#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MEGF6	1953	hgsc.bcm.edu	37	1	3417558	3417558	+	Silent	SNP	G	G	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:3417558G>C	ENST00000356575.4	-	20	2773	c.2547C>G	c.(2545-2547)ccC>ccG	p.P849P	MEGF6_ENST00000294599.4_Silent_p.P744P	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	849	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CGGTCCACCCGGGGGCACAGC	0.642																																					p.P849P	Ovarian(73;978 3658)	Atlas-SNP	.											.	MEGF6	91	.	0			c.C2547G						.						35.0	44.0	41.0					1																	3417558		2000	4177	6177	SO:0001819	synonymous_variant	1953	exon20			CCACCCGGGGGCA	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.2547C>G	chr1.hg19:g.3417558G>C		152.0	0.0		254.0	112.0	NM_001409	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	hg19	CCDS41237.1																																																																																			.	.		0.642	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
TP73	7161	hgsc.bcm.edu	37	1	3599745	3599745	+	Splice_Site	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:3599745G>A	ENST00000378295.4	+	3	341		c.e3+1		TP73_ENST00000354437.4_Splice_Site|TP73_ENST00000604074.1_Splice_Site|TP73_ENST00000346387.4_Splice_Site|TP73_ENST00000357733.3_Splice_Site|TP73_ENST00000604479.1_Splice_Site|TP73_ENST00000603362.1_Splice_Site	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73						activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		ATCTGTCATGGTGAGTGGGGG	0.592																																					.		Atlas-SNP	.											.	TP73	54	.	0			c.186+1G>A						.						73.0	74.0	74.0					1																	3599745		2203	4300	6503	SO:0001630	splice_region_variant	7161	exon3			GTCATGGTGAGTG	AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.186+1G>A	chr1.hg19:g.3599745G>A		103.0	0.0		162.0	55.0	NM_001204188	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Splice_Site	SNP	ENST00000378295.4	hg19	CCDS49.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967158	0.53507	.	.	ENSG00000078900	ENST00000378295;ENST00000354437;ENST00000357733;ENST00000346387	.	.	.	4.6	4.6	0.57074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7783	0.85557	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TP73	3589605	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	5.479000	0.66813	2.250000	0.74265	0.563000	0.77884	.	.	.		0.592	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001468.4	NM_005427	Intron
WDR47	22911	hgsc.bcm.edu	37	1	109538417	109538417	+	Silent	SNP	G	G	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:109538417G>C	ENST00000369962.3	-	8	1698	c.1476C>G	c.(1474-1476)ggC>ggG	p.G492G	WDR47_ENST00000369965.4_Silent_p.G493G|WDR47_ENST00000357672.3_Silent_p.G464G|WDR47_ENST00000361054.3_Silent_p.G464G|WDR47_ENST00000400794.3_Silent_p.G500G			O94967	WDR47_HUMAN	WD repeat domain 47	492					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		CATTACCAAGGCCATCCATTC	0.343																																					p.G500G		Atlas-SNP	.											.	WDR47	56	.	0			c.C1500G						.						153.0	153.0	153.0					1																	109538417		2203	4296	6499	SO:0001819	synonymous_variant	22911	exon8			ACCAAGGCCATCC	AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.1476C>G	chr1.hg19:g.109538417G>C		154.0	0.0		159.0	42.0	NM_001142550	A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Silent	SNP	ENST00000369962.3	hg19	CCDS44187.1																																																																																			.	.		0.343	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032414.2	NM_014969	
TUFT1	7286	hgsc.bcm.edu	37	1	151546817	151546817	+	Silent	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:151546817G>T	ENST00000368849.3	+	8	728	c.666G>T	c.(664-666)gtG>gtT	p.V222V	TUFT1_ENST00000392712.3_Silent_p.V167V|TUFT1_ENST00000538902.1_Silent_p.V241V|TUFT1_ENST00000368848.2_Silent_p.V197V|TUFT1_ENST00000353024.3_Silent_p.V163V	NM_020127.2	NP_064512.1	Q9NNX1	TUFT1_HUMAN	tuftelin 1	222					bone mineralization (GO:0030282)|odontogenesis (GO:0042476)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	structural constituent of tooth enamel (GO:0030345)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGGACAGAGTGGAGCAGAAAG	0.542											OREG0003906	type=REGULATORY REGION|Gene=TUFT1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.V222V		Atlas-SNP	.											.	TUFT1	32	.	0			c.G666T						.						111.0	101.0	104.0					1																	151546817		2203	4300	6503	SO:0001819	synonymous_variant	7286	exon8			CAGAGTGGAGCAG	AF254260	CCDS1000.1, CCDS44223.1	1q21	2008-02-05			ENSG00000143367	ENSG00000143367			12422	protein-coding gene	gene with protein product		600087				7919663	Standard	NM_020127		Approved		uc001eyl.3	Q9NNX1	OTTHUMG00000012536	ENST00000368849.3:c.666G>T	chr1.hg19:g.151546817G>T		300.0	0.0	1741	384.0	87.0	NM_020127	B2RD57|D3DV21|D3DV22|Q5T384|Q5T385|Q9BU28|Q9H5L1	Silent	SNP	ENST00000368849.3	hg19	CCDS1000.1																																																																																			.	.		0.542	TUFT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035022.1	NM_020127	
IQGAP3	128239	hgsc.bcm.edu	37	1	156520099	156520099	+	Silent	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:156520099G>A	ENST00000361170.2	-	16	1789	c.1779C>T	c.(1777-1779)cgC>cgT	p.R593R		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	593					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCACTCCCTGGCGGATCTCCT	0.552																																					p.R593R		Atlas-SNP	.											.	IQGAP3	146	.	0			c.C1779T						.						82.0	71.0	75.0					1																	156520099		2203	4300	6503	SO:0001819	synonymous_variant	128239	exon16			TCCCTGGCGGATC	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.1779C>T	chr1.hg19:g.156520099G>A		68.0	0.0		95.0	46.0	NM_178229	Q5T3H8	Silent	SNP	ENST00000361170.2	hg19	CCDS1144.1																																																																																			.	.		0.552	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
FCRL1	115350	hgsc.bcm.edu	37	1	157772291	157772291	+	Silent	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:157772291C>T	ENST00000368176.3	-	4	550	c.483G>A	c.(481-483)caG>caA	p.Q161Q	FCRL1_ENST00000358292.3_Silent_p.Q161Q|FCRL1_ENST00000491942.1_Silent_p.Q161Q|FCRL1_ENST00000489998.1_5'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	161	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCAGTGAACGCTGGGTCTTTG	0.498																																					p.Q161Q	GBM(54;482 1003 11223 30131 35730)	Atlas-SNP	.											.	FCRL1	164	.	0			c.G483A						.						115.0	95.0	102.0					1																	157772291		2203	4300	6503	SO:0001819	synonymous_variant	115350	exon4			TGAACGCTGGGTC	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.483G>A	chr1.hg19:g.157772291C>T		133.0	0.0		136.0	29.0	NM_001159397	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Silent	SNP	ENST00000368176.3	hg19	CCDS1170.1																																																																																			.	.		0.498	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
KCNJ10	3766	hgsc.bcm.edu	37	1	160012115	160012115	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:160012115G>A	ENST00000368089.3	-	2	434	c.208C>T	c.(208-210)Ctc>Ttc	p.L70F	KCNJ10_ENST00000509700.1_5'Flank	NM_002241.4	NP_002232.2	P78508	KCJ10_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 10	70					adult walking behavior (GO:0007628)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|membrane hyperpolarization (GO:0060081)|optic nerve development (GO:0021554)|potassium ion homeostasis (GO:0055075)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of resting membrane potential (GO:0060075)|regulation of sensory perception of pain (GO:0051930)|response to blue light (GO:0009637)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)		Yohimbine(DB01392)	GCAGAGAAGAGCAGAAGCTTG	0.572																																					p.L70F	GBM(167;1368 2014 14817 36425 43215)	Atlas-SNP	.											.	KCNJ10	58	.	0			c.C208T						.						176.0	151.0	159.0					1																	160012115		2203	4300	6503	SO:0001583	missense	3766	exon2			AGAAGAGCAGAAG	U52155	CCDS1193.1	1q23.2	2011-07-05			ENSG00000177807	ENSG00000177807		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6256	protein-coding gene	gene with protein product		602208				9367690, 8995301, 16382105	Standard	NM_002241		Approved	Kir4.1, Kir1.2	uc001fuw.2	P78508	OTTHUMG00000024073	ENST00000368089.3:c.208C>T	chr1.hg19:g.160012115G>A	ENSP00000357068:p.Leu70Phe	123.0	0.0		106.0	19.0	NM_002241	A3KME7|Q5VUT9|Q8N4I7|Q92808	Missense_Mutation	SNP	ENST00000368089.3	hg19	CCDS1193.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.519921	0.44866	.	.	ENSG00000177807	ENST00000368089	D	0.94966	-3.57	5.17	4.23	0.50019	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.95079	0.8406	L	0.53671	1.685	0.53005	D	0.999968	D	0.69078	0.997	D	0.76575	0.988	D	0.94360	0.7587	10	0.52906	T	0.07	.	11.9518	0.52959	0.0869:0.0:0.9131:0.0	.	70	P78508	IRK10_HUMAN	F	70	ENSP00000357068:L70F	ENSP00000357068:L70F	L	-	1	0	KCNJ10	158278739	0.940000	0.31905	1.000000	0.80357	0.998000	0.95712	1.401000	0.34589	2.688000	0.91661	0.591000	0.81541	CTC	.	.		0.572	KCNJ10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060629.1	NM_002241	
DUSP27	92235	hgsc.bcm.edu	37	1	167095331	167095331	+	Silent	SNP	C	C	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:167095331C>A	ENST00000361200.2	+	6	1129	c.963C>A	c.(961-963)gcC>gcA	p.A321A	DUSP27_ENST00000271385.5_Silent_p.A321A|DUSP27_ENST00000443333.1_Silent_p.A321A|DUSP27_ENST00000485151.1_3'UTR			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	321					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACGACAGCGCCAGCCACCTGA	0.667																																					p.A321A		Atlas-SNP	.											.	DUSP27	235	.	0			c.C963A						.						23.0	26.0	25.0					1																	167095331		2202	4299	6501	SO:0001819	synonymous_variant	92235	exon5			CAGCGCCAGCCAC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.963C>A	chr1.hg19:g.167095331C>A		69.0	0.0		61.0	25.0	NM_001080426	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	hg19	CCDS30932.1																																																																																			.	.		0.667	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
KISS1	3814	hgsc.bcm.edu	37	1	204159709	204159709	+	Missense_Mutation	SNP	T	T	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:204159709T>G	ENST00000367194.4	-	3	468	c.320A>C	c.(319-321)aAg>aCg	p.K107T		NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	107					cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		CGGCAGGTCCTTCTCCCGCTG	0.736																																					p.K107T		Atlas-SNP	.											.	KISS1	6	.	0			c.A320C						.						7.0	7.0	7.0					1																	204159709		1829	3973	5802	SO:0001583	missense	3814	exon3			AGGTCCTTCTCCC	U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060	ENST00000367194.4:c.320A>C	chr1.hg19:g.204159709T>G	ENSP00000356162:p.Lys107Thr	105.0	0.0		129.0	30.0	NM_002256	A8K6N0|Q9HBP1	Missense_Mutation	SNP	ENST00000367194.4	hg19	CCDS41454.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.246875	0.59103	.	.	ENSG00000170498	ENST00000367194	D	0.84223	-1.82	4.98	3.82	0.43975	.	0.000000	0.50627	D	0.000106	D	0.89986	0.6874	M	0.76002	2.32	0.38582	D	0.950206	D	0.71674	0.998	D	0.71656	0.974	D	0.89618	0.3846	10	0.72032	D	0.01	-18.2005	7.6564	0.28377	0.0:0.0991:0.0:0.9009	.	107	Q15726	KISS1_HUMAN	T	107	ENSP00000356162:K107T	ENSP00000356162:K107T	K	-	2	0	KISS1	202426332	1.000000	0.71417	0.883000	0.34634	0.347000	0.29111	1.272000	0.33109	0.706000	0.31912	0.418000	0.28097	AAG	.	.		0.736	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087892.1	NM_002256	
NBAS	51594	hgsc.bcm.edu	37	2	15651378	15651378	+	Silent	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr2:15651378C>T	ENST00000281513.5	-	10	868	c.843G>A	c.(841-843)ccG>ccA	p.P281P	NBAS_ENST00000441750.1_Silent_p.P281P	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	281					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GCTTATAATACGGTGATCCTG	0.428																																					p.P281P		Atlas-SNP	.											.	NBAS	246	.	0			c.G843A						.						155.0	156.0	156.0					2																	15651378		2203	4300	6503	SO:0001819	synonymous_variant	51594	exon10			ATAATACGGTGAT	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.843G>A	chr2.hg19:g.15651378C>T		258.0	0.0		228.0	62.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	hg19	CCDS1685.1																																																																																			.	.		0.428	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
PUM2	23369	hgsc.bcm.edu	37	2	20490528	20490528	+	Silent	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr2:20490528C>T	ENST00000361078.2	-	9	1198	c.1176G>A	c.(1174-1176)caG>caA	p.Q392Q	PUM2_ENST00000536417.1_Silent_p.Q336Q|PUM2_ENST00000319801.5_Silent_p.Q392Q|PUM2_ENST00000403432.1_Silent_p.Q392Q|PUM2_ENST00000338086.5_Silent_p.Q392Q			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	392	Ala-rich.|Gln-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAGAGGACGCTGACCTGCTC	0.423																																					p.Q392Q		Atlas-SNP	.											.	PUM2	91	.	0			c.G1176A						.						67.0	60.0	63.0					2																	20490528		2203	4300	6503	SO:0001819	synonymous_variant	23369	exon9			AGGACGCTGACCT	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1176G>A	chr2.hg19:g.20490528C>T		209.0	0.0		171.0	43.0	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Silent	SNP	ENST00000361078.2	hg19																																																																																				.	.		0.423	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
VIT	5212	hgsc.bcm.edu	37	2	37041407	37041407	+	Missense_Mutation	SNP	A	A	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr2:37041407A>C	ENST00000389975.3	+	15	2242	c.1940A>C	c.(1939-1941)cAc>cCc	p.H647P	VIT_ENST00000379241.3_Missense_Mutation_p.H625P|VIT_ENST00000379242.3_Missense_Mutation_p.H662P|VIT_ENST00000401530.1_Missense_Mutation_p.H626P|VIT_ENST00000404084.1_Missense_Mutation_p.H599P|VIT_ENST00000497382.1_Missense_Mutation_p.H316P	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	647	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				GCCAGAGACCACTCCTTCTTT	0.517																																					p.H662P		Atlas-SNP	.											.	VIT	138	.	0			c.A1985C						.						133.0	110.0	118.0					2																	37041407		2203	4300	6503	SO:0001583	missense	5212	exon16			GAGACCACTCCTT	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.1940A>C	chr2.hg19:g.37041407A>C	ENSP00000374625:p.His647Pro	110.0	0.0		88.0	21.0	NM_053276	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	ENST00000389975.3	hg19	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.745451	0.89663	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000497382;ENST00000404084;ENST00000379241;ENST00000401530	D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	5.52	5.52	0.82312	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.94866	0.8341	H	0.95917	3.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.96277	0.9203	10	0.66056	D	0.02	-19.8221	15.6637	0.77209	1.0:0.0:0.0:0.0	.	626;625;647;662	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4	.;.;VITRN_HUMAN;.	P	662;647;316;599;625;626	ENSP00000368544:H662P;ENSP00000374625:H647P;ENSP00000417874:H316P;ENSP00000384154:H599P;ENSP00000368543:H625P;ENSP00000385658:H626P	ENSP00000368543:H625P	H	+	2	0	VIT	36894911	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	9.300000	0.96151	2.095000	0.63458	0.533000	0.62120	CAC	.	.		0.517	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
SLC25A12	8604	hgsc.bcm.edu	37	2	172650192	172650192	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr2:172650192G>T	ENST00000422440.2	-	14	1428	c.1391C>A	c.(1390-1392)cCc>cAc	p.P464H	SLC25A12_ENST00000392592.4_Missense_Mutation_p.P357H	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	464					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	GCTGACTCTGGGTCCCGTGGT	0.468																																					p.P464H		Atlas-SNP	.											.	SLC25A12	59	.	0			c.C1391A						.						82.0	83.0	83.0					2																	172650192		2203	4300	6503	SO:0001583	missense	8604	exon14			ACTCTGGGTCCCG	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1391C>A	chr2.hg19:g.172650192G>T	ENSP00000388658:p.Pro464His	127.0	0.0		118.0	23.0	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	hg19	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.835266	0.91117	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	T;T	0.79454	-1.27;-1.27	5.31	5.31	0.75309	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.87958	0.6309	M	0.77313	2.365	0.80722	D	1	D;P	0.60160	0.987;0.953	D;P	0.64687	0.928;0.895	D	0.89181	0.3544	10	0.72032	D	0.01	-10.381	18.9718	0.92718	0.0:0.0:1.0:0.0	.	357;464	B3KR64;O75746	.;CMC1_HUMAN	H	464;357	ENSP00000388658:P464H;ENSP00000376371:P357H	ENSP00000376371:P357H	P	-	2	0	SLC25A12	172358438	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.835000	0.99442	2.480000	0.83734	0.655000	0.94253	CCC	.	.		0.468	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
WHSC1	7468	hgsc.bcm.edu	37	4	1961231	1961231	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr4:1961231A>G	ENST00000382895.3	+	19	3450	c.3019A>G	c.(3019-3021)Aca>Gca	p.T1007A	WHSC1_ENST00000382888.3_Missense_Mutation_p.T355A|WHSC1_ENST00000382892.2_Missense_Mutation_p.T1007A|WHSC1_ENST00000382891.5_Missense_Mutation_p.T1007A|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000508803.1_Missense_Mutation_p.T1007A	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	1007					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CCAGATCTACACAGCGGATAT	0.488			T	IGH@	MM																																p.T1007A		Atlas-SNP	.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1	180	.	0			c.A3019G						.						65.0	57.0	60.0					4																	1961231		2203	4300	6503	SO:0001583	missense	7468	exon17			ATCTACACAGCGG	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.3019A>G	chr4.hg19:g.1961231A>G	ENSP00000372351:p.Thr1007Ala	195.0	0.0		143.0	62.0	NM_133335	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	hg19	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.750564	0.49257	.	.	ENSG00000109685	ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D;D;D;D;D	0.97138	-3.67;-3.67;-3.67;-3.67;-4.26	5.45	5.45	0.79879	.	0.000000	0.56097	D	0.000039	D	0.93334	0.7875	N	0.21508	0.67	0.80722	D	1	B;B	0.13594	0.0;0.008	B;B	0.14023	0.001;0.01	D	0.90252	0.4294	10	0.27082	T	0.32	.	15.806	0.78513	1.0:0.0:0.0:0.0	.	355;1007	A2A2T2;O96028	.;NSD2_HUMAN	A	1007;1007;1007;1007;355	ENSP00000423972:T1007A;ENSP00000372347:T1007A;ENSP00000372348:T1007A;ENSP00000372351:T1007A;ENSP00000372344:T355A	ENSP00000372344:T355A	T	+	1	0	WHSC1	1931029	1.000000	0.71417	0.519000	0.27824	0.952000	0.60782	6.136000	0.71703	2.196000	0.70406	0.533000	0.62120	ACA	.	.		0.488	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
TLR6	10333	hgsc.bcm.edu	37	4	38829121	38829121	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr4:38829121A>T	ENST00000381950.1	-	1	2039	c.1974T>A	c.(1972-1974)agT>agA	p.S658R	TLR6_ENST00000436693.2_Missense_Mutation_p.S658R			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	658	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GTACCAATTCACTTTTCACCC	0.403																																					p.S658R		Atlas-SNP	.											.	TLR6	67	.	0			c.T1974A						.						94.0	99.0	98.0					4																	38829121		2203	4300	6503	SO:0001583	missense	10333	exon2			CAATTCACTTTTC		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.1974T>A	chr4.hg19:g.38829121A>T	ENSP00000371376:p.Ser658Arg	137.0	0.0		87.0	43.0	NM_006068	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	ENST00000381950.1	hg19	CCDS3446.1	.	.	.	.	.	.	.	.	.	.	A	9.177	1.022504	0.19433	.	.	ENSG00000174130	ENST00000436693;ENST00000381950	T;T	0.02498	4.27;4.27	4.55	1.93	0.25924	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.393883	0.25419	N	0.030804	T	0.01523	0.0049	N	0.02765	-0.5	0.09310	N	1	B	0.13594	0.008	B	0.16722	0.016	T	0.46303	-0.9201	10	0.87932	D	0	.	8.8328	0.35093	0.7667:0.0:0.2333:0.0	.	658	Q9Y2C9	TLR6_HUMAN	R	658	ENSP00000389600:S658R;ENSP00000371376:S658R	ENSP00000371376:S658R	S	-	3	2	TLR6	38505516	0.000000	0.05858	0.984000	0.44739	0.665000	0.39181	0.174000	0.16743	0.734000	0.32515	0.459000	0.35465	AGT	.	.		0.403	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1		
PCDHA12	56137	hgsc.bcm.edu	37	5	140255592	140255592	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr5:140255592G>T	ENST00000398631.2	+	1	535	c.535G>T	c.(535-537)Gag>Tag	p.E179*	PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGAATTTTGAGCTTAAAAT	0.378																																					p.E179X	Pancreas(113;759 1672 13322 24104 50104)	Atlas-SNP	.											.	PCDHA12	196	.	0			c.G535T						.						47.0	51.0	50.0					5																	140255592		1959	4186	6145	SO:0001587	stop_gained	56137	exon1			AATTTTGAGCTTA	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.535G>T	chr5.hg19:g.140255592G>T	ENSP00000381628:p.Glu179*	185.0	0.0		101.0	37.0	NM_018903	O75278|Q2M1N8	Nonsense_Mutation	SNP	ENST00000398631.2	hg19	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	G	9.172	1.021408	0.19433	.	.	ENSG00000251664	ENST00000398631	.	.	.	5.07	-4.33	0.03677	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	4.8766	0.13658	0.4124:0.0:0.1962:0.3914	.	.	.	.	X	179	.	ENSP00000381628:E179X	E	+	1	0	PCDHA12	140235776	0.000000	0.05858	0.000000	0.03702	0.045000	0.14185	-2.792000	0.00766	-0.442000	0.07190	0.591000	0.81541	GAG	.	.		0.378	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
FOXC1	2296	hgsc.bcm.edu	37	6	1612016	1612016	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr6:1612016C>G	ENST00000380874.2	+	1	1336	c.1336C>G	c.(1336-1338)Cac>Gac	p.H446D		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	446					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		GTCCCTGAGTCAcggcggcgg	0.781																																					p.H446D	Pancreas(133;719 1821 3197 26645 35015)	Atlas-SNP	.											.	FOXC1	19	.	0			c.C1336G						.						1.0	1.0	1.0					6																	1612016		321	808	1129	SO:0001583	missense	2296	exon1			CTGAGTCACGGCG	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.1336C>G	chr6.hg19:g.1612016C>G	ENSP00000370256:p.His446Asp	157.0	0.0		120.0	5.0	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	ENST00000380874.2	hg19	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	C	4.868	0.161390	0.09287	.	.	ENSG00000054598	ENST00000380874	T	0.36878	1.23	2.69	2.69	0.31865	.	2.064780	0.03070	U	0.157019	T	0.15825	0.0381	L	0.34521	1.04	0.45791	D	0.998674	B	0.15930	0.015	B	0.06405	0.002	T	0.09907	-1.0653	10	0.27082	T	0.32	.	12.2364	0.54518	0.0:1.0:0.0:0.0	.	446	Q12948	FOXC1_HUMAN	D	446	ENSP00000370256:H446D	ENSP00000370256:H446D	H	+	1	0	FOXC1	1557015	0.998000	0.40836	0.998000	0.56505	0.852000	0.48524	3.555000	0.53727	1.380000	0.46344	0.281000	0.19383	CAC	.	.		0.781	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
ZBED9	114821	hgsc.bcm.edu	37	6	28539781	28539781	+	Missense_Mutation	SNP	T	T	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr6:28539781T>G	ENST00000452236.2	-	4	4502	c.3885A>C	c.(3883-3885)ttA>ttC	p.L1295F		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						aatgtatatttaaactgtttc	0.343																																					p.L1295F		Atlas-SNP	.											.	SCAND3	156	.	0			c.A3885C						.						84.0	83.0	83.0					6																	28539781		2203	4300	6503	SO:0001583	missense	114821	exon4			TATATTTAAACTG																												ENST00000452236.2:c.3885A>C	chr6.hg19:g.28539781T>G	ENSP00000395259:p.Leu1295Phe	211.0	0.0		230.0	52.0	NM_052923		Missense_Mutation	SNP	ENST00000452236.2	hg19	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	T	14.70	2.612241	0.46631	.	.	ENSG00000232040	ENST00000452236	T	0.45668	0.89	2.63	1.44	0.22558	HAT dimerisation (1);Ribonuclease H-like (1);	0.000000	0.44688	U	0.000426	T	0.47021	0.1423	M	0.84433	2.695	0.25078	N	0.990944	D	0.69078	0.997	D	0.83275	0.996	T	0.30765	-0.9967	10	0.62326	D	0.03	.	4.5595	0.12152	0.0:0.1559:0.0:0.8441	.	1295	Q6R2W3	SCND3_HUMAN	F	1295	ENSP00000395259:L1295F	ENSP00000395259:L1295F	L	-	3	2	SCAND3	28647760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.773000	0.26661	0.415000	0.25817	0.533000	0.62120	TTA	.	.		0.343	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
GUCA1A	2978	hgsc.bcm.edu	37	6	42146134	42146134	+	Silent	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr6:42146134C>T	ENST00000394237.1	+	4	1294	c.318C>T	c.(316-318)tgC>tgT	p.C106C	GUCA1A_ENST00000053469.4_Silent_p.C106C|GUCA1A_ENST00000372958.1_Silent_p.C106C|GUCA1A_ENST00000541991.1_Silent_p.C106C			P43080	GUC1A_HUMAN	guanylate cyclase activator 1A (retina)	106	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;5.54e-05)|Epithelial(12;0.000167)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCAACGGCTGCATTGACCGCG	0.622																																					p.C106C		Atlas-SNP	.											.	GUCA1A	18	.	0			c.C318T						.						120.0	111.0	114.0					6																	42146134		2203	4300	6503	SO:0001819	synonymous_variant	2978	exon4			CGGCTGCATTGAC		CCDS4864.1	6p21.1	2013-06-06			ENSG00000048545	ENSG00000048545		"""EF-hand domain containing"""	4678	protein-coding gene	gene with protein product	"""cone dystrophy 3"""	600364	"""chromosome 6 open reading frame 131"""	GUCA, GUCA1, C6orf131		9425234	Standard	NM_000409		Approved	GCAP, GCAP1, COD3, dJ139D8.6, CORD14	uc003orx.3	P43080	OTTHUMG00000014696	ENST00000394237.1:c.318C>T	chr6.hg19:g.42146134C>T		79.0	0.0		57.0	15.0	NM_000409	B3KWT4|Q7Z6T1|Q9NU14	Silent	SNP	ENST00000394237.1	hg19	CCDS4864.1																																																																																			.	.		0.622	GUCA1A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316582.1		
CAPN11	11131	hgsc.bcm.edu	37	6	44148397	44148397	+	Nonsense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr6:44148397G>T	ENST00000398776.1	+	16	1782	c.1744G>T	c.(1744-1746)Gag>Tag	p.E582*	CAPN11_ENST00000542245.1_Nonsense_Mutation_p.E582*	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	582	Domain IV.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGTGGCAGGAGAGGTGAGCAG	0.597																																					p.E582X		Atlas-SNP	.											.	CAPN11	66	.	0			c.G1744T						.						34.0	38.0	36.0					6																	44148397		1910	4124	6034	SO:0001587	stop_gained	11131	exon16			GCAGGAGAGGTGA	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1744G>T	chr6.hg19:g.44148397G>T	ENSP00000381758:p.Glu582*	111.0	0.0		126.0	28.0	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Nonsense_Mutation	SNP	ENST00000398776.1	hg19	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	g	38	7.091783	0.98059	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	.	.	.	4.54	-0.771	0.11002	.	1.288740	0.05432	N	0.546089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	8.0704	0.30687	0.1513:0.4039:0.4448:0.0	.	.	.	.	X	582	.	ENSP00000381758:E582X	E	+	1	0	CAPN11	44256375	0.870000	0.30015	0.787000	0.31911	0.861000	0.49209	0.640000	0.24705	-0.249000	0.09569	0.493000	0.49557	GAG	.	.		0.597	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
PHF3	23469	hgsc.bcm.edu	37	6	64408443	64408443	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr6:64408443A>G	ENST00000262043.3	+	8	3270	c.2930A>G	c.(2929-2931)tAt>tGt	p.Y977C	PHF3_ENST00000393387.1_Missense_Mutation_p.Y977C			Q92576	PHF3_HUMAN	PHD finger protein 3	977	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GATGCTAAATATAAGAACAAA	0.328																																					p.Y977C	GBM(135;136 1820 29512 34071 46235)	Atlas-SNP	.											.	PHF3	191	.	0			c.A2930G						.						38.0	45.0	43.0					6																	64408443		2198	4291	6489	SO:0001583	missense	23469	exon7			CTAAATATAAGAA	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.2930A>G	chr6.hg19:g.64408443A>G	ENSP00000262043:p.Tyr977Cys	497.0	0.0		479.0	119.0	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	hg19	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	A	16.50	3.140395	0.56936	.	.	ENSG00000118482	ENST00000506783;ENST00000515594;ENST00000262043;ENST00000393387	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.49	5.49	0.81192	Transcription elongation factor S-IIM (1);Transcription elongation factor S-II, central domain (4);	0.000000	0.36002	N	0.002859	D	0.82435	0.5036	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87750	0.2591	10	0.87932	D	0	-15.7394	15.8791	0.79189	1.0:0.0:0.0:0.0	.	977	Q92576	PHF3_HUMAN	C	791;246;977;977	ENSP00000424694:Y791C;ENSP00000425338:Y246C;ENSP00000262043:Y977C;ENSP00000377048:Y977C	ENSP00000262043:Y977C	Y	+	2	0	PHF3	64466402	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.229000	0.95273	2.213000	0.71641	0.397000	0.26171	TAT	.	.		0.328	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
DAGLB	221955	hgsc.bcm.edu	37	7	6474641	6474641	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr7:6474641T>C	ENST00000297056.6	-	4	599	c.430A>G	c.(430-432)Atc>Gtc	p.I144V	DAGLB_ENST00000421761.2_Intron|DAGLB_ENST00000428902.2_Missense_Mutation_p.I17V|DAGLB_ENST00000425398.2_Intron|DAGLB_ENST00000479922.2_5'Flank|DAGLB_ENST00000436575.1_Missense_Mutation_p.I103V	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	144					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GTGGCAGCGATGATGATCCAA	0.562																																					p.I144V		Atlas-SNP	.											.	DAGLB	74	.	0			c.A430G						.						64.0	66.0	65.0					7																	6474641		2203	4300	6503	SO:0001583	missense	221955	exon4			CAGCGATGATGAT	AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.430A>G	chr7.hg19:g.6474641T>C	ENSP00000297056:p.Ile144Val	119.0	0.0		110.0	26.0	NM_139179	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	hg19	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	T	12.16	1.856023	0.32791	.	.	ENSG00000164535	ENST00000297056;ENST00000436575;ENST00000471132;ENST00000428902	T;T	0.47177	0.88;0.85	5.34	5.34	0.76211	.	0.139516	0.51477	N	0.000099	T	0.45597	0.1350	M	0.64170	1.965	0.80722	D	1	P	0.35612	0.512	B	0.32677	0.15	T	0.43048	-0.9415	10	0.33940	T	0.23	-10.0322	15.3197	0.74112	0.0:0.0:0.0:1.0	.	144	Q8NCG7	DGLB_HUMAN	V	144;103;144;17	ENSP00000297056:I144V;ENSP00000404785:I103V	ENSP00000297056:I144V	I	-	1	0	DAGLB	6441166	1.000000	0.71417	0.988000	0.46212	0.570000	0.35934	5.836000	0.69375	2.008000	0.58898	0.472000	0.43445	ATC	.	.		0.562	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
HOXA10	3206	hgsc.bcm.edu	37	7	27211712	27211712	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr7:27211712G>T	ENST00000283921.4	-	2	1038	c.1039C>A	c.(1039-1041)Cag>Aag	p.Q347K	MIR196B_ENST00000384852.1_RNA|HOXA10_ENST00000396344.4_Missense_Mutation_p.Q31K|HOXA-AS4_ENST00000523790.1_RNA|HOXA-AS4_ENST00000519694.1_RNA|RP1-170O19.20_ENST00000470747.4_Intron|HOXA-AS4_ENST00000519935.1_RNA|RP1-170O19.20_ENST00000465941.1_Intron|HOXA9_ENST00000497089.1_5'Flank|HOXA10_ENST00000521421.1_5'UTR	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10	347					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						TCCAGTGTCTGGTGCTTCGTG	0.527																																					p.Q347K		Atlas-SNP	.											.	HOXA10	55	.	0			c.C1039A						.						103.0	98.0	99.0					7																	27211712		2203	4300	6503	SO:0001583	missense	3206	exon2			GTGTCTGGTGCTT		CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.1039C>A	chr7.hg19:g.27211712G>T	ENSP00000283921:p.Gln347Lys	165.0	0.0		129.0	39.0	NM_018951	O43370|O43605|Q15949|Q504T1	Missense_Mutation	SNP	ENST00000283921.4	hg19	CCDS5410.2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937710	0.73557	.	.	ENSG00000253293	ENST00000283921;ENST00000396344	D;D	0.97941	-4.62;-4.62	5.7	5.7	0.88788	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.99306	0.9757	H	0.97635	4.045	0.58432	D	0.999992	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	D	0.98683	1.0693	10	0.87932	D	0	.	19.8362	0.96658	0.0:0.0:1.0:0.0	.	347;31	P31260;Q504T1	HXA10_HUMAN;.	K	347;31	ENSP00000283921:Q347K;ENSP00000379633:Q31K	ENSP00000283921:Q347K	Q	-	1	0	HOXA10	27178237	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.984000	0.88150	2.690000	0.91761	0.563000	0.77884	CAG	.	.		0.527	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2		
ASB10	136371	hgsc.bcm.edu	37	7	150883974	150883974	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr7:150883974C>G	ENST00000420175.2	-	1	268	c.244G>C	c.(244-246)Gct>Cct	p.A82P	ASB10_ENST00000377867.3_Intron|ASB10_ENST00000434669.1_Missense_Mutation_p.A127P|ASB10_ENST00000422024.1_Missense_Mutation_p.A127P|ASB10_ENST00000275838.1_Missense_Mutation_p.A82P			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	82					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAATCAGGAGCCAGGCCAGTA	0.642																																					p.A82P		Atlas-SNP	.											.	ASB10	99	.	0			c.G244C						.						45.0	48.0	47.0					7																	150883974		2203	4300	6503	SO:0001583	missense	136371	exon1			CAGGAGCCAGGCC	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.244G>C	chr7.hg19:g.150883974C>G	ENSP00000391137:p.Ala82Pro	118.0	0.0		111.0	30.0	NM_001142459	A0AVH0|Q6ZUL6	Missense_Mutation	SNP	ENST00000420175.2	hg19	CCDS47750.2	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744342	0.30865	.	.	ENSG00000146926	ENST00000275838;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	4.37	3.47	0.39725	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.29389	0.0732	N	0.05230	-0.09	0.22112	N	0.999356	B;B	0.16166	0.016;0.011	B;B	0.18561	0.015;0.022	T	0.09122	-1.0689	9	0.30854	T	0.27	-4.4497	8.1794	0.31302	0.0:0.7484:0.1608:0.0908	.	82;127	Q8WXI3;D5MNW9	ASB10_HUMAN;.	P	82;127;127;82	ENSP00000275838:A82P;ENSP00000401369:A127P;ENSP00000398247:A127P;ENSP00000391137:A82P	ENSP00000275838:A82P	A	-	1	0	ASB10	150514907	0.924000	0.31332	0.999000	0.59377	0.940000	0.58332	0.734000	0.26101	2.143000	0.66587	0.491000	0.48974	GCT	.	.		0.642	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871	
CDH17	1015	hgsc.bcm.edu	37	8	95161092	95161092	+	Missense_Mutation	SNP	T	T	A	rs558415835		TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr8:95161092T>A	ENST00000027335.3	-	14	1931	c.1807A>T	c.(1807-1809)Agg>Tgg	p.R603W	CDH17_ENST00000450165.2_Missense_Mutation_p.R603W|CDH17_ENST00000441892.2_Missense_Mutation_p.R389W	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	603	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			GTGTCTCCCCTCAGTGAATAG	0.428																																					p.R603W		Atlas-SNP	.											.	CDH17	119	.	0			c.A1807T						.						107.0	91.0	96.0					8																	95161092		2203	4300	6503	SO:0001583	missense	1015	exon14			CTCCCCTCAGTGA	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1807A>T	chr8.hg19:g.95161092T>A	ENSP00000027335:p.Arg603Trp	73.0	0.0		68.0	14.0	NM_004063	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	hg19	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	T	18.73	3.687113	0.68157	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.52057	0.68;0.68;0.68	5.91	3.59	0.41128	Cadherin (4);Cadherin-like (1);	0.863480	0.10335	N	0.687002	T	0.56499	0.1989	L	0.39898	1.24	0.25742	N	0.985142	D;D	0.69078	0.997;0.996	D;D	0.73380	0.98;0.928	T	0.41052	-0.9530	10	0.72032	D	0.01	-2.0689	6.6607	0.23012	0.0:0.1787:0.0:0.8213	.	389;603	E7EN24;Q12864	.;CAD17_HUMAN	W	603;389;603	ENSP00000027335:R603W;ENSP00000392811:R389W;ENSP00000401468:R603W	ENSP00000027335:R603W	R	-	1	2	CDH17	95230268	0.758000	0.28405	0.708000	0.30435	0.131000	0.20780	0.855000	0.27805	1.076000	0.40961	0.379000	0.24179	AGG	.	.		0.428	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
SNX31	169166	hgsc.bcm.edu	37	8	101624286	101624286	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr8:101624286G>A	ENST00000311812.2	-	7	703	c.553C>T	c.(553-555)Cct>Tct	p.P185S	SNX31_ENST00000428383.2_Missense_Mutation_p.P86S	NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	185					protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)	p.P185S(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			CTAACATAAGGGAGTTCAAAG	0.418																																					p.P185S		Atlas-SNP	.											SNX31,extremity,malignant_melanoma,0,2	SNX31	66	.	1	Substitution - Missense(1)	skin(1)	c.C553T						.						87.0	88.0	88.0					8																	101624286		2203	4300	6503	SO:0001583	missense	169166	exon7			CATAAGGGAGTTC		CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.553C>T	chr8.hg19:g.101624286G>A	ENSP00000312368:p.Pro185Ser	130.0	1.0		121.0	13.0	NM_152628	C9J6L9|Q8N0U9	Missense_Mutation	SNP	ENST00000311812.2	hg19	CCDS6288.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002348	0.74932	.	.	ENSG00000174226	ENST00000311812;ENST00000428383;ENST00000520352	T;T;T	0.76060	1.91;1.41;-0.99	5.92	5.04	0.67666	.	0.095774	0.44483	D	0.000444	D	0.87220	0.6123	M	0.86953	2.85	0.51012	D	0.999904	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.89208	0.3562	10	0.87932	D	0	-2.5239	13.1125	0.59281	0.0:0.1604:0.8396:0.0	.	86;185	Q8N9S9-2;Q8N9S9	.;SNX31_HUMAN	S	185;86;119	ENSP00000312368:P185S;ENSP00000405024:P86S;ENSP00000428210:P119S	ENSP00000312368:P185S	P	-	1	0	SNX31	101693462	1.000000	0.71417	0.995000	0.50966	0.884000	0.51177	4.973000	0.63763	1.500000	0.48636	0.650000	0.86243	CCT	.	.		0.418	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379910.1	NM_152628	
TRPM6	140803	hgsc.bcm.edu	37	9	77401029	77401029	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr9:77401029C>T	ENST00000360774.1	-	21	2917	c.2680G>A	c.(2680-2682)Gaa>Aaa	p.E894K	TRPM6_ENST00000361255.3_Missense_Mutation_p.E889K|TRPM6_ENST00000449912.2_Missense_Mutation_p.E889K|TRPM6_ENST00000451710.3_Missense_Mutation_p.E894K|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.E894K|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	894					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TTCCCAGGTTCTGAAATACAG	0.393																																					p.E894K		Atlas-SNP	.											.	TRPM6	377	.	0			c.G2680A						.						90.0	90.0	90.0					9																	77401029		2203	4300	6503	SO:0001583	missense	140803	exon21			CAGGTTCTGAAAT	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.2680G>A	chr9.hg19:g.77401029C>T	ENSP00000354006:p.Glu894Lys	201.0	0.0		158.0	44.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	hg19	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	19.01	3.744081	0.69418	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.14	5.14	0.70334	Ion transport (1);	0.090386	0.85682	D	0.000000	D	0.83238	0.5211	M	0.89904	3.07	0.80722	D	1	D;P;D	0.76494	0.966;0.836;0.999	P;P;D	0.74023	0.89;0.794;0.982	D	0.86666	0.1907	10	0.87932	D	0	.	18.7871	0.91960	0.0:1.0:0.0:0.0	.	557;894;889	F5H7D1;Q9BX84;Q9BX84-3	.;TRPM6_HUMAN;.	K	894;894;889;889;894;557;557	ENSP00000354006:E894K;ENSP00000407341:E894K;ENSP00000396672:E889K;ENSP00000354962:E889K;ENSP00000366060:E894K	ENSP00000309693:E557K	E	-	1	0	TRPM6	76590849	1.000000	0.71417	1.000000	0.80357	0.056000	0.15407	7.602000	0.82796	2.669000	0.90835	0.549000	0.68633	GAA	.	.		0.393	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
TRPM6	140803	hgsc.bcm.edu	37	9	77427340	77427340	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr9:77427340G>T	ENST00000360774.1	-	12	1555	c.1318C>A	c.(1318-1320)Ctg>Atg	p.L440M	TRPM6_ENST00000361255.3_Missense_Mutation_p.L435M|TRPM6_ENST00000449912.2_Missense_Mutation_p.L435M|TRPM6_ENST00000451710.3_Missense_Mutation_p.L440M|TRPM6_ENST00000376871.3_Missense_Mutation_p.L440M|TRPM6_ENST00000376864.4_Missense_Mutation_p.L440M|TRPM6_ENST00000376872.3_Missense_Mutation_p.L440M	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	440					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GCTTGTTCCAGGGCATCAGGC	0.353																																					p.L440M		Atlas-SNP	.											.	TRPM6	377	.	0			c.C1318A						.						77.0	72.0	74.0					9																	77427340		2203	4300	6503	SO:0001583	missense	140803	exon12			GTTCCAGGGCATC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.1318C>A	chr9.hg19:g.77427340G>T	ENSP00000354006:p.Leu440Met	93.0	0.0		99.0	4.0	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	hg19	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727154	0.48833	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22;0.22;0.22	5.7	3.63	0.41609	.	0.000000	0.85682	D	0.000000	T	0.77246	0.4102	M	0.93375	3.41	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	T	0.77960	-0.2391	10	0.87932	D	0	.	4.2243	0.10574	0.4623:0.0:0.5377:0.0	.	440;440;440;435	Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3	.;.;TRPM6_HUMAN;.	M	440;440;440;440;435;435;440;103;103	ENSP00000354006:L440M;ENSP00000407341:L440M;ENSP00000366068:L440M;ENSP00000366067:L440M;ENSP00000396672:L435M;ENSP00000354962:L435M;ENSP00000366060:L440M	ENSP00000309693:L103M	L	-	1	2	TRPM6	76617160	0.893000	0.30496	0.825000	0.32803	0.459000	0.32528	1.730000	0.38125	1.405000	0.46838	0.650000	0.86243	CTG	.	.		0.353	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
ST6GALNAC6	30815	hgsc.bcm.edu	37	9	130649801	130649801	+	Silent	SNP	G	G	A	rs145170753		TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr9:130649801G>A	ENST00000373146.1	-	6	953	c.774C>T	c.(772-774)caC>caT	p.H258H	ST6GALNAC6_ENST00000373141.1_Silent_p.H224H|RP11-203J24.9_ENST00000476274.2_RNA|ST6GALNAC6_ENST00000291839.5_Silent_p.H258H|ST6GALNAC6_ENST00000542456.1_Silent_p.H58H|ST6GALNAC6_ENST00000485320.1_5'UTR|ST6GALNAC6_ENST00000373142.1_Silent_p.H258H|ST6GALNAC6_ENST00000373144.3_Silent_p.H224H			Q969X2	SIA7F_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6	258					cell-cell recognition (GO:0009988)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AGACATGCACGTGGTCACACA	0.612																																					p.H258H		Atlas-SNP	.											.	ST6GALNAC6	36	.	0			c.C774T						.	G		1,4405	2.1+/-5.4	0,1,2202	167.0	96.0	120.0		774	-6.5	0.9	9	dbSNP_134	120	0,8600		0,0,4300	no	coding-synonymous	ST6GALNAC6	NM_013443.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		258/334	130649801	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	30815	exon6			ATGCACGTGGTCA	BC006564	CCDS6882.1, CCDS69668.1, CCDS69669.1, CCDS75908.1	9q34.13	2013-03-01		2005-02-07	ENSG00000160408	ENSG00000160408		"""Sialyltransferases"""	23364	protein-coding gene	gene with protein product		610135	"""sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F"""	SIAT7F		12668675	Standard	XM_005251952		Approved	ST6GALNACVI	uc004bso.1	Q969X2	OTTHUMG00000020718	ENST00000373146.1:c.774C>T	chr9.hg19:g.130649801G>A		120.0	0.0		147.0	15.0	NM_013443	B3KQ01|Q5T9C4|Q5T9C5|Q9H8A2|Q9ULB8	Silent	SNP	ENST00000373146.1	hg19	CCDS6882.1																																																																																			.	G|1.000;A|0.000		0.612	ST6GALNAC6-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054278.1	NM_013443	
OR2D2	120776	hgsc.bcm.edu	37	11	6913415	6913415	+	Missense_Mutation	SNP	A	A	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr11:6913415A>T	ENST00000299459.2	-	1	415	c.317T>A	c.(316-318)aTt>aAt	p.I106N		NM_003700.1	NP_003691.1	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D, member 2	106					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	18		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ACACCCAAAAATGAGGAAAAA	0.468																																					p.I106N		Atlas-SNP	.											.	OR2D2	52	.	0			c.T317A						.						115.0	94.0	101.0					11																	6913415		2201	4296	6497	SO:0001583	missense	120776	exon1			CCAAAAATGAGGA	AB065824	CCDS31416.1	11p15.4	2012-08-09			ENSG00000166368	ENSG00000166368		"""GPCR / Class A : Olfactory receptors"""	8244	protein-coding gene	gene with protein product		608494		OR2D1		9787077	Standard	NM_003700		Approved	OR11-610, hg27	uc010rau.2	Q9H210	OTTHUMG00000165741	ENST00000299459.2:c.317T>A	chr11.hg19:g.6913415A>T	ENSP00000299459:p.Ile106Asn	281.0	0.0		152.0	34.0	NM_003700	B9EIL5|O95224|Q6IF28|Q8NGH4|Q96R52	Missense_Mutation	SNP	ENST00000299459.2	hg19	CCDS31416.1	.	.	.	.	.	.	.	.	.	.	a	8.937	0.964800	0.18583	.	.	ENSG00000166368	ENST00000299459	T	0.01323	5.01	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.134994	0.33515	N	0.004822	T	0.01976	0.0062	L	0.46614	1.455	0.09310	N	1	P	0.43885	0.82	B	0.42555	0.391	T	0.50996	-0.8761	10	0.37606	T	0.19	-21.1989	7.9016	0.29738	0.9104:0.0:0.0896:0.0	.	106	Q9H210	OR2D2_HUMAN	N	106	ENSP00000299459:I106N	ENSP00000299459:I106N	I	-	2	0	OR2D2	6869991	0.112000	0.22096	0.007000	0.13788	0.433000	0.31745	3.913000	0.56394	2.337000	0.79520	0.524000	0.50904	ATT	.	.		0.468	OR2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385986.1	NM_003700	
EEF1G	1937	hgsc.bcm.edu	37	11	62327913	62327913	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr11:62327913C>T	ENST00000329251.4	-	8	1001	c.871G>A	c.(871-873)Gat>Aat	p.D291N	EEF1G_ENST00000378019.3_Missense_Mutation_p.D341N|MIR3654_ENST00000496634.2_3'UTR	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	291	EF-1-gamma C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00519}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TTAAATTCATCCAACACAAAG	0.458																																					p.D291N		Atlas-SNP	.											.	EEF1G	33	.	0			c.G871A						.						32.0	29.0	30.0					11																	62327913		1917	4120	6037	SO:0001583	missense	1937	exon8			ATTCATCCAACAC	X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.871G>A	chr11.hg19:g.62327913C>T	ENSP00000331901:p.Asp291Asn	118.0	0.0		66.0	16.0	NM_001404	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Missense_Mutation	SNP	ENST00000329251.4	hg19	CCDS44626.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903395	0.72754	.	.	ENSG00000254772	ENST00000329251;ENST00000378019;ENST00000424909	T;T	0.35973	1.37;1.28	4.7	4.7	0.59300	Translation elongation factor EF1B, gamma chain, conserved (4);	0.000000	0.85682	D	0.000000	T	0.59542	0.2201	M	0.89658	3.05	0.80722	D	1	B;B;B	0.25904	0.105;0.137;0.119	B;B;B	0.43445	0.187;0.42;0.38	T	0.66056	-0.6018	10	0.66056	D	0.02	.	15.2077	0.73192	0.0:1.0:0.0:0.0	.	341;60;291	B4DTG2;B4DUP0;P26641	.;.;EF1G_HUMAN	N	291;341;60	ENSP00000331901:D291N;ENSP00000367258:D341N	ENSP00000331901:D291N	D	-	1	0	EEF1G	62084489	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.485000	0.81204	2.465000	0.83290	0.550000	0.68814	GAT	.	.		0.458	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395047.1	NM_001404	
MACROD1	28992	hgsc.bcm.edu	37	11	63767228	63767228	+	Silent	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr11:63767228G>T	ENST00000255681.6	-	6	738	c.672C>A	c.(670-672)atC>atA	p.I224I	OTUB1_ENST00000535715.1_Intron	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1	224	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CCACTGTGTGGATGACGTCTA	0.706																																					p.I224I		Atlas-SNP	.											.	MACROD1	17	.	0			c.C672A						.						11.0	15.0	13.0					11																	63767228		2152	4216	6368	SO:0001819	synonymous_variant	28992	exon6			TGTGTGGATGACG	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.672C>A	chr11.hg19:g.63767228G>T		109.0	0.0		59.0	12.0	NM_014067	Q9UH96	Silent	SNP	ENST00000255681.6	hg19	CCDS8056.1																																																																																			.	.		0.706	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
AKAP3	10566	hgsc.bcm.edu	37	12	4736121	4736121	+	Silent	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:4736121G>T	ENST00000545990.2	-	5	2471	c.1947C>A	c.(1945-1947)gcC>gcA	p.A649A	AKAP3_ENST00000228850.1_Silent_p.A649A|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	649					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						GCCCAGAAAGGGCACCAGGGG	0.522																																					p.A649A		Atlas-SNP	.											.	AKAP3	212	.	0			c.C1947A						.						54.0	48.0	50.0					12																	4736121		2203	4300	6503	SO:0001819	synonymous_variant	10566	exon4			AGAAAGGGCACCA	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1947C>A	chr12.hg19:g.4736121G>T		76.0	0.0		77.0	24.0	NM_006422	O75945|Q86X01|Q9UM61	Silent	SNP	ENST00000545990.2	hg19	CCDS8531.1																																																																																			.	.		0.522	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398911.2	NM_006422	
COL2A1	1280	hgsc.bcm.edu	37	12	48368646	48368646	+	Splice_Site	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:48368646C>T	ENST00000380518.3	-	52	4051		c.e52-1		COL2A1_ENST00000493991.1_Splice_Site|COL2A1_ENST00000337299.6_Splice_Site	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1						axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CAGTAGTCTCCTGCAGGGGGA	0.572																																					.		Atlas-SNP	.											.	COL2A1	368	.	0			c.3680-1G>A						.						67.0	67.0	67.0					12																	48368646		2203	4300	6503	SO:0001630	splice_region_variant	1280	exon52			AGTCTCCTGCAGG	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.3887-1G>A	chr12.hg19:g.48368646C>T		66.0	0.0		55.0	16.0	NM_033150	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Splice_Site	SNP	ENST00000380518.3	hg19	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349141	0.82132	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.095	0.89487	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL2A1	46654913	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.770000	0.85390	2.444000	0.82710	0.561000	0.74099	.	.	.		0.572	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	Intron
SPATS2	65244	hgsc.bcm.edu	37	12	49884489	49884489	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:49884489A>G	ENST00000553127.1	+	7	752	c.239A>G	c.(238-240)gAa>gGa	p.E80G	SPATS2_ENST00000321898.6_Missense_Mutation_p.E80G|SPATS2_ENST00000552557.1_3'UTR|SPATS2_ENST00000552918.1_Missense_Mutation_p.E80G			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	80						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						GTACTCAAAGAATGGACAGTA	0.353																																					p.E80G		Atlas-SNP	.											.	SPATS2	43	.	0			c.A239G						.						122.0	113.0	116.0					12																	49884489		2203	4300	6503	SO:0001583	missense	65244	exon6			TCAAAGAATGGAC	AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.239A>G	chr12.hg19:g.49884489A>G	ENSP00000448228:p.Glu80Gly	77.0	0.0		81.0	21.0	NM_023071	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	ENST00000553127.1	hg19	CCDS31794.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.801910	0.90538	.	.	ENSG00000123352	ENST00000550997;ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	5.24	5.24	0.73138	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.69459	0.3113	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.66084	0.941	T	0.72721	-0.4208	9	0.87932	D	0	-20.8127	11.5475	0.50702	1.0:0.0:0.0:0.0	.	80	Q86XZ4	SPAS2_HUMAN	G	80	.	ENSP00000326841:E80G	E	+	2	0	SPATS2	48170756	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.714000	0.84703	1.974000	0.57490	0.472000	0.43445	GAA	.	.		0.353	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404023.1	NM_023071	
HSD17B6	8630	hgsc.bcm.edu	37	12	57180989	57180989	+	Missense_Mutation	SNP	A	A	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:57180989A>C	ENST00000554643.1	+	6	1166	c.817A>C	c.(817-819)Aca>Cca	p.T273P	HSD17B6_ENST00000554150.1_Missense_Mutation_p.T273P|HSD17B6_ENST00000555159.1_Missense_Mutation_p.T273P|HSD17B6_ENST00000555805.1_Missense_Mutation_p.T273P|HSD17B6_ENST00000322165.1_Missense_Mutation_p.T273P			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	273					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	ACATGCTCTGACATCGGTGCA	0.408																																					p.T273P		Atlas-SNP	.											.	HSD17B6	26	.	0			c.A817C						.						143.0	123.0	130.0					12																	57180989		2203	4300	6503	SO:0001583	missense	8630	exon5			GCTCTGACATCGG	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.817A>C	chr12.hg19:g.57180989A>C	ENSP00000451406:p.Thr273Pro	128.0	0.0		79.0	18.0	NM_003725	O43275	Missense_Mutation	SNP	ENST00000554643.1	hg19	CCDS8925.1	.	.	.	.	.	.	.	.	.	.	a	18.15	3.561025	0.65538	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000554150;ENST00000322165	D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18;-2.18	4.97	3.83	0.44106	NAD(P)-binding domain (1);	0.356817	0.23995	N	0.042535	D	0.93641	0.7969	M	0.93678	3.445	0.32712	N	0.511418	D	0.63880	0.993	D	0.63033	0.91	D	0.94324	0.7556	10	0.54805	T	0.06	.	9.6529	0.39908	0.9158:0.0:0.0842:0.0	.	273	O14756	H17B6_HUMAN	P	273	ENSP00000450698:T273P;ENSP00000451753:T273P;ENSP00000451406:T273P;ENSP00000452273:T273P;ENSP00000318631:T273P	ENSP00000318631:T273P	T	+	1	0	HSD17B6	55467256	1.000000	0.71417	0.760000	0.31359	0.865000	0.49528	3.500000	0.53318	0.912000	0.36772	0.529000	0.55759	ACA	.	.		0.408	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410714.1	NM_003725	
RASSF9	9182	hgsc.bcm.edu	37	12	86198626	86198626	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:86198626G>A	ENST00000361228.3	-	2	1530	c.1162C>T	c.(1162-1164)Ccc>Tcc	p.P388S		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	388					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TTGCTACTGGGAACCTCAGAT	0.418																																					p.P388S		Atlas-SNP	.											.	RASSF9	100	.	0			c.C1162T						.						182.0	176.0	178.0					12																	86198626		1909	4139	6048	SO:0001583	missense	9182	exon2			TACTGGGAACCTC		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.1162C>T	chr12.hg19:g.86198626G>A	ENSP00000354884:p.Pro388Ser	168.0	0.0		146.0	40.0	NM_005447	B3KMQ4|Q8N5U8	Missense_Mutation	SNP	ENST00000361228.3	hg19	CCDS44950.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.730573	0.00687	.	.	ENSG00000198774	ENST00000361228	T	0.43294	0.95	5.29	-3.56	0.04626	.	1.610810	0.03755	N	0.257253	T	0.23054	0.0557	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.08554	-1.0716	10	0.33940	T	0.23	-9.833	1.3355	0.02144	0.4052:0.1646:0.2774:0.1527	.	388	O75901	RASF9_HUMAN	S	388	ENSP00000354884:P388S	ENSP00000354884:P388S	P	-	1	0	RASSF9	84722757	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.288000	0.08377	-0.623000	0.05618	-1.847000	0.00572	CCC	.	.		0.418	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406109.1		
BRAP	8315	hgsc.bcm.edu	37	12	112082089	112082089	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:112082089C>T	ENST00000327551.6	-	12	1743	c.1603G>A	c.(1603-1605)Gcc>Acc	p.A535T	BRAP_ENST00000539060.1_Missense_Mutation_p.A386T|BRAP_ENST00000419234.4_Missense_Mutation_p.A565T			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						GAGGCCATGGCGATGTTGATC	0.612																																					p.A565T	Pancreas(146;846 1904 7830 25130 26065)	Atlas-SNP	.											.	BRAP	42	.	0			c.G1693A						.						127.0	103.0	111.0					12																	112082089		2203	4300	6503	SO:0001583	missense	8315	exon12			CCATGGCGATGTT	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1603G>A	chr12.hg19:g.112082089C>T	ENSP00000330813:p.Ala535Thr	80.0	0.0		75.0	18.0	NM_006768	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000327551.6	hg19		.	.	.	.	.	.	.	.	.	.	C	19.15	3.772596	0.69992	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551	T;T;T	0.46063	0.88;0.9;0.89	5.8	-1.07	0.09968	.	0.430676	0.25380	N	0.031099	T	0.38161	0.1030	L	0.55103	1.725	0.37325	D	0.909745	B;P	0.43909	0.327;0.821	B;B	0.38500	0.05;0.275	T	0.44651	-0.9314	10	0.20046	T	0.44	-0.0437	21.6149	0.99957	0.0:0.3762:0.6238:0.0	.	386;565	B4DRM1;Q7Z569	.;BRAP_HUMAN	T	565;386;535	ENSP00000403524:A565T;ENSP00000441659:A386T;ENSP00000330813:A535T	ENSP00000330813:A535T	A	-	1	0	BRAP	110566472	0.426000	0.25506	0.151000	0.22473	0.957000	0.61999	0.661000	0.25023	-0.501000	0.06605	-0.264000	0.10439	GCC	.	.		0.612	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
HECTD4	283450	hgsc.bcm.edu	37	12	112638476	112638476	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:112638476C>G	ENST00000430131.2	-	54	8412	c.7267G>C	c.(7267-7269)Gtc>Ctc	p.V2423L	HECTD4_ENST00000550722.1_Missense_Mutation_p.V2699L|HECTD4_ENST00000377560.5_Missense_Mutation_p.V2673L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2423					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TCCAGTGTGACCAGCCCATTG	0.517																																					p.V2711L		Atlas-SNP	.											.	.	.	.	0			c.G8131C						.						141.0	137.0	138.0					12																	112638476		2011	4176	6187	SO:0001583	missense	283450	exon55			GTGTGACCAGCCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.7267G>C	chr12.hg19:g.112638476C>G	ENSP00000404379:p.Val2423Leu	191.0	0.0		162.0	48.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	C	35	5.544317	0.96488	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000548896	T;T;T	0.46819	0.86;0.86;0.86	5.86	5.86	0.93980	.	.	.	.	.	T	0.56601	0.1996	N	0.24115	0.695	0.58432	D	0.999999	P	0.44690	0.841	P	0.58820	0.846	T	0.57676	-0.7770	9	0.87932	D	0	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	2423	Q9Y4D8	K0614_HUMAN	L	2673;2423;2699;54	ENSP00000366783:V2673L;ENSP00000404379:V2423L;ENSP00000449784:V2699L	ENSP00000366783:V2673L	V	-	1	0	C12orf51	111122859	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.226000	0.78060	2.937000	0.99478	0.650000	0.86243	GTC	.	.		0.517	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
GOLGA3	2802	hgsc.bcm.edu	37	12	133358980	133358980	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr12:133358980C>T	ENST00000450791.2	-	16	3550	c.3367G>A	c.(3367-3369)Ggc>Agc	p.G1123S	GOLGA3_ENST00000456883.2_Missense_Mutation_p.G1123S|GOLGA3_ENST00000204726.3_Missense_Mutation_p.G1123S			Q08378	GOGA3_HUMAN	golgin A3	1123					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TGACCGAGGCCCGTAAGCTTC	0.502																																					p.G1123S		Atlas-SNP	.											.	GOLGA3	234	.	0			c.G3367A						.						225.0	206.0	212.0					12																	133358980		2203	4300	6503	SO:0001583	missense	2802	exon17			CGAGGCCCGTAAG	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3367G>A	chr12.hg19:g.133358980C>T	ENSP00000410378:p.Gly1123Ser	115.0	0.0		123.0	33.0	NM_005895	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	hg19	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523369	0.85600	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883	T;T;T	0.68903	-0.36;-0.36;-0.31	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.74496	0.3724	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75593	-0.3264	10	0.59425	D	0.04	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	1123;1123	Q08378-2;Q08378	.;GOGA3_HUMAN	S	1123	ENSP00000204726:G1123S;ENSP00000410378:G1123S;ENSP00000409303:G1123S	ENSP00000204726:G1123S	G	-	1	0	GOLGA3	131869053	1.000000	0.71417	0.886000	0.34754	0.046000	0.14306	7.629000	0.83207	2.884000	0.98904	0.655000	0.94253	GGC	.	.		0.502	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
ATL1	51062	hgsc.bcm.edu	37	14	51060573	51060573	+	Missense_Mutation	SNP	T	T	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr14:51060573T>G	ENST00000358385.6	+	5	773	c.532T>G	c.(532-534)Tta>Gta	p.L178V	ATL1_ENST00000441560.2_Missense_Mutation_p.L178V|ATL1_ENST00000357032.3_Missense_Mutation_p.L178V|ATL1_ENST00000354525.4_Missense_Mutation_p.L178V	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1	178	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						GGTATATAACTTATCCCAAAA	0.313																																					p.L178V		Atlas-SNP	.											.	ATL1	46	.	0			c.T532G						.						117.0	117.0	117.0					14																	51060573		2203	4299	6502	SO:0001583	missense	51062	exon5			TATAACTTATCCC	AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.532T>G	chr14.hg19:g.51060573T>G	ENSP00000351155:p.Leu178Val	68.0	0.0		39.0	8.0	NM_015915	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000358385.6	hg19	CCDS9700.1	.	.	.	.	.	.	.	.	.	.	T	13.32	2.202210	0.38905	.	.	ENSG00000198513	ENST00000441560;ENST00000358385;ENST00000357032;ENST00000354525;ENST00000554886	T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16	5.46	1.79	0.24919	Guanylate-binding protein, N-terminal (1);	0.060050	0.64402	D	0.000003	T	0.45498	0.1345	L	0.35723	1.085	0.52099	D	0.999945	B;B	0.16802	0.019;0.015	B;B	0.33339	0.162;0.1	T	0.14699	-1.0463	10	0.19147	T	0.46	-10.1854	8.143	0.31095	0.0:0.2493:0.0:0.7507	.	178;178	Q8WXF7;G5E9T1	ATLA1_HUMAN;.	V	178;178;178;178;34	ENSP00000413675:L178V;ENSP00000351155:L178V;ENSP00000349534:L178V;ENSP00000346522:L178V;ENSP00000452074:L34V	ENSP00000346522:L178V	L	+	1	2	ATL1	50130323	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.886000	0.39688	0.436000	0.26393	0.533000	0.62120	TTA	.	.		0.313	ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2		
ATG2B	55102	hgsc.bcm.edu	37	14	96752158	96752158	+	Missense_Mutation	SNP	C	C	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr14:96752158C>A	ENST00000359933.4	-	42	7064	c.6171G>T	c.(6169-6171)atG>atT	p.M2057I		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	2057					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TTTGGTTTCTCATGCCACCCA	0.547																																					p.M2057I		Atlas-SNP	.											.	ATG2B	169	.	0			c.G6171T						.						141.0	108.0	119.0					14																	96752158		2203	4300	6503	SO:0001583	missense	55102	exon42			GTTTCTCATGCCA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.6171G>T	chr14.hg19:g.96752158C>A	ENSP00000353010:p.Met2057Ile	141.0	0.0		87.0	33.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	C	36	5.614511	0.96649	.	.	ENSG00000066739	ENST00000359933	T	0.09630	2.96	5.76	5.76	0.90799	Autophagy-related, C-terminal (1);	0.080494	0.85682	D	0.000000	T	0.26448	0.0646	L	0.41492	1.28	0.80722	D	1	D	0.60575	0.988	D	0.74348	0.983	T	0.00304	-1.1832	10	0.30854	T	0.27	.	19.976	0.97309	0.0:1.0:0.0:0.0	.	2057	Q96BY7	ATG2B_HUMAN	I	2057	ENSP00000353010:M2057I	ENSP00000353010:M2057I	M	-	3	0	ATG2B	95821911	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.468000	0.80943	2.713000	0.92767	0.655000	0.94253	ATG	.	.		0.547	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
WDR90	197335	hgsc.bcm.edu	37	16	701923	701923	+	Missense_Mutation	SNP	A	A	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr16:701923A>C	ENST00000293879.4	+	9	937	c.937A>C	c.(937-939)Agc>Cgc	p.S313R	WDR90_ENST00000549091.1_Missense_Mutation_p.S313R|AL022341.3_ENST00000455294.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	313										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CGGTTTCCATAGCCTTGAGCC	0.701																																					p.S313R		Atlas-SNP	.											.	WDR90	107	.	0			c.A937C						.						15.0	20.0	18.0					16																	701923		2046	4181	6227	SO:0001583	missense	197335	exon9			TTCCATAGCCTTG	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.937A>C	chr16.hg19:g.701923A>C	ENSP00000293879:p.Ser313Arg	69.0	0.0		44.0	9.0	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	hg19	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	A	3.478	-0.106403	0.06924	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.28069	1.66;1.63	3.21	-6.42	0.01932	.	1.775110	0.04139	U	0.319296	T	0.18341	0.0440	L	0.38531	1.155	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.001;0.001;0.003	T	0.17228	-1.0376	10	0.15499	T	0.54	.	4.2291	0.10594	0.2912:0.0:0.4127:0.2961	.	313;314;313	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	R	313	ENSP00000448122:S313R;ENSP00000293879:S313R	ENSP00000293879:S313R	S	+	1	0	WDR90	641924	0.004000	0.15560	0.000000	0.03702	0.003000	0.03518	0.970000	0.29383	-1.990000	0.00978	-0.558000	0.04189	AGC	.	.		0.701	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
ZNF423	23090	hgsc.bcm.edu	37	16	49671334	49671334	+	Missense_Mutation	SNP	T	T	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr16:49671334T>A	ENST00000561648.1	-	4	1782	c.1729A>T	c.(1729-1731)Atc>Ttc	p.I577F	ZNF423_ENST00000562520.1_Missense_Mutation_p.I517F|ZNF423_ENST00000262383.2_Missense_Mutation_p.I577F|ZNF423_ENST00000535559.1_Missense_Mutation_p.I460F|ZNF423_ENST00000563137.2_Missense_Mutation_p.I517F|ZNF423_ENST00000562871.1_Missense_Mutation_p.I517F|ZNF423_ENST00000567169.1_Missense_Mutation_p.I460F	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	577					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				AGTTTCAGGATGGAGCCAAAG	0.567																																					p.I577F		Atlas-SNP	.											.	ZNF423	463	.	0			c.A1729T						.						138.0	123.0	128.0					16																	49671334		2198	4300	6498	SO:0001583	missense	23090	exon4			TCAGGATGGAGCC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1729A>T	chr16.hg19:g.49671334T>A	ENSP00000455426:p.Ile577Phe	135.0	0.0		64.0	27.0	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	hg19	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	T	10.54	1.379998	0.24944	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.08720	3.06;3.08	4.99	3.82	0.43975	Zinc finger, C2H2-like (1);	0.116446	0.64402	D	0.000015	T	0.03783	0.0107	N	0.03608	-0.345	0.47153	D	0.999339	B	0.27068	0.167	B	0.28465	0.09	T	0.50311	-0.8843	9	.	.	.	.	11.4301	0.50034	0.0:0.0:0.1509:0.8491	.	577	Q2M1K9	ZN423_HUMAN	F	577;460	ENSP00000262383:I577F;ENSP00000442321:I460F	.	I	-	1	0	ZNF423	48228835	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.332000	0.52083	1.881000	0.54492	0.459000	0.35465	ATC	.	.		0.567	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
PPM1E	22843	hgsc.bcm.edu	37	17	56833448	56833448	+	Silent	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr17:56833448G>A	ENST00000308249.2	+	1	219	c.90G>A	c.(88-90)gaG>gaA	p.E30E		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GCGGCGGcgagccggagccgg	0.667																																					p.E30E		Atlas-SNP	.											.	PPM1E	97	.	0			c.G90A						.						14.0	19.0	17.0					17																	56833448		2178	4275	6453	SO:0001819	synonymous_variant	22843	exon1			CGGCGAGCCGGAG	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.90G>A	chr17.hg19:g.56833448G>A		212.0	0.0		230.0	12.0	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.		0.667	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
PPM1E	22843	hgsc.bcm.edu	37	17	56833451	56833451	+	Silent	SNP	G	G	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr17:56833451G>C	ENST00000308249.2	+	1	222	c.93G>C	c.(91-93)ccG>ccC	p.P31P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GCGGcgagccggagccggaac	0.672																																					p.P31P		Atlas-SNP	.											.	PPM1E	97	.	0			c.G93C						.						14.0	20.0	18.0					17																	56833451		2180	4278	6458	SO:0001819	synonymous_variant	22843	exon1			CGAGCCGGAGCCG	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.93G>C	chr17.hg19:g.56833451G>C		209.0	0.0		226.0	17.0	NM_014906	Q8N8J9|Q96DB8	Silent	SNP	ENST00000308249.2	hg19	CCDS11613.1																																																																																			.	.		0.672	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445458.1	NM_014906	
TLK2	11011	hgsc.bcm.edu	37	17	60679436	60679436	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr17:60679436G>T	ENST00000326270.9	+	20	2088	c.1820G>T	c.(1819-1821)gGa>gTa	p.G607V	TLK2_ENST00000582809.1_Missense_Mutation_p.G436V|TLK2_ENST00000542523.1_Missense_Mutation_p.G553V|TLK2_ENST00000343388.7_Missense_Mutation_p.G553V|TLK2_ENST00000346027.5_Missense_Mutation_p.G585V	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	607	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						ACAGCGTGTGGAGAGATAAAA	0.343																																					p.G585V		Atlas-SNP	.											.	TLK2	223	.	0			c.G1754T						.						91.0	87.0	88.0					17																	60679436		2203	4300	6503	SO:0001583	missense	11011	exon19			CGTGTGGAGAGAT	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.1820G>T	chr17.hg19:g.60679436G>T	ENSP00000316512:p.Gly607Val	84.0	0.0		109.0	31.0	NM_006852	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	hg19		.	.	.	.	.	.	.	.	.	.	G	13.61	2.289612	0.40494	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.78	4.82	0.62117	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.75884	2.315	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;0.982;0.999	D;D;D;D	0.97110	1.0;0.977;0.941;0.995	T	0.56189	-0.8020	10	0.87932	D	0	.	13.8848	0.63702	0.0729:0.0:0.9271:0.0	.	607;553;585;585	Q86UE8;Q86UE8-3;Q86UE8-2;D3DU05	TLK2_HUMAN;.;.;.	V	585;553;607;553	ENSP00000275780:G585V;ENSP00000340800:G553V;ENSP00000316512:G607V;ENSP00000442311:G553V	ENSP00000316512:G607V	G	+	2	0	TLK2	58033168	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	1.450000	0.47717	0.561000	0.74099	GGA	.	.		0.343	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
TEX2	55852	hgsc.bcm.edu	37	17	62265633	62265633	+	Silent	SNP	A	A	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr17:62265633A>C	ENST00000583097.1	-	5	2491	c.2319T>G	c.(2317-2319)ctT>ctG	p.L773L	TEX2_ENST00000258991.3_Silent_p.L780L|TEX2_ENST00000584379.1_Silent_p.L773L			Q8IWB9	TEX2_HUMAN	testis expressed 2	773					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TGTAGTCGAGAAGCATCTTCT	0.627																																					p.L780L		Atlas-SNP	.											.	TEX2	89	.	0			c.T2340G						.						101.0	82.0	88.0					17																	62265633		2203	4300	6503	SO:0001819	synonymous_variant	55852	exon5			GTCGAGAAGCATC	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2319T>G	chr17.hg19:g.62265633A>C		74.0	0.0		50.0	20.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Silent	SNP	ENST00000583097.1	hg19																																																																																				.	.		0.627	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
APCDD1	147495	hgsc.bcm.edu	37	18	10471890	10471890	+	Silent	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr18:10471890G>A	ENST00000355285.5	+	3	960	c.606G>A	c.(604-606)gtG>gtA	p.V202V	APCDD1_ENST00000578882.1_Intron	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1											NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		CCAAGGCCGTGAACTTTGCCA	0.602																																					p.V202V		Atlas-SNP	.											.	APCDD1	57	.	0			c.G606A						.						146.0	134.0	138.0					18																	10471890		2203	4300	6503	SO:0001819	synonymous_variant	147495	exon3			GGCCGTGAACTTT	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.606G>A	chr18.hg19:g.10471890G>A		127.0	0.0		89.0	47.0	NM_153000		Silent	SNP	ENST00000355285.5	hg19	CCDS11849.1																																																																																			.	.		0.602	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
ZNF396	252884	hgsc.bcm.edu	37	18	32949594	32949594	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr18:32949594G>T	ENST00000589332.1	-	4	724	c.593C>A	c.(592-594)tCt>tAt	p.S198Y	ZNF396_ENST00000306346.1_Missense_Mutation_p.S198Y			Q96N95	ZN396_HUMAN	zinc finger protein 396	198					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	7						CCTTGAAGCAGATTTCACATT	0.363																																					p.S198Y		Atlas-SNP	.											.	ZNF396	28	.	0			c.C593A						.						101.0	99.0	99.0					18																	32949594		2203	4300	6503	SO:0001583	missense	252884	exon4			GAAGCAGATTTCA	AK055775	CCDS11913.1	18p12	2013-01-09			ENSG00000186496	ENSG00000186496		"""-"", ""Zinc fingers, C2H2-type"""	18824	protein-coding gene	gene with protein product		609600					Standard	NM_145756		Approved	ZSCAN14, FLJ31213	uc010xcf.1	Q96N95	OTTHUMG00000132562	ENST00000589332.1:c.593C>A	chr18.hg19:g.32949594G>T	ENSP00000466500:p.Ser198Tyr	103.0	0.0		83.0	38.0	NM_145756	A1L3V0|Q8NF98|Q8TD80	Missense_Mutation	SNP	ENST00000589332.1	hg19		.	.	.	.	.	.	.	.	.	.	G	10.42	1.344948	0.24426	.	.	ENSG00000186496	ENST00000306346;ENST00000399057	T	0.08807	3.05	4.41	3.54	0.40534	.	0.670897	0.11710	U	0.537013	T	0.14485	0.0350	L	0.32530	0.975	0.43222	D	0.995103	D	0.67145	0.996	D	0.65874	0.939	T	0.15435	-1.0437	10	0.20519	T	0.43	.	8.1514	0.31143	0.107:0.0:0.893:0.0	.	198	Q96N95-3	.	Y	198	ENSP00000302310:S198Y	ENSP00000302310:S198Y	S	-	2	0	ZNF396	31203592	0.001000	0.12720	0.003000	0.11579	0.004000	0.04260	0.855000	0.27805	1.451000	0.47736	0.650000	0.86243	TCT	.	.		0.363	ZNF396-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255766.1	NM_145756	
ZNF441	126068	hgsc.bcm.edu	37	19	11891848	11891848	+	Missense_Mutation	SNP	C	C	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr19:11891848C>G	ENST00000357901.4	+	4	1311	c.1209C>G	c.(1207-1209)ttC>ttG	p.F403L	ZNF441_ENST00000454339.2_Missense_Mutation_p.F336L	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTAGTGATTTCTATTACTTTC	0.378																																					p.F403L		Atlas-SNP	.											ZNF441_ENST00000357901,NS,carcinoma,0,2	ZNF441	123	.	0			c.C1209G						.						46.0	48.0	47.0					19																	11891848		2203	4300	6503	SO:0001583	missense	126068	exon4			TGATTTCTATTAC	AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.1209C>G	chr19.hg19:g.11891848C>G	ENSP00000350576:p.Phe403Leu	87.0	0.0		77.0	20.0	NM_152355		Missense_Mutation	SNP	ENST00000357901.4	hg19	CCDS12266.2	.	.	.	.	.	.	.	.	.	.	-	8.650	0.898135	0.17686	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	T;T	0.07021	3.23;3.23	1.06	-1.96	0.07525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.	.	.	.	T	0.02193	0.0068	N	0.02296	-0.605	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45190	-0.9278	9	0.15066	T	0.55	.	0.1783	0.00120	0.2122:0.2385:0.2107:0.3385	.	403	Q8N8Z8	ZN441_HUMAN	L	359;403;336	ENSP00000350576:F403L;ENSP00000403738:F336L	ENSP00000350576:F403L	F	+	3	2	ZNF441	11752848	0.000000	0.05858	0.000000	0.03702	0.934000	0.57294	-5.767000	0.00099	-0.483000	0.06772	0.298000	0.19748	TTC	.	.		0.378	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335273.3	NM_152355	
SYDE1	85360	hgsc.bcm.edu	37	19	15221118	15221118	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr19:15221118C>T	ENST00000342784.2	+	3	1065	c.1034C>T	c.(1033-1035)cCc>cTc	p.P345L	SYDE1_ENST00000600252.1_5'UTR|SYDE1_ENST00000600440.1_Missense_Mutation_p.P278L	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	345					activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						AGGCACCGGCCCTGTGCCCAG	0.716																																					p.P345L		Atlas-SNP	.											.	SYDE1	44	.	0			c.C1034T						.						6.0	9.0	8.0					19																	15221118		1891	3647	5538	SO:0001583	missense	85360	exon3			ACCGGCCCTGTGC	BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1034C>T	chr19.hg19:g.15221118C>T	ENSP00000341489:p.Pro345Leu	45.0	0.0		40.0	11.0	NM_033025	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	ENST00000342784.2	hg19	CCDS12324.1	.	.	.	.	.	.	.	.	.	.	c	1.023	-0.684263	0.03353	.	.	ENSG00000105137	ENST00000342784	T	0.07567	3.18	3.83	2.79	0.32731	C2 calcium/lipid-binding domain, CaLB (1);	0.361722	0.26586	N	0.023549	T	0.02807	0.0084	N	0.02315	-0.6	0.33534	D	0.593957	B;B	0.13145	0.007;0.001	B;B	0.08055	0.001;0.003	T	0.30060	-0.9991	10	0.24483	T	0.36	.	5.9307	0.19138	0.0:0.76:0.0:0.24	.	278;345	Q6ZW31-2;Q6ZW31	.;SYDE1_HUMAN	L	345	ENSP00000341489:P345L	ENSP00000341489:P345L	P	+	2	0	SYDE1	15082118	0.996000	0.38824	0.999000	0.59377	0.010000	0.07245	2.405000	0.44548	0.833000	0.34828	-0.359000	0.07587	CCC	.	.		0.716	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465666.1	NM_033025	
MAP1S	55201	hgsc.bcm.edu	37	19	17837234	17837234	+	Silent	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr19:17837234G>T	ENST00000324096.4	+	5	1192	c.1041G>T	c.(1039-1041)cgG>cgT	p.R347R	MAP1S_ENST00000544059.2_Silent_p.R321R|CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	347	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						CCGCGTCGCGGCTGGCGCGCG	0.721																																					p.R347R		Atlas-SNP	.											.	MAP1S	74	.	0			c.G1041T						.						5.0	6.0	5.0					19																	17837234		1975	3888	5863	SO:0001819	synonymous_variant	55201	exon5			GTCGCGGCTGGCG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1041G>T	chr19.hg19:g.17837234G>T		25.0	0.0		26.0	11.0	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	ENST00000324096.4	hg19	CCDS32954.1																																																																																			.	.		0.721	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
ZNF781	163115	hgsc.bcm.edu	37	19	38160695	38160695	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr19:38160695A>G	ENST00000590008.1	-	5	1207	c.355T>C	c.(355-357)Tgt>Cgt	p.C119R	ZNF781_ENST00000593040.1_5'Flank|ZNF781_ENST00000358582.4_Missense_Mutation_p.C119R|ZFP30_ENST00000586732.1_Intron			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						CATTGCTTACATTTATAAGGT	0.383																																					p.C119R		Atlas-SNP	.											.	ZNF781	66	.	0			c.T355C						.						122.0	121.0	121.0					19																	38160695		2203	4300	6503	SO:0001583	missense	163115	exon4			GCTTACATTTATA	AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.355T>C	chr19.hg19:g.38160695A>G	ENSP00000466370:p.Cys119Arg	84.0	0.0		93.0	28.0	NM_152605	Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	hg19	CCDS12507.1	.	.	.	.	.	.	.	.	.	.	A	11.23	1.577208	0.28092	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	D	0.85258	-1.96	2.23	1.13	0.20643	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92786	0.7706	M	0.92880	3.355	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.83865	0.0270	9	0.87932	D	0	.	8.2999	0.32008	0.875:0.0:0.125:0.0	.	119	Q8N8C0	ZN781_HUMAN	R	119	ENSP00000351391:C119R	ENSP00000351391:C119R	C	-	1	0	ZNF781	42852535	0.985000	0.35326	0.003000	0.11579	0.001000	0.01503	3.784000	0.55416	-0.269000	0.09298	-1.446000	0.01064	TGT	.	.		0.383	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	NM_152605	
B9D2	80776	hgsc.bcm.edu	37	19	41858864	41858864	+	IGR	SNP	C	C	T	rs199758510|rs66551611	byFrequency	TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr19:41858864C>T	ENST00000243578.3	-	0	1027				CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000604123.1_5'Flank|TMEM91_ENST00000539627.1_Intron|TGFB1_ENST00000221930.5_Missense_Mutation_p.G29E	NM_030578.3	NP_085055.2	Q9BPU9	B9D2_HUMAN	B9 protein domain 2						cilium assembly (GO:0042384)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)	gamma-tubulin binding (GO:0043015)			large_intestine(1)|ovary(1)	2						GGTGGATAGTCCCGCGGCCGG	0.711													C|||	2	0.000399361	0.0008	0.0	5008	,	,		12405	0.0		0.001	False		,,,				2504	0.0				p.G29E		Atlas-SNP	.											.	TGFB1	27	.	0			c.G86A	GRCh37	CM090931|CM090932	TGFB1	M		.	C	GLU/GLY	2,4240		0,2,2119	13.0	10.0	11.0		86	1.3	1.0	19		11	3,8293		0,3,4145	yes	missense	TGFB1	NM_000660.4	98	0,5,6264	TT,TC,CC		0.0362,0.0471,0.0399	possibly-damaging	29/391	41858864	5,12533	2121	4148	6269	SO:0001628	intergenic_variant	7040	exon1			GATAGTCCCGCGG	BC004157	CCDS12579.1	19q13.2	2014-01-28				ENSG00000123810			28636	protein-coding gene	gene with protein product		611951				21763481	Standard	NM_030578		Approved	MGC4093, MKS10	uc002oqj.2	Q9BPU9			chr19.hg19:g.41858864C>T		77.0	0.0		68.0	17.0	NM_000660		Missense_Mutation	SNP	ENST00000243578.3	hg19	CCDS12579.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735595	0.69189	4.71E-4	3.62E-4	ENSG00000105329	ENST00000221930	T	0.31769	1.48	3.74	1.29	0.21616	Transforming growth factor-beta, N-terminal (1);	0.473959	0.22160	N	0.063783	T	0.33585	0.0868	M	0.62723	1.935	0.80722	D	1	P	0.42161	0.772	B	0.43575	0.424	T	0.30149	-0.9988	10	0.49607	T	0.09	-15.6854	12.0894	0.53717	0.0:0.5772:0.4228:0.0	.	29	P01137	TGFB1_HUMAN	E	29	ENSP00000221930:G29E	ENSP00000221930:G29E	G	-	2	0	TGFB1	46550704	0.004000	0.15560	0.981000	0.43875	0.943000	0.58893	0.541000	0.23207	0.724000	0.32296	0.462000	0.41574	GGA	.	.		0.711	B9D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463489.1	NM_030578	
KLK12	43849	hgsc.bcm.edu	37	19	51534168	51534168	+	Missense_Mutation	SNP	G	G	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr19:51534168G>T	ENST00000525263.1	-	4	586	c.467C>A	c.(466-468)cCg>cAg	p.P156Q	CTC-518B2.9_ENST00000594910.1_RNA|KLK11_ENST00000319720.7_5'Flank|KLK12_ENST00000529888.1_Silent_p.P69P|KLK12_ENST00000250351.4_Missense_Mutation_p.P156Q|KLK12_ENST00000319590.4_Missense_Mutation_p.P156Q|KLK11_ENST00000391804.3_5'Flank|KLK12_ENST00000250352.11_Missense_Mutation_p.P46Q			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	156	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		GAGCAGATCCGGGAATGGGTC	0.592																																					p.P156Q		Atlas-SNP	.											.	KLK12	30	.	0			c.C467A						.						162.0	152.0	156.0					19																	51534168		2203	4300	6503	SO:0001583	missense	43849	exon5			AGATCCGGGAATG		CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.467C>A	chr19.hg19:g.51534168G>T	ENSP00000436458:p.Pro156Gln	117.0	0.0		82.0	19.0	NM_019598	Q9UKR1|Q9UKR2	Missense_Mutation	SNP	ENST00000525263.1	hg19	CCDS12821.1	.	.	.	.	.	.	.	.	.	.	g	15.19	2.759872	0.49468	.	.	ENSG00000186474	ENST00000525263;ENST00000319590;ENST00000250352;ENST00000250351	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	4.62	4.62	0.57501	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.450566	0.16616	N	0.206692	D	0.93877	0.8041	M	0.79475	2.455	0.32947	D	0.519266	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;0.999;0.999;0.971	D	0.94969	0.8115	10	0.87932	D	0	.	12.8167	0.57669	0.0:0.0:1.0:0.0	.	46;46;156;156	B9EGA9;Q49AM7;Q9UKR0-2;Q9UKR0	.;.;.;KLK12_HUMAN	Q	156;156;46;156	ENSP00000436458:P156Q;ENSP00000324181:P156Q;ENSP00000250352:P46Q;ENSP00000250351:P156Q	ENSP00000250351:P156Q	P	-	2	0	KLK12	56225980	1.000000	0.71417	0.861000	0.33841	0.318000	0.28184	5.638000	0.67861	2.395000	0.81488	0.555000	0.69702	CCG	.	.		0.592	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386288.1	NM_019598	
MAVS	57506	hgsc.bcm.edu	37	20	3845305	3845305	+	Missense_Mutation	SNP	A	A	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr20:3845305A>G	ENST00000428216.2	+	6	1156	c.1028A>G	c.(1027-1029)aAt>aGt	p.N343S	MAVS_ENST00000416600.2_Missense_Mutation_p.N202S|MAVS_ENST00000358134.6_3'UTR	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	343					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						GCGCTCACCAATCCAGCACCA	0.557																																					p.N343S		Atlas-SNP	.											.	MAVS	34	.	0			c.A1028G						.						138.0	125.0	129.0					20																	3845305		2203	4300	6503	SO:0001583	missense	57506	exon6			TCACCAATCCAGC	DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.1028A>G	chr20.hg19:g.3845305A>G	ENSP00000401980:p.Asn343Ser	84.0	0.0		65.0	19.0	NM_020746	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	hg19	CCDS33437.1	.	.	.	.	.	.	.	.	.	.	A	9.862	1.196692	0.22037	.	.	ENSG00000088888	ENST00000416600;ENST00000428216	T;T	0.32515	1.45;2.46	3.73	-2.66	0.06077	.	1.390520	0.04818	N	0.436369	T	0.13543	0.0328	N	0.11201	0.11	0.09310	N	1	B	0.27625	0.183	B	0.25140	0.058	T	0.23726	-1.0180	10	0.05620	T	0.96	-1.1473	8.4884	0.33084	0.4964:0.0:0.5036:0.0	.	343	Q7Z434	MAVS_HUMAN	S	202;343	ENSP00000413749:N202S;ENSP00000401980:N343S	ENSP00000413749:N202S	N	+	2	0	MAVS	3793305	0.000000	0.05858	0.000000	0.03702	0.786000	0.44442	-0.159000	0.10056	-0.476000	0.06842	0.402000	0.26972	AAT	.	.		0.557	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077784.3	NM_020746	
TRMT6	51605	hgsc.bcm.edu	37	20	5919267	5919267	+	Missense_Mutation	SNP	G	G	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr20:5919267G>A	ENST00000203001.2	-	11	1538	c.1408C>T	c.(1408-1410)Ctc>Ttc	p.L470F	TRMT6_ENST00000473131.1_5'UTR|TRMT6_ENST00000453074.2_Missense_Mutation_p.L300F	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	470					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						TTAGATTTGAGGCTGGTGTCT	0.473																																					p.L470F		Atlas-SNP	.											.	TRMT6	28	.	0			c.C1408T						.						134.0	131.0	132.0					20																	5919267		2203	4300	6503	SO:0001583	missense	51605	exon11			ATTTGAGGCTGGT	AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.1408C>T	chr20.hg19:g.5919267G>A	ENSP00000203001:p.Leu470Phe	93.0	0.0		95.0	24.0	NM_015939	B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Missense_Mutation	SNP	ENST00000203001.2	hg19	CCDS13093.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.243252	0.22796	.	.	ENSG00000089195	ENST00000203001;ENST00000453074	T;T	0.24151	1.88;1.87	5.65	4.69	0.59074	.	0.153525	0.30969	N	0.008516	T	0.20170	0.0485	N	0.22421	0.69	0.09310	N	1	B	0.25169	0.119	B	0.26517	0.07	T	0.19031	-1.0318	10	0.54805	T	0.06	-2.8296	14.6958	0.69121	0.0:0.4016:0.5984:0.0	.	470	Q9UJA5	TRM6_HUMAN	F	470;300	ENSP00000203001:L470F;ENSP00000392070:L300F	ENSP00000203001:L470F	L	-	1	0	TRMT6	5867267	0.006000	0.16342	0.308000	0.25141	0.125000	0.20455	1.678000	0.37586	1.507000	0.48752	0.650000	0.86243	CTC	.	.		0.473	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077889.2		
SOGA1	140710	hgsc.bcm.edu	37	20	35422556	35422556	+	Missense_Mutation	SNP	C	C	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr20:35422556C>T	ENST00000357779.3	-	14	3541	c.3215G>A	c.(3214-3216)cGg>cAg	p.R1072Q	SOGA1_ENST00000456801.2_Missense_Mutation_p.R913Q|SOGA1_ENST00000279034.6_Intron|SOGA1_ENST00000237536.4_Missense_Mutation_p.R1310Q			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	1072					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CAGGCGCTGCCGTGAGAAGTT	0.652																																					p.R1310Q		Atlas-SNP	.											.	SOGA1	136	.	0			c.G3929A						.						30.0	30.0	30.0					20																	35422556		692	1591	2283	SO:0001583	missense	140710	exon14			CGCTGCCGTGAGA	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.3215G>A	chr20.hg19:g.35422556C>T	ENSP00000350424:p.Arg1072Gln	90.0	0.0		83.0	21.0	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	hg19		.	.	.	.	.	.	.	.	.	.	C	15.82	2.945960	0.53079	.	.	ENSG00000149639	ENST00000237536;ENST00000456801;ENST00000357779	T;T;T	0.18016	2.24;2.26;2.25	5.3	4.29	0.51040	.	0.529373	0.20551	N	0.090115	T	0.19967	0.0480	L	0.52126	1.63	0.30214	N	0.797445	.	.	.	.	.	.	T	0.05550	-1.0878	8	0.45353	T	0.12	-40.9805	5.3258	0.15905	0.0:0.7579:0.0:0.2421	.	.	.	.	Q	1310;913;1072	ENSP00000237536:R1310Q;ENSP00000413886:R913Q;ENSP00000350424:R1072Q	ENSP00000237536:R1310Q	R	-	2	0	KIAA0889	34855970	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	2.423000	0.44705	2.748000	0.94277	0.655000	0.94253	CGG	.	.		0.652	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47558450	47558450	+	Missense_Mutation	SNP	T	T	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr20:47558450T>C	ENST00000371917.4	+	3	202	c.202T>C	c.(202-204)Tat>Cat	p.Y68H		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	68	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AGCTGACAAGTATTTTCTTCC	0.473																																					p.Y68H	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.T202C						.						174.0	159.0	164.0					20																	47558450		2203	4300	6503	SO:0001583	missense	10564	exon3			GACAAGTATTTTC	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.202T>C	chr20.hg19:g.47558450T>C	ENSP00000360985:p.Tyr68His	65.0	0.0		68.0	17.0	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.832285	0.91036	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.26373	1.74	5.74	5.74	0.90152	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42743	0.1216	M	0.73598	2.24	0.80722	D	1	D	0.61080	0.989	P	0.51701	0.677	T	0.38415	-0.9662	10	0.48119	T	0.1	.	16.0314	0.80579	0.0:0.0:0.0:1.0	.	68	Q9Y6D5	BIG2_HUMAN	H	68	ENSP00000360985:Y68H	ENSP00000360985:Y68H	Y	+	1	0	ARFGEF2	46991857	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.955000	0.87856	2.193000	0.70182	0.402000	0.26972	TAT	.	.		0.473	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
MYO18B	84700	hgsc.bcm.edu	37	22	26348383	26348383	+	Silent	SNP	A	A	G			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr22:26348383A>G	ENST00000407587.2	+	38	6136	c.5967A>G	c.(5965-5967)agA>agG	p.R1989R	MYO18B_ENST00000335473.7_Silent_p.R1988R|MYO18B_ENST00000536101.1_Silent_p.R1988R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1988	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGATTAAGAGATTTGAGGTAC	0.483																																					p.R1988R		Atlas-SNP	.											.	MYO18B	322	.	0			c.A5964G						.						64.0	68.0	66.0					22																	26348383		2025	4192	6217	SO:0001819	synonymous_variant	84700	exon38			TAAGAGATTTGAG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5967A>G	chr22.hg19:g.26348383A>G		127.0	0.0		125.0	43.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	hg19																																																																																				.	.		0.483	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
TRMU	55687	hgsc.bcm.edu	37	22	46733707	46733707	+	Missense_Mutation	SNP	C	C	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr22:46733707C>A	ENST00000290846.4	+	2	454	c.114C>A	c.(112-114)aaC>aaA	p.N38K	TRMU_ENST00000424260.2_Missense_Mutation_p.N3K|TRMU_ENST00000381019.3_Missense_Mutation_p.N38K	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	38					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		TTATGAAGAACTGGGACTCAC	0.458																																					p.N38K		Atlas-SNP	.											.	TRMU	23	.	0			c.C114A						.						125.0	106.0	112.0					22																	46733707		2203	4300	6503	SO:0001583	missense	55687	exon2			GAAGAACTGGGAC	AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.114C>A	chr22.hg19:g.46733707C>A	ENSP00000290846:p.Asn38Lys	127.0	0.0		123.0	35.0	NM_018006	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Missense_Mutation	SNP	ENST00000290846.4	hg19	CCDS14075.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223688	0.79576	.	.	ENSG00000100416	ENST00000290846;ENST00000381019;ENST00000424260	T;T;T	0.72394	-0.08;-0.08;-0.65	4.91	4.91	0.64330	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.88934	0.6572	H	0.97265	3.97	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	D	0.91950	0.5570	10	0.87932	D	0	-44.7634	12.2442	0.54560	0.0:0.9166:0.0:0.0834	.	38;38;38	B4DHM1;O75648-2;O75648	.;.;MTU1_HUMAN	K	38;38;3	ENSP00000290846:N38K;ENSP00000370407:N38K;ENSP00000406038:N3K	ENSP00000290846:N38K	N	+	3	2	TRMU	45112371	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.527000	0.53517	2.256000	0.74724	0.557000	0.71058	AAC	.	.		0.458	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318042.2	NM_018006	
RIBC1	158787	hgsc.bcm.edu	37	X	53457918	53457918	+	Silent	SNP	T	T	C			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chrX:53457918T>C	ENST00000375327.3	+	8	1275	c.1122T>C	c.(1120-1122)ttT>ttC	p.F374F	HSD17B10_ENST00000495986.1_5'Flank|RP3-339A18.6_ENST00000418049.1_RNA	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1	374										lung(2)	2						ACCAGCAGTTTAACACCAGCA	0.468																																					p.F374F		Atlas-SNP	.											.	RIBC1	20	.	0			c.T1122C						.						201.0	155.0	171.0					X																	53457918		2203	4300	6503	SO:0001819	synonymous_variant	158787	exon8			GCAGTTTAACACC	AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.1122T>C	chrX.hg19:g.53457918T>C		108.0	0.0		163.0	53.0	NM_001031745	B4E297|E9PDU2|Q5H931|Q96A80	Silent	SNP	ENST00000375327.3	hg19	CCDS35299.1																																																																																			.	.		0.468	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056762.1	NM_144968	
RAD51AP2	729475	hgsc.bcm.edu	37	2	17698736	17698737	+	Frame_Shift_Ins	INS	-	-	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr2:17698736_17698737insT	ENST00000399080.2	-	1	969_970	c.946_947insA	c.(946-948)actfs	p.T316fs		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	316										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CGCTTCTACAGTTTTTTTATCA	0.332																																					p.T316fs		Atlas-Indel,Pindel	.											.,2	RAD51AP2	134	.	0			c.947_948insA						.			1,3493		0,1,1746						-5.6	0.0			116	1,7797		0,1,3898	no	frameshift	RAD51AP2	NM_001099218.2		0,2,5644	A1A1,A1R,RR		0.0128,0.0286,0.0177				2,11290				SO:0001589	frameshift_variant	729475	exon1			.	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.947dupA	chr2.hg19:g.17698743_17698743dupT	ENSP00000382030:p.Thr316fs	89.0	0.0		68.0	22.0	NM_001099218		Frame_Shift_Ins	INS	ENST00000399080.2	hg19	CCDS42656.1																																																																																			.	.		0.332	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218	
VEGFA	7422	hgsc.bcm.edu	37	6	43738861	43738875	+	5'Flank	DEL	GCCCGGGCCTCGGGC	GCCCGGGCCTCGGGC	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	GCCCGGGCCTCGGGC	GCCCGGGCCTCGGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr6:43738861_43738875delGCCCGGGCCTCGGGC	ENST00000523873.1	+	0	0				VEGFA_ENST00000372067.3_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000417285.2_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000230480.6_5'Flank|RP1-261G23.7_ENST00000607600.1_RNA|VEGFA_ENST00000523950.1_5'Flank|VEGFA_ENST00000518689.1_5'Flank|VEGFA_ENST00000324450.6_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000372077.4_5'UTR|VEGFA_ENST00000372064.4_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000520948.1_5'UTR|VEGFA_ENST00000372055.4_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000518824.1_5'Flank|VEGFA_ENST00000482630.2_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000413642.3_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000523125.1_5'Flank|VEGFA_ENST00000425836.2_In_Frame_Del_p.ARASG140del|VEGFA_ENST00000457104.2_5'Flank			P15692	VEGFA_HUMAN	vascular endothelial growth factor A						activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|basophil chemotaxis (GO:0002575)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|camera-type eye morphogenesis (GO:0048593)|cardiac muscle fiber development (GO:0048739)|cardiac vascular smooth muscle cell development (GO:0060948)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to hypoxia (GO:0071456)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|dopaminergic neuron differentiation (GO:0071542)|endothelial cell chemotaxis (GO:0035767)|epithelial cell differentiation (GO:0030855)|eye photoreceptor cell development (GO:0042462)|growth (GO:0040007)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|induction of positive chemotaxis (GO:0050930)|kidney development (GO:0001822)|lactation (GO:0007595)|lung development (GO:0030324)|lymph vessel morphogenesis (GO:0036303)|macrophage differentiation (GO:0030225)|mammary gland alveolus development (GO:0060749)|mesoderm development (GO:0007498)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|outflow tract morphogenesis (GO:0003151)|ovarian follicle development (GO:0001541)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cellular component movement (GO:0051272)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein localization to early endosome (GO:1902966)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor internalization (GO:0002092)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular permeability (GO:0043117)|post-embryonic camera-type eye development (GO:0031077)|primitive erythrocyte differentiation (GO:0060319)|regulation of cell shape (GO:0008360)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)|surfactant homeostasis (GO:0043129)|tube formation (GO:0035148)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|VEGF-activated neuropilin signaling pathway (GO:0038190)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|neuropilin binding (GO:0038191)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor agonist activity (GO:0048018)|vascular endothelial growth factor receptor 1 binding (GO:0043183)|vascular endothelial growth factor receptor 2 binding (GO:0043184)|vascular endothelial growth factor receptor binding (GO:0005172)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Aflibercept(DB08885)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Dalteparin(DB06779)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Vandetanib(DB05294)	CCAGGCCCTGGCCCGGGCCTCGGGCCGGGGAGGAA	0.791																																					p.139_144del		Atlas-INDEL	.											.	VEGFA	21	.	0			c.417_431del						.																																			SO:0001631	upstream_gene_variant	7422	exon1			.	AB021221	CCDS34457.1, CCDS4907.2, CCDS34458.1, CCDS47432.1, CCDS47433.1, CCDS47434.1, CCDS47435.1, CCDS55007.1, CCDS55008.1, CCDS55009.1, CCDS55010.1, CCDS55011.1, CCDS55012.1, CCDS55013.1, CCDS55014.1, CCDS55015.1, CCDS69125.1	6p12	2008-02-05	2006-10-31	2006-10-31	ENSG00000112715	ENSG00000112715			12680	protein-coding gene	gene with protein product		192240	"""vascular endothelial growth factor"""	VEGF		8786112	Standard	NM_001025366		Approved	VEGF-A, VPF	uc003owh.3	P15692	OTTHUMG00000014745		chr6.hg19:g.43738861_43738875delGCCCGGGCCTCGGGC	Exception_encountered	56.0	0.0		46.0	10.0	NM_001204385	B5BU86|H0Y2S8|H0Y407|H0Y414|H0Y462|H0Y8N2|H3BLW7|O60720|O75875|Q074Z4|Q16889|Q5UB46|Q6P0P5|Q96KJ0|Q96L82|Q96NW5|Q9H1W8|Q9H1W9|Q9UH58|Q9UL23	In_Frame_Del	DEL	ENST00000523873.1	hg19	CCDS55010.1																																																																																			.	.		0.791	VEGFA-021	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374460.1	NM_001025366	
DHX57	90957	hgsc.bcm.edu	37	2	39046078	39046104	+	Splice_Site	DEL	CTTCTTTTGTACTTAGCTGCCATCCCT	CTTCTTTTGTACTTAGCTGCCATCCCT	-	rs147441334		TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	CTTCTTTTGTACTTAGCTGCCATCCCT	CTTCTTTTGTACTTAGCTGCCATCCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr2:39046078_39046104delCTTCTTTTGTACTTAGCTGCCATCCCT	ENST00000295373.6	-	19	3514_3538	c.3388_3412delAGGGATGGCAGCTAAGTACAAAAGAAG	c.(3388-3414)agggatggcagctaagtacaaaagaag>ag	p.RDGS*VQKK1130del		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1130							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				GCACGCACGCCTTCTTTTGTACTTAGCTGCCATCCCTAAATTTTGGA	0.366																																					p.1130_1138del	Melanoma(191;1090 2095 4375 23729 47341)	Atlas-Indel,Pindel	.											.	DHX57	127	.	0			c.3388_3413del						.																																			SO:0001630	splice_region_variant	90957	exon19			.	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3388-1AGGGATGGCAGCTAAGTACAAAAGAAG>-	chr2.hg19:g.39046078_39046104delCTTCTTTTGTACTTAGCTGCCATCCCT		114.0	0.0		80.0	11.0	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Frame_Shift_Del	DEL	ENST00000295373.6	hg19	CCDS1800.1																																																																																			.	.		0.366	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	In_Frame_Del
RALGPS1	9649	hgsc.bcm.edu	37	9	129831597	129831597	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr9:129831597delT	ENST00000259351.5	+	8	839	c.572delT	c.(571-573)atcfs	p.I191fs	RALGPS1_ENST00000373436.1_Frame_Shift_Del_p.I191fs|RALGPS1_ENST00000373434.1_Frame_Shift_Del_p.I191fs|RALGPS1_ENST00000394022.3_Frame_Shift_Del_p.I191fs|RALGPS1_ENST00000424082.2_Frame_Shift_Del_p.I191fs	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	191	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)			kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						CGGGAATATATCCGAAGCCTG	0.368																																					p.I191fs		Atlas-Indel,Pindel	.											.	RALGPS1	86	.	0			c.571delA						.						108.0	111.0	110.0					9																	129831597		2203	4300	6503	SO:0001589	frameshift_variant	9649	exon8			.	AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.572delT	chr9.hg19:g.129831597delT	ENSP00000259351:p.Ile191fs	113.0	0.0		94.0	28.0	NM_001190729	B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Frame_Shift_Del	DEL	ENST00000259351.5	hg19	CCDS35143.1																																																																																			.	.		0.368	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054133.1	NM_014636	
IL23R	149233	hgsc.bcm.edu	37	1	67666504	67666505	+	Frame_Shift_Ins	INS	-	-	T			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:67666504_67666505insT	ENST00000347310.5	+	5	747_748	c.576_577insT	c.(577-579)ttgfs	p.L193fs	IL23R_ENST00000371002.1_Frame_Shift_Ins_p.L193fs|C1orf141_ENST00000371007.2_Intron	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	193	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						GCAAGAAGTACTTGGTTTGGGT	0.371																																					p.Y192fs		Atlas-Indel,Pindel	.											.	IL23R	52	.	0			c.576_577insT						.																																			SO:0001589	frameshift_variant	149233	exon5			.	AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.578dupT	chr1.hg19:g.67666506_67666506dupT	ENSP00000321345:p.Leu193fs	360.0	0.0		296.0	83.0	NM_144701	C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Frame_Shift_Ins	INS	ENST00000347310.5	hg19	CCDS637.1																																																																																			.	.		0.371	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2	NM_144701	
ANKRD20A2	441430	hgsc.bcm.edu	37	9	42372341	42372341	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr9:42372341delT	ENST00000377601.2	+	3	570	c.458delT	c.(457-459)cttfs	p.L153fs		NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2	153										large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						GAAAAACTGCTTTCCCATGGT	0.418																																					p.L153fs		Atlas-INDEL	.											.	.	.	.	0			c.457delC						.						1.0	1.0	1.0					9																	42372341		47	88	135	SO:0001589	frameshift_variant	441425	exon3			.		CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.458delT	chr9.hg19:g.42372341delT	ENSP00000366826:p.Leu153fs	134.0	0.0		140.0	20.0	NM_001012419		Frame_Shift_Del	DEL	ENST00000377601.2	hg19	CCDS35028.1																																																																																			.	.		0.418	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129794.1	NM_001012421	
ARSD	414	hgsc.bcm.edu	37	X	2827944	2827966	+	Frame_Shift_Del	DEL	GGCCGGGAGCACCCCCGGCCAGT	GGCCGGGAGCACCCCCGGCCAGT	-	rs144863992		TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	GGCCGGGAGCACCCCCGGCCAGT	GGCCGGGAGCACCCCCGGCCAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chrX:2827944_2827966delGGCCGGGAGCACCCCCGGCCAGT	ENST00000381154.1	-	8	1265_1287	c.1190_1212delACTGGCCGGGGGTGCTCCCGGCC	c.(1189-1212)cactggccgggggtgctcccggccfs	p.HWPGVLPA397fs		NM_001669.3	NP_001660.2	P51689	ARSD_HUMAN	arylsulfatase D	397					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			large_intestine(3)|lung(3)	6		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCACTCGGCCGGCCGGGAGCACCCCCGGCCAGTGGAAGATCCC	0.619																																					p.397_405del		Atlas-Indel,Pindel	.											.	ARSD	47	.	0			c.1191_1213del						.																																			SO:0001589	frameshift_variant	414	exon8			.	X83572	CCDS35196.1	Xp22.3	2013-02-14			ENSG00000006756	ENSG00000006756		"""Arylsulfatase family"""	717	protein-coding gene	gene with protein product		300002				7720070	Standard	NM_001669		Approved		uc004cqy.3	P51689	OTTHUMG00000021077	ENST00000381154.1:c.1190_1212delACTGGCCGGGGGTGCTCCCGGCC	chrX.hg19:g.2827944_2827966delGGCCGGGAGCACCCCCGGCCAGT	ENSP00000370546:p.His397fs	283.0	0.0		287.0	135.0	NM_001669	Q9UHJ8	Frame_Shift_Del	DEL	ENST00000381154.1	hg19	CCDS35196.1																																																																																			.	.		0.619	ARSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055636.1		
ANKRD20A1	84210	hgsc.bcm.edu	37	9	67930803	67930803	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr9:67930803delT	ENST00000377477.2	+	3	570	c.458delT	c.(457-459)cttfs	p.L153fs		NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1	153						plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						GAAAAACTGCTTTCCCATGGT	0.418																																					p.L153fs		Atlas-INDEL	.											.	.	.	.	0			c.457delC						.						3.0	4.0	4.0					9																	67930803		307	944	1251	SO:0001589	frameshift_variant	441425	exon3			.	AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594	ENST00000377477.2:c.458delT	chr9.hg19:g.67930803delT	ENSP00000366697:p.Leu153fs	83.0	0.0		87.0	15.0	NM_001012419	Q9H0H6	Frame_Shift_Del	DEL	ENST00000377477.2	hg19	CCDS6620.1																																																																																			.	.		0.418	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083800.1		
ANKRD20A4	728747	hgsc.bcm.edu	37	9	69386021	69386021	+	Frame_Shift_Del	DEL	T	T	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr9:69386021delT	ENST00000357336.3	+	3	739	c.458delT	c.(457-459)cttfs	p.L153fs		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	153										breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						GAAAAACTGCTTTCCCATGGT	0.418																																					p.L153fs		Atlas-INDEL	.											.	ANKRD20A4	38	.	0			c.457delC						.						1.0	1.0	1.0					9																	69386021		76	174	250	SO:0001589	frameshift_variant	728747	exon3			.		CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.458delT	chr9.hg19:g.69386021delT	ENSP00000349891:p.Leu153fs	124.0	0.0		116.0	13.0	NM_001098805		Frame_Shift_Del	DEL	ENST00000357336.3	hg19	CCDS43828.1																																																																																			.	.		0.418	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143287.3	NM_001098805	
TNFAIP6	7130	hgsc.bcm.edu	37	2	152235980	152235981	+	Frame_Shift_Ins	INS	-	-	A			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr2:152235980_152235981insA	ENST00000243347.3	+	6	842_843	c.767_768insA	c.(766-771)ggaaaafs	p.GK256fs		NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	256					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	TCCAGTCAAGGAAAAAATACAA	0.337																																					p.G256fs		Atlas-Indel,Pindel	.											.	TNFAIP6	98	.	0			c.767_768insA						.																																			SO:0001589	frameshift_variant	7130	exon6			.		CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.773dupA	chr2.hg19:g.152235986_152235986dupA	ENSP00000243347:p.Gly256fs	172.0	0.0		165.0	34.0	NM_007115	Q53TI7|Q8WWI9	Frame_Shift_Ins	INS	ENST00000243347.3	hg19	CCDS2193.1																																																																																			.	.		0.337	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254834.2	NM_007115	
TP53	7157	hgsc.bcm.edu	37	17	7579559	7579559	+	Frame_Shift_Del	DEL	A	A	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr17:7579559delA	ENST00000269305.4	-	4	317	c.128delT	c.(127-129)ttgfs	p.L43fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.L43fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.L43fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.L43fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Del_p.L43fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.L43fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	43	Interaction with HRMT1L2.|Transcription activation (acidic).		L -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S37fs*79(1)|p.L43fs*7(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGACAGCATCAAATCATCCAT	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.L43fs	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53	33396	.	12	Whole gene deletion(8)|Deletion - Frameshift(4)	bone(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|ovary(1)|prostate(1)	c.129delG						.						169.0	166.0	167.0					17																	7579559		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.128delT	chr17.hg19:g.7579559delA	ENSP00000269305:p.Leu43fs	92.0	0.0		58.0	26.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RERE	473	hgsc.bcm.edu	37	1	8416253	8416255	+	In_Frame_Del	DEL	GGT	GGT	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	GGT	GGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr1:8416253_8416255delGGT	ENST00000337907.3	-	22	5025_5027	c.4391_4393delACC	c.(4390-4395)cacctg>ctg	p.H1464del	RERE_ENST00000476556.1_In_Frame_Del_p.H910del|RERE_ENST00000400907.2_Intron|RERE_ENST00000377464.1_In_Frame_Del_p.H1196del|RERE_ENST00000400908.2_In_Frame_Del_p.H1464del	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1464	Pro-rich.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		AAGCGAGCCAGGTGGGGACCGGC	0.626																																					p.1464_1465del		Atlas-Indel,Pindel	.											.	RERE	129	.	0			c.4392_4394del						.																																			SO:0001651	inframe_deletion	473	exon22			.	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.4391_4393delACC	chr1.hg19:g.8416253_8416255delGGT	ENSP00000338629:p.His1464del	105.0	0.0		185.0	57.0	NM_012102	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	In_Frame_Del	DEL	ENST00000337907.3	hg19	CCDS95.1																																																																																			.	.		0.626	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
RB1	5925	hgsc.bcm.edu	37	13	49037924	49037924	+	Frame_Shift_Del	DEL	A	A	-	rs587778849		TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr13:49037924delA	ENST00000267163.4	+	21	2302	c.2164delA	c.(2164-2166)aaafs	p.K722fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	722	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(10)|p.I703_E737del(2)|p.C712_A727del(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCTTAAATTCAAAATCATTGT	0.294		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.F721fs		Pindel	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	28	Whole gene deletion(15)|Unknown(10)|Deletion - In frame(3)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|ovary(1)|prostate(1)|liver(1)	c.2163delC	GRCh37	CM030514	RB1	M		.						109.0	115.0	112.0					13																	49037924		2203	4288	6491	SO:0001589	frameshift_variant	5925	exon21	Familial Cancer Database		.	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2164delA	chr13.hg19:g.49037924delA	ENSP00000267163:p.Lys722fs	443.0	0.0		397.0	115.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	ENST00000267163.4	hg19	CCDS31973.1																																																																																			.	.		0.294	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
VEGFA	7422	hgsc.bcm.edu	37	6	43738861	43738876	+	5'Flank	DEL	GCCCGGGCCTCGGGCC	GCCCGGGCCTCGGGCC	-			TCGA-5C-AAPD-01A-21D-A38X-10	TCGA-5C-AAPD-10A-01D-A38X-10	GCCCGGGCCTCGGGCC	GCCCGGGCCTCGGGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fb2728b8-fc2d-4f40-98b0-649f020fd475	94fbe599-361a-4bfb-9e37-dae2c10b4ddd	g.chr6:43738861_43738876delGCCCGGGCCTCGGGCC	ENST00000523873.1	+	0	0				VEGFA_ENST00000372067.3_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000417285.2_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000230480.6_5'Flank|RP1-261G23.7_ENST00000607600.1_RNA|VEGFA_ENST00000523950.1_5'Flank|VEGFA_ENST00000518689.1_5'Flank|VEGFA_ENST00000324450.6_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000372077.4_5'UTR|VEGFA_ENST00000372064.4_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000520948.1_5'UTR|VEGFA_ENST00000372055.4_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000518824.1_5'Flank|VEGFA_ENST00000482630.2_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000413642.3_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000523125.1_5'Flank|VEGFA_ENST00000425836.2_Frame_Shift_Del_p.ARASGR140fs|VEGFA_ENST00000457104.2_5'Flank			P15692	VEGFA_HUMAN	vascular endothelial growth factor A						activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|basophil chemotaxis (GO:0002575)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|camera-type eye morphogenesis (GO:0048593)|cardiac muscle fiber development (GO:0048739)|cardiac vascular smooth muscle cell development (GO:0060948)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to hypoxia (GO:0071456)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|dopaminergic neuron differentiation (GO:0071542)|endothelial cell chemotaxis (GO:0035767)|epithelial cell differentiation (GO:0030855)|eye photoreceptor cell development (GO:0042462)|growth (GO:0040007)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|induction of positive chemotaxis (GO:0050930)|kidney development (GO:0001822)|lactation (GO:0007595)|lung development (GO:0030324)|lymph vessel morphogenesis (GO:0036303)|macrophage differentiation (GO:0030225)|mammary gland alveolus development (GO:0060749)|mesoderm development (GO:0007498)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|outflow tract morphogenesis (GO:0003151)|ovarian follicle development (GO:0001541)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cellular component movement (GO:0051272)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein localization to early endosome (GO:1902966)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor internalization (GO:0002092)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular permeability (GO:0043117)|post-embryonic camera-type eye development (GO:0031077)|primitive erythrocyte differentiation (GO:0060319)|regulation of cell shape (GO:0008360)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)|surfactant homeostasis (GO:0043129)|tube formation (GO:0035148)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|VEGF-activated neuropilin signaling pathway (GO:0038190)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|neuropilin binding (GO:0038191)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor agonist activity (GO:0048018)|vascular endothelial growth factor receptor 1 binding (GO:0043183)|vascular endothelial growth factor receptor 2 binding (GO:0043184)|vascular endothelial growth factor receptor binding (GO:0005172)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Aflibercept(DB08885)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Dalteparin(DB06779)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Vandetanib(DB05294)	CCAGGCCCTGGCCCGGGCCTCGGGCCGGGGAGGAAG	0.792																																					p.139_144del		Pindel	.											.	VEGFA	21	.	0			c.417_432del						.																																			SO:0001631	upstream_gene_variant	7422	exon1			.	AB021221	CCDS34457.1, CCDS4907.2, CCDS34458.1, CCDS47432.1, CCDS47433.1, CCDS47434.1, CCDS47435.1, CCDS55007.1, CCDS55008.1, CCDS55009.1, CCDS55010.1, CCDS55011.1, CCDS55012.1, CCDS55013.1, CCDS55014.1, CCDS55015.1, CCDS69125.1	6p12	2008-02-05	2006-10-31	2006-10-31	ENSG00000112715	ENSG00000112715			12680	protein-coding gene	gene with protein product		192240	"""vascular endothelial growth factor"""	VEGF		8786112	Standard	NM_001025366		Approved	VEGF-A, VPF	uc003owh.3	P15692	OTTHUMG00000014745		chr6.hg19:g.43738861_43738876delGCCCGGGCCTCGGGCC	Exception_encountered	60.0	0.0		51.0	13.0	NM_001171622	B5BU86|H0Y2S8|H0Y407|H0Y414|H0Y462|H0Y8N2|H3BLW7|O60720|O75875|Q074Z4|Q16889|Q5UB46|Q6P0P5|Q96KJ0|Q96L82|Q96NW5|Q9H1W8|Q9H1W9|Q9UH58|Q9UL23	Frame_Shift_Del	DEL	ENST00000523873.1	hg19	CCDS55010.1																																																																																			.	.		0.792	VEGFA-021	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374460.1	NM_001025366	
