17916	0.0		0.0	False		,,,				2504	0.0				p.D1019D		Atlas-SNP	.											.	CCDC108	208	.	0			c.C3057T						.						149.0	150.0	150.0					2																	219886575		2203	4300	6503	SO:0001819	synonymous_variant	255101	exon18			GTTGCCGTCATTC	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.3057C>T	chr2.hg19:g.219886575G>A		239.0	0.0		221.0	10.0	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	hg19	CCDS2430.2																																																																																			.	.		0.607	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
SERPINE2	5270	hgsc.bcm.edu	37	2	224866386	224866386	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr2:224866386C>T	ENST00000258405.4	-	2	474	c.232G>A	c.(232-234)Gcc>Acc	p.A78T	SERPINE2_ENST00000447280.2_Missense_Mutation_p.A90T|SERPINE2_ENST00000409840.3_Missense_Mutation_p.A78T|SERPINE2_ENST00000409304.1_Missense_Mutation_p.A78T	NM_001136528.1|NM_006216.3	NP_001130000.1|NP_006207.1	P07093	GDN_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2	78					blood coagulation (GO:0007596)|cerebellar granular layer morphogenesis (GO:0021683)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|innervation (GO:0060384)|long-term synaptic potentiation (GO:0060291)|mating plug formation (GO:0042628)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein processing (GO:0010955)|negative regulation of proteolysis (GO:0045861)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of sodium ion transport (GO:0010766)|positive regulation of astrocyte differentiation (GO:0048711)|regulation of cell migration (GO:0030334)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of timing of cell differentiation (GO:0048505)|secretion by cell (GO:0032940)|secretory granule organization (GO:0033363)|seminal vesicle epithelium development (GO:0061108)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|neuromuscular junction (GO:0031594)|platelet alpha granule (GO:0031091)|vesicle (GO:0031982)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	17		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ATCACCATGGCGAGCTGCTTC	0.577																																					p.A90T		Atlas-SNP	.											.	SERPINE2	103	.	0			c.G268A						.						78.0	68.0	71.0					2																	224866386		2203	4300	6503	SO:0001583	missense	5270	exon2			CCATGGCGAGCTG	M17783	CCDS2460.1, CCDS46525.1, CCDS46526.1	2q36.1	2014-02-18	2005-08-18		ENSG00000135919	ENSG00000135919		"""Serine (or cysteine) peptidase inhibitors"""	8951	protein-coding gene	gene with protein product	"""glial-derived nexin 1"""	177010	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2"""	PI7		7665170, 24172014	Standard	NM_006216		Approved	PN1, GDN, PNI, nexin	uc002vnu.2	P07093	OTTHUMG00000133163	ENST00000258405.4:c.232G>A	chr2.hg19:g.224866386C>T	ENSP00000258405:p.Ala78Thr	54.0	0.0		46.0	7.0	NM_001136530	B2R6A4|B4DIF2|Q53S15|Q5D0C4	Missense_Mutation	SNP	ENST00000258405.4	hg19	CCDS2460.1	.	.	.	.	.	.	.	.	.	.	C	0.036	-1.306444	0.01353	.	.	ENSG00000135919	ENST00000409304;ENST00000258405;ENST00000409840;ENST00000447280;ENST00000432738;ENST00000454956	D;D;D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88;-1.88;-1.88	5.67	0.476	0.16779	Serpin domain (3);	0.408702	0.28921	N	0.013718	T	0.65428	0.2690	N	0.11724	0.165	0.19300	N	0.999979	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.48703	-0.9012	10	0.18276	T	0.48	.	5.3815	0.16194	0.1216:0.2:0.0:0.6784	.	90;78	B4DIF2;P07093	.;GDN_HUMAN	T	78;78;78;90;78;78	ENSP00000386412:A78T;ENSP00000258405:A78T;ENSP00000386969:A78T;ENSP00000415786:A90T;ENSP00000408452:A78T;ENSP00000399655:A78T	ENSP00000258405:A78T	A	-	1	0	SERPINE2	224574630	1.000000	0.71417	0.133000	0.22050	0.054000	0.15201	1.150000	0.31639	-0.138000	0.11434	-1.004000	0.02495	GCC	.	.		0.577	SERPINE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256865.2	NM_006216	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T41A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,1	CTNNB1	4904	.	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	c.A121G						.						89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCCACTACCACAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	chr3.hg19:g.41266124A>G	ENSP00000344456:p.Thr41Ala	69.0	1.0		135.0	29.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	CTNNB1	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	.	.		0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LARS2	23395	hgsc.bcm.edu	37	3	45517966	45517966	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr3:45517966G>C	ENST00000415258.1	+	9	1006	c.865G>C	c.(865-867)Ggg>Cgg	p.G289R	LARS2_ENST00000265537.3_Missense_Mutation_p.G289R|LARS2_ENST00000414984.1_Missense_Mutation_p.G246R			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	289					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	CCAGGTTCATGGGCAAGCCAC	0.552																																					p.G289R		Atlas-SNP	.											.	LARS2	48	.	0			c.G865C						.						126.0	128.0	127.0					3																	45517966		2203	4300	6503	SO:0001583	missense	23395	exon10			GTTCATGGGCAAG	AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.865G>C	chr3.hg19:g.45517966G>C	ENSP00000408576:p.Gly289Arg	139.0	0.0		257.0	76.0	NM_015340		Missense_Mutation	SNP	ENST00000415258.1	hg19	CCDS2728.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461265	0.43736	.	.	ENSG00000011376	ENST00000265537;ENST00000415258;ENST00000414984	T;T;T	0.36157	1.27;1.27;1.27	5.45	5.45	0.79879	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.050710	0.85682	D	0.000000	T	0.62183	0.2407	M	0.85859	2.78	0.58432	D	0.999999	D;D	0.76494	0.999;0.995	D;D	0.75020	0.985;0.975	T	0.67055	-0.5767	10	0.66056	D	0.02	-24.0841	12.2187	0.54420	0.0822:0.0:0.9178:0.0	.	246;289	E9PHM2;Q15031	.;SYLM_HUMAN	R	289;289;246	ENSP00000265537:G289R;ENSP00000408576:G289R;ENSP00000412893:G246R	ENSP00000265537:G289R	G	+	1	0	LARS2	45492970	1.000000	0.71417	0.357000	0.25798	0.053000	0.15095	6.419000	0.73345	2.555000	0.86185	0.563000	0.77884	GGG	.	.		0.552	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345001.1	NM_015340	
RP11-93K22.13	0	hgsc.bcm.edu	37	3	129813246	129813246	+	lincRNA	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr3:129813246G>A	ENST00000514010.1	-	0	0				ALG1L2_ENST00000507643.1_RNA|AC083906.2_ENST00000578837.1_RNA																							CTCTGTGAAGGCAAAGGGCCT	0.597																																					p.G105D		Atlas-SNP	.											.	.	.	.	0			c.G314A						.																																					644974	exon5			GTGAAGGCAAAGG																													chr3.hg19:g.129813246G>A		121.0	0.0		46.0	10.0	NM_001136152		Missense_Mutation	SNP	ENST00000514010.1	hg19																																																																																				.	.		0.597	RP11-93K22.13-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000358040.1		
EIF4A2	1974	hgsc.bcm.edu	37	3	186502787	186502787	+	Missense_Mutation	SNP	G	G	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr3:186502787G>C	ENST00000323963.5	+	4	309	c.245G>C	c.(244-246)gGc>gCc	p.G82A	SNORA81_ENST00000408493.2_RNA|EIF4A2_ENST00000356531.5_Intron|SNORA4_ENST00000584302.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.G83A|SNORA63_ENST00000363548.1_RNA|SNORA63_ENST00000363450.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	82	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TCAGGTACTGGCAAGACAGCC	0.448			T	BCL6	NHL																																p.G82A		Atlas-SNP	.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	EIF4A2	55	.	0			c.G245C						.						174.0	156.0	162.0					3																	186502787		2203	4300	6503	SO:0001583	missense	1974	exon4			GTACTGGCAAGAC	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.245G>C	chr3.hg19:g.186502787G>C	ENSP00000326381:p.Gly82Ala	120.0	0.0		86.0	28.0	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	hg19	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985235	0.74474	.	.	ENSG00000156976	ENST00000445596;ENST00000323963;ENST00000440191	D;D;D	0.85411	-1.98;-1.98;-1.98	4.7	4.7	0.59300	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96027	0.8706	H	0.99752	4.75	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79784	0.956;0.993	D	0.97673	1.0168	10	0.87932	D	0	-16.8913	15.5195	0.75854	0.0:0.0:1.0:0.0	.	83;82	Q14240-2;Q14240	.;IF4A2_HUMAN	A	82;82;83	ENSP00000415878:G82A;ENSP00000326381:G82A;ENSP00000398370:G83A	ENSP00000326381:G82A	G	+	2	0	EIF4A2	187985481	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.045000	0.93812	2.592000	0.87571	0.585000	0.79938	GGC	.	.		0.448	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
TMEM207	131920	hgsc.bcm.edu	37	3	190167544	190167544	+	Missense_Mutation	SNP	A	A	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr3:190167544A>C	ENST00000354905.2	-	1	121	c.55T>G	c.(55-57)Ttg>Gtg	p.L19V		NM_207316.1	NP_997199.1	Q6UWW9	TM207_HUMAN	transmembrane protein 207	19						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(4)	7	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		GGCAAACACAAGATCCCTATC	0.413																																					p.L19V		Atlas-SNP	.											.	TMEM207	19	.	0			c.T55G						.						165.0	139.0	147.0					3																	190167544		2203	4300	6503	SO:0001583	missense	131920	exon1			AACACAAGATCCC	BC071780	CCDS3297.1	3q28	2008-02-18			ENSG00000198398	ENSG00000198398			33705	protein-coding gene	gene with protein product		614786					Standard	NM_207316		Approved		uc003fsj.2	Q6UWW9	OTTHUMG00000156213	ENST00000354905.2:c.55T>G	chr3.hg19:g.190167544A>C	ENSP00000346981:p.Leu19Val	52.0	0.0		75.0	23.0	NM_207316		Missense_Mutation	SNP	ENST00000354905.2	hg19	CCDS3297.1	.	.	.	.	.	.	.	.	.	.	A	2.718	-0.267240	0.05754	.	.	ENSG00000198398	ENST00000354905	T	0.06068	3.35	5.29	2.76	0.32466	.	0.865799	0.09511	N	0.792276	T	0.06508	0.0167	L	0.47716	1.5	0.09310	N	1	P	0.40731	0.728	B	0.36666	0.23	T	0.36286	-0.9754	10	0.87932	D	0	.	4.5123	0.11917	0.7277:0.0:0.1002:0.172	.	19	Q6UWW9	TM207_HUMAN	V	19	ENSP00000346981:L19V	ENSP00000346981:L19V	L	-	1	2	TMEM207	191650238	0.078000	0.21339	0.002000	0.10522	0.008000	0.06430	-0.026000	0.12392	0.961000	0.38030	0.477000	0.44152	TTG	.	.		0.413	TMEM207-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343515.1	NM_207316	
MUC4	4585	hgsc.bcm.edu	37	3	195515017	195515017	+	Missense_Mutation	SNP	A	A	T	rs199883835		TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr3:195515017A>T	ENST00000463781.3	-	2	3893	c.3434T>A	c.(3433-3435)gTa>gAa	p.V1145E	MUC4_ENST00000475231.1_Missense_Mutation_p.V1145E|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	619					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V1145A(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGT	0.562																																					p.V1145E		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	.	2	Substitution - Missense(2)	stomach(2)	c.T3434A						.						12.0	7.0	8.0					3																	195515017		680	1501	2181	SO:0001583	missense	4585	exon2			GTGGATACTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3434T>A	chr3.hg19:g.195515017A>T	ENSP00000417498:p.Val1145Glu	57.0	1.0		53.0	4.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	4.932	0.173236	0.09391	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.41;1.41	0.814	-1.63	0.08345	.	.	.	.	.	T	0.14570	0.0352	N	0.19112	0.55	0.09310	N	1	B	0.15141	0.012	B	0.04013	0.001	T	0.27905	-1.0060	8	.	.	.	.	3.4865	0.07622	0.2163:0.2632:0.5205:0.0	.	1145	E7ESK3	.	E	1145	ENSP00000417498:V1145E;ENSP00000420243:V1145E	.	V	-	2	0	MUC4	196999412	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-1.901000	0.01597	-0.707000	0.05022	0.055000	0.15244	GTA	.	.		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
JAKMIP1	152789	hgsc.bcm.edu	37	4	6107374	6107374	+	Silent	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr4:6107374C>T	ENST00000282924.5	-	3	935	c.450G>A	c.(448-450)cgG>cgA	p.R150R	JAKMIP1_ENST00000409371.3_Intron|JAKMIP1_ENST00000409831.1_Silent_p.R150R|JAKMIP1_ENST00000409021.3_Silent_p.R150R|JAKMIP1_ENST00000410077.2_Intron|JAKMIP1_ENST00000457227.2_Intron	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	150	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCTGCTGCAGCCGCAGGCGCT	0.682																																					p.R150R		Atlas-SNP	.											.	JAKMIP1	250	.	0			c.G450A						.						17.0	15.0	16.0					4																	6107374		2198	4292	6490	SO:0001819	synonymous_variant	152789	exon3			CTGCAGCCGCAGG	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.450G>A	chr4.hg19:g.6107374C>T		76.0	0.0		50.0	18.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Silent	SNP	ENST00000282924.5	hg19	CCDS3385.1																																																																																			.	.		0.682	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	
ANK2	287	hgsc.bcm.edu	37	4	114276704	114276704	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr4:114276704G>T	ENST00000357077.4	+	38	6983	c.6930G>T	c.(6928-6930)gaG>gaT	p.E2310D	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.E2277D|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2310					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TTCAGAAAGAGGCCACTCTAG	0.493																																					p.E2310D		Atlas-SNP	.											.	ANK2	576	.	0			c.G6930T						.						43.0	44.0	44.0					4																	114276704		2203	4300	6503	SO:0001583	missense	287	exon38			GAAAGAGGCCACT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6930G>T	chr4.hg19:g.114276704G>T	ENSP00000349588:p.Glu2310Asp	60.0	0.0		93.0	33.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	G	3.119	-0.180958	0.06380	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.71461	-0.57;-0.57	5.79	3.1	0.35709	.	0.464019	0.19603	N	0.110349	T	0.62221	0.2410	M	0.64997	1.995	0.09310	N	0.999993	B;B	0.14805	0.004;0.011	B;B	0.14023	0.002;0.01	T	0.51244	-0.8730	9	.	.	.	.	5.6225	0.17465	0.1648:0.0:0.6783:0.1569	.	2277;2310	Q01484;Q01484-4	ANK2_HUMAN;.	D	2310;2277	ENSP00000349588:E2310D;ENSP00000264366:E2277D	.	E	+	3	2	ANK2	114496153	0.364000	0.24997	0.001000	0.08648	0.016000	0.09150	0.478000	0.22212	0.350000	0.24002	0.655000	0.94253	GAG	.	.		0.493	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
APC	324	hgsc.bcm.edu	37	5	112173329	112173329	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr5:112173329G>T	ENST00000457016.1	+	16	2418	c.2038G>T	c.(2038-2040)Gca>Tca	p.A680S	APC_ENST00000508376.2_Missense_Mutation_p.A680S|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.A680S			P25054	APC_HUMAN	adenomatous polyposis coli	680	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGTCAGTAATGCATGTGGAAC	0.378		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.A680S	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	4158	.	1	Unknown(1)	skin(1)	c.G2038T						.						89.0	90.0	90.0					5																	112173329		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	AGTAATGCATGTG	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2038G>T	chr5.hg19:g.112173329G>T	ENSP00000413133:p.Ala680Ser	76.0	0.0		123.0	61.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	hg19	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607475	0.66558	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71	5.99	5.99	0.97316	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88905	0.6564	L	0.39898	1.24	0.80722	D	1	P;P	0.49358	0.923;0.923	D;D	0.72625	0.978;0.978	D	0.88757	0.3254	10	0.87932	D	0	-17.9049	20.4777	0.99188	0.0:0.0:1.0:0.0	.	682;680	Q4LE70;P25054	.;APC_HUMAN	S	680;662;680;680;680	ENSP00000413133:A680S;ENSP00000423224:A662S;ENSP00000257430:A680S;ENSP00000427089:A680S;ENSP00000423828:A680S	ENSP00000257430:A680S	A	+	1	0	APC	112201228	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GCA	.	.		0.378	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
MEGF10	84466	hgsc.bcm.edu	37	5	126791174	126791174	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr5:126791174C>T	ENST00000274473.6	+	25	3374	c.3107C>T	c.(3106-3108)cCa>cTa	p.P1036L	MEGF10_ENST00000510828.1_3'UTR|MEGF10_ENST00000503335.2_Missense_Mutation_p.P1036L	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1036	Necessary for formation of large intracellular vacuoles.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.P1036L(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		ATTAAAGACCCACCTGTACTT	0.423																																					p.P1036L		Atlas-SNP	.											MEGF10,NS,carcinoma,0,1	MEGF10	152	.	1	Substitution - Missense(1)	lung(1)	c.C3107T						.						120.0	132.0	128.0					5																	126791174		2203	4300	6503	SO:0001583	missense	84466	exon25			AAGACCCACCTGT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3107C>T	chr5.hg19:g.126791174C>T	ENSP00000274473:p.Pro1036Leu	123.0	1.0		319.0	142.0	NM_032446	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	hg19	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549343	0.45383	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.74947	-0.89;-0.89	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000001	T	0.79470	0.4451	L	0.41492	1.28	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71041	-0.4707	10	0.02654	T	1	-9.3156	19.843	0.96697	0.0:1.0:0.0:0.0	.	1036	Q96KG7	MEG10_HUMAN	L	1036	ENSP00000423354:P1036L;ENSP00000274473:P1036L	ENSP00000274473:P1036L	P	+	2	0	MEGF10	126819073	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	7.487000	0.81328	2.679000	0.91253	0.655000	0.94253	CCA	.	.		0.423	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	
RAD50	10111	hgsc.bcm.edu	37	5	131939116	131939116	+	Missense_Mutation	SNP	A	A	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr5:131939116A>G	ENST00000265335.6	+	14	2719	c.2332A>G	c.(2332-2334)Ata>Gta	p.I778V	RAD50_ENST00000378823.3_Missense_Mutation_p.I639V			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	778					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTTGGGTACAATAATGCCTGA	0.368								Homologous recombination																													p.I778V		Atlas-SNP	.											.	RAD50	246	.	0			c.A2332G						.						124.0	114.0	117.0					5																	131939116		2203	4300	6503	SO:0001583	missense	10111	exon14			GGTACAATAATGC	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.2332A>G	chr5.hg19:g.131939116A>G	ENSP00000265335:p.Ile778Val	177.0	0.0		337.0	93.0	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	hg19	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	A	7.958	0.746245	0.15710	.	.	ENSG00000113522	ENST00000378823;ENST00000265335	T;T	0.04603	3.59;3.82	5.16	1.37	0.22104	.	0.313588	0.32430	N	0.006120	T	0.01870	0.0059	N	0.04508	-0.205	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.47156	-0.9139	10	0.18710	T	0.47	-9.0847	4.529	0.11995	0.5516:0.0:0.3075:0.1409	.	778	Q92878	RAD50_HUMAN	V	639;778	ENSP00000368100:I639V;ENSP00000265335:I778V	ENSP00000265335:I778V	I	+	1	0	RAD50	131967015	0.050000	0.20438	0.988000	0.46212	0.957000	0.61999	0.362000	0.20284	0.348000	0.23949	-0.256000	0.11100	ATA	.	.		0.368	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
BTNL9	153579	hgsc.bcm.edu	37	5	180486695	180486695	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr5:180486695G>A	ENST00000327705.9	+	11	1672	c.1441G>A	c.(1441-1443)Gcg>Acg	p.A481T	BTNL9_ENST00000376842.3_Missense_Mutation_p.A482T	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	481	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTCTCGGGCGCGCTCTGTGC	0.667																																					p.A481T		Atlas-SNP	.											.	BTNL9	58	.	0			c.G1441A						.						37.0	35.0	36.0					5																	180486695		2203	4300	6503	SO:0001583	missense	153579	exon11			TCGGGCGCGCTCT	AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.1441G>A	chr5.hg19:g.180486695G>A	ENSP00000330200:p.Ala481Thr	172.0	0.0		94.0	16.0	NM_152547	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	ENST00000327705.9	hg19	CCDS4460.2	.	.	.	.	.	.	.	.	.	.	g	5.406	0.260076	0.10239	.	.	ENSG00000165810	ENST00000327705;ENST00000376842	T;T	0.60548	0.18;0.18	4.22	-7.0	0.01599	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	1.157270	0.06801	N	0.788764	T	0.18964	0.0455	N	0.01656	-0.775	0.09310	N	0.999998	B	0.11235	0.004	B	0.14023	0.01	T	0.23868	-1.0176	10	0.05721	T	0.95	.	4.5035	0.11876	0.2159:0.4869:0.2028:0.0945	.	481	Q6UXG8	BTNL9_HUMAN	T	481;482	ENSP00000330200:A481T;ENSP00000366038:A482T	ENSP00000330200:A481T	A	+	1	0	BTNL9	180419301	0.000000	0.05858	0.011000	0.14972	0.021000	0.10359	-0.392000	0.07314	-1.343000	0.02219	0.449000	0.29647	GCG	.	.		0.667	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157342.3	NM_152547	
FANCE	2178	hgsc.bcm.edu	37	6	35434031	35434031	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr6:35434031C>G	ENST00000229769.2	+	10	1705	c.1520C>G	c.(1519-1521)aCc>aGc	p.T507S	RPL10A_ENST00000322203.6_5'Flank	NM_021922.2	NP_068741.1	Q9HB96	FANCE_HUMAN	Fanconi anemia, complementation group E	507					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)|skin(2)	13						ATCACTGAGACCCAGAGGCTG	0.577			"""N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.T507S		Atlas-SNP	.	yes	Rec		Fanconi anaemia E	6	6p21-p22	2178	"""Fanconi anemia, complementation group E"""		L	.	FANCE	45	.	0			c.C1520G						.						92.0	90.0	91.0					6																	35434031		2203	4300	6503	SO:0001583	missense	2178	exon10	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CTGAGACCCAGAG	AF265210	CCDS4805.1	6p22-p21	2014-09-17			ENSG00000112039	ENSG00000112039		"""Fanconi anemia, complementation groups"""	3586	protein-coding gene	gene with protein product		613976		FACE		7662964, 11001585	Standard	XM_005248885		Approved	FAE	uc003oko.1	Q9HB96	OTTHUMG00000014565	ENST00000229769.2:c.1520C>G	chr6.hg19:g.35434031C>G	ENSP00000229769:p.Thr507Ser	97.0	0.0		78.0	28.0	NM_021922	A8K907|Q4ZGH2	Missense_Mutation	SNP	ENST00000229769.2	hg19	CCDS4805.1	.	.	.	.	.	.	.	.	.	.	C	8.762	0.923820	0.18056	.	.	ENSG00000112039	ENST00000229769	T	0.47177	0.85	5.77	1.85	0.25348	Fanconi Anaemia group E protein, C-terminal (1);	0.825347	0.11256	N	0.583076	T	0.08626	0.0214	N	0.19112	0.55	0.09310	N	1	B	0.16166	0.016	B	0.17979	0.02	T	0.39143	-0.9628	10	0.07990	T	0.79	-17.3398	4.1775	0.10358	0.1642:0.5669:0.0:0.2689	.	507	Q9HB96	FANCE_HUMAN	S	507	ENSP00000229769:T507S	ENSP00000229769:T507S	T	+	2	0	FANCE	35542009	0.070000	0.21116	0.505000	0.27651	0.829000	0.46940	0.653000	0.24902	0.042000	0.15717	-0.258000	0.10820	ACC	.	.		0.577	FANCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040282.1		
DOPEY1	23033	hgsc.bcm.edu	37	6	83863710	83863710	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr6:83863710G>T	ENST00000349129.2	+	32	6597	c.6337G>T	c.(6337-6339)Gac>Tac	p.D2113Y	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Missense_Mutation_p.D2104Y|DOPEY1_ENST00000237163.5_Missense_Mutation_p.D2043Y	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2113					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AGAAGCTTTTGACCTCTTTAT	0.443																																					p.D2113Y		Atlas-SNP	.											.	DOPEY1	190	.	0			c.G6337T						.						219.0	217.0	217.0					6																	83863710		2203	4300	6503	SO:0001583	missense	23033	exon32			GCTTTTGACCTCT	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6337G>T	chr6.hg19:g.83863710G>T	ENSP00000195654:p.Asp2113Tyr	68.0	0.0		75.0	4.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	hg19	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636113	0.87760	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.53857	0.6;1.29	4.94	4.94	0.65067	.	0.091396	0.64402	D	0.000001	T	0.65595	0.2706	M	0.61703	1.905	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.75020	0.985;0.97;0.978	T	0.68911	-0.5284	10	0.87932	D	0	.	18.3686	0.90399	0.0:0.0:1.0:0.0	.	2004;2104;2113	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	Y	2113;2043;2043	ENSP00000195654:D2113Y;ENSP00000237163:D2043Y	ENSP00000237163:D2043Y	D	+	1	0	DOPEY1	83920429	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.229000	0.95273	2.584000	0.87258	0.557000	0.71058	GAC	.	.		0.443	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
REV3L	5980	hgsc.bcm.edu	37	6	111695908	111695908	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr6:111695908T>G	ENST00000358835.3	-	14	4104	c.3650A>C	c.(3649-3651)aAa>aCa	p.K1217T	REV3L_ENST00000435970.1_Missense_Mutation_p.K1139T|REV3L_ENST00000368805.1_Missense_Mutation_p.K1217T|REV3L_ENST00000368802.3_Missense_Mutation_p.K1217T			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1217					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CGATGTACCTTTCTCATTTGT	0.338								DNA polymerases (catalytic subunits)																													p.K1217T		Atlas-SNP	.											.	REV3L	386	.	0			c.A3650C						.						85.0	84.0	84.0					6																	111695908		2203	4300	6503	SO:0001583	missense	5980	exon13			GTACCTTTCTCAT	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3650A>C	chr6.hg19:g.111695908T>G	ENSP00000351697:p.Lys1217Thr	20.0	0.0		46.0	15.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	hg19	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	23.0	4.357682	0.82243	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02787	4.25;4.25;4.25;4.16	5.32	5.32	0.75619	Ribonuclease H-like (1);	0.571312	0.18173	N	0.149400	T	0.07818	0.0196	L	0.59436	1.845	0.40602	D	0.981594	D	0.76494	0.999	D	0.78314	0.991	T	0.05099	-1.0906	10	0.72032	D	0.01	.	15.5723	0.76349	0.0:0.0:0.0:1.0	.	1217	O60673	DPOLZ_HUMAN	T	1217;1217;1217;1139	ENSP00000357792:K1217T;ENSP00000357795:K1217T;ENSP00000351697:K1217T;ENSP00000402003:K1139T	ENSP00000351697:K1217T	K	-	2	0	REV3L	111802601	1.000000	0.71417	0.968000	0.41197	0.827000	0.46813	5.412000	0.66392	2.139000	0.66308	0.533000	0.62120	AAA	.	.		0.338	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
VWDE	221806	hgsc.bcm.edu	37	7	12376619	12376619	+	Missense_Mutation	SNP	T	T	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr7:12376619T>G	ENST00000275358.3	-	26	4741	c.4553A>C	c.(4552-4554)aAc>aCc	p.N1518T		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1518	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						CTTACGTGTGTTGCATCGTTT	0.418																																					p.N1518T		Atlas-SNP	.											.	VWDE	123	.	0			c.A4553C						.						136.0	109.0	117.0					7																	12376619		692	1591	2283	SO:0001583	missense	221806	exon26			CGTGTGTTGCATC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.4553A>C	chr7.hg19:g.12376619T>G	ENSP00000275358:p.Asn1518Thr	104.0	0.0		120.0	43.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.276781	0.40294	.	.	ENSG00000146530	ENST00000275358	D	0.91631	-2.88	4.63	-5.34	0.02705	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.553031	0.19753	N	0.106858	D	0.87030	0.6076	M	0.69248	2.105	0.21782	N	0.999547	B	0.18741	0.03	B	0.10450	0.005	T	0.73736	-0.3889	10	0.41790	T	0.15	.	8.8731	0.35327	0.0:0.4177:0.107:0.4753	.	1518	Q8N2E2	VWDE_HUMAN	T	1518	ENSP00000275358:N1518T	ENSP00000275358:N1518T	N	-	2	0	VWDE	12343144	0.998000	0.40836	0.339000	0.25562	0.865000	0.49528	0.440000	0.21592	-0.948000	0.03668	-1.117000	0.02048	AAC	.	.		0.418	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
VWDE	221806	hgsc.bcm.edu	37	7	12428766	12428766	+	Silent	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr7:12428766G>T	ENST00000275358.3	-	3	650	c.462C>A	c.(460-462)ggC>ggA	p.G154G		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	154						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						CCGCACAGTAGCCCATACATC	0.413																																					p.G154G		Atlas-SNP	.											.	VWDE	123	.	0			c.C462A						.						81.0	82.0	82.0					7																	12428766		692	1591	2283	SO:0001819	synonymous_variant	221806	exon3			ACAGTAGCCCATA		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.462C>A	chr7.hg19:g.12428766G>T		78.0	0.0		94.0	22.0	NM_001135924	B7ZM77|Q96SQ3	Silent	SNP	ENST00000275358.3	hg19	CCDS47544.1																																																																																			.	.		0.413	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
OSBPL3	26031	hgsc.bcm.edu	37	7	24911674	24911674	+	Silent	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr7:24911674C>T	ENST00000313367.2	-	3	562	c.111G>A	c.(109-111)gtG>gtA	p.V37V	OSBPL3_ENST00000353930.1_Silent_p.V37V|OSBPL3_ENST00000396431.1_Silent_p.V37V|OSBPL3_ENST00000409069.1_Silent_p.V37V|OSBPL3_ENST00000431825.2_Silent_p.V37V|OSBPL3_ENST00000352860.1_Silent_p.V37V|OSBPL3_ENST00000396429.1_Silent_p.V37V	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	37					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						GTCCTTCCACCACTTCCCAGC	0.413																																					p.V37V		Atlas-SNP	.											.	OSBPL3	100	.	0			c.G111A						.						97.0	89.0	92.0					7																	24911674		2203	4300	6503	SO:0001819	synonymous_variant	26031	exon3			TTCCACCACTTCC	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.111G>A	chr7.hg19:g.24911674C>T		88.0	0.0		94.0	39.0	NM_145321	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Silent	SNP	ENST00000313367.2	hg19	CCDS5390.1																																																																																			.	.		0.413	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
NPC1L1	29881	hgsc.bcm.edu	37	7	44575496	44575496	+	Silent	SNP	G	G	A	rs200986707		TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr7:44575496G>A	ENST00000289547.4	-	5	1981	c.1926C>T	c.(1924-1926)gtC>gtT	p.V642V	NPC1L1_ENST00000546276.1_Silent_p.V642V|NPC1L1_ENST00000381160.3_Silent_p.V642V|NPC1L1_ENST00000423141.1_Silent_p.V642V	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	642	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	ACAGGAATATGACAATGTAGC	0.582																																					p.V642V		Atlas-SNP	.											.	NPC1L1	141	.	0			c.C1926T						.						117.0	103.0	108.0					7																	44575496		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon5			GAATATGACAATG		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1926C>T	chr7.hg19:g.44575496G>A		101.0	0.0		72.0	22.0	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	hg19	CCDS5491.1																																																																																			.	G|0.999;T|0.001		0.582	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
SLC4A2	6522	hgsc.bcm.edu	37	7	150761796	150761796	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr7:150761796C>T	ENST00000485713.1	+	4	1441	c.401C>T	c.(400-402)gCt>gTt	p.A134V	SLC4A2_ENST00000392826.2_Missense_Mutation_p.A125V|SLC4A2_ENST00000413384.2_Missense_Mutation_p.A134V|SLC4A2_ENST00000461735.1_Missense_Mutation_p.A120V|SLC4A2_ENST00000310317.5_Missense_Mutation_p.A52V	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	134	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCAGCGAGGCTGAGGGGGCC	0.701																																					p.A134V		Atlas-SNP	.											.	SLC4A2	98	.	0			c.C401T						.						26.0	32.0	30.0					7																	150761796		2203	4300	6503	SO:0001583	missense	6522	exon4			GCGAGGCTGAGGG		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.401C>T	chr7.hg19:g.150761796C>T	ENSP00000419412:p.Ala134Val	245.0	0.0		119.0	43.0	NM_003040	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	hg19	CCDS5917.1	.	.	.	.	.	.	.	.	.	.	C	9.404	1.078781	0.20227	.	.	ENSG00000164889	ENST00000483786;ENST00000485713;ENST00000413384;ENST00000490898;ENST00000463414;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T;T;T;T	0.75367	0.95;-0.9;-0.9;1.51;0.93;-0.93;-0.9;-0.9	5.3	4.41	0.53225	.	0.821622	0.10565	N	0.659854	T	0.57125	0.2032	N	0.22421	0.69	0.24271	N	0.995245	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.40979	-0.9534	10	0.10111	T	0.7	.	8.5651	0.33534	0.0:0.8247:0.0:0.1753	.	125;120;134	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	V	134;134;134;134;134;52;125;120	ENSP00000417808:A134V;ENSP00000419412:A134V;ENSP00000405600:A134V;ENSP00000418114:A134V;ENSP00000418584:A134V;ENSP00000311402:A52V;ENSP00000376571:A125V;ENSP00000419164:A120V	ENSP00000311402:A52V	A	+	2	0	SLC4A2	150392729	0.365000	0.25006	0.935000	0.37517	0.012000	0.07955	0.996000	0.29719	2.478000	0.83669	0.563000	0.77884	GCT	.	.		0.701	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
TNFRSF10B	8795	hgsc.bcm.edu	37	8	22885267	22885267	+	Splice_Site	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr8:22885267C>T	ENST00000276431.4	-	6	1033		c.e6-1		TNFRSF10B_ENST00000542226.1_Splice_Site|TNFRSF10B_ENST00000519910.1_5'Flank|TNFRSF10B_ENST00000347739.3_Splice_Site	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		CCACCACCACCTAAAAAAGAA	0.622																																					.	GBM(94;1064 1342 1839 21060 42553)	Atlas-SNP	.											.	TNFRSF10B	34	.	0			c.749-1G>A						.						63.0	56.0	58.0					8																	22885267		2203	4300	6503	SO:0001630	splice_region_variant	8795	exon7			CACCACCTAAAAA	AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.749-1G>A	chr8.hg19:g.22885267C>T		77.0	0.0		35.0	17.0	NM_003842	O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Splice_Site	SNP	ENST00000276431.4	hg19	CCDS6035.1	.	.	.	.	.	.	.	.	.	.	c	6.217	0.408112	0.11754	.	.	ENSG00000120889	ENST00000276431;ENST00000347739;ENST00000542226	.	.	.	2.44	2.44	0.29823	.	.	.	.	.	.	.	.	.	.	.	0.41469	D	0.988092	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.4828	0.33054	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TNFRSF10B	22941212	0.328000	0.24687	0.109000	0.21407	0.017000	0.09413	2.253000	0.43205	1.665000	0.50811	0.655000	0.94253	.	.	.		0.622	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215099.2	NM_147187	Intron
PXDNL	137902	hgsc.bcm.edu	37	8	52321471	52321471	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr8:52321471G>A	ENST00000356297.4	-	17	2813	c.2713C>T	c.(2713-2715)Cgg>Tgg	p.R905W	PXDNL_ENST00000543296.1_Missense_Mutation_p.R905W	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	905					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGGGATTCCCGCTCCGAGCTC	0.587																																					p.R905W		Atlas-SNP	.											PXDNL_ENST00000356297,right_upper_lobe,carcinoma,+1,4	PXDNL	414	.	0			c.C2713T						.						38.0	43.0	41.0					8																	52321471		1990	4153	6143	SO:0001583	missense	137902	exon17			ATTCCCGCTCCGA		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2713C>T	chr8.hg19:g.52321471G>A	ENSP00000348645:p.Arg905Trp	217.0	0.0		117.0	30.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	hg19	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	7.352	0.623064	0.14193	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.69806	-0.43;-0.43	4.03	-1.77	0.07982	.	0.817539	0.10469	N	0.671059	T	0.61048	0.2316	M	0.76328	2.33	0.21861	N	0.999501	B	0.18863	0.031	B	0.20955	0.032	T	0.54057	-0.8350	10	0.66056	D	0.02	.	4.7256	0.12939	0.1743:0.0:0.4214:0.4044	.	905	A1KZ92	PXDNL_HUMAN	W	905	ENSP00000348645:R905W;ENSP00000444865:R905W	ENSP00000348645:R905W	R	-	1	2	PXDNL	52484024	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	0.394000	0.20834	-0.970000	0.03569	-0.258000	0.10820	CGG	.	.		0.587	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
JPH1	56704	hgsc.bcm.edu	37	8	75157022	75157022	+	Silent	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr8:75157022C>T	ENST00000342232.4	-	4	1687	c.1647G>A	c.(1645-1647)caG>caA	p.Q549Q	JPH1_ENST00000518195.1_5'UTR	NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	549					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			AGCCGTGATACTGAGAATGCA	0.612																																					p.Q549Q		Atlas-SNP	.											.	JPH1	77	.	0			c.G1647A						.						71.0	62.0	65.0					8																	75157022		2203	4300	6503	SO:0001819	synonymous_variant	56704	exon4			GTGATACTGAGAA	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.1647G>A	chr8.hg19:g.75157022C>T		50.0	0.0		56.0	17.0	NM_020647	B2RTZ0	Silent	SNP	ENST00000342232.4	hg19	CCDS6217.1																																																																																			.	.		0.612	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
AARD	441376	hgsc.bcm.edu	37	8	117950650	117950650	+	Silent	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr8:117950650G>A	ENST00000378279.3	+	1	213	c.168G>A	c.(166-168)ctG>ctA	p.L56L		NM_001025357.2	NP_001020528.1	Q4LEZ3	AARD_HUMAN	alanine and arginine rich domain containing protein	56					lung development (GO:0030324)												GCCCGCTGCTGGAGGACCTCA	0.746																																					p.L56L		Atlas-SNP	.											C8orf85,NS,carcinoma,0,1	.	.	.	0			c.G168A						.						12.0	13.0	13.0					8																	117950650		2166	4253	6419	SO:0001819	synonymous_variant	441376	exon1			GCTGCTGGAGGAC	AB181519, BC140924	CCDS34935.1	8q24.11	2012-04-19	2012-04-19	2012-04-19	ENSG00000205002	ENSG00000205002			33842	protein-coding gene	gene with protein product	"""Alanine and arginine-rich domain-containing protein"""		"""chromosome 8 open reading frame 85"""	C8orf85			Standard	NM_001025357		Approved	LOC441376	uc003yof.3	Q4LEZ3	OTTHUMG00000164961	ENST00000378279.3:c.168G>A	chr8.hg19:g.117950650G>A		151.0	0.0		91.0	33.0	NM_001025357	A5PKU8	Silent	SNP	ENST00000378279.3	hg19	CCDS34935.1																																																																																			.	.		0.746	AARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381195.1	NM_001025357	
TG	7038	hgsc.bcm.edu	37	8	133911108	133911108	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr8:133911108C>T	ENST00000220616.4	+	14	3323	c.3283C>T	c.(3283-3285)Caa>Taa	p.Q1095*	TG_ENST00000377869.1_Nonsense_Mutation_p.Q1095*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1095	Thyroglobulin type-1 9. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.Q1095K(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGCTAGATCCCAAGAAAACCC	0.552																																					p.Q1095X		Atlas-SNP	.											TG,NS,carcinoma,0,1	TG	416	.	1	Substitution - Missense(1)	ovary(1)	c.C3283T						.						79.0	66.0	70.0					8																	133911108		2203	4300	6503	SO:0001587	stop_gained	7038	exon14			AGATCCCAAGAAA	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3283C>T	chr8.hg19:g.133911108C>T	ENSP00000220616:p.Gln1095*	142.0	0.0		111.0	38.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.242778|6.242778	0.97408|0.97408	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000543313|ENST00000377869;ENST00000220616	.|.	.|.	.|.	5.74|5.74	4.85|4.85	0.62838|0.62838	.|.	.|0.333863	.|0.25848	.|N	.|0.027910	T|.	0.32406|.	0.0828|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34850|.	-0.9812|.	3|.	.|0.11182	.|T	.|0.66	.|.	8.0944|8.0944	0.30820|0.30820	0.1517:0.626:0.2223:0.0|0.1517:0.626:0.2223:0.0	.|.	.|.	.|.	.|.	L|X	2|1095	.|.	.|ENSP00000220616:Q1095X	P|Q	+|+	2|1	0|0	TG|TG	133980290|133980290	0.011000|0.011000	0.17503|0.17503	0.039000|0.039000	0.18376|0.18376	0.351000|0.351000	0.29236|0.29236	1.418000|1.418000	0.34782|0.34782	2.702000|2.702000	0.92279|0.92279	0.655000|0.655000	0.94253|0.94253	CCA|CAA	.	.		0.552	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TOP1MT	116447	hgsc.bcm.edu	37	8	144406772	144406772	+	Silent	SNP	C	C	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr8:144406772C>A	ENST00000329245.4	-	6	733	c.699G>T	c.(697-699)gcG>gcT	p.A233A	TOP1MT_ENST00000521193.1_Silent_p.A135A|TOP1MT_ENST00000523676.1_Silent_p.A135A|TOP1MT_ENST00000519148.1_Silent_p.A135A	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	233					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	ACTGGTGCCCCGCCGGCGGCT	0.562																																					p.A233A		Atlas-SNP	.											.	TOP1MT	63	.	0			c.G699T						.						93.0	94.0	94.0					8																	144406772		2203	4300	6503	SO:0001819	synonymous_variant	116447	exon6			GTGCCCCGCCGGC	AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.699G>T	chr8.hg19:g.144406772C>A		94.0	0.0		39.0	7.0	NM_052963	B7ZAR5|E7ES89|Q86ST4|Q86V82	Silent	SNP	ENST00000329245.4	hg19	CCDS6400.1																																																																																			.	.		0.562	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381247.3	NM_052963	
EPPK1	83481	hgsc.bcm.edu	37	8	144940679	144940679	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr8:144940679G>T	ENST00000525985.1	-	2	6814	c.6743C>A	c.(6742-6744)gCc>gAc	p.A2248D				P58107	EPIPL_HUMAN	epiplakin 1	2248						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTTCCACATGGCCTGGTAGAT	0.711																																					p.A2248D		Atlas-SNP	.											.	EPPK1	199	.	0			c.C6743A						.						60.0	57.0	58.0					8																	144940679		2185	4252	6437	SO:0001583	missense	83481	exon1			CACATGGCCTGGT	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6743C>A	chr8.hg19:g.144940679G>T	ENSP00000436337:p.Ala2248Asp	91.0	0.0		54.0	13.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	G	32	5.129311	0.94473	.	.	ENSG00000227184	ENST00000525985	D	0.97598	-4.45	4.67	4.67	0.58626	.	.	.	.	.	D	0.98413	0.9472	M	0.84433	2.695	0.53688	D	0.999977	D	0.89917	1.0	D	0.97110	1.0	D	0.99274	1.0894	9	0.87932	D	0	.	15.1226	0.72457	0.0:0.0:1.0:0.0	.	2248	E9PPU0	.	D	2248	ENSP00000436337:A2248D	ENSP00000436337:A2248D	A	-	2	0	EPPK1	145012667	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.795000	0.99099	2.420000	0.82092	0.591000	0.81541	GCC	.	.		0.711	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
IFNA8	3445	hgsc.bcm.edu	37	9	21409340	21409340	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr9:21409340C>A	ENST00000380205.1	+	1	195	c.165C>A	c.(163-165)gaC>gaA	p.D55E		NM_002170.3	NP_002161.2	P32881	IFNA8_HUMAN	interferon, alpha 8	55					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		GCCTGAAGGACAGACATGACT	0.507																																					p.D55E		Atlas-SNP	.											.	IFNA8	19	.	0			c.C165A						.						109.0	107.0	108.0					9																	21409340		2203	4300	6503	SO:0001583	missense	3445	exon1			GAAGGACAGACAT		CCDS6507.1	9p22	2010-08-24			ENSG00000120242	ENSG00000120242		"""Interferons"""	5429	protein-coding gene	gene with protein product	"""interferon alpha-B''"", ""interferon alpha type 201"""	147568				1385305	Standard	NM_002170		Approved	IFN-alphaB	uc003zpc.1	P32881	OTTHUMG00000019677	ENST00000380205.1:c.165C>A	chr9.hg19:g.21409340C>A	ENSP00000369553:p.Asp55Glu	59.0	0.0		69.0	17.0	NM_002170	P01565|P09236|Q5VWV7|Q5VYQ3	Missense_Mutation	SNP	ENST00000380205.1	hg19	CCDS6507.1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359335	0.24598	.	.	ENSG00000120242	ENST00000380205	T	0.06608	3.28	3.43	2.51	0.30379	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.507012	0.20203	N	0.097050	T	0.14013	0.0339	M	0.73753	2.245	0.25727	N	0.985314	P	0.35894	0.526	P	0.49192	0.602	T	0.04191	-1.0970	10	0.66056	D	0.02	.	4.692	0.12785	0.0:0.7621:0.0:0.2379	.	55	P32881	IFNA8_HUMAN	E	55	ENSP00000369553:D55E	ENSP00000369553:D55E	D	+	3	2	IFNA8	21399340	0.149000	0.22717	0.562000	0.28370	0.264000	0.26372	0.489000	0.22387	1.914000	0.55421	0.561000	0.74099	GAC	.	.		0.507	IFNA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051906.1	NM_002170	
ABL1	25	hgsc.bcm.edu	37	9	133759735	133759735	+	Silent	SNP	G	G	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr9:133759735G>C	ENST00000318560.5	+	11	2439	c.2058G>C	c.(2056-2058)ctG>ctC	p.L686L		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	686					actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CTCCCCACCTGTGGAAGAAGT	0.687			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.L705L		Atlas-SNP	.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1	1632	.	0			c.G2115C						.						14.0	17.0	16.0					9																	133759735		2184	4252	6436	SO:0001819	synonymous_variant	25	exon11			CCACCTGTGGAAG	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.2058G>C	chr9.hg19:g.133759735G>C		114.0	0.0		58.0	24.0	NM_007313	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Silent	SNP	ENST00000318560.5	hg19	CCDS35166.1																																																																																			.	.		0.687	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
ABL1	25	hgsc.bcm.edu	37	9	133759741	133759741	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr9:133759741G>T	ENST00000318560.5	+	11	2445	c.2064G>T	c.(2062-2064)aaG>aaT	p.K688N		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	688					actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	ACCTGTGGAAGAAGTCCAGCA	0.692			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																p.K707N		Atlas-SNP	.		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	.	ABL1	1632	.	0			c.G2121T						.						14.0	17.0	16.0					9																	133759741		2184	4263	6447	SO:0001583	missense	25	exon11			GTGGAAGAAGTCC	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.2064G>T	chr9.hg19:g.133759741G>T	ENSP00000323315:p.Lys688Asn	111.0	0.0		58.0	26.0	NM_007313	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	ENST00000318560.5	hg19	CCDS35166.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457431	0.63401	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	T;T	0.13196	2.61;2.61	5.42	-5.24	0.02789	.	0.044485	0.85682	D	0.000000	T	0.21718	0.0523	L	0.61218	1.895	0.80722	D	1	D;D	0.58620	0.971;0.983	P;P	0.52267	0.58;0.694	T	0.07385	-1.0775	10	0.52906	T	0.07	.	18.0736	0.89421	0.2097:0.0:0.7903:0.0	.	688;725	P00519;Q59FK4	ABL1_HUMAN;.	N	503;707;688	ENSP00000361423:K707N;ENSP00000323315:K688N	ENSP00000323315:K688N	K	+	3	2	ABL1	132749562	0.058000	0.20735	0.959000	0.39883	0.917000	0.54804	-0.375000	0.07475	-1.014000	0.03379	-0.367000	0.07326	AAG	.	.		0.692	ABL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054684.1	NM_007313	
CAMSAP1	157922	hgsc.bcm.edu	37	9	138714941	138714941	+	Silent	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr9:138714941C>T	ENST00000389532.4	-	11	1630	c.1566G>A	c.(1564-1566)acG>acA	p.T522T	CAMSAP1_ENST00000312405.6_Silent_p.T244T|CAMSAP1_ENST00000409386.3_Silent_p.T533T|CAMSAP1_ENST00000483991.1_5'UTR	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	522					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CGTGGCTCTTCGTGGCCGTGG	0.557																																					p.T522T		Atlas-SNP	.											CAMSAP1,NS,carcinoma,0,1	CAMSAP1	142	.	0			c.G1566A						.						187.0	185.0	186.0					9																	138714941		2203	4300	6503	SO:0001819	synonymous_variant	157922	exon11			GCTCTTCGTGGCC	AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.1566G>A	chr9.hg19:g.138714941C>T		192.0	0.0		88.0	29.0	NM_015447	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Silent	SNP	ENST00000389532.4	hg19	CCDS35176.2																																																																																			.	.		0.557	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
SAPCD2	89958	hgsc.bcm.edu	37	9	139959358	139959358	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr9:139959358T>A	ENST00000409687.3	-	5	1140	c.1013A>T	c.(1012-1014)cAg>cTg	p.Q338L	RP11-229P13.23_ENST00000456356.2_RNA|RP11-229P13.22_ENST00000435463.2_RNA	NM_178448.3	NP_848543.2	Q86UD0	SAPC2_HUMAN	suppressor APC domain containing 2	338						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)											GAGGATGGTCTGCTGCTGCCA	0.721																																					p.Q338L		Atlas-SNP	.											.	.	.	.	0			c.A1013T						.						15.0	14.0	14.0					9																	139959358		2158	4248	6406	SO:0001583	missense	89958	exon5			ATGGTCTGCTGCT	BC024299	CCDS7027.2	9q34.3	2012-02-08	2012-02-08	2012-02-08	ENSG00000186193	ENSG00000186193			28055	protein-coding gene	gene with protein product		612057	"""chromosome 9 open reading frame 140"""	C9orf140		12477932	Standard	NM_178448		Approved	p42.3	uc011men.2	Q86UD0	OTTHUMG00000020961	ENST00000409687.3:c.1013A>T	chr9.hg19:g.139959358T>A	ENSP00000386348:p.Gln338Leu	102.0	0.0		54.0	18.0	NM_178448		Missense_Mutation	SNP	ENST00000409687.3	hg19	CCDS7027.2	.	.	.	.	.	.	.	.	.	.	T	14.76	2.631329	0.46944	.	.	ENSG00000186193	ENST00000409687	T	0.48836	0.8	4.19	4.19	0.49359	.	1.190600	0.06363	N	0.712143	T	0.59622	0.2207	M	0.67953	2.075	0.34878	D	0.7443	P	0.51791	0.948	P	0.51324	0.666	T	0.59873	-0.7372	10	0.59425	D	0.04	-1.0488	10.7252	0.46064	0.0:0.0:0.0:1.0	.	338	Q86UD0	CI140_HUMAN	L	338	ENSP00000386348:Q338L	ENSP00000386348:Q338L	Q	-	2	0	C9orf140	139079179	1.000000	0.71417	1.000000	0.80357	0.263000	0.26337	3.106000	0.50322	1.762000	0.52044	0.260000	0.18958	CAG	.	.		0.721	SAPCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055215.2	NM_178448	
PITX3	5309	hgsc.bcm.edu	37	10	103991828	103991828	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr10:103991828C>A	ENST00000370002.3	-	2	163	c.10G>T	c.(10-12)Ggc>Tgc	p.G4C	PITX3_ENST00000539804.1_Missense_Mutation_p.G4C	NM_005029.3	NP_005020.1	O75364	PITX3_HUMAN	paired-like homeodomain 3	4					dopaminergic neuron differentiation (GO:0071542)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|locomotory behavior (GO:0007626)|midbrain development (GO:0030901)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|large_intestine(2)|lung(2)	5		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CTGAGCAGGCCGAACTCCATG	0.652																																					p.G4C		Atlas-SNP	.											.	PITX3	9	.	0			c.G10T						.						9.0	11.0	10.0					10																	103991828		2191	4282	6473	SO:0001583	missense	5309	exon2			GCAGGCCGAACTC		CCDS7532.1	10q24.32	2013-11-14	2007-07-12		ENSG00000107859	ENSG00000107859		"""Homeoboxes / PRD class"""	9006	protein-coding gene	gene with protein product		602669	"""paired-like homeodomain transcription factor 3"", ""anterior segment mesenchymal dysgenesis"""	ASMD		9620774	Standard	NM_005029		Approved		uc001kuu.1	O75364	OTTHUMG00000018952	ENST00000370002.3:c.10G>T	chr10.hg19:g.103991828C>A	ENSP00000359019:p.Gly4Cys	128.0	0.0		58.0	20.0	NM_005029	Q5VZL2	Missense_Mutation	SNP	ENST00000370002.3	hg19	CCDS7532.1	.	.	.	.	.	.	.	.	.	.	C	16.32	3.090921	0.55968	.	.	ENSG00000107859	ENST00000370002;ENST00000539804	D;D	0.89343	-2.5;-2.5	5.58	3.67	0.42095	.	0.156761	0.53938	D	0.000046	T	0.72771	0.3502	N	0.08118	0	0.29602	N	0.847578	P	0.40619	0.724	B	0.34779	0.189	T	0.71748	-0.4499	10	0.62326	D	0.03	.	5.5485	0.17078	0.0:0.6014:0.0:0.3986	.	4	O75364	PITX3_HUMAN	C	4	ENSP00000359019:G4C;ENSP00000439383:G4C	ENSP00000359019:G4C	G	-	1	0	PITX3	103981818	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	1.666000	0.37460	1.298000	0.44778	0.455000	0.32223	GGC	.	.		0.652	PITX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050031.1		
FAM160A2	84067	hgsc.bcm.edu	37	11	6244964	6244964	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr11:6244964G>A	ENST00000449352.2	-	3	916	c.653C>T	c.(652-654)cCt>cTt	p.P218L	FAM160A2_ENST00000265978.4_Missense_Mutation_p.P218L|FAM160A2_ENST00000524416.1_Missense_Mutation_p.P218L			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	218					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ATGCACAAAAGGGACAAGGCG	0.602																																					p.P218L		Atlas-SNP	.											.	FAM160A2	100	.	0			c.C653T						.						96.0	112.0	107.0					11																	6244964		2201	4296	6497	SO:0001583	missense	84067	exon3			ACAAAAGGGACAA		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.653C>T	chr11.hg19:g.6244964G>A	ENSP00000416918:p.Pro218Leu	265.0	0.0		226.0	69.0	NM_032127	Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	ENST00000449352.2	hg19	CCDS44530.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660666	0.67586	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.31247	1.5;1.5;1.5	5.1	5.1	0.69264	.	0.056991	0.64402	D	0.000001	T	0.60625	0.2283	M	0.87180	2.865	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.75020	0.985;0.982;0.964	T	0.61724	-0.7004	10	0.33940	T	0.23	2.261	17.6783	0.88236	0.0:0.0:1.0:0.0	.	218;218;218	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	L	218;143;218;218	ENSP00000416918:P218L;ENSP00000265978:P218L;ENSP00000431773:P218L	ENSP00000265978:P218L	P	-	2	0	FAM160A2	6201540	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.340000	0.72973	2.671000	0.90904	0.655000	0.94253	CCT	.	.		0.602	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127	
FAT3	120114	hgsc.bcm.edu	37	11	92533685	92533685	+	Silent	SNP	A	A	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr11:92533685A>T	ENST00000298047.6	+	9	7523	c.7506A>T	c.(7504-7506)gtA>gtT	p.V2502V	FAT3_ENST00000525166.1_Silent_p.V2352V|FAT3_ENST00000409404.2_Silent_p.V2502V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2502	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GCACATACGTAGCTGAGGTGA	0.498										TCGA Ovarian(4;0.039)																											p.V2502V		Atlas-SNP	.											.	FAT3	1822	.	0			c.A7506T						.						84.0	81.0	82.0					11																	92533685		2051	4195	6246	SO:0001819	synonymous_variant	120114	exon9			ATACGTAGCTGAG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7506A>T	chr11.hg19:g.92533685A>T		59.0	0.0		101.0	31.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	hg19																																																																																				.	.		0.498	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
SORL1	6653	hgsc.bcm.edu	37	11	121393351	121393351	+	Silent	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr11:121393351C>T	ENST00000260197.7	+	10	1590	c.1461C>T	c.(1459-1461)ctC>ctT	p.L487L	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	487					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TCCTCAACCTCCAGCTCCGGA	0.547																																					p.L487L		Atlas-SNP	.											.	SORL1	218	.	0			c.C1461T						.						168.0	154.0	159.0					11																	121393351		2203	4299	6502	SO:0001819	synonymous_variant	6653	exon10			CAACCTCCAGCTC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1461C>T	chr11.hg19:g.121393351C>T		50.0	0.0		74.0	16.0	NM_003105	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	hg19	CCDS8436.1																																																																																			.	.		0.547	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
YBX3	8531	hgsc.bcm.edu	37	12	10865872	10865872	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr12:10865872C>T	ENST00000228251.4	-	5	711	c.511G>A	c.(511-513)Gct>Act	p.A171T	YBX3_ENST00000279550.7_Missense_Mutation_p.A171T	NM_003651.4	NP_003642.3	P16989	YBOX3_HUMAN	Y box binding protein 3	171					3'-UTR-mediated mRNA stabilization (GO:0070935)|cellular hyperosmotic response (GO:0071474)|cellular response to tumor necrosis factor (GO:0071356)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of necroptotic process (GO:0060546)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytoplasmic translation (GO:2000767)|positive regulation of organ growth (GO:0046622)|response to cold (GO:0009409)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|tight junction (GO:0005923)	double-stranded DNA binding (GO:0003690)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|Rho GTPase binding (GO:0017048)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)										CGATCTGCAGCGTAACGACTC	0.502																																					p.A171T		Atlas-SNP	.											.	CSDA	35	.	0			c.G511A						.						92.0	99.0	97.0					12																	10865872		2203	4300	6503	SO:0001583	missense	8531	exon5			CTGCAGCGTAACG	L29064	CCDS8630.1, CCDS44831.1	12p13.1	2013-03-13	2013-03-13	2013-03-13	ENSG00000060138	ENSG00000060138			2428	protein-coding gene	gene with protein product	"""cold-shock domain containing A1"""	603437	"""cold shock domain protein A"""	CSDA		2977358, 8710501	Standard	NM_003651		Approved	dbpA, ZONAB, CSDA1	uc001qyt.3	P16989	OTTHUMG00000168409	ENST00000228251.4:c.511G>A	chr12.hg19:g.10865872C>T	ENSP00000228251:p.Ala171Thr	52.0	0.0		28.0	13.0	NM_003651	B2RBW6|Q14121|Q969N6|Q96B76	Missense_Mutation	SNP	ENST00000228251.4	hg19	CCDS8630.1	.	.	.	.	.	.	.	.	.	.	C	34	5.324672	0.95708	.	.	ENSG00000060138	ENST00000279550;ENST00000228251	T;T	0.34472	1.4;1.36	5.49	4.58	0.56647	.	0.000000	0.64402	D	0.000003	T	0.61553	0.2356	M	0.80028	2.48	0.51233	D	0.999914	D;D	0.89917	1.0;1.0	D;D	0.91635	0.984;0.999	T	0.66160	-0.5993	10	0.56958	D	0.05	.	13.9601	0.64172	0.0:0.8467:0.1533:0.0	.	171;171	P16989-2;P16989	.;DBPA_HUMAN	T	171	ENSP00000279550:A171T;ENSP00000228251:A171T	ENSP00000228251:A171T	A	-	1	0	CSDA	10757139	1.000000	0.71417	0.936000	0.37596	0.985000	0.73830	6.605000	0.74155	1.268000	0.44264	0.491000	0.48974	GCT	.	.		0.502	YBX3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399628.1	NM_003651	
MCRS1	10445	hgsc.bcm.edu	37	12	49960179	49960179	+	Intron	SNP	C	C	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr12:49960179C>G	ENST00000550165.1	-	4	277				MCRS1_ENST00000343810.4_Intron|MCRS1_ENST00000357123.4_Missense_Mutation_p.G15A|MCRS1_ENST00000546244.1_Intron			Q96EZ8	MCRS1_HUMAN	microspherule protein 1						cellular protein modification process (GO:0006464)|chromatin organization (GO:0006325)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)	23						CAGACCTGGCCCAGACCTTCC	0.622																																					p.G15A		Atlas-SNP	.											.	MCRS1	40	.	0			c.G44C						.						33.0	29.0	30.0					12																	49960179		2201	4296	6497	SO:0001627	intron_variant	10445	exon1			CCTGGCCCAGACC	BC011794	CCDS8787.1, CCDS31795.1, CCDS61118.1	12q13.12	2011-07-06				ENSG00000187778		"""INO80 complex subunits"""	6960	protein-coding gene	gene with protein product	"""INO80 complex subunit Q"""	609504				9765390, 9654073	Standard	NM_006337		Approved	ICP22BP, MSP58, P78, MCRS2, INO80Q	uc001rui.1	Q96EZ8		ENST00000550165.1:c.11-181G>C	chr12.hg19:g.49960179C>G		99.0	0.0		63.0	25.0	NM_001012300	O14742|O75497|Q6VN53|Q7Z372	Missense_Mutation	SNP	ENST00000550165.1	hg19	CCDS8787.1	.	.	.	.	.	.	.	.	.	.	C	1.232	-0.623867	0.03636	.	.	ENSG00000187778	ENST00000357123	.	.	.	3.63	3.63	0.41609	.	1.145640	0.06318	N	0.703861	T	0.56307	0.1976	.	.	.	0.80722	D	1	B	0.19706	0.038	B	0.14578	0.011	T	0.50659	-0.8802	8	0.87932	D	0	-1.3425	10.6615	0.45704	0.0:1.0:0.0:0.0	.	15	Q96EZ8-2	.	A	15	.	ENSP00000349640:G15A	G	-	2	0	MCRS1	48246446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.073000	0.50057	1.849000	0.53698	0.563000	0.77884	GGG	.	.		0.622	MCRS1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405102.1	NM_006337	
AGAP2	116986	hgsc.bcm.edu	37	12	58120766	58120766	+	Silent	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr12:58120766C>T	ENST00000547588.1	-	18	3326	c.3327G>A	c.(3325-3327)ctG>ctA	p.L1109L	AGAP2-AS1_ENST00000542466.2_5'UTR|AGAP2_ENST00000257897.3_Silent_p.L753L|RP11-571M6.8_ENST00000548410.2_RNA	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	1109					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						CCCACAGCAGCAGTTGCGTGA	0.657											OREG0021951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1109L		Atlas-SNP	.											.	AGAP2	167	.	0			c.G3327A						.						17.0	20.0	19.0					12																	58120766		2202	4298	6500	SO:0001819	synonymous_variant	116986	exon18			CAGCAGCAGTTGC	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.3327G>A	chr12.hg19:g.58120766C>T		109.0	0.0	1028	64.0	24.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Silent	SNP	ENST00000547588.1	hg19	CCDS44932.1	.	.	.	.	.	.	.	.	.	.	C	8.233	0.805079	0.16467	.	.	ENSG00000135439	ENST00000328568	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	T	0.63931	0.2553	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62567	-0.6827	4	.	.	.	.	12.4071	0.55445	0.169:0.831:0.0:0.0	.	.	.	.	T	953	.	.	A	-	1	0	AGAP2	56407033	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	0.909000	0.28558	2.276000	0.75962	0.455000	0.32223	GCT	.	.		0.657	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
SOS2	6655	hgsc.bcm.edu	37	14	50649189	50649189	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr14:50649189A>T	ENST00000216373.5	-	6	1124	c.850T>A	c.(850-852)Ttg>Atg	p.L284M	SOS2_ENST00000555794.1_5'Flank|SOS2_ENST00000543680.1_Missense_Mutation_p.L284M	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	284	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					ACTTCTGCCAAATCTTCAAAA	0.378																																					p.L284M		Atlas-SNP	.											.	SOS2	195	.	0			c.T850A						.						73.0	69.0	70.0					14																	50649189		2203	4300	6503	SO:0001583	missense	6655	exon6			CTGCCAAATCTTC	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.850T>A	chr14.hg19:g.50649189A>T	ENSP00000216373:p.Leu284Met	55.0	0.0		77.0	27.0	NM_006939	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	ENST00000216373.5	hg19	CCDS9697.1	.	.	.	.	.	.	.	.	.	.	A	16.99	3.274935	0.59649	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.68903	-0.36;-0.36	5.54	1.89	0.25635	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.61198	0.2328	L	0.49513	1.565	0.51482	D	0.999928	P;P	0.45240	0.78;0.854	B;P	0.47603	0.377;0.551	T	0.54741	-0.8248	10	0.34782	T	0.22	.	6.779	0.23636	0.5725:0.0:0.4275:0.0	.	284;284	B7ZKT6;Q07890	.;SOS2_HUMAN	M	284	ENSP00000216373:L284M;ENSP00000445328:L284M	ENSP00000216373:L284M	L	-	1	2	SOS2	49718939	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.342000	0.43992	0.395000	0.25257	-0.263000	0.10527	TTG	.	.		0.378	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276878.2		
TDP1	55775	hgsc.bcm.edu	37	14	90446920	90446920	+	Silent	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr14:90446920G>T	ENST00000335725.4	+	8	1078	c.828G>T	c.(826-828)cgG>cgT	p.R276R	TDP1_ENST00000393454.2_Silent_p.R276R|TDP1_ENST00000393452.3_Silent_p.R276R|TDP1_ENST00000555565.1_3'UTR|TDP1_ENST00000555880.1_Silent_p.R276R|TDP1_ENST00000357382.3_Silent_p.R37R	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	276					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		AAGGCCTCCGGGTTGTCATAC	0.438								Repair of DNA-protein crosslinks																													p.R276R		Atlas-SNP	.											.	TDP1	47	.	0			c.G828T						.						117.0	110.0	112.0					14																	90446920		2203	4300	6503	SO:0001819	synonymous_variant	55775	exon8			CCTCCGGGTTGTC	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.828G>T	chr14.hg19:g.90446920G>T		55.0	0.0		94.0	29.0	NM_018319	Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Silent	SNP	ENST00000335725.4	hg19	CCDS9888.1																																																																																			.	.		0.438	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319	
DLK1	8788	hgsc.bcm.edu	37	14	101201153	101201153	+	Missense_Mutation	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr14:101201153G>A	ENST00000341267.4	+	5	1314	c.1072G>A	c.(1072-1074)Gac>Aac	p.D358N	RP11-566J3.4_ENST00000608876.1_lincRNA|DLK1_ENST00000331224.6_Missense_Mutation_p.D285N	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	358					cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				CAGCGGGGAGGACCTGGCCGT	0.582																																					p.D358N		Atlas-SNP	.											.	DLK1	57	.	0			c.G1072A						.						102.0	96.0	98.0					14																	101201153		2203	4300	6503	SO:0001583	missense	8788	exon5			GGGGAGGACCTGG	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.1072G>A	chr14.hg19:g.101201153G>A	ENSP00000340292:p.Asp358Asn	91.0	0.0		46.0	21.0	NM_003836	P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	hg19	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	G	7.900	0.734183	0.15574	.	.	ENSG00000185559	ENST00000341267;ENST00000331224	D;D	0.87179	-2.22;-2.2	4.61	3.71	0.42584	.	0.530450	0.17800	N	0.161613	T	0.75824	0.3902	N	0.08118	0	0.80722	D	1	P;P	0.42692	0.787;0.546	B;B	0.44163	0.443;0.156	T	0.76721	-0.2855	10	0.56958	D	0.05	.	7.8965	0.29710	0.1809:0.0:0.8191:0.0	.	285;358	P80370-2;P80370	.;DLK1_HUMAN	N	358;285	ENSP00000340292:D358N;ENSP00000331081:D285N	ENSP00000331081:D285N	D	+	1	0	DLK1	100270906	1.000000	0.71417	0.103000	0.21229	0.006000	0.05464	5.923000	0.70045	2.113000	0.64589	0.491000	0.48974	GAC	.	.		0.582	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1		
SEMA6D	80031	hgsc.bcm.edu	37	15	48058110	48058110	+	Missense_Mutation	SNP	A	A	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr15:48058110A>T	ENST00000316364.5	+	14	1911	c.1472A>T	c.(1471-1473)cAg>cTg	p.Q491L	SEMA6D_ENST00000355997.3_Missense_Mutation_p.Q491L|SEMA6D_ENST00000537942.1_Missense_Mutation_p.Q491L|SEMA6D_ENST00000389428.3_Missense_Mutation_p.Q491L|SEMA6D_ENST00000354744.4_Missense_Mutation_p.Q491L|SEMA6D_ENST00000558014.1_Missense_Mutation_p.Q491L|SEMA6D_ENST00000389433.2_Missense_Mutation_p.Q491L|SEMA6D_ENST00000558816.1_Missense_Mutation_p.Q491L|SEMA6D_ENST00000536845.2_Missense_Mutation_p.Q491L|SEMA6D_ENST00000358066.4_Missense_Mutation_p.Q491L|SEMA6D_ENST00000389432.2_Missense_Mutation_p.Q491L	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	491	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		ATCTCATTACAGTTGGATAAA	0.423																																					p.Q491L		Atlas-SNP	.											.	SEMA6D	322	.	0			c.A1472T						.						219.0	191.0	200.0					15																	48058110		2198	4297	6495	SO:0001583	missense	80031	exon14			CATTACAGTTGGA	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1472A>T	chr15.hg19:g.48058110A>T	ENSP00000324857:p.Gln491Leu	53.0	0.0		126.0	7.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	hg19	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	A	17.01	3.280456	0.59758	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997	T;T;T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12;2.12	5.68	5.68	0.88126	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.050581	0.85682	D	0.000000	T	0.21550	0.0519	L	0.47078	1.49	0.80722	D	1	P;B;P;P;B	0.40302	0.621;0.322;0.621;0.712;0.359	B;B;B;B;B	0.35727	0.077;0.056;0.119;0.209;0.077	T	0.02190	-1.1198	10	0.87932	D	0	.	15.926	0.79618	1.0:0.0:0.0:0.0	.	491;491;491;491;491	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	L	491	ENSP00000442040:Q491L;ENSP00000446152:Q491L;ENSP00000324857:Q491L;ENSP00000374084:Q491L;ENSP00000374083:Q491L;ENSP00000346786:Q491L;ENSP00000350770:Q491L;ENSP00000374079:Q491L;ENSP00000348276:Q491L	ENSP00000324857:Q491L	Q	+	2	0	SEMA6D	45845402	1.000000	0.71417	0.889000	0.34880	0.951000	0.60555	9.339000	0.96797	2.164000	0.68074	0.528000	0.53228	CAG	.	.		0.423	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
NTRK3	4916	hgsc.bcm.edu	37	15	88690596	88690596	+	Missense_Mutation	SNP	T	T	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr15:88690596T>C	ENST00000360948.2	-	5	595	c.434A>G	c.(433-435)cAg>cGg	p.Q145R	NTRK3_ENST00000542733.2_Missense_Mutation_p.Q47R|NTRK3_ENST00000357724.2_Missense_Mutation_p.Q145R|NTRK3_ENST00000540489.2_Missense_Mutation_p.Q145R|NTRK3_ENST00000355254.2_Missense_Mutation_p.Q145R|NTRK3_ENST00000394480.2_Missense_Mutation_p.Q145R|NTRK3_ENST00000317501.3_Missense_Mutation_p.Q145R|NTRK3_ENST00000558676.1_Missense_Mutation_p.Q145R|NTRK3_ENST00000557856.1_Missense_Mutation_p.Q145R	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	145					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTGGAAGAGCTGCCACGAGAG	0.458			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.Q145R		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.A434G						.						74.0	64.0	67.0					15																	88690596		2201	4299	6500	SO:0001583	missense	4916	exon6			AAGAGCTGCCACG	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.434A>G	chr15.hg19:g.88690596T>C	ENSP00000354207:p.Gln145Arg	96.0	0.0		172.0	89.0	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	T	12.40	1.927686	0.34002	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42;0.42;0.42	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.34629	0.0904	N	0.02202	-0.64	0.45439	D	0.998411	P;P;B;P;P;B	0.49185	0.801;0.92;0.004;0.891;0.804;0.004	B;P;B;P;B;B	0.48952	0.339;0.551;0.007;0.596;0.415;0.007	T	0.35599	-0.9782	10	0.22109	T	0.4	.	13.3964	0.60856	0.0:0.0:0.0:1.0	.	47;145;145;145;145;145	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	R	145;145;145;145;47;145;145	ENSP00000377990:Q145R;ENSP00000354207:Q145R;ENSP00000350356:Q145R;ENSP00000347397:Q145R;ENSP00000437773:Q47R;ENSP00000444673:Q145R;ENSP00000318328:Q145R	ENSP00000318328:Q145R	Q	-	2	0	NTRK3	86491600	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.114000	0.64648	2.095000	0.63458	0.460000	0.39030	CAG	.	.		0.458	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
NR2F2	7026	hgsc.bcm.edu	37	15	96877632	96877632	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr15:96877632C>G	ENST00000394166.3	+	2	2159	c.770C>G	c.(769-771)gCg>gGg	p.A257G	MIR1469_ENST00000410719.1_RNA|NR2F2_ENST00000394171.2_Missense_Mutation_p.A104G|NR2F2_ENST00000421109.2_Missense_Mutation_p.A124G|NR2F2_ENST00000453270.2_Missense_Mutation_p.A104G	NM_021005.3	NP_066285.1	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	257	Interaction with ZFPM2. {ECO:0000250}.|Ligand-binding. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|blood vessel morphogenesis (GO:0048514)|fertilization (GO:0009566)|forebrain development (GO:0030900)|intracellular receptor signaling pathway (GO:0030522)|limb development (GO:0060173)|lipid metabolic process (GO:0006629)|maternal placenta development (GO:0001893)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|radial pattern formation (GO:0009956)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A257V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(2)|lung(3)|ovary(2)|urinary_tract(1)	17	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			GTGTTGAATGCGGCGCAGTGC	0.677																																					p.A257G		Atlas-SNP	.											NR2F2,NS,carcinoma,0,1	NR2F2	35	.	1	Substitution - Missense(1)	endometrium(1)	c.C770G						.						86.0	76.0	80.0					15																	96877632		2197	4298	6495	SO:0001583	missense	7026	exon2			TGAATGCGGCGCA	M64497	CCDS10375.1, CCDS45358.1, CCDS45359.1	15q26	2013-01-16			ENSG00000185551	ENSG00000185551		"""Nuclear hormone receptors"""	7976	protein-coding gene	gene with protein product		107773		ARP1, TFCOUP2		8530078, 11544252	Standard	NM_021005		Approved	COUP-TFII, COUPTFB, SVP40, NF-E3	uc010uri.2	P24468	OTTHUMG00000149848	ENST00000394166.3:c.770C>G	chr15.hg19:g.96877632C>G	ENSP00000377721:p.Ala257Gly	134.0	1.0		98.0	22.0	NM_021005	B4DQJ2|B6ZGU1|Q03754|Q3KQR7	Missense_Mutation	SNP	ENST00000394166.3	hg19	CCDS10375.1	.	.	.	.	.	.	.	.	.	.	C	35	5.504944	0.96371	.	.	ENSG00000185551	ENST00000421109;ENST00000394166;ENST00000394171;ENST00000453270	T;T;D;D	0.96885	0.65;0.65;-4.16;-4.16	5.09	5.09	0.68999	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98523	0.9507	M	0.91510	3.215	0.80722	D	1	D;P	0.89917	1.0;0.946	D;P	0.97110	1.0;0.849	D	0.99346	1.0913	10	0.59425	D	0.04	.	18.4813	0.90812	0.0:1.0:0.0:0.0	.	257;124	P24468;Q3KQR7	COT2_HUMAN;.	G	124;257;104;104	ENSP00000401674:A124G;ENSP00000377721:A257G;ENSP00000377726:A104G;ENSP00000389853:A104G	ENSP00000377721:A257G	A	+	2	0	NR2F2	94678636	1.000000	0.71417	0.987000	0.45799	0.981000	0.71138	7.818000	0.86416	2.376000	0.81061	0.655000	0.94253	GCG	.	.		0.677	NR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313534.1		
TNRC6A	27327	hgsc.bcm.edu	37	16	24826592	24826592	+	Silent	SNP	G	G	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr16:24826592G>A	ENST00000395799.3	+	19	4926	c.4797G>A	c.(4795-4797)tcG>tcA	p.S1599S	CTD-2515A14.1_ENST00000568895.1_RNA|TNRC6A_ENST00000432286.2_Silent_p.S77S|TNRC6A_ENST00000315183.7_Silent_p.S1550S	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1599					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GTGCCAAATCGCCTAACGGCT	0.438																																					p.S1599S		Atlas-SNP	.											.	TNRC6A	171	.	0			c.G4797A						.						77.0	73.0	74.0					16																	24826592		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon19			CAAATCGCCTAAC	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4797G>A	chr16.hg19:g.24826592G>A		82.0	0.0		70.0	31.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	G	9.931	1.214738	0.22289	.	.	ENSG00000090905	ENST00000450465	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	T	0.71204	0.3312	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68674	-0.5346	4	.	.	.	-5.317	14.4704	0.67512	0.0699:0.0:0.9301:0.0	.	.	.	.	T	490	.	.	A	+	1	0	TNRC6A	24734093	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.951000	0.56684	2.809000	0.96659	0.655000	0.94253	GCC	.	.		0.438	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
RNF40	9810	hgsc.bcm.edu	37	16	30774809	30774809	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr16:30774809C>G	ENST00000324685.6	+	4	806	c.371C>G	c.(370-372)gCa>gGa	p.A124G	RNF40_ENST00000357890.5_Missense_Mutation_p.A124G|RNF40_ENST00000402121.3_Intron|C16orf93_ENST00000545825.1_5'Flank|C16orf93_ENST00000543610.1_5'Flank|C16orf93_ENST00000541260.1_5'Flank|RNF40_ENST00000563683.1_Missense_Mutation_p.A124G	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	124					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GCGCCTGAGGCACCTGGGACC	0.577																																					p.A124G		Atlas-SNP	.											.	RNF40	83	.	0			c.C371G						.						56.0	57.0	57.0					16																	30774809		2197	4300	6497	SO:0001583	missense	9810	exon4			CTGAGGCACCTGG	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.371C>G	chr16.hg19:g.30774809C>G	ENSP00000325677:p.Ala124Gly	179.0	0.0		96.0	46.0	NM_014771	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	ENST00000324685.6	hg19	CCDS10691.1	.	.	.	.	.	.	.	.	.	.	C	6.101	0.386969	0.11581	.	.	ENSG00000103549	ENST00000324685;ENST00000357890	T;T	0.30714	1.52;1.52	5.84	0.0452	0.14229	.	0.702903	0.14066	N	0.343745	T	0.11879	0.0289	N	0.08118	0	0.19575	N	0.999963	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.24905	-1.0147	10	0.23302	T	0.38	-3.0577	3.7695	0.08636	0.2584:0.3624:0.0:0.3792	.	124;124;124	O75150-4;A8K6K1;O75150	.;.;BRE1B_HUMAN	G	124	ENSP00000325677:A124G;ENSP00000350563:A124G	ENSP00000325677:A124G	A	+	2	0	RNF40	30682310	0.001000	0.12720	0.083000	0.20561	0.732000	0.41865	-0.046000	0.11983	0.098000	0.17522	0.563000	0.77884	GCA	.	.		0.577	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255524.2	NM_014771	
PDPR	55066	hgsc.bcm.edu	37	16	70161189	70161189	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr16:70161189G>T	ENST00000288050.4	+	4	1211	c.254G>T	c.(253-255)tGt>tTt	p.C85F	PDPR_ENST00000568530.1_Missense_Mutation_p.C85F|PDPR_ENST00000398122.3_5'UTR	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	85					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		ACCAGGTTCTGTGCTGGCATC	0.478																																					p.C85F		Atlas-SNP	.											.	PDPR	66	.	0			c.G254T						.						34.0	31.0	32.0					16																	70161189		1825	4065	5890	SO:0001583	missense	55066	exon4			GGTTCTGTGCTGG		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.254G>T	chr16.hg19:g.70161189G>T	ENSP00000288050:p.Cys85Phe	187.0	0.0		176.0	59.0	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	ENST00000288050.4	hg19	CCDS45520.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895545	0.52121	.	.	ENSG00000090857	ENST00000288050	T	0.81078	-1.45	4.7	4.7	0.59300	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	N	0.03608	-0.345	0.80722	D	1	B	0.21520	0.057	B	0.26094	0.066	T	0.65689	-0.6107	10	0.62326	D	0.03	.	17.0035	0.86386	0.0:0.0:1.0:0.0	.	85	Q8NCN5	PDPR_HUMAN	F	85	ENSP00000288050:C85F	ENSP00000288050:C85F	C	+	2	0	PDPR	68718690	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.777000	0.85628	2.312000	0.78011	0.645000	0.84053	TGT	.	.		0.478	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
TOP2A	7153	hgsc.bcm.edu	37	17	38569014	38569014	+	Silent	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr17:38569014C>T	ENST00000423485.1	-	7	944	c.786G>A	c.(784-786)ctG>ctA	p.L262L		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	262					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	TACTCACTGGCAGTTTATTTC	0.348																																					p.L262L		Atlas-SNP	.											.	TOP2A	124	.	0			c.G786A						.						60.0	54.0	56.0					17																	38569014		1841	4091	5932	SO:0001819	synonymous_variant	7153	exon7			CACTGGCAGTTTA		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.786G>A	chr17.hg19:g.38569014C>T		170.0	0.0		115.0	6.0	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Silent	SNP	ENST00000423485.1	hg19	CCDS45672.1																																																																																			.	.		0.348	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
STAT5A	6776	hgsc.bcm.edu	37	17	40453352	40453352	+	Missense_Mutation	SNP	C	C	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr17:40453352C>G	ENST00000345506.4	+	10	1691	c.1049C>G	c.(1048-1050)gCc>gGc	p.A350G	STAT5A_ENST00000588868.1_Missense_Mutation_p.A350G|STAT5A_ENST00000546010.2_Missense_Mutation_p.A320G|STAT5A_ENST00000452307.2_Missense_Mutation_p.A350G|STAT5A_ENST00000590949.1_Missense_Mutation_p.A350G	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	350					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		AAGTTTGCAGCCACCGTACGC	0.582																																					p.A350G		Atlas-SNP	.											.	STAT5A	49	.	0			c.C1049G						.						157.0	136.0	143.0					17																	40453352		2203	4300	6503	SO:0001583	missense	6776	exon10			TTGCAGCCACCGT	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1049C>G	chr17.hg19:g.40453352C>G	ENSP00000341208:p.Ala350Gly	125.0	0.0		77.0	24.0	NM_003152	Q1KLZ6	Missense_Mutation	SNP	ENST00000345506.4	hg19	CCDS11424.1	.	.	.	.	.	.	.	.	.	.	C	18.07	3.540950	0.65085	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.89617	-2.54;-2.54;-2.54	4.87	4.87	0.63330	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92760	0.7698	L	0.60957	1.885	0.80722	D	1	B;P;B	0.50617	0.028;0.937;0.074	B;P;B	0.61722	0.104;0.893;0.158	D	0.93663	0.6983	10	0.87932	D	0	-9.6895	18.0732	0.89417	0.0:1.0:0.0:0.0	.	320;352;350	Q1KLZ6;Q59GY7;P42229	.;.;STA5A_HUMAN	G	350;320;352;350	ENSP00000341208:A350G;ENSP00000443107:A320G;ENSP00000400320:A350G	ENSP00000341208:A350G	A	+	2	0	STAT5A	37706878	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	7.689000	0.84165	2.274000	0.75844	0.306000	0.20318	GCC	.	.		0.582	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152	
FASN	2194	hgsc.bcm.edu	37	17	80041427	80041427	+	Silent	SNP	A	A	G			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr17:80041427A>G	ENST00000306749.2	-	31	5525	c.5307T>C	c.(5305-5307)atT>atC	p.I1769I	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1769	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CGAATTTGCCAATTTCCAGGA	0.637																																					p.I1769I	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.T5307C						.						54.0	52.0	53.0					17																	80041427		2198	4297	6495	SO:0001819	synonymous_variant	2194	exon31			TTTGCCAATTTCC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5307T>C	chr17.hg19:g.80041427A>G		148.0	0.0		87.0	28.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	hg19	CCDS11801.1																																																																																			.	.		0.637	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
NFIC	4782	hgsc.bcm.edu	37	19	3452573	3452573	+	Missense_Mutation	SNP	C	C	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr19:3452573C>T	ENST00000443272.2	+	8	1229	c.1178C>T	c.(1177-1179)gCc>gTc	p.A393V	NFIC_ENST00000586919.1_Missense_Mutation_p.A360V|NFIC_ENST00000589123.1_Missense_Mutation_p.A384V|NFIC_ENST00000346156.5_Missense_Mutation_p.A360V|NFIC_ENST00000395111.3_Missense_Mutation_p.A384V|NFIC_ENST00000590282.1_Missense_Mutation_p.A393V|NFIC_ENST00000341919.3_Missense_Mutation_p.A393V	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	393					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CCCCACACGGCCATCCGCTAC	0.652																																					p.A393V		Atlas-SNP	.											NFIC,colon,carcinoma,0,1	NFIC	36	.	0			c.C1178T						.						187.0	159.0	168.0					19																	3452573		2203	4300	6503	SO:0001583	missense	4782	exon8			ACACGGCCATCCG	X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.1178C>T	chr19.hg19:g.3452573C>T	ENSP00000396843:p.Ala393Val	129.0	0.0		40.0	16.0	NM_001245004	A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	ENST00000443272.2	hg19	CCDS59330.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890863	0.91889	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T	0.53640	0.61;0.61;0.61	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.66117	0.2757	M	0.65498	2.005	0.52501	D	0.999953	D;D;D;D;D	0.76494	0.999;0.999;0.998;0.972;0.998	D;D;D;P;D	0.83275	0.996;0.996;0.994;0.592;0.994	T	0.69614	-0.5098	10	0.54805	T	0.06	.	15.0657	0.71992	0.0:1.0:0.0:0.0	.	393;393;384;393;384	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	V	384;384;360;393;393;393	ENSP00000378543:A384V;ENSP00000301935:A360V;ENSP00000342194:A393V	ENSP00000269778:A393V	A	+	2	0	NFIC	3403573	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.240000	0.78192	1.874000	0.54306	0.555000	0.69702	GCC	.	.		0.652	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452834.1	NM_005597	
MATK	4145	hgsc.bcm.edu	37	19	3778345	3778345	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr19:3778345G>T	ENST00000310132.6	-	14	1758	c.1360C>A	c.(1360-1362)Cac>Aac	p.H454N	MATK_ENST00000395040.2_Missense_Mutation_p.H413N|MATK_ENST00000395045.2_Missense_Mutation_p.H455N|MATK_ENST00000585778.1_Missense_Mutation_p.H453N	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	454	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGAGGACGTGCACGGGGCCT	0.697																																					p.H455N		Atlas-SNP	.											.	MATK	108	.	0			c.C1363A						.						27.0	32.0	30.0					19																	3778345		2203	4293	6496	SO:0001583	missense	4145	exon14			GGACGTGCACGGG	L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.1360C>A	chr19.hg19:g.3778345G>T	ENSP00000308734:p.His454Asn	165.0	0.0		83.0	32.0	NM_002378	B3KNZ9|Q9NST8	Missense_Mutation	SNP	ENST00000310132.6	hg19	CCDS12114.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.485877	0.26686	.	.	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	D;D;D	0.82255	-1.59;-1.59;-1.59	3.68	0.123	0.14709	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.078323	0.52532	D	0.000064	T	0.71230	0.3315	L	0.31476	0.935	0.09310	N	1	P;P;P	0.35821	0.523;0.523;0.523	B;B;B	0.39562	0.303;0.303;0.303	T	0.64067	-0.6494	10	0.87932	D	0	-22.8259	5.4811	0.16723	0.6168:0.0:0.3832:0.0	.	454;455;454	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	N	455;454;413	ENSP00000378485:H455N;ENSP00000308734:H454N;ENSP00000378481:H413N	ENSP00000308734:H454N	H	-	1	0	MATK	3729345	1.000000	0.71417	0.000000	0.03702	0.573000	0.36030	5.962000	0.70364	0.254000	0.21573	-0.219000	0.12488	CAC	.	.		0.697	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453639.1	NM_139355	
MIS18A	54069	hgsc.bcm.edu	37	21	33641405	33641405	+	Silent	SNP	T	T	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr21:33641405T>C	ENST00000290130.3	-	5	699	c.645A>G	c.(643-645)ttA>ttG	p.L215L	MIS18A_ENST00000486363.1_5'Flank	NM_018944.2	NP_061817.1	Q9NYP9	MS18A_HUMAN	MIS18 kinetochore protein A	215					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)|regulation of DNA methylation (GO:0044030)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	7						GCTTCATTTGTAATGCTTTCA	0.353																																					p.L215L		Atlas-SNP	.											.	MIS18A	11	.	0			c.A645G						.						102.0	92.0	95.0					21																	33641405		2203	4300	6503	SO:0001819	synonymous_variant	54069	exon5			CATTTGTAATGCT	AF231921	CCDS13611.1	21q22.11	2013-10-21	2013-10-21	2011-02-23	ENSG00000159055	ENSG00000159055			1286	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 46"", ""chromosome 21 open reading frame 45"", ""MIS18 kinetochore protein homolog A (S. pombe)"""	C21orf46, C21orf45		17199038	Standard	NM_018944		Approved	B28, FASP1, hMis18alpha	uc002ypi.3	Q9NYP9	OTTHUMG00000085308	ENST00000290130.3:c.645A>G	chr21.hg19:g.33641405T>C		524.0	1.0		243.0	124.0	NM_018944	B2R562|Q542Z0	Silent	SNP	ENST00000290130.3	hg19	CCDS13611.1																																																																																			.	.		0.353	MIS18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193090.1	NM_018944	
NLGN4X	57502	hgsc.bcm.edu	37	X	5811119	5811119	+	Missense_Mutation	SNP	C	C	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chrX:5811119C>A	ENST00000381095.3	-	6	2817	c.2190G>T	c.(2188-2190)atG>atT	p.M730I	NLGN4X_ENST00000381093.2_Missense_Mutation_p.M750I|NLGN4X_ENST00000538097.1_Missense_Mutation_p.M730I|NLGN4X_ENST00000381092.1_Missense_Mutation_p.M730I|NLGN4X_ENST00000275857.6_Missense_Mutation_p.M730I	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	730					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TCTGCAGAGACATGATCTCTT	0.552																																					p.M730I		Atlas-SNP	.											.	NLGN4X	191	.	0			c.G2190T						.						162.0	121.0	135.0					X																	5811119		2203	4300	6503	SO:0001583	missense	57502	exon6			CAGAGACATGATC	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.2190G>T	chrX.hg19:g.5811119C>A	ENSP00000370485:p.Met730Ile	68.0	0.0		57.0	39.0	NM_181332	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	hg19	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	9.648	1.140726	0.21205	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33	3.82	3.82	0.43975	.	0.599350	0.13950	N	0.351623	T	0.22126	0.0533	M	0.72894	2.215	0.44816	D	0.997821	B;B;B	0.31274	0.212;0.212;0.317	B;B;B	0.31547	0.062;0.062;0.132	T	0.03922	-1.0992	10	0.25106	T	0.35	.	14.222	0.65833	0.0:1.0:0.0:0.0	.	787;730;750	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	I	730;750;730;730;730	ENSP00000370485:M730I;ENSP00000370483:M750I;ENSP00000275857:M730I;ENSP00000370482:M730I;ENSP00000439203:M730I	ENSP00000275857:M730I	M	-	3	0	NLGN4X	5821119	1.000000	0.71417	0.982000	0.44146	0.266000	0.26442	3.945000	0.56637	1.508000	0.48769	0.513000	0.50165	ATG	.	.		0.552	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20206619	20206619	+	Missense_Mutation	SNP	T	T	A			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chrX:20206619T>A	ENST00000379565.3	-	8	834	c.627A>T	c.(625-627)ttA>ttT	p.L209F	RPS6KA3_ENST00000544447.1_Missense_Mutation_p.L181F|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.L180F|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.L181F	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	209	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TTTTACCTGTTAACTTGATGT	0.264																																					p.L209F		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.A627T						.						20.0	19.0	19.0					X																	20206619		2171	4264	6435	SO:0001583	missense	6197	exon8			ACCTGTTAACTTG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.627A>T	chrX.hg19:g.20206619T>A	ENSP00000368884:p.Leu209Phe	271.0	1.0		388.0	177.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	13.53	2.263264	0.39995	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145	T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12	5.11	1.55	0.23275	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000005	T	0.65883	0.2734	M	0.90650	3.135	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;0.997;1.0	D;D;D;D	0.85130	0.986;0.996;0.971;0.997	T	0.69150	-0.5221	10	0.87932	D	0	.	9.2431	0.37509	0.0:0.2936:0.0:0.7064	.	181;180;181;209	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	F	209;181;180;181;180	ENSP00000368884:L209F;ENSP00000440220:L181F;ENSP00000368865:L180F;ENSP00000444837:L181F;ENSP00000407655:L180F	ENSP00000368865:L180F	L	-	3	2	RPS6KA3	20116540	0.630000	0.27155	1.000000	0.80357	0.157000	0.22087	-0.261000	0.08694	0.615000	0.30124	0.412000	0.27726	TTA	.	.		0.264	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
NR0B1	190	hgsc.bcm.edu	37	X	30327260	30327260	+	Missense_Mutation	SNP	G	G	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chrX:30327260G>T	ENST00000378970.4	-	1	455	c.221C>A	c.(220-222)cCa>cAa	p.P74Q	NR0B1_ENST00000378963.1_5'Flank|NR0B1_ENST00000453287.1_Missense_Mutation_p.P74Q	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	74	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GCCCTGCCGTGGGTGGTCTTT	0.677																																					p.P74Q		Atlas-SNP	.											.	NR0B1	61	.	0			c.C221A						.						25.0	21.0	22.0					X																	30327260		2194	4285	6479	SO:0001583	missense	190	exon1			TGCCGTGGGTGGT	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.221C>A	chrX.hg19:g.30327260G>T	ENSP00000368253:p.Pro74Gln	135.0	0.0		76.0	51.0	NM_000475	Q96F69	Missense_Mutation	SNP	ENST00000378970.4	hg19	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169015	0.57584	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.97553	-3.56;-4.43	4.27	3.33	0.38152	.	0.334229	0.28036	N	0.016850	D	0.96291	0.8790	L	0.39397	1.21	0.31003	N	0.720125	D	0.58620	0.983	P	0.61201	0.885	D	0.93643	0.6966	10	0.59425	D	0.04	-3.9043	8.3741	0.32432	0.0:0.236:0.764:0.0	.	74	P51843	NR0B1_HUMAN	Q	74	ENSP00000368253:P74Q;ENSP00000396403:P74Q	ENSP00000368253:P74Q	P	-	2	0	NR0B1	30237181	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	1.805000	0.38883	2.102000	0.63906	0.513000	0.50165	CCA	.	.		0.677	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475	
STAG2	10735	hgsc.bcm.edu	37	X	123196845	123196845	+	Splice_Site	SNP	G	G	C			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chrX:123196845G>C	ENST00000371160.1	+	18	2021		c.e18+1		STAG2_ENST00000371157.3_Splice_Site|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000371145.3_Splice_Site|STAG2_ENST00000218089.9_Splice_Site|STAG2_ENST00000371144.3_Splice_Site|STAG2_ENST00000354548.5_Splice_Site	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2						meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						ATTAGCAAAAGTAAGTTTGTG	0.348																																					.		Atlas-SNP	.											.	STAG2	309	.	0			c.1731+1G>C						.						87.0	78.0	81.0					X																	123196845		2203	4300	6503	SO:0001630	splice_region_variant	10735	exon18			GCAAAAGTAAGTT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1731+1G>C	chrX.hg19:g.123196845G>C		124.0	0.0		162.0	101.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Splice_Site	SNP	ENST00000371160.1	hg19	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677576	0.88445	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9779	0.92745	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAG2	123024526	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.809000	0.99208	2.430000	0.82344	0.544000	0.68410	.	.	.		0.348	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	Intron
SIGLEC15	284266	hgsc.bcm.edu	37	18	43418834	43418836	+	In_Frame_Del	DEL	GGG	GGG	-	rs180893016		TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	GGG	GGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr18:43418834_43418836delGGG	ENST00000389474.3	+	4	865_867	c.648_650delGGG	c.(646-651)gagggt>gat	p.216_217EG>D	SIGLEC15_ENST00000587418.1_5'UTR|SIGLEC15_ENST00000602118.2_3'UTR|SIGLEC15_ENST00000546268.1_In_Frame_Del_p.62_63EG>D	NM_213602.2	NP_998767.1	Q6ZMC9	SIG15_HUMAN	sialic acid binding Ig-like lectin 15	216	Ig-like C2-type.				cellular response to lipoprotein particle stimulus (GO:0071402)|innate immune response (GO:0045087)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of bone resorption (GO:0045124)|regulation of osteoclast development (GO:2001204)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)		p.G217D(1)		endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						GCCCGCGTGAGGGTCACGGCCAC	0.744																																					p.216_217del		Atlas-Indel,Pindel	.											.	SIGLEC15	10	.	1	Substitution - Missense(1)	lung(1)	c.647_649del						.																																			SO:0001651	inframe_deletion	284266	exon4			.	AK095432	CCDS32819.1	18q21.1	2014-01-28	2007-05-31	2007-05-31	ENSG00000197046	ENSG00000197046		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27596	protein-coding gene	gene with protein product			"""CD33 antigen-like 3"", ""CD33 molecule-like 3"""	CD33L3		17483134	Standard	NM_213602		Approved	HsT1361	uc002lbl.1	Q6ZMC9		ENST00000389474.3:c.648_650delGGG	chr18.hg19:g.43418834_43418836delGGG	ENSP00000374125:p.Glu216_Gly217delinsAsp	172.0	0.0		91.0	32.0	NM_213602	A8K2Y5|B4DVQ9	In_Frame_Del	DEL	ENST00000389474.3	hg19	CCDS32819.1																																																																																			.	.		0.744	SIGLEC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410768.2	NM_213602	
SERPINA1	5265	hgsc.bcm.edu	37	14	94848963	94848964	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr14:94848963_94848964delTG	ENST00000448921.1	-	4	1183_1184	c.611_612delCA	c.(610-612)acafs	p.T204fs	SERPINA1_ENST00000393088.4_Frame_Shift_Del_p.T204fs|SERPINA1_ENST00000437397.1_Frame_Shift_Del_p.T204fs|SERPINA1_ENST00000393087.4_Frame_Shift_Del_p.T204fs|SERPINA1_ENST00000402629.1_Frame_Shift_Del_p.T204fs|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000355814.4_Frame_Shift_Del_p.T204fs|SERPINA1_ENST00000440909.1_Frame_Shift_Del_p.T204fs|SERPINA1_ENST00000449399.3_Frame_Shift_Del_p.T204fs|SERPINA1_ENST00000404814.4_Frame_Shift_Del_p.T204fs	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	204					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GAGCAAAAACTGTGTCTCTGTC	0.436																																					p.204_205del		Atlas-Indel,Pindel	.											.,1	SERPINA1	51	.	0			c.612_613del						.																																			SO:0001589	frameshift_variant	5265	exon4			.	X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.611_612delCA	chr14.hg19:g.94848965_94848966delTG	ENSP00000416066:p.Thr204fs	105.0	0.0		123.0	51.0	NM_001127701	A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Frame_Shift_Del	DEL	ENST00000448921.1	hg19	CCDS9925.1																																																																																			.	.		0.436	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317768.2	NM_001002235	
SUV420H1	51111	hgsc.bcm.edu	37	11	67934456	67934457	+	Frame_Shift_Ins	INS	-	-	T			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr11:67934456_67934457insT	ENST00000304363.4	-	10	1519_1520	c.1166_1167insA	c.(1165-1167)aacfs	p.N389fs	SUV420H1_ENST00000405515.1_Frame_Shift_Ins_p.N389fs|SUV420H1_ENST00000402789.1_Frame_Shift_Ins_p.N389fs|SUV420H1_ENST00000402185.2_Frame_Shift_Ins_p.N366fs|SUV420H1_ENST00000401547.2_Frame_Shift_Ins_p.N389fs	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	389					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TACTTGCATTGTTTTTTTCCTG	0.317																																					p.N389fs		Atlas-Indel,Pindel	.											.	SUV420H1	125	.	0			c.1167_1168insA						.																																			SO:0001589	frameshift_variant	51111	exon10			.	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1167dupA	chr11.hg19:g.67934463_67934463dupT	ENSP00000305899:p.Asn389fs	55.0	0.0		74.0	24.0	NM_016028	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Frame_Shift_Ins	INS	ENST00000304363.4	hg19	CCDS31623.1																																																																																			.	.		0.317	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
GRIK2	2898	hgsc.bcm.edu	37	6	102134116	102134116	+	Frame_Shift_Del	DEL	G	G	-			TCGA-2Y-A9HB-01A-11D-A38X-10	TCGA-2Y-A9HB-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bb715136-b745-4c73-a3d5-e7a63b10fba2	53b59194-cc58-4bbf-a05d-c627c7485018	g.chr6:102134116delG	ENST00000421544.1	+	6	1329	c.839delG	c.(838-840)agafs	p.R280fs	GRIK2_ENST00000369137.3_Frame_Shift_Del_p.R280fs|GRIK2_ENST00000369134.4_Frame_Shift_Del_p.R231fs|GRIK2_ENST00000369138.1_Frame_Shift_Del_p.R280fs|GRIK2_ENST00000413795.1_Frame_Shift_Del_p.R280fs|GRIK2_ENST00000358361.3_Frame_Shift_Del_p.R280fs|GRIK2_ENST00000318991.6_Frame_Shift_Del_p.R280fs	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	280					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	ACAGGGTTCAGAATATTAAAT	0.423																																					p.R280fs		Atlas-Indel,Pindel	.											.	GRIK2	487	.	0			c.838delA						.						90.0	88.0	89.0					6																	102134116		2203	4300	6503	SO:0001589	frameshift_variant	2898	exon6			.		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.839delG	chr6.hg19:g.102134116delG	ENSP00000397026:p.Arg280fs	59.0	0.0		136.0	46.0	NM_001166247	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Frame_Shift_Del	DEL	ENST00000421544.1	hg19	CCDS5048.1																																																																																			.	.		0.423	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
