#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MFAP2	4237	hgsc.bcm.edu	37	1	17298042	17298042	+	IGR	SNP	A	A	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:17298042A>T	ENST00000375535.3	-	0	1260				CROCC_ENST00000375541.5_Missense_Mutation_p.Q1956L|MFAP2_ENST00000490075.1_5'Flank			P55001	MFAP2_HUMAN	microfibrillar-associated protein 2						extracellular matrix organization (GO:0030198)|platelet formation (GO:0030220)	extracellular region (GO:0005576)|microfibril (GO:0001527)				kidney(1)|lung(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000118)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000538)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|COAD - Colon adenocarcinoma(227;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;3.04e-05)|Kidney(64;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00544)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GAGCTGCAGCAGGAGGTGGAG	0.731																																					p.Q1956L		Atlas-SNP	.											.	CROCC	185	.	0			c.A5867T						.						5.0	6.0	5.0					1																	17298042		1971	3830	5801	SO:0001628	intergenic_variant	9696	exon36			TGCAGCAGGAGGT	BC015039	CCDS174.1, CCDS44071.1	1p36.1-p35	2008-02-05			ENSG00000117122	ENSG00000117122			7033	protein-coding gene	gene with protein product		156790				7759096	Standard	NM_017459		Approved	MAGP, MAGP-1	uc001azw.3	P55001	OTTHUMG00000002290		chr1.hg19:g.17298042A>T		117.0	0.0		75.0	28.0	NM_014675	Q53X60|Q5JXY0	Missense_Mutation	SNP	ENST00000375535.3	hg19	CCDS174.1	.	.	.	.	.	.	.	.	.	.	A	11.32	1.605096	0.28623	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.09911	2.93	4.52	2.18	0.27775	.	.	.	.	.	T	0.04543	0.0124	N	0.10916	0.065	0.34564	D	0.712698	B;B;B	0.22346	0.068;0.068;0.019	B;B;B	0.19391	0.025;0.025;0.025	T	0.33369	-0.9871	9	0.23891	T	0.37	.	2.7668	0.05322	0.601:0.0:0.2094:0.1896	.	1837;1259;1956	B1AKD8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	L	1956;1837	ENSP00000364691:Q1956L	ENSP00000364691:Q1956L	Q	+	2	0	CROCC	17170629	0.994000	0.37717	1.000000	0.80357	0.793000	0.44817	0.293000	0.19029	0.599000	0.29845	0.402000	0.26972	CAG	.	.		0.731	MFAP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000006609.1	NM_002403	
VWA5B1	127731	hgsc.bcm.edu	37	1	20644146	20644146	+	Silent	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:20644146C>A	ENST00000375079.2	+	5	883	c.687C>A	c.(685-687)atC>atA	p.I229I	VWA5B1_ENST00000289825.4_5'UTR|VWA5B1_ENST00000375083.4_Silent_p.I229I|VWA5B1_ENST00000289815.8_Silent_p.I229I|RP4-745E8.2_ENST00000444923.1_RNA	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	229						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						AGCTGGAGATCCGTGGGCCAT	0.607																																					p.I229I		Atlas-SNP	.											.	VWA5B1	44	.	0			c.C687A						.						96.0	84.0	88.0					1																	20644146		692	1591	2283	SO:0001819	synonymous_variant	127731	exon5			GGAGATCCGTGGG	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.687C>A	chr1.hg19:g.20644146C>A		124.0	0.0		68.0	15.0	NM_001039500	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Silent	SNP	ENST00000375079.2	hg19																																																																																				.	.		0.607	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
RCAN3	11123	hgsc.bcm.edu	37	1	24859580	24859580	+	Missense_Mutation	SNP	T	T	C	rs537312929		TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:24859580T>C	ENST00000374395.4	+	4	690	c.377T>C	c.(376-378)aTg>aCg	p.M126T	RCAN3_ENST00000436717.2_Intron|RCAN3_ENST00000538532.1_Missense_Mutation_p.M68T|RCAN3_ENST00000374393.2_Intron|RCAN3_ENST00000412742.2_Intron	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	126					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		CAGGTGCAGATGTCCGGCGAA	0.552													T|||	1	0.000199681	0.0	0.0	5008	,	,		13003	0.0		0.0	False		,,,				2504	0.001				p.M126T		Atlas-SNP	.											.	RCAN3	22	.	0			c.T377C						.						53.0	46.0	49.0					1																	24859580		2203	4300	6503	SO:0001583	missense	11123	exon4			TGCAGATGTCCGG		CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.377T>C	chr1.hg19:g.24859580T>C	ENSP00000363516:p.Met126Thr	98.0	0.0		64.0	25.0	NM_001251979	A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Missense_Mutation	SNP	ENST00000374395.4	hg19	CCDS254.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.726501	0.00694	.	.	ENSG00000117602	ENST00000374395;ENST00000538532	T;T	0.41065	1.09;1.01	5.08	-1.65	0.08291	.	0.723471	0.14800	N	0.297716	T	0.09247	0.0228	N	0.00332	-1.63	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.44065	-0.9352	10	0.05721	T	0.95	-16.5523	10.0284	0.42085	0.0:0.3978:0.0:0.6022	.	68;126	A4GU14;Q9UKA8	.;RCAN3_HUMAN	T	126;68	ENSP00000363516:M126T;ENSP00000445401:M68T	ENSP00000363516:M126T	M	+	2	0	RCAN3	24732167	1.000000	0.71417	0.073000	0.20177	0.038000	0.13279	2.015000	0.40961	-0.370000	0.08016	-0.410000	0.06199	ATG	.	.		0.552	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009176.2		
NCDN	23154	hgsc.bcm.edu	37	1	36029507	36029507	+	Missense_Mutation	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:36029507C>A	ENST00000373243.2	+	6	2133	c.1750C>A	c.(1750-1752)Cca>Aca	p.P584T	NCDN_ENST00000373253.3_Missense_Mutation_p.P567T|NCDN_ENST00000356090.4_Missense_Mutation_p.P584T	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	584					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TAGCACCTCTCCAGGTAAGAA	0.562																																					p.P584T		Atlas-SNP	.											.	NCDN	79	.	0			c.C1750A						.						40.0	39.0	40.0					1																	36029507		2203	4300	6503	SO:0001583	missense	23154	exon6			ACCTCTCCAGGTA	AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.1750C>A	chr1.hg19:g.36029507C>A	ENSP00000362340:p.Pro584Thr	65.0	0.0		54.0	32.0	NM_014284	D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Missense_Mutation	SNP	ENST00000373243.2	hg19	CCDS392.1	.	.	.	.	.	.	.	.	.	.	C	12.80	2.045917	0.36085	.	.	ENSG00000020129	ENST00000373253;ENST00000356090;ENST00000373243	.	.	.	4.39	4.39	0.52855	.	0.221552	0.38058	N	0.001821	T	0.27169	0.0666	N	0.22421	0.69	0.37629	D	0.921616	B	0.34372	0.451	B	0.30029	0.11	T	0.17137	-1.0379	9	0.23302	T	0.38	.	6.6022	0.22707	0.0:0.6976:0.2012:0.1012	.	584	Q9UBB6	NCDN_HUMAN	T	567;584;584	.	ENSP00000348394:P584T	P	+	1	0	NCDN	35802094	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.003000	0.40844	1.993000	0.58246	0.462000	0.41574	CCA	.	.		0.562	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131298.1	NM_014284	
ZNF691	51058	hgsc.bcm.edu	37	1	43315395	43315395	+	Missense_Mutation	SNP	G	G	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:43315395G>T	ENST00000397044.3	+	2	456	c.66G>T	c.(64-66)atG>atT	p.M22I	ZNF691_ENST00000372502.1_5'Flank|ZNF691_ENST00000372506.1_5'UTR|ZNF691_ENST00000372508.3_Intron|ZNF691_ENST00000372504.1_5'UTR|ZNF691_ENST00000372507.1_Intron			Q5VV52	ZN691_HUMAN	zinc finger protein 691	22						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CGGAGGAAATGCTACCACTCT	0.488																																					p.M22I		Atlas-SNP	.											.	ZNF691	30	.	0			c.G66T						.																																			SO:0001583	missense	51058	exon3			GGAAATGCTACCA		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000397044.3:c.66G>T	chr1.hg19:g.43315395G>T	ENSP00000380237:p.Met22Ile	152.0	0.0		125.0	48.0	NM_001242739	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000397044.3	hg19	CCDS55595.1	.	.	.	.	.	.	.	.	.	.	G	8.130	0.782881	0.16189	.	.	ENSG00000164011	ENST00000397044;ENST00000372503	T	0.08193	3.12	1.78	0.844	0.18943	.	.	.	.	.	T	0.03915	0.0110	N	0.08118	0	0.09310	N	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.40664	-0.9551	9	0.46703	T	0.11	.	4.2432	0.10658	0.2135:0.0:0.7865:0.0	.	22	B4DJR7	.	I	22	ENSP00000380237:M22I	ENSP00000361581:M22I	M	+	3	0	ZNF691	43087982	0.000000	0.05858	0.007000	0.13788	0.015000	0.08874	-1.673000	0.01951	0.305000	0.22832	-0.192000	0.12808	ATG	.	.		0.488	ZNF691-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_015911	
EPS8L3	79574	hgsc.bcm.edu	37	1	110293318	110293318	+	Silent	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:110293318G>A	ENST00000361965.4	-	18	1840	c.1734C>T	c.(1732-1734)atC>atT	p.I578I	EPS8L3_ENST00000369805.3_Silent_p.I579I|EPS8L3_ENST00000361852.4_Silent_p.I548I|RP4-735C1.4_ENST00000431955.1_RNA	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	578						cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GCCGGGACAGGATTCGTGGGG	0.612																																					p.I579I		Atlas-SNP	.											.	EPS8L3	73	.	0			c.C1737T						.						62.0	49.0	53.0					1																	110293318		2203	4300	6503	SO:0001819	synonymous_variant	79574	exon18			GGACAGGATTCGT	AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1734C>T	chr1.hg19:g.110293318G>A		127.0	0.0		97.0	5.0	NM_139053	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Silent	SNP	ENST00000361965.4	hg19	CCDS814.1																																																																																			.	.		0.612	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526	
KCNN3	3782	hgsc.bcm.edu	37	1	154842095	154842095	+	Missense_Mutation	SNP	A	A	T	rs76110919		TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:154842095A>T	ENST00000271915.4	-	1	661	c.346T>A	c.(346-348)Tcc>Acc	p.S116T	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	121					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ATGGCGGTGGAGTTGGACGAA	0.632																																					p.S116T		Atlas-SNP	.											.	KCNN3	141	.	0			c.T346A						.						48.0	40.0	43.0					1																	154842095		2203	4300	6503	SO:0001583	missense	3782	exon1			CGGTGGAGTTGGA	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.346T>A	chr1.hg19:g.154842095A>T	ENSP00000271915:p.Ser116Thr	213.0	0.0		260.0	17.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.41|13.41	2.229373|2.229373	0.39399|0.39399	.|.	.|.	ENSG00000143603|ENSG00000143603	ENST00000539103|ENST00000271915	.|D	.|0.96365	.|-3.99	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|0.165944	.|0.29172	.|N	.|0.012936	D|D	0.86272|0.86272	0.5893|0.5893	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	.|P;B	.|0.48764	.|0.915;0.378	.|B;B	.|0.36959	.|0.237;0.073	D|D	0.88373|0.88373	0.2996|0.2996	6|10	0.87932|0.39692	D|T	0|0.17	-26.9966|-26.9966	12.737|12.737	0.57230|0.57230	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|122;121	.|Q6JXY2;Q9UGI6	.|.;KCNN3_HUMAN	H|T	210|116	.|ENSP00000271915:S116T	ENSP00000442214:L210H|ENSP00000271915:S116T	L|S	-|-	2|1	0|0	KCNN3|KCNN3	153108719|153108719	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.358000|3.358000	0.52284|0.52284	2.110000|2.110000	0.64415|0.64415	0.460000|0.460000	0.39030|0.39030	CTC|TCC	.	.		0.632	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
SHC1	6464	hgsc.bcm.edu	37	1	154940971	154940971	+	Splice_Site	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:154940971C>A	ENST00000368445.5	-	4	964	c.750G>T	c.(748-750)caG>caT	p.Q250H	SHC1_ENST00000368453.4_Splice_Site_p.Q140H|SHC1_ENST00000368449.4_Splice_Site_p.Q21H|SHC1_ENST00000490667.1_5'Flank|SHC1_ENST00000448116.2_Splice_Site_p.Q250H|SHC1_ENST00000368450.1_Splice_Site_p.Q140H|SHC1_ENST00000606391.1_Splice_Site_p.Q51H	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	250	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTTCACCAACCTGTTTGCAGT	0.542																																					p.Q250H	NSCLC(4;32 234 1864 2492 3259 13747 17376)	Atlas-SNP	.											.	SHC1	91	.	0			c.G750T						.						215.0	226.0	223.0					1																	154940971		2203	4300	6503	SO:0001630	splice_region_variant	6464	exon4			ACCAACCTGTTTG	U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.750+1G>T	chr1.hg19:g.154940971C>A		83.0	0.0		104.0	68.0	NM_183001	B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	hg19	CCDS30881.1	.	.	.	.	.	.	.	.	.	.	C	32	5.171568	0.94807	.	.	ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368449;ENST00000368453;ENST00000368450;ENST00000368443;ENST00000414115;ENST00000444179;ENST00000412170	T;T;T;T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06;2.49;2.06;2.06	5.51	5.51	0.81932	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	M	0.81942	2.565	0.80722	D	1	P;P;P	0.48407	0.91;0.693;0.538	P;P;P	0.58391	0.838;0.69;0.591	T	0.14144	-1.0483	9	.	.	.	.	19.4272	0.94746	0.0:1.0:0.0:0.0	.	29;250;250	Q59HB0;P29353-6;P29353	.;.;SHC1_HUMAN	H	250;250;51;140;140;186;21;21;140	ENSP00000357430:Q250H;ENSP00000401303:Q250H;ENSP00000357434:Q51H;ENSP00000357438:Q140H;ENSP00000357435:Q140H;ENSP00000404908:Q21H;ENSP00000398864:Q21H;ENSP00000398441:Q140H	.	Q	-	3	2	SHC1	153207595	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.276000	0.78559	2.590000	0.87494	0.467000	0.42956	CAG	.	.		0.542	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001	Missense_Mutation
ACKR1	2532	hgsc.bcm.edu	37	1	159176208	159176208	+	Missense_Mutation	SNP	T	T	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:159176208T>A	ENST00000368122.2	+	2	1658	c.979T>A	c.(979-981)Tct>Act	p.S327T	DARC_ENST00000537147.1_Missense_Mutation_p.S327T|CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000368121.2_Missense_Mutation_p.S329T	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		327					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					AGGATGGTCTTCTCATCTGGA	0.532																																					p.S329T		Atlas-SNP	.											.	DARC	76	.	0			c.T985A						.						213.0	230.0	225.0					1																	159176208		2203	4300	6503	SO:0001583	missense	2532	exon1			TGGTCTTCTCATC																												ENST00000368122.2:c.979T>A	chr1.hg19:g.159176208T>A	ENSP00000357104:p.Ser327Thr	111.0	0.0		132.0	36.0	NM_001122951	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	ENST00000368122.2	hg19	CCDS1183.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372147	0.61624	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.02369	4.33;4.33;4.32	5.4	3.11	0.35812	.	.	.	.	.	T	0.02083	0.0065	L	0.39898	1.24	0.09310	N	0.999999	D;D	0.54772	0.968;0.968	P;P	0.53450	0.726;0.726	T	0.46048	-0.9219	9	0.87932	D	0	-5.3364	6.8845	0.24191	0.0:0.1832:0.0:0.8168	.	329;327	Q5Y7A1;Q16570	.;DUFFY_HUMAN	T	327;327;327;329	ENSP00000357104:S327T;ENSP00000441985:S327T;ENSP00000357103:S329T	ENSP00000352341:S327T	S	+	1	0	DARC	157442832	0.479000	0.25925	0.255000	0.24374	0.740000	0.42216	0.466000	0.22019	0.457000	0.26962	0.533000	0.62120	TCT	.	.		0.532	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090338.2		
PRG4	10216	hgsc.bcm.edu	37	1	186281352	186281352	+	Missense_Mutation	SNP	A	A	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:186281352A>G	ENST00000445192.2	+	11	3884	c.3839A>G	c.(3838-3840)aAg>aGg	p.K1280R	TPR_ENST00000367478.4_3'UTR|PRG4_ENST00000367484.3_Missense_Mutation_p.K809R|PRG4_ENST00000367485.4_Missense_Mutation_p.K1187R|PRG4_ENST00000367483.4_Missense_Mutation_p.K1239R|RNU6-1240P_ENST00000365155.1_RNA|PRG4_ENST00000367486.3_Missense_Mutation_p.K1237R	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	1280					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CCTGTACAGAAGTGCCCTGGA	0.398																																					p.K1280R		Atlas-SNP	.											.	PRG4	259	.	0			c.A3839G						.						97.0	97.0	97.0					1																	186281352		2203	4300	6503	SO:0001583	missense	10216	exon11			TACAGAAGTGCCC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.3839A>G	chr1.hg19:g.186281352A>G	ENSP00000399679:p.Lys1280Arg	144.0	0.0		199.0	128.0	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	hg19	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	A	11.08	1.534293	0.27475	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T	0.06449	3.3;3.43;3.39;3.3;3.42	5.38	4.24	0.50183	Hemopexin/matrixin (2);	0.137606	0.32459	N	0.006077	T	0.07188	0.0182	L	0.42245	1.32	0.23366	N	0.997823	P;P;P;P	0.40050	0.694;0.694;0.7;0.694	B;B;B;P	0.44623	0.37;0.37;0.357;0.455	T	0.25187	-1.0139	10	0.34782	T	0.22	-5.4422	3.1118	0.06361	0.6349:0.148:0.0756:0.1416	.	1146;1187;1280;1239	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	R	1237;809;1239;1187;1280	ENSP00000356456:K1237R;ENSP00000356454:K809R;ENSP00000356453:K1239R;ENSP00000356455:K1187R;ENSP00000399679:K1280R	ENSP00000356453:K1239R	K	+	2	0	PRG4	184547975	0.976000	0.34144	0.907000	0.35723	0.653000	0.38743	1.429000	0.34903	0.962000	0.38057	0.477000	0.44152	AAG	.	.		0.398	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PQLC3	130814	hgsc.bcm.edu	37	2	11317882	11317882	+	Silent	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr2:11317882C>T	ENST00000295083.3	+	7	712	c.537C>T	c.(535-537)atC>atT	p.I179I	PQLC3_ENST00000402361.1_3'UTR|PQLC3_ENST00000441908.2_Silent_p.I165I	NM_152391.3	NP_689604.1	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3	179						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)		GTTTTGTGATCATGCTGGCTT	0.368																																					p.I179I		Atlas-SNP	.											.	PQLC3	8	.	0			c.C537T						.						85.0	84.0	84.0					2																	11317882		2203	4300	6503	SO:0001819	synonymous_variant	130814	exon7			TGTGATCATGCTG	BC027625	CCDS1679.1, CCDS62856.1, CCDS62857.1	2p25.1	2004-02-05	2005-07-19	2005-07-19	ENSG00000162976	ENSG00000162976			28503	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 22"""	C2orf22		12477932	Standard	NM_001282711		Approved	MGC33602	uc002rbc.3	Q8N755	OTTHUMG00000119055	ENST00000295083.3:c.537C>T	chr2.hg19:g.11317882C>T		51.0	0.0		54.0	30.0	NM_152391	B2R8K1|B4DWA4	Silent	SNP	ENST00000295083.3	hg19	CCDS1679.1																																																																																			.	.		0.368	PQLC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239266.4	NM_152391	
EMILIN1	11117	hgsc.bcm.edu	37	2	27305559	27305559	+	Missense_Mutation	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr2:27305559G>A	ENST00000380320.4	+	4	1619	c.1120G>A	c.(1120-1122)Ggc>Agc	p.G374S		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	374					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTCGTGGCCGGCTCAGTGAC	0.726																																					p.G374S		Atlas-SNP	.											.	EMILIN1	75	.	0			c.G1120A						.						7.0	6.0	6.0					2																	27305559		2070	4081	6151	SO:0001583	missense	11117	exon4			GTGGCCGGCTCAG	AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.1120G>A	chr2.hg19:g.27305559G>A	ENSP00000369677:p.Gly374Ser	114.0	0.0		103.0	24.0	NM_007046	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	ENST00000380320.4	hg19	CCDS1733.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465105	0.43839	.	.	ENSG00000138080	ENST00000380320	T	0.64260	-0.09	5.25	4.38	0.52667	.	0.077352	0.51477	D	0.000083	T	0.40619	0.1124	L	0.27053	0.805	0.42202	D	0.991778	P	0.36438	0.553	B	0.23574	0.047	T	0.28586	-1.0039	10	0.14252	T	0.57	-19.2585	11.4969	0.50413	0.0881:0.0:0.9119:0.0	.	374	Q9Y6C2	EMIL1_HUMAN	S	374	ENSP00000369677:G374S	ENSP00000369677:G374S	G	+	1	0	EMILIN1	27159063	0.973000	0.33851	0.958000	0.39756	0.299000	0.27559	1.613000	0.36900	1.227000	0.43598	0.407000	0.27541	GGC	.	.		0.726	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214185.1	NM_007046	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	239.0	0.0		273.0	11.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
DNAH7	56171	hgsc.bcm.edu	37	2	196681579	196681579	+	Missense_Mutation	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr2:196681579C>A	ENST00000312428.6	-	51	9634	c.9534G>T	c.(9532-9534)ttG>ttT	p.L3178F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3178	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCTCATTAGCCAAGGCCTTGG	0.398																																					p.L3178F		Atlas-SNP	.											.	DNAH7	512	.	0			c.G9534T						.						103.0	104.0	104.0					2																	196681579		1857	4097	5954	SO:0001583	missense	56171	exon51			ATTAGCCAAGGCC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9534G>T	chr2.hg19:g.196681579C>A	ENSP00000311273:p.Leu3178Phe	489.0	1.0		494.0	133.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	19.11	3.762967	0.69763	.	.	ENSG00000118997	ENST00000312428	T	0.54479	0.57	5.26	2.29	0.28610	.	0.000000	0.64402	D	0.000002	T	0.72358	0.3450	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74506	-0.3643	10	0.52906	T	0.07	.	10.7938	0.46449	0.0:0.7561:0.0:0.2439	.	3178	Q8WXX0	DYH7_HUMAN	F	3178	ENSP00000311273:L3178F	ENSP00000311273:L3178F	L	-	3	2	DNAH7	196389824	0.989000	0.36119	0.996000	0.52242	0.993000	0.82548	0.381000	0.20619	0.794000	0.33899	0.591000	0.81541	TTG	.	.		0.398	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
COL4A3	1285	hgsc.bcm.edu	37	2	228141161	228141161	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr2:228141161C>T	ENST00000396578.3	+	27	2150	c.1988C>T	c.(1987-1989)cCc>cTc	p.P663L	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000433324.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	663	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		CCTCCAGGGCCCCCTGGCCAT	0.527																																					p.P663L		Atlas-SNP	.											.	COL4A3	293	.	0			c.C1988T						.						56.0	59.0	58.0					2																	228141161		1929	4126	6055	SO:0001583	missense	1285	exon27			CAGGGCCCCCTGG		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.1988C>T	chr2.hg19:g.228141161C>T	ENSP00000379823:p.Pro663Leu	98.0	0.0		121.0	65.0	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	hg19	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	C	4.746	0.138703	0.09083	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.94931	-3.56	5.33	0.926	0.19430	.	0.992308	0.08186	N	0.984716	D	0.87807	0.6270	L	0.28694	0.88	0.23095	N	0.998308	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.001;0.002;0.002	T	0.73052	-0.4104	10	0.10111	T	0.7	.	6.4894	0.22107	0.0:0.5469:0.0:0.4531	.	663;663;663;663	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	L	663	ENSP00000379823:P663L	ENSP00000323334:P663L	P	+	2	0	COL4A3	227849405	0.000000	0.05858	0.766000	0.31476	0.677000	0.39632	0.125000	0.15749	0.327000	0.23409	0.655000	0.94253	CCC	.	.		0.527	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
SH3BP4	23677	hgsc.bcm.edu	37	2	235949591	235949591	+	Missense_Mutation	SNP	G	G	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr2:235949591G>T	ENST00000409212.1	+	4	685	c.178G>T	c.(178-180)Gtg>Ttg	p.V60L	SH3BP4_ENST00000344528.4_Missense_Mutation_p.V60L|SH3BP4_ENST00000392011.2_Missense_Mutation_p.V60L			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	60	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		TGCAAAGGAAGTGATTGCGAT	0.522																																					p.V60L		Atlas-SNP	.											.	SH3BP4	109	.	0			c.G178T						.						143.0	137.0	139.0					2																	235949591		2203	4300	6503	SO:0001583	missense	23677	exon4			AAGGAAGTGATTG	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.178G>T	chr2.hg19:g.235949591G>T	ENSP00000386862:p.Val60Leu	113.0	0.0		119.0	68.0	NM_014521	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	hg19	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192849	0.78902	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000416021;ENST00000409212;ENST00000344528;ENST00000446904	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.44	5.44	0.79542	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	M	0.79011	2.435	0.80722	D	1	D;D	0.61080	0.989;0.989	D;D	0.70227	0.968;0.968	T	0.65796	-0.6081	10	0.66056	D	0.02	-0.0082	17.8307	0.88682	0.0:0.0:1.0:0.0	.	60;60	A8K594;Q9P0V3	.;SH3B4_HUMAN	L	60	ENSP00000375867:V60L;ENSP00000403251:V60L;ENSP00000386862:V60L;ENSP00000340237:V60L;ENSP00000415391:V60L	ENSP00000340237:V60L	V	+	1	0	SH3BP4	235614330	1.000000	0.71417	1.000000	0.80357	0.167000	0.22549	9.549000	0.98106	2.549000	0.85964	0.655000	0.94253	GTG	.	.		0.522	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
GOLGA4	2803	hgsc.bcm.edu	37	3	37396591	37396591	+	Splice_Site	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr3:37396591G>A	ENST00000361924.2	+	22	6950		c.e22-1		GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Splice_Site	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4						Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTTTCTTGTAGACCATGGCAA	0.408																																					.		Atlas-SNP	.											.	GOLGA4	173	.	0			c.6622-1G>A						.						151.0	146.0	148.0					3																	37396591		2203	4299	6502	SO:0001630	splice_region_variant	2803	exon22			CTTGTAGACCATG	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6577-1G>A	chr3.hg19:g.37396591G>A		87.0	0.0		127.0	30.0	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Splice_Site	SNP	ENST00000361924.2	hg19	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055800	0.55325	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1086	0.97902	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GOLGA4	37371595	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	6.056000	0.71111	2.756000	0.94617	0.563000	0.77884	.	.	.		0.408	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Intron
CTNNB1	1499	hgsc.bcm.edu	37	3	41266137	41266137	+	Missense_Mutation	SNP	C	C	A	rs121913409		TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr3:41266137C>A	ENST00000349496.5	+	3	414	c.134C>A	c.(133-135)tCt>tAt	p.S45Y	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38Y|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45Y|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGT	0.498	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45Y	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1,2	CTNNB1	4904	.	601	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(4)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134A						.						84.0	74.0	77.0					3																	41266137		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.134C>A	chr3.hg19:g.41266137C>A	ENSP00000344456:p.Ser45Tyr	209.0	0.0		174.0	95.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519229	0.85495	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.65677	2.01	0.80722	D	1	D	0.76494	0.999	D	0.67231	0.95	T	0.69320	-0.5176	10	0.87932	D	0	-13.6823	20.2983	0.98569	0.0:1.0:0.0:0.0	.	45	P35222	CTNB1_HUMAN	Y	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38Y;ENSP00000385604:S45Y;ENSP00000412219:S45Y;ENSP00000379486:S45Y;ENSP00000344456:S45Y;ENSP00000411226:S38Y;ENSP00000379488:S45Y;ENSP00000409302:S45Y;ENSP00000401599:S45Y	ENSP00000344456:S45Y	S	+	2	0	CTNNB1	41241141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
SACM1L	22908	hgsc.bcm.edu	37	3	45751119	45751119	+	Missense_Mutation	SNP	G	G	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr3:45751119G>C	ENST00000389061.5	+	5	667	c.463G>C	c.(463-465)Gaa>Caa	p.E155Q	SACM1L_ENST00000541314.1_Missense_Mutation_p.E94Q|SACM1L_ENST00000418611.1_Missense_Mutation_p.E52Q|SACM1L_ENST00000464524.1_3'UTR	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	155	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TGAATTCCAAGAAATGAGTCT	0.333																																					p.E155Q		Atlas-SNP	.											.	SACM1L	38	.	0			c.G463C						.						86.0	81.0	83.0					3																	45751119		2203	4300	6503	SO:0001583	missense	22908	exon5			TTCCAAGAAATGA	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.463G>C	chr3.hg19:g.45751119G>C	ENSP00000373713:p.Glu155Gln	126.0	0.0		127.0	27.0	NM_014016	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	hg19	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510582	0.64522	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000438671;ENST00000541314	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	6.08	6.08	0.98989	Synaptojanin, N-terminal (2);	0.051390	0.85682	D	0.000000	T	0.45796	0.1360	N	0.16790	0.44	0.80722	D	1	B;B	0.18310	0.027;0.013	B;B	0.24701	0.042;0.055	T	0.34453	-0.9828	10	0.13853	T	0.58	-15.7407	20.6721	0.99693	0.0:0.0:1.0:0.0	.	94;155	B4DK71;Q9NTJ5	.;SAC1_HUMAN	Q	52;155;94;94	ENSP00000396387:E52Q;ENSP00000373713:E155Q;ENSP00000411966:E94Q;ENSP00000443373:E94Q	ENSP00000373713:E155Q	E	+	1	0	SACM1L	45726123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.459000	0.97638	2.894000	0.99253	0.591000	0.81541	GAA	.	.		0.333	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	
PDZRN3	23024	hgsc.bcm.edu	37	3	73433952	73433952	+	Missense_Mutation	SNP	T	T	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr3:73433952T>G	ENST00000263666.4	-	10	1879	c.1765A>C	c.(1765-1767)Aat>Cat	p.N589H	PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000479530.1_Missense_Mutation_p.N306H|PDZRN3_ENST00000535920.1_Missense_Mutation_p.N311H|PDZRN3_ENST00000462146.2_Missense_Mutation_p.N246H|PDZRN3_ENST00000466780.1_Missense_Mutation_p.N246H	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	589					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TCGTCGCCATTGTTCTCTTGC	0.632																																					p.N589H		Atlas-SNP	.											.	PDZRN3	196	.	0			c.A1765C						.						87.0	78.0	81.0					3																	73433952		2203	4300	6503	SO:0001583	missense	23024	exon10			CGCCATTGTTCTC	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1765A>C	chr3.hg19:g.73433952T>G	ENSP00000263666:p.Asn589His	70.0	0.0		79.0	21.0	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	hg19	CCDS33789.1	.	.	.	.	.	.	.	.	.	.	T	9.111	1.006508	0.19199	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	T;T;T;T;T;T	0.09723	2.95;3.64;3.53;3.53;3.65;3.64	4.77	4.77	0.60923	.	0.948643	0.08842	N	0.885715	T	0.11367	0.0277	L	0.44542	1.39	0.40950	D	0.984538	B;B;B;B	0.18863	0.001;0.007;0.002;0.031	B;B;B;B	0.12156	0.007;0.004;0.003;0.007	T	0.09930	-1.0652	10	0.24483	T	0.36	.	10.3295	0.43814	0.0:0.0:0.165:0.835	.	311;306;306;589	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	H	589;311;246;246;306;589;287	ENSP00000263666:N589H;ENSP00000442026:N311H;ENSP00000418168:N246H;ENSP00000418484:N246H;ENSP00000418624:N306H;ENSP00000419250:N287H	ENSP00000263666:N589H	N	-	1	0	PDZRN3	73516642	1.000000	0.71417	0.998000	0.56505	0.767000	0.43475	3.124000	0.50461	1.995000	0.58328	0.533000	0.62120	AAT	.	.		0.632	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
HMCES	56941	hgsc.bcm.edu	37	3	129017267	129017267	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr3:129017267C>T	ENST00000383463.4	+	5	613	c.524C>T	c.(523-525)aCa>aTa	p.T175I	HMCES_ENST00000389735.3_Missense_Mutation_p.T175I|HMCES_ENST00000417226.2_Missense_Mutation_p.T133I|HMCES_ENST00000502878.2_Missense_Mutation_p.T175I	NM_020187.2	NP_064572.2	Q96FZ2	HMCES_HUMAN	5-hydroxymethylcytosine (hmC) binding, ES cell-specific	175							DNA binding (GO:0003677)|peptidase activity (GO:0008233)										AGGCTGCTGACAATGGCCGGG	0.507																																					p.T175I		Atlas-SNP	.											.	C3orf37	27	.	0			c.C524T						.						112.0	102.0	106.0					3																	129017267		2203	4300	6503	SO:0001583	missense	56941	exon5			TGCTGACAATGGC	AF201934	CCDS33852.1	3q21.3	2013-08-30	2013-08-30	2013-08-30	ENSG00000183624	ENSG00000183624			24446	protein-coding gene	gene with protein product	"""SOS response associated peptidase domain containing 1"""		"""chromosome 3 open reading frame 37"""	C3orf37		23434322, 23945014	Standard	XM_005247636		Approved	DC12, SRAPD1	uc003elt.3	Q96FZ2	OTTHUMG00000159452	ENST00000383463.4:c.524C>T	chr3.hg19:g.129017267C>T	ENSP00000372955:p.Thr175Ile	214.0	1.0		195.0	103.0	NM_020187	A6NJR9|Q96G34|Q9NRP3	Missense_Mutation	SNP	ENST00000383463.4	hg19	CCDS33852.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337138	0.81801	.	.	ENSG00000183624	ENST00000509042;ENST00000383463;ENST00000417226;ENST00000510314;ENST00000502878;ENST00000389735;ENST00000509551;ENST00000511665	.	.	.	4.73	4.73	0.59995	.	0.102570	0.64402	D	0.000003	T	0.79684	0.4488	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82808	-0.0274	9	0.66056	D	0.02	-19.4031	15.1904	0.73038	0.0:1.0:0.0:0.0	.	133;175	E7EMP6;Q96FZ2	.;CC037_HUMAN	I	127;175;133;85;175;175;175;85	.	ENSP00000372955:T175I	T	+	2	0	C3orf37	130499957	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.179000	0.77665	2.165000	0.68154	0.585000	0.79938	ACA	.	.		0.507	HMCES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355470.2	NM_020187	
PDE6B	5158	hgsc.bcm.edu	37	4	661717	661717	+	Missense_Mutation	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr4:661717G>A	ENST00000496514.1	+	21	2446	c.2425G>A	c.(2425-2427)Gcg>Acg	p.A809T	PDE6B_ENST00000255622.6_Missense_Mutation_p.A809T|PDE6B_ENST00000429163.2_Missense_Mutation_p.A530T			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	809					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	AGAGTGGAAGGCGCTGGCTGA	0.562																																					p.A809T	GBM(71;463 1194 9848 25922 46834)	Atlas-SNP	.											.	PDE6B	80	.	0			c.G2425A						.						140.0	145.0	143.0					4																	661717		2203	4300	6503	SO:0001583	missense	5158	exon21			TGGAAGGCGCTGG	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2425G>A	chr4.hg19:g.661717G>A	ENSP00000420295:p.Ala809Thr	89.0	0.0		77.0	24.0	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	hg19	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	g	13.26	2.185372	0.38609	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.77489	-1.1;-1.1;-1.1	4.7	2.95	0.34219	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.126462	0.51477	N	0.000093	T	0.65322	0.2680	L	0.33753	1.03	0.39314	D	0.965121	B;B	0.14012	0.005;0.009	B;B	0.20767	0.031;0.031	T	0.56944	-0.7895	10	0.30854	T	0.27	.	9.4703	0.38837	0.1804:0.0:0.8196:0.0	.	809;809	P35913;P35913-2	PDE6B_HUMAN;.	T	809;809;530	ENSP00000255622:A809T;ENSP00000420295:A809T;ENSP00000406334:A530T	ENSP00000255622:A809T	A	+	1	0	PDE6B	651717	1.000000	0.71417	0.925000	0.36789	0.890000	0.51754	3.418000	0.52721	0.517000	0.28361	-0.141000	0.14075	GCG	.	.		0.562	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
STK32B	55351	hgsc.bcm.edu	37	4	5500781	5500781	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr4:5500781C>T	ENST00000282908.5	+	12	1638	c.1216C>T	c.(1216-1218)Cac>Tac	p.H406Y	STK32B_ENST00000512636.1_Missense_Mutation_p.H329Y|STK32B_ENST00000510398.1_Missense_Mutation_p.H359Y|STK32B_ENST00000508728.1_3'UTR	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						CCTCCTCACCCACACCTGCAC	0.647																																					p.H406Y		Atlas-SNP	.											.	STK32B	87	.	0			c.C1216T						.						138.0	101.0	114.0					4																	5500781		2203	4300	6503	SO:0001583	missense	55351	exon12			CTCACCCACACCT	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.1216C>T	chr4.hg19:g.5500781C>T	ENSP00000282908:p.His406Tyr	323.0	0.0		219.0	97.0	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	hg19	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	C	1.863	-0.462098	0.04508	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.67698	-0.21;0.1;-0.28	4.97	2.23	0.28157	.	0.179933	0.25984	U	0.027052	T	0.55529	0.1926	L	0.51422	1.61	0.09310	N	1	B	0.27068	0.167	B	0.28011	0.085	T	0.40887	-0.9539	10	0.25751	T	0.34	.	7.8806	0.29621	0.2825:0.6341:0.0:0.0834	.	406	Q9NY57	ST32B_HUMAN	Y	406;329;359	ENSP00000282908:H406Y;ENSP00000423209:H329Y;ENSP00000420984:H359Y	ENSP00000282908:H406Y	H	+	1	0	STK32B	5551682	0.006000	0.16342	0.001000	0.08648	0.001000	0.01503	0.437000	0.21543	-0.097000	0.12307	-2.600000	0.00162	CAC	.	.		0.647	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
GABRG1	2565	hgsc.bcm.edu	37	4	46067487	46067487	+	Missense_Mutation	SNP	G	G	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr4:46067487G>T	ENST00000295452.4	-	4	603	c.436C>A	c.(436-438)Cct>Act	p.P146T		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	146					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.P146T(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAAGTGTCAGGAATCCAAATT	0.358																																					p.P146T		Atlas-SNP	.											GABRG1,NS,carcinoma,0,1	GABRG1	172	.	1	Substitution - Missense(1)	lung(1)	c.C436A						.						85.0	85.0	85.0					4																	46067487		2203	4300	6503	SO:0001583	missense	2565	exon4			TGTCAGGAATCCA	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.436C>A	chr4.hg19:g.46067487G>T	ENSP00000295452:p.Pro146Thr	80.0	0.0		93.0	39.0	NM_173536	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	hg19	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596088	0.86953	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	D	0.98550	-4.99	5.08	5.08	0.68730	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.99384	0.9783	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98440	1.0586	10	0.87932	D	0	.	17.8218	0.88652	0.0:0.0:1.0:0.0	.	146	Q8N1C3	GBRG1_HUMAN	T	146	ENSP00000295452:P146T	ENSP00000295452:P146T	P	-	1	0	GABRG1	45762244	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.792000	0.99085	2.513000	0.84729	0.508000	0.49915	CCT	.	.		0.358	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
CXCL13	10563	hgsc.bcm.edu	37	4	78528986	78528986	+	Missense_Mutation	SNP	T	T	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr4:78528986T>C	ENST00000286758.4	+	3	272	c.194T>C	c.(193-195)aTc>aCc	p.I65T		NM_006419.2	NP_006410.1	O43927	CXL13_HUMAN	chemokine (C-X-C motif) ligand 13	65					activation of Rap GTPase activity (GO:0032861)|B cell chemotaxis (GO:0035754)|B cell chemotaxis across high endothelial venule (GO:0035769)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|chronic inflammatory response (GO:0002544)|defense response to bacterium (GO:0042742)|endothelial cell chemotaxis to fibroblast growth factor (GO:0035768)|germinal center formation (GO:0002467)|immune response (GO:0006955)|lymph node development (GO:0048535)|lymphocyte chemotaxis across high endothelial venule (GO:0002518)|negative regulation of endothelial cell chemotaxis to fibroblast growth factor (GO:2000545)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of integrin activation (GO:0033625)|positive regulation of T cell chemotaxis (GO:0010820)|regulation of angiogenesis (GO:0045765)|regulation of humoral immune response (GO:0002920)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR10 chemokine receptor binding (GO:0031735)|chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|CXCR5 chemokine receptor binding (GO:0031724)|fibroblast growth factor binding (GO:0017134)|heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|receptor agonist activity (GO:0048018)			large_intestine(1)|ovary(1)|skin(1)|urinary_tract(1)	4						AGAAAAGAAATCATGTAAGTT	0.378																																					p.I65T		Atlas-SNP	.											.	CXCL13	9	.	0			c.T194C						.						76.0	73.0	74.0					4																	78528986		2203	4300	6503	SO:0001583	missense	10563	exon3			AAGAAATCATGTA	AJ002211	CCDS3582.1	4q21	2013-02-25	2008-08-29	2002-08-23	ENSG00000156234	ENSG00000156234		"""Endogenous ligands"""	10639	protein-coding gene	gene with protein product	"""B-cell chemoattractant"""	605149	"""small inducible cytokine B subfamily (Cys-X-Cys motif), member 13 (B-cell chemoattractant)"""	SCYB13		9463416, 9486651	Standard	NM_006419		Approved	BLC, BCA-1, BLR1L, ANGIE, ANGIE2	uc003hkr.3	O43927	OTTHUMG00000130201	ENST00000286758.4:c.194T>C	chr4.hg19:g.78528986T>C	ENSP00000286758:p.Ile65Thr	108.0	0.0		90.0	13.0	NM_006419		Missense_Mutation	SNP	ENST00000286758.4	hg19	CCDS3582.1	.	.	.	.	.	.	.	.	.	.	T	14.00	2.405102	0.42613	.	.	ENSG00000156234	ENST00000286758	T	0.07216	3.21	4.74	3.54	0.40534	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.479361	0.21446	N	0.074405	T	0.28863	0.0716	M	0.87328	2.875	0.24173	N	0.995617	D	0.76494	0.999	D	0.72625	0.978	T	0.08046	-1.0741	10	0.87932	D	0	-11.6691	7.7838	0.29080	0.1855:0.0:0.0:0.8145	.	65	O43927	CXL13_HUMAN	T	65	ENSP00000286758:I65T	ENSP00000286758:I65T	I	+	2	0	CXCL13	78748010	0.810000	0.29049	0.739000	0.30968	0.479000	0.33129	1.964000	0.40462	0.924000	0.37069	0.460000	0.39030	ATC	.	.		0.378	CXCL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252519.1		
FAM160A1	729830	hgsc.bcm.edu	37	4	152570857	152570857	+	Missense_Mutation	SNP	C	C	T	rs567628337		TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr4:152570857C>T	ENST00000505231.1	+	9	1823	c.1664C>T	c.(1663-1665)cCg>cTg	p.P555L	FAM160A1_ENST00000435205.1_Missense_Mutation_p.P555L			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	555										endometrium(2)|kidney(1)	3						TTCGGGCTCCCGCAACAACTC	0.597																																					p.P555L		Atlas-SNP	.											.	FAM160A1	60	.	0			c.C1664T						.						34.0	35.0	35.0					4																	152570857		692	1591	2283	SO:0001583	missense	729830	exon11			GGCTCCCGCAACA		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.1664C>T	chr4.hg19:g.152570857C>T	ENSP00000421580:p.Pro555Leu	130.0	0.0		154.0	63.0	NM_001109977	Q6ZUS2	Missense_Mutation	SNP	ENST00000505231.1	hg19	CCDS47146.1	.	.	.	.	.	.	.	.	.	.	C	6.155	0.396804	0.11638	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.11604	2.76;2.76	5.17	4.22	0.49857	.	.	.	.	.	T	0.07593	0.0191	L	0.47716	1.5	0.09310	N	0.99999	P	0.37997	0.614	B	0.24974	0.057	T	0.30909	-0.9962	9	0.24483	T	0.36	.	6.1025	0.20055	0.4691:0.4287:0.0:0.1022	.	555	Q05DH4	F16A1_HUMAN	L	555	ENSP00000413196:P555L;ENSP00000421580:P555L	ENSP00000413196:P555L	P	+	2	0	FAM160A1	152790307	0.079000	0.21365	0.474000	0.27266	0.058000	0.15608	1.933000	0.40153	1.115000	0.41800	0.558000	0.71614	CCG	.	.		0.597	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365691.1	NM_001109977	
HEXB	3074	hgsc.bcm.edu	37	5	73981154	73981154	+	Silent	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr5:73981154G>A	ENST00000261416.7	+	1	186	c.69G>A	c.(67-69)ctG>ctA	p.L23L	HEXB_ENST00000511181.1_Intron	NM_000521.3	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B (beta polypeptide)	23					astrocyte cell migration (GO:0043615)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|ganglioside catabolic process (GO:0006689)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|lipid storage (GO:0019915)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|male courtship behavior (GO:0008049)|myelination (GO:0042552)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|oogenesis (GO:0048477)|penetration of zona pellucida (GO:0007341)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(3)|large_intestine(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		CGACACTGCTGGCGGCGATGT	0.751																																					p.L23L	Melanoma(66;841 1270 13391 18706 27225)	Atlas-SNP	.											.	HEXB	34	.	0			c.G69A						.						5.0	6.0	6.0					5																	73981154		2054	4046	6100	SO:0001819	synonymous_variant	3074	exon1			ACTGCTGGCGGCG	M13519	CCDS4022.1	5q13.3	2012-10-02			ENSG00000049860	ENSG00000049860	3.2.1.52		4879	protein-coding gene	gene with protein product		606873				2579389, 3013851	Standard	NM_000521		Approved		uc003kdf.4	P07686	OTTHUMG00000102057	ENST00000261416.7:c.69G>A	chr5.hg19:g.73981154G>A		104.0	0.0		97.0	49.0	NM_000521		Silent	SNP	ENST00000261416.7	hg19	CCDS4022.1																																																																																			.	.		0.751	HEXB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219859.6	NM_000521	
GFM2	84340	hgsc.bcm.edu	37	5	74021934	74021934	+	Missense_Mutation	SNP	A	A	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr5:74021934A>C	ENST00000296805.3	-	18	2201	c.1744T>G	c.(1744-1746)Tta>Gta	p.L582V	GFM2_ENST00000515125.1_5'UTR|GFM2_ENST00000345239.2_Missense_Mutation_p.L535V|RNU6-658P_ENST00000384606.1_RNA|GFM2_ENST00000509430.1_Missense_Mutation_p.L582V	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		TTGTCTCCTAAAGTTCTATCT	0.358																																					p.L582V		Atlas-SNP	.											.	GFM2	38	.	0			c.T1744G						.						104.0	98.0	100.0					5																	74021934		2203	4300	6503	SO:0001583	missense	84340	exon18			CTCCTAAAGTTCT	AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.1744T>G	chr5.hg19:g.74021934A>C	ENSP00000296805:p.Leu582Val	61.0	0.0		44.0	10.0	NM_032380		Missense_Mutation	SNP	ENST00000296805.3	hg19	CCDS4023.1	.	.	.	.	.	.	.	.	.	.	A	6.291	0.421778	0.11928	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000509430	T;T;T	0.29397	1.57;1.57;1.57	5.7	0.5	0.16919	Ribosomal protein S5 domain 2-type fold (1);Translation elongation factor EFG/EF2, domain IV (2);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.226724	0.35772	N	0.002991	T	0.18173	0.0436	L	0.29908	0.895	0.50039	D	0.999843	B;B;B	0.18013	0.007;0.025;0.008	B;B;B	0.26864	0.03;0.046;0.074	T	0.08432	-1.0722	10	0.72032	D	0.01	-2.6368	2.1389	0.03770	0.3416:0.3336:0.2193:0.1055	.	582;535;582	Q969S9-3;Q969S9-2;Q969S9	.;.;RRF2M_HUMAN	V	582;535;582	ENSP00000296805:L582V;ENSP00000296804:L535V;ENSP00000427004:L582V	ENSP00000296805:L582V	L	-	1	2	GFM2	74057690	0.040000	0.19996	0.950000	0.38849	0.631000	0.37964	0.378000	0.20569	0.101000	0.17610	-0.371000	0.07208	TTA	.	.		0.358	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219860.2	NM_032380	
DOCK2	1794	hgsc.bcm.edu	37	5	169412919	169412919	+	Nonsense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr5:169412919C>T	ENST00000256935.8	+	29	3066	c.2986C>T	c.(2986-2988)Caa>Taa	p.Q996*	DOCK2_ENST00000540750.1_Nonsense_Mutation_p.Q57*|DOCK2_ENST00000520908.1_Nonsense_Mutation_p.Q488*|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	996	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAGCATGGTTCAAAACAGGTG	0.453																																					p.Q996X		Atlas-SNP	.											.	DOCK2	389	.	0			c.C2986T						.						219.0	207.0	211.0					5																	169412919		2203	4300	6503	SO:0001587	stop_gained	1794	exon29			ATGGTTCAAAACA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2986C>T	chr5.hg19:g.169412919C>T	ENSP00000256935:p.Gln996*	164.0	0.0		107.0	33.0	NM_004946	Q2M3I0|Q96AK7	Nonsense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	49	15.080676	0.99821	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	19.0483	0.93030	0.0:1.0:0.0:0.0	.	.	.	.	X	996;488;57	.	ENSP00000256935:Q996X	Q	+	1	0	DOCK2	169345497	1.000000	0.71417	0.989000	0.46669	0.309000	0.27889	7.776000	0.85560	2.495000	0.84180	0.655000	0.94253	CAA	.	.		0.453	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
HIST1H2AH	85235	hgsc.bcm.edu	37	6	27114964	27114964	+	Silent	SNP	T	T	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:27114964T>C	ENST00000377459.1	+	1	104	c.57T>C	c.(55-57)tcT>tcC	p.S19S	HIST1H2BK_ENST00000396891.4_5'Flank|HIST1H2BK_ENST00000356950.1_5'Flank|MIR3143_ENST00000584253.1_RNA	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	19						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						AGACCCGCTCTTCTCGGGCTG	0.622																																					p.S19S		Atlas-SNP	.											.	HIST1H2AH	26	.	0			c.T57C						.						63.0	71.0	68.0					6																	27114964		2203	4300	6503	SO:0001819	synonymous_variant	85235	exon1			CCGCTCTTCTCGG	AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.57T>C	chr6.hg19:g.27114964T>C		268.0	0.0		266.0	54.0	NM_080596		Silent	SNP	ENST00000377459.1	hg19	CCDS4622.1																																																																																			.	.		0.622	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040136.1	NM_080596	
SKIV2L	6499	hgsc.bcm.edu	37	6	31927872	31927872	+	Missense_Mutation	SNP	T	T	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:31927872T>A	ENST00000375394.2	+	3	325	c.212T>A	c.(211-213)cTg>cAg	p.L71Q	NELFE_ENST00000375425.5_5'Flank|NELFE_ENST00000375429.3_5'Flank|SKIV2L_ENST00000488648.1_3'UTR|SKIV2L_ENST00000544581.1_Intron|NELFE_ENST00000444811.2_5'Flank	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	71					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						TGGCTGCCTCTGCATGGTGTG	0.572																																					p.L71Q		Atlas-SNP	.											.	SKIV2L	97	.	0			c.T212A						.						69.0	69.0	69.0					6																	31927872		1509	2709	4218	SO:0001583	missense	6499	exon3			TGCCTCTGCATGG		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.212T>A	chr6.hg19:g.31927872T>A	ENSP00000364543:p.Leu71Gln	92.0	0.0		120.0	41.0	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	hg19	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.443581	0.63067	.	.	ENSG00000204351	ENST00000375394	T	0.44482	0.92	4.61	4.61	0.57282	.	0.174295	0.39146	N	0.001451	T	0.28466	0.0704	L	0.36672	1.1	0.80722	D	1	D	0.56968	0.978	P	0.52267	0.694	T	0.02813	-1.1107	10	0.24483	T	0.36	-12.0315	11.6576	0.51328	0.0:0.0:0.0:1.0	.	71	Q15477	SKIV2_HUMAN	Q	71	ENSP00000364543:L71Q	ENSP00000364543:L71Q	L	+	2	0	SKIV2L	32035851	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.294000	0.59043	1.944000	0.56390	0.533000	0.62120	CTG	.	.		0.572	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
TEAD3	7005	hgsc.bcm.edu	37	6	35443156	35443156	+	Missense_Mutation	SNP	T	T	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:35443156T>C	ENST00000402886.3	-	10	1124	c.971A>G	c.(970-972)aAg>aGg	p.K324R	TEAD3_ENST00000338863.7_Missense_Mutation_p.K384R			Q99594	TEAD3_HUMAN	TEA domain family member 3	384	Transcriptional activation. {ECO:0000255}.				female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						CATCATGTACTTCTCGGGCAG	0.592																																					p.K384R		Atlas-SNP	.											.	TEAD3	52	.	0			c.A1151G						.						101.0	95.0	97.0					6																	35443156		2203	4300	6503	SO:0001583	missense	7005	exon12			ATGTACTTCTCGG	X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.971A>G	chr6.hg19:g.35443156T>C	ENSP00000384577:p.Lys324Arg	64.0	0.0		58.0	24.0	NM_003214	O95910|Q5BJG7|Q8N6Y4	Missense_Mutation	SNP	ENST00000402886.3	hg19		.	.	.	.	.	.	.	.	.	.	T	19.56	3.849889	0.71603	.	.	ENSG00000007866	ENST00000338863;ENST00000402886;ENST00000373905	T;T	0.34275	1.37;1.37	5.61	5.61	0.85477	.	0.055638	0.64402	D	0.000001	T	0.44767	0.1309	M	0.69185	2.1	0.58432	D	0.999998	P;D;P	0.57899	0.867;0.981;0.79	P;D;P	0.68353	0.519;0.957;0.508	T	0.33904	-0.9850	10	0.20519	T	0.43	-30.5472	14.6427	0.68737	0.0:0.0:0.0:1.0	.	324;400;384	B5MCM0;Q7Z6V0;Q99594	.;.;TEAD3_HUMAN	R	384;324;400	ENSP00000345772:K384R;ENSP00000384577:K324R	ENSP00000345772:K384R	K	-	2	0	TEAD3	35551134	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.235000	0.72332	2.132000	0.65825	0.528000	0.53228	AAG	.	.		0.592	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316961.2		
TJAP1	93643	hgsc.bcm.edu	37	6	43473578	43473578	+	Silent	SNP	C	C	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:43473578C>G	ENST00000372445.5	+	11	2035	c.1659C>G	c.(1657-1659)ggC>ggG	p.G553G	TJAP1_ENST00000438588.2_Silent_p.G553G|TJAP1_ENST00000372444.2_Silent_p.G543G|TJAP1_ENST00000372449.1_Silent_p.G553G|TJAP1_ENST00000372452.1_Silent_p.G543G|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000436109.2_Silent_p.G543G|TJAP1_ENST00000259751.1_Silent_p.G543G	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	553					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			AGGAGCAGGGCAACCTGCTCA	0.672																																					p.G553G		Atlas-SNP	.											.	TJAP1	35	.	0			c.C1659G						.						6.0	7.0	6.0					6																	43473578		2122	4191	6313	SO:0001819	synonymous_variant	93643	exon11			GCAGGGCAACCTG	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.1659C>G	chr6.hg19:g.43473578C>G		54.0	0.0		73.0	23.0	NM_001146016	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Silent	SNP	ENST00000372445.5	hg19	CCDS55004.1																																																																																			.	.		0.672	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
TFAP2B	7021	hgsc.bcm.edu	37	6	50803851	50803851	+	Missense_Mutation	SNP	G	G	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:50803851G>C	ENST00000393655.3	+	4	848	c.679G>C	c.(679-681)Ggc>Cgc	p.G227R	TFAP2B_ENST00000263046.4_Missense_Mutation_p.G236R	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	227					aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					TGTCAACACCGGCGAGGTGTT	0.502																																					p.G227R	Pancreas(116;1373 2332 5475 10752)	Atlas-SNP	.											.	TFAP2B	91	.	0			c.G679C						.						107.0	109.0	108.0					6																	50803851		2203	4300	6503	SO:0001583	missense	7021	exon4			AACACCGGCGAGG	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.679G>C	chr6.hg19:g.50803851G>C	ENSP00000377265:p.Gly227Arg	110.0	0.0		155.0	10.0	NM_003221	Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Missense_Mutation	SNP	ENST00000393655.3	hg19	CCDS4934.2	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941381	0.53079	.	.	ENSG00000008196	ENST00000393655;ENST00000263046	D;D	0.97232	-4.3;-4.29	5.44	5.44	0.79542	.	0.161988	0.56097	D	0.000033	D	0.93736	0.7998	L	0.40543	1.245	0.49483	D	0.999791	P	0.38535	0.635	B	0.42959	0.403	D	0.93957	0.7237	10	0.51188	T	0.08	-13.0556	12.5994	0.56489	0.0759:0.0:0.9241:0.0	.	227	Q92481	AP2B_HUMAN	R	227;236	ENSP00000377265:G227R;ENSP00000263046:G236R	ENSP00000263046:G236R	G	+	1	0	TFAP2B	50911810	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.131000	0.71670	2.561000	0.86390	0.650000	0.86243	GGC	.	.		0.502	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3	NM_003221	
HCRTR2	3062	hgsc.bcm.edu	37	6	55120007	55120007	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:55120007C>T	ENST00000370862.3	+	3	812	c.476C>T	c.(475-477)cCt>cTt	p.P159L		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	159					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ATCTGTCACCCTTTGATGTTT	0.468																																					p.P159L		Atlas-SNP	.											.	HCRTR2	112	.	0			c.C476T						.						162.0	136.0	145.0					6																	55120007		2203	4300	6503	SO:0001583	missense	3062	exon3			GTCACCCTTTGAT	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.476C>T	chr6.hg19:g.55120007C>T	ENSP00000359899:p.Pro159Leu	81.0	0.0		132.0	70.0	NM_001526	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	hg19	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.965998	0.92855	.	.	ENSG00000137252	ENST00000370862	T	0.61274	0.12	5.05	5.05	0.67936	GPCR, rhodopsin-like superfamily (1);	0.103102	0.64402	D	0.000002	D	0.83806	0.5334	H	0.98111	4.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90329	0.4350	10	0.87932	D	0	.	18.3959	0.90497	0.0:1.0:0.0:0.0	.	159;159	Q548Y0;O43614	.;OX2R_HUMAN	L	159	ENSP00000359899:P159L	ENSP00000359899:P159L	P	+	2	0	HCRTR2	55227966	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.345000	0.79718	0.484000	0.47621	CCT	.	.		0.468	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
HMGCLL1	54511	hgsc.bcm.edu	37	6	55300495	55300495	+	Missense_Mutation	SNP	T	T	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:55300495T>A	ENST00000398661.2	-	10	1209	c.1078A>T	c.(1078-1080)Aac>Tac	p.N360Y	HMGCLL1_ENST00000508459.1_Missense_Mutation_p.N164Y|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.N227Y|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.N330Y|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.N298Y|HMGCLL1_ENST00000507223.1_5'UTR	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	360					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACTTTAGAGTTTGTGGTTTTA	0.393																																					p.N360Y	Ovarian(35;840 893 7837 15538 42887)	Atlas-SNP	.											.	HMGCLL1	70	.	0			c.A1078T						.						142.0	144.0	143.0					6																	55300495		1861	4094	5955	SO:0001583	missense	54511	exon10			TAGAGTTTGTGGT	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.1078A>T	chr6.hg19:g.55300495T>A	ENSP00000381654:p.Asn360Tyr	122.0	0.0		117.0	32.0	NM_019036	B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	hg19	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	T	19.87	3.908274	0.72868	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000508459;ENST00000308161	D;D;D;D;D	0.98164	-4.76;-4.76;-4.4;-4.76;-4.76	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.98686	0.9559	M	0.84846	2.72	0.80722	D	1	D;D;D;B;B	0.65815	0.995;0.995;0.958;0.313;0.402	P;P;P;B;B	0.62014	0.897;0.854;0.772;0.227;0.438	D	0.99544	1.0964	10	0.72032	D	0.01	-3.3409	15.1716	0.72878	0.0:0.0:0.0:1.0	.	164;227;298;330;360	B7Z4D4;B7Z212;F8W793;Q8TB92-2;Q8TB92	.;.;.;.;HMGC2_HUMAN	Y	330;360;227;164;298	ENSP00000274901:N330Y;ENSP00000381654:N360Y;ENSP00000359887:N227Y;ENSP00000424309:N164Y;ENSP00000309737:N298Y	ENSP00000274901:N330Y	N	-	1	0	HMGCLL1	55408454	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.138000	0.64795	1.986000	0.57962	0.533000	0.62120	AAC	.	.		0.393	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383	
BAI3	577	hgsc.bcm.edu	37	6	70071152	70071152	+	Silent	SNP	T	T	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:70071152T>C	ENST00000370598.1	+	29	4808	c.3987T>C	c.(3985-3987)aaT>aaC	p.N1329N	BAI3_ENST00000238918.8_Silent_p.N535N|BAI3_ENST00000546190.1_Silent_p.N293N	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1329					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GCAAAATGAATATTGGCATGG	0.383																																					p.N1329N		Atlas-SNP	.											.	BAI3	451	.	0			c.T3987C						.						69.0	64.0	66.0					6																	70071152		2203	4299	6502	SO:0001819	synonymous_variant	577	exon29			AATGAATATTGGC	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3987T>C	chr6.hg19:g.70071152T>C		109.0	0.0		77.0	35.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	hg19	CCDS4968.1																																																																																			.	.		0.383	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152831461	152831461	+	Missense_Mutation	SNP	T	T	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:152831461T>G	ENST00000367255.5	-	8	1049	c.448A>C	c.(448-450)Agc>Cgc	p.S150R	SYNE1_ENST00000466159.2_Missense_Mutation_p.S150R|SYNE1_ENST00000423061.1_Missense_Mutation_p.S157R|SYNE1_ENST00000448038.1_Missense_Mutation_p.S157R|SYNE1_ENST00000413186.2_Missense_Mutation_p.S150R|SYNE1_ENST00000367248.3_Missense_Mutation_p.S157R|SYNE1_ENST00000367253.4_Missense_Mutation_p.S150R|SYNE1_ENST00000341594.5_Missense_Mutation_p.S150R|SYNE1_ENST00000265368.4_Missense_Mutation_p.S150R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	150	Actin-binding.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATGCGCTGCTGGACAAAGAC	0.468										HNSCC(10;0.0054)																											p.S157R		Atlas-SNP	.											.	SYNE1	3227	.	0			c.A469C						.						107.0	94.0	99.0					6																	152831461		2203	4300	6503	SO:0001583	missense	23345	exon8			CGCTGCTGGACAA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.448A>C	chr6.hg19:g.152831461T>G	ENSP00000356224:p.Ser150Arg	175.0	0.0		92.0	64.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	20.6	4.024026	0.75390	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.92299	0.39;0.32;0.29;0.32;0.53;-2.43;-2.6;-2.55;-2.84;-3.01	5.66	1.88	0.25563	Calponin homology domain (1);	0.246735	0.35585	N	0.003116	D	0.90998	0.7169	M	0.66378	2.025	0.80722	D	1	P;P;P;P;P	0.51147	0.884;0.904;0.553;0.84;0.942	P;P;P;P;P	0.58013	0.678;0.562;0.566;0.461;0.831	D	0.89613	0.3843	10	0.72032	D	0.01	.	8.6257	0.33888	0.0:0.2426:0.0:0.7574	.	150;150;150;150;157	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	R	150;157;150;157;150;150;157;150;150;150	ENSP00000356224:S150R;ENSP00000396024:S157R;ENSP00000265368:S150R;ENSP00000390975:S157R;ENSP00000341887:S150R;ENSP00000356222:S150R;ENSP00000356217:S157R;ENSP00000414510:S150R;ENSP00000446021:S150R;ENSP00000441264:S150R	ENSP00000265368:S150R	S	-	1	0	SYNE1	152873154	1.000000	0.71417	0.994000	0.49952	0.933000	0.57130	2.877000	0.48506	0.085000	0.17107	-0.312000	0.09012	AGC	.	.		0.468	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TNRC18	84629	hgsc.bcm.edu	37	7	5352817	5352817	+	Missense_Mutation	SNP	T	T	C	rs548772421	byFrequency	TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr7:5352817T>C	ENST00000430969.1	-	27	8053	c.7705A>G	c.(7705-7707)Agc>Ggc	p.S2569G	TNRC18_ENST00000399537.4_Missense_Mutation_p.S2569G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2569	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		ctgctgctgctactgctgcca	0.672													T|||	9	0.00179712	0.0	0.0	5008	,	,		8638	0.001		0.003	False		,,,				2504	0.0051				p.S2569G		Atlas-SNP	.											.	TNRC18	311	.	0			c.A7705G						.																																			SO:0001583	missense	84629	exon27			TGCTGCTACTGCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7705A>G	chr7.hg19:g.5352817T>C	ENSP00000395538:p.Ser2569Gly	64.0	0.0		49.0	12.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	hg19	CCDS47534.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	13.83|13.83	2.353299|2.353299	0.41700|0.41700	.|.	.|.	ENSG00000182095|ENSG00000182095	ENST00000399537;ENST00000430969|ENST00000328270	T;T|.	0.06449|.	3.3;3.3|.	4.66|4.66	2.25|2.25	0.28309|0.28309	.|.	0.370157|.	0.19843|.	N|.	0.104820|.	T|.	0.33731|.	0.0873|.	L|L	0.34521|0.34521	1.04|1.04	0.19300|0.19300	N|N	0.999978|0.999978	B|.	0.31318|.	0.319|.	B|.	0.22880|.	0.042|.	T|.	0.21827|.	-1.0234|.	10|.	0.22706|.	T|.	0.39|.	.|.	8.4207|8.4207	0.32698|0.32698	0.0:0.1633:0.0:0.8367|0.0:0.1633:0.0:0.8367	.|.	2569|.	O15417|.	TNC18_HUMAN|.	G|W	2569|382	ENSP00000382452:S2569G;ENSP00000395538:S2569G|.	ENSP00000382452:S2569G|.	S|X	-|-	1|2	0|0	TNRC18|TNRC18	5319343|5319343	0.089000|0.089000	0.21612|0.21612	0.998000|0.998000	0.56505|0.56505	0.874000|0.874000	0.50279|0.50279	0.201000|0.201000	0.17276|0.17276	0.242000|0.242000	0.21303|0.21303	0.454000|0.454000	0.30748|0.30748	AGC|TAG	.	.		0.672	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CCDC129	223075	hgsc.bcm.edu	37	7	31592634	31592634	+	5'UTR	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr7:31592634C>A	ENST00000407970.3	+	0	34				CCDC129_ENST00000319386.3_5'UTR|CCDC129_ENST00000482748.1_Intron|CCDC129_ENST00000451887.2_Missense_Mutation_p.S25Y|CCDC129_ENST00000409210.1_5'Flank	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129											cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						CAGAATTACTCTCCTATGATG	0.468																																					p.S25Y		Atlas-SNP	.											.	CCDC129	127	.	0			c.C74A						.						80.0	65.0	70.0					7																	31592634		2203	4300	6503	SO:0001623	5_prime_UTR_variant	223075	exon2			ATTACTCTCCTAT	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.-5C>A	chr7.hg19:g.31592634C>A		95.0	0.0		78.0	29.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	hg19	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383654	0.42308	.	.	ENSG00000180347	ENST00000451887;ENST00000538406	T	0.14766	2.48	5.2	1.42	0.22433	.	.	.	.	.	T	0.25457	0.0619	.	.	.	0.09310	N	1	D;D	0.58970	0.984;0.984	P;P	0.58172	0.834;0.834	T	0.07539	-1.0767	8	0.87932	D	0	.	7.334	0.26599	0.0:0.6481:0.0:0.3519	.	25;9	F5H3V5;F5H2J8	.;.	Y	25;9	ENSP00000395835:S25Y	ENSP00000395835:S25Y	S	+	2	0	CCDC129	31559159	0.000000	0.05858	0.001000	0.08648	0.904000	0.53231	-0.018000	0.12568	0.150000	0.19136	-0.140000	0.14226	TCT	.	.		0.468	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
ZNF3	7551	hgsc.bcm.edu	37	7	99674980	99674980	+	Start_Codon_SNP	SNP	T	T	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr7:99674980T>A	ENST00000424697.1	-	3	307	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	ZNF3_ENST00000303915.6_Start_Codon_SNP_p.M1L|ZNF3_ENST00000413658.2_Start_Codon_SNP_p.M1L|ZNF3_ENST00000299667.4_Start_Codon_SNP_p.M1L	NM_001278284.1|NM_001278287.1|NM_001278290.1|NM_001278291.1|NM_001278292.1|NM_032924.3	NP_001265213.1|NP_001265216.1|NP_001265219.1|NP_001265220.1|NP_001265221.1|NP_116313.3	P17036	ZNF3_HUMAN	zinc finger protein 3	1					cell differentiation (GO:0030154)|leukocyte activation (GO:0045321)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	25	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			TGAGTTTCCATGGAAGGGCAA	0.488																																					p.M1L		Atlas-SNP	.											.	ZNF3	54	.	0			c.A1T						.						144.0	144.0	144.0					7																	99674980		1974	4172	6146	SO:0001582	initiator_codon_variant	7551	exon3			TTTCCATGGAAGG	AF027136	CCDS43618.1, CCDS43619.1	7q22.1	2013-01-08	2006-05-05					"""Zinc fingers, C2H2-type"", ""-"""	13089	protein-coding gene	gene with protein product		194510	"""zinc finger protein 3 (A8-51)"""				Standard	NM_032924		Approved	A8-51, KOX25, PP838, FLJ20216, HF.12, Zfp113	uc003usr.4	P17036		ENST00000424697.1:c.1A>T	chr7.hg19:g.99674980T>A	ENSP00000415358:p.Met1Leu	122.0	0.0		99.0	34.0	NM_032924	D6W5U0|P13683|Q9HBR4|Q9NNX8|Q9NXJ1|Q9UC15|Q9UC16	Missense_Mutation	SNP	ENST00000424697.1	hg19	CCDS43619.1	.	.	.	.	.	.	.	.	.	.	T	12.30	1.895298	0.33442	.	.	ENSG00000166526	ENST00000413658;ENST00000424697;ENST00000303915;ENST00000299667;ENST00000449785;ENST00000428683;ENST00000415068	T;T;T;T;T;T;T	0.05081	4.88;3.5;3.5;3.5;5.42;5.42;5.15	5.53	5.53	0.82687	.	0.000000	0.51477	D	0.000087	T	0.17066	0.0410	.	.	.	0.80722	D	1	P;D	0.56746	0.518;0.977	P;D	0.69654	0.558;0.965	T	0.04607	-1.0939	9	0.20519	T	0.43	-21.0317	11.9763	0.53094	0.0:0.0:0.0:1.0	.	1;1	P17036;P17036-2	ZNF3_HUMAN;.	L	1	ENSP00000399951:M1L;ENSP00000415358:M1L;ENSP00000306372:M1L;ENSP00000299667:M1L;ENSP00000405970:M1L;ENSP00000388042:M1L;ENSP00000416686:M1L	ENSP00000299667:M1L	M	-	1	0	ZNF3	99512916	1.000000	0.71417	0.998000	0.56505	0.909000	0.53808	3.305000	0.51873	2.324000	0.78689	0.533000	0.62120	ATG	.	.		0.488	ZNF3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336247.3	NM_017715	Missense_Mutation
FLNC	2318	hgsc.bcm.edu	37	7	128494870	128494870	+	Silent	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr7:128494870C>T	ENST00000325888.8	+	42	7300	c.7039C>T	c.(7039-7041)Ctg>Ttg	p.L2347L	FLNC_ENST00000346177.6_Silent_p.L2314L|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	2347					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CGCTGGGGGCCTGTCCATTGC	0.612																																					p.L2347L		Atlas-SNP	.											.	FLNC	339	.	0			c.C7039T						.						69.0	79.0	76.0					7																	128494870		2053	4202	6255	SO:0001819	synonymous_variant	2318	exon42			GGGGGCCTGTCCA	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.7039C>T	chr7.hg19:g.128494870C>T		155.0	0.0		89.0	35.0	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	hg19	CCDS43644.1																																																																																			.	.		0.612	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
CNOT4	4850	hgsc.bcm.edu	37	7	135099083	135099083	+	Silent	SNP	A	A	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr7:135099083A>T	ENST00000315544.5	-	5	837	c.558T>A	c.(556-558)ctT>ctA	p.L186L	CNOT4_ENST00000451834.1_Silent_p.L186L|CNOT4_ENST00000541284.1_Silent_p.L186L|CNOT4_ENST00000428680.2_Silent_p.L186L|CNOT4_ENST00000361528.4_Silent_p.L186L|CNOT4_ENST00000423368.2_Silent_p.L186L|CNOT4_ENST00000356162.4_Silent_p.L186L|CNOT4_ENST00000414802.1_Silent_p.L186L	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	186	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						ATATTACCTTAAGTGTTCTGC	0.363																																					p.L186L	Ovarian(51;766 1130 5502 35047 50875)	Atlas-SNP	.											.	CNOT4	146	.	0			c.T558A						.						153.0	146.0	148.0					7																	135099083		1859	4100	5959	SO:0001819	synonymous_variant	4850	exon5			TACCTTAAGTGTT	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.558T>A	chr7.hg19:g.135099083A>T		74.0	0.0		74.0	29.0	NM_001190850	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Silent	SNP	ENST00000315544.5	hg19	CCDS55166.1																																																																																			.	.		0.363	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
SSPO	23145	hgsc.bcm.edu	37	7	149518154	149518154	+	RNA	SNP	C	C	A	rs563749259		TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr7:149518154C>A	ENST00000378016.2	+	0	12497							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGCCACTGGTCGGCCTGGAGT	0.682																																					p.S4166X		Atlas-SNP	.											.	.	.	.	0			c.C12497A						.						4.0	7.0	6.0					7																	149518154		1926	4030	5956			23145	exon87			ACTGGTCGGCCTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149518154C>A		55.0	0.0		43.0	13.0	NM_198455	Q76B61	Nonsense_Mutation	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.682	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
HTR5A	3361	hgsc.bcm.edu	37	7	154876098	154876098	+	Missense_Mutation	SNP	G	G	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr7:154876098G>C	ENST00000287907.2	+	2	1551	c.975G>C	c.(973-975)tgG>tgC	p.W325C	HTR5A_ENST00000486819.1_3'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	325					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	TCTTCCTGTGGCTTGGCTACT	0.512																																					p.W325C		Atlas-SNP	.											.	HTR5A	114	.	0			c.G975C						.						196.0	185.0	189.0					7																	154876098		2203	4300	6503	SO:0001583	missense	3361	exon2			CCTGTGGCTTGGC		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.975G>C	chr7.hg19:g.154876098G>C	ENSP00000287907:p.Trp325Cys	170.0	0.0		120.0	48.0	NM_024012	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	hg19	CCDS5936.1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614064	0.66672	.	.	ENSG00000157219	ENST00000287907	T	0.73789	-0.78	4.93	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86847	0.6031	H	0.94306	3.52	0.80722	D	1	P	0.41673	0.759	P	0.48815	0.591	D	0.90690	0.4612	10	0.87932	D	0	.	18.1526	0.89679	0.0:0.0:1.0:0.0	.	325	P47898	5HT5A_HUMAN	C	325	ENSP00000287907:W325C	ENSP00000287907:W325C	W	+	3	0	HTR5A	154507031	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.438000	0.97539	2.274000	0.75844	0.655000	0.94253	TGG	.	.		0.512	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
XKR4	114786	hgsc.bcm.edu	37	8	56015588	56015588	+	Silent	SNP	T	T	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr8:56015588T>A	ENST00000327381.6	+	1	640	c.540T>A	c.(538-540)gcT>gcA	p.A180A		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	180						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			CCACGGCCGCTGCTGCCTCCA	0.652																																					p.A180A		Atlas-SNP	.											.	XKR4	104	.	0			c.T540A						.						26.0	23.0	24.0					8																	56015588		2192	4286	6478	SO:0001819	synonymous_variant	114786	exon1			GGCCGCTGCTGCC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.540T>A	chr8.hg19:g.56015588T>A		106.0	0.0		89.0	38.0	NM_052898	Q96PZ8	Silent	SNP	ENST00000327381.6	hg19	CCDS34893.1																																																																																			.	.		0.652	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
TMEM67	91147	hgsc.bcm.edu	37	8	94770709	94770709	+	Splice_Site	SNP	A	A	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr8:94770709A>G	ENST00000453321.3	+	3	370		c.e3-1		TMEM67_ENST00000409623.3_Intron	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67						cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			CTTTTAATTTAGAAAGGTGTT	0.333																																					.		Atlas-SNP	.											.	TMEM67	187	.	0			c.313-2A>G						.						72.0	75.0	74.0					8																	94770709		2203	4300	6503	SO:0001630	splice_region_variant	91147	exon3			TAATTTAGAAAGG	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.313-1A>G	chr8.hg19:g.94770709A>G		91.0	0.0		114.0	66.0	NM_153704	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Splice_Site	SNP	ENST00000453321.3	hg19	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	A	17.55	3.418729	0.62622	.	.	ENSG00000164953	ENST00000452276;ENST00000453321;ENST00000453906;ENST00000521517	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3966	0.55389	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM67	94839885	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.011000	0.64011	2.190000	0.69967	0.533000	0.62120	.	.	.		0.333	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	Intron
KIAA1429	25962	hgsc.bcm.edu	37	8	95550552	95550552	+	Nonsense_Mutation	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr8:95550552G>A	ENST00000297591.5	-	3	277	c.202C>T	c.(202-204)Caa>Taa	p.Q68*	KIAA1429_ENST00000437199.1_Nonsense_Mutation_p.Q68*|KIAA1429_ENST00000421249.2_Nonsense_Mutation_p.Q68*	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	68					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			AAGTCTAATTGAAATGTATGG	0.353																																					p.Q68X		Atlas-SNP	.											.	KIAA1429	176	.	0			c.C202T						.						121.0	116.0	118.0					8																	95550552		2203	4300	6503	SO:0001587	stop_gained	25962	exon3			CTAATTGAAATGT	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.202C>T	chr8.hg19:g.95550552G>A	ENSP00000297591:p.Gln68*	110.0	0.0		141.0	41.0	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Nonsense_Mutation	SNP	ENST00000297591.5	hg19	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	G	36	5.701936	0.96812	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	.	.	.	5.57	5.57	0.84162	.	0.064299	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-10.1825	19.5403	0.95271	0.0:0.0:1.0:0.0	.	.	.	.	X	68	.	ENSP00000297591:Q68X	Q	-	1	0	KIAA1429	95619728	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.066000	0.93949	2.623000	0.88846	0.561000	0.74099	CAA	.	.		0.353	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
AZIN1	51582	hgsc.bcm.edu	37	8	103855817	103855817	+	Nonsense_Mutation	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr8:103855817C>A	ENST00000337198.5	-	3	1227	c.64G>T	c.(64-66)Gga>Tga	p.G22*	AZIN1_ENST00000522311.1_5'UTR|AZIN1_ENST00000347770.4_Nonsense_Mutation_p.G22*	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1	22					cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			ATAACATTTCCAAGGTTTGTT	0.383																																					p.G22X		Atlas-SNP	.											.	AZIN1	26	.	0			c.G64T						.						172.0	158.0	163.0					8																	103855817		2203	4300	6503	SO:0001587	stop_gained	51582	exon4			CATTTCCAAGGTT	AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.64G>T	chr8.hg19:g.103855817C>A	ENSP00000337180:p.Gly22*	166.0	0.0		194.0	20.0	NM_015878	A6NCD5|Q6IBQ7|Q96D20	Nonsense_Mutation	SNP	ENST00000337198.5	hg19	CCDS6295.1	.	.	.	.	.	.	.	.	.	.	C	37	6.085814	0.97271	.	.	ENSG00000155096	ENST00000337198;ENST00000347770;ENST00000520402;ENST00000518353	.	.	.	5.96	5.96	0.96718	.	0.214946	0.48286	D	0.000191	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-10.986	13.5795	0.61893	0.0:0.9291:0.0:0.0709	.	.	.	.	X	22	.	ENSP00000337180:G22X	G	-	1	0	AZIN1	103924993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.032000	0.41127	2.820000	0.97059	0.655000	0.94253	GGA	.	.		0.383	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380133.1		
AGO2	27161	hgsc.bcm.edu	37	8	141559371	141559371	+	Missense_Mutation	SNP	A	A	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr8:141559371A>T	ENST00000220592.5	-	12	1542	c.1430T>A	c.(1429-1431)aTc>aAc	p.I477N	AGO2_ENST00000519980.1_Missense_Mutation_p.I477N	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	477					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GTCTCTCGAGATCTTTCTGAG	0.612																																					p.I477N		Atlas-SNP	.											.	.	.	.	0			c.T1430A						.						44.0	41.0	42.0					8																	141559371		2203	4300	6503	SO:0001583	missense	27161	exon12			CTCGAGATCTTTC	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1430T>A	chr8.hg19:g.141559371A>T	ENSP00000220592:p.Ile477Asn	65.0	0.0		64.0	42.0	NM_012154	Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	ENST00000220592.5	hg19	CCDS6380.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.600344	0.87055	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.05199	3.48;3.48	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	M	0.92317	3.295	0.80722	D	1	D;P	0.56035	0.974;0.956	P;P	0.60609	0.877;0.757	T	0.37291	-0.9712	10	0.87932	D	0	-15.5008	15.5084	0.75760	1.0:0.0:0.0:0.0	.	477;477	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	N	477	ENSP00000220592:I477N;ENSP00000430176:I477N	ENSP00000220592:I477N	I	-	2	0	EIF2C2	141628553	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	9.190000	0.94934	2.134000	0.65973	0.460000	0.39030	ATC	.	.		0.612	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377866.4		
JAK2	3717	hgsc.bcm.edu	37	9	5044434	5044434	+	Missense_Mutation	SNP	A	A	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr9:5044434A>T	ENST00000381652.3	+	5	876	c.382A>T	c.(382-384)Agc>Tgc	p.S128C	JAK2_ENST00000544510.1_5'UTR|JAK2_ENST00000539801.1_Missense_Mutation_p.S128C	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	128	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TTGCAGTGGCAGCAACAGAGC	0.373		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.S128C		Atlas-SNP	.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2	35466	.	0			c.A382T						.						140.0	131.0	134.0					9																	5044434		2203	4300	6503	SO:0001583	missense	3717	exon5	Familial Cancer Database		AGTGGCAGCAACA		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.382A>T	chr9.hg19:g.5044434A>T	ENSP00000371067:p.Ser128Cys	102.0	0.0		102.0	34.0	NM_004972	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	hg19	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	A	13.30	2.196534	0.38806	.	.	ENSG00000096968	ENST00000539801;ENST00000381652	T;T	0.57436	0.4;0.4	5.35	2.99	0.34606	Band 4.1 domain (1);FERM domain (1);	0.460963	0.26272	N	0.025331	T	0.32224	0.0822	N	0.12182	0.205	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.11867	-1.0570	10	0.54805	T	0.06	-3.8034	9.464	0.38802	0.8548:0.0:0.1452:0.0	.	128	O60674	JAK2_HUMAN	C	128	ENSP00000440387:S128C;ENSP00000371067:S128C	ENSP00000371067:S128C	S	+	1	0	JAK2	5034434	0.029000	0.19370	1.000000	0.80357	0.804000	0.45430	0.863000	0.27913	0.958000	0.37956	0.533000	0.62120	AGC	.	.		0.373	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
ZMYND11	10771	hgsc.bcm.edu	37	10	226050	226050	+	Missense_Mutation	SNP	A	A	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr10:226050A>G	ENST00000397962.3	+	2	526	c.98A>G	c.(97-99)aAc>aGc	p.N33S	ZMYND11_ENST00000381604.4_5'UTR|ZMYND11_ENST00000397959.3_Missense_Mutation_p.N33S|ZMYND11_ENST00000309776.4_5'UTR|ZMYND11_ENST00000381607.4_5'UTR|ZMYND11_ENST00000602682.1_Missense_Mutation_p.N33S|ZMYND11_ENST00000381591.1_Missense_Mutation_p.N33S|ZMYND11_ENST00000402736.1_Missense_Mutation_p.N33S|ZMYND11_ENST00000403354.1_Missense_Mutation_p.N33S|ZMYND11_ENST00000381584.1_5'UTR|ZMYND11_ENST00000509513.2_Missense_Mutation_p.N33S|ZMYND11_ENST00000558098.2_Missense_Mutation_p.N33S|ZMYND11_ENST00000381602.4_5'UTR			Q15326	ZMY11_HUMAN	zinc finger, MYND-type containing 11	33					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription elongation from RNA polymerase II promoter (GO:0034243)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	24		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CAGATTGCCAACATTGACCGT	0.378																																					p.N33S		Atlas-SNP	.											.	ZMYND11	72	.	0			c.A98G						.						122.0	110.0	114.0					10																	226050		1568	3582	5150	SO:0001583	missense	10771	exon2			TTGCCAACATTGA	X86098	CCDS7052.1, CCDS7053.1, CCDS7052.2, CCDS55696.1, CCDS55697.1, CCDS7053.2, CCDS73060.1, CCDS73061.1	10p14	2011-01-26	2011-01-26		ENSG00000015171	ENSG00000015171		"""Zinc fingers, MYND-type"""	16966	protein-coding gene	gene with protein product		608668	"""zinc finger, MYND domain containing 11"""			7621829, 10734313	Standard	NM_006624		Approved	BS69	uc010pzx.2	Q15326	OTTHUMG00000017526	ENST00000397962.3:c.98A>G	chr10.hg19:g.226050A>G	ENSP00000381053:p.Asn33Ser	129.0	0.0		113.0	44.0	NM_001202465	B2R6G8|B7Z293|F6UH50|Q2LD45|Q2LD46|Q2LD47|Q2LD48|Q5VUI1|Q8N4B3	Missense_Mutation	SNP	ENST00000397962.3	hg19	CCDS7052.2	.	.	.	.	.	.	.	.	.	.	A	12.96	2.093310	0.36952	.	.	ENSG00000015171	ENST00000439456;ENST00000397962;ENST00000509513;ENST00000397959;ENST00000381591;ENST00000403354;ENST00000402736;ENST00000397955	.	.	.	6.02	6.02	0.97574	.	0.164028	0.38548	N	0.001645	T	0.60753	0.2293	L	0.29908	0.895	0.29737	N	0.83744	B;P;B;B;B;B;B	0.52842	0.002;0.956;0.0;0.002;0.003;0.001;0.002	B;P;B;B;B;B;B	0.62184	0.002;0.899;0.001;0.004;0.003;0.003;0.004	T	0.54536	-0.8279	8	0.07990	T	0.79	-12.4953	16.5494	0.84464	1.0:0.0:0.0:0.0	.	33;33;33;33;33;33;33	Q2LD45;B7Z293;B7Z2J6;Q2LD48;Q2LD46;Q2LD47;E7ENI9	.;.;.;.;.;.;.	S	33	.	ENSP00000371003:N33S	N	+	2	0	ZMYND11	216050	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.910000	0.92685	2.299000	0.77371	0.528000	0.53228	AAC	.	.		0.378	ZMYND11-206	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046382.4	NM_006624	
UPF2	26019	hgsc.bcm.edu	37	10	12041933	12041933	+	Missense_Mutation	SNP	T	T	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr10:12041933T>G	ENST00000356352.2	-	6	2203	c.1730A>C	c.(1729-1731)aAc>aCc	p.N577T	UPF2_ENST00000397053.2_Missense_Mutation_p.N577T|UPF2_ENST00000357604.5_Missense_Mutation_p.N577T			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	577	MIF4G 2.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				GTTGACACAGTTGGGTAACTG	0.388																																					p.N577T		Atlas-SNP	.											.	UPF2	111	.	0			c.A1730C						.						164.0	139.0	148.0					10																	12041933		2203	4300	6503	SO:0001583	missense	26019	exon7			ACACAGTTGGGTA	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.1730A>C	chr10.hg19:g.12041933T>G	ENSP00000348708:p.Asn577Thr	124.0	0.0		80.0	31.0	NM_080599	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	ENST00000356352.2	hg19	CCDS7086.1	.	.	.	.	.	.	.	.	.	.	T	16.98	3.272571	0.59649	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000379172;ENST00000397053;ENST00000313977	T;T;T	0.34072	1.38;1.38;1.38	5.19	5.19	0.71726	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.47395	0.1443	L	0.33137	0.985	0.80722	D	1	D;B	0.61080	0.989;0.374	D;B	0.70487	0.969;0.289	T	0.33240	-0.9876	10	0.30854	T	0.27	.	15.0023	0.71483	0.0:0.0:0.0:1.0	.	547;577	Q9HAU5-2;Q9HAU5	.;RENT2_HUMAN	T	577;577;547;577;547	ENSP00000348708:N577T;ENSP00000350221:N577T;ENSP00000380244:N577T	ENSP00000313617:N547T	N	-	2	0	UPF2	12081939	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.630000	0.83225	2.087000	0.62958	0.379000	0.24179	AAC	.	.		0.388	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046783.1		
C10orf71	118461	hgsc.bcm.edu	37	10	50534397	50534397	+	Silent	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr10:50534397G>A	ENST00000374144.3	+	3	4095	c.3807G>A	c.(3805-3807)gcG>gcA	p.A1269A	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1269				A -> T (in Ref. 2; AL833265). {ECO:0000305}.						endometrium(1)	1						CCCTGCCCGCGTACCCCGCCA	0.667																																					p.A1269A		Atlas-SNP	.											.	C10orf71	179	.	0			c.G3807A						.						3.0	6.0	5.0					10																	50534397		624	1495	2119	SO:0001819	synonymous_variant	118461	exon3			GCCCGCGTACCCC	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3807G>A	chr10.hg19:g.50534397G>A		175.0	0.0		114.0	38.0	NM_001135196	A0AVL8	Silent	SNP	ENST00000374144.3	hg19	CCDS44387.1																																																																																			.	.		0.667	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
ADAM12	8038	hgsc.bcm.edu	37	10	127753571	127753571	+	Splice_Site	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr10:127753571C>A	ENST00000368679.4	-	14	1732		c.e14-1		ADAM12_ENST00000368676.4_Splice_Site|ADAM12_ENST00000467145.1_Splice_Site	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12						cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CAGGCTTCAGCTGGAAGGAGA	0.602																																					.		Atlas-SNP	.											.	ADAM12	388	.	0			c.1423-1G>T						.						49.0	49.0	49.0					10																	127753571		2203	4300	6503	SO:0001630	splice_region_variant	8038	exon15			CTTCAGCTGGAAG	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1423-1G>T	chr10.hg19:g.127753571C>A		38.0	0.0		31.0	14.0	NM_003474	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Splice_Site	SNP	ENST00000368679.4	hg19	CCDS7653.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.371248	0.82573	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0783	0.93171	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAM12	127743561	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.537000	0.82033	2.731000	0.93534	0.650000	0.86243	.	.	.		0.602	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		Intron
KRTAP5-1	387264	hgsc.bcm.edu	37	11	1606214	1606214	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr11:1606214C>T	ENST00000382171.2	-	1	299	c.266G>A	c.(265-267)tGt>tAt	p.C89Y	KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	89	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACAAGAGCCACAGCCCCCCTT	0.672																																					p.C89Y		Atlas-SNP	.											.	KRTAP5-1	74	.	0			c.G266A						.						36.0	52.0	47.0					11																	1606214		2201	4292	6493	SO:0001583	missense	387264	exon1			GAGCCACAGCCCC	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.266G>A	chr11.hg19:g.1606214C>T	ENSP00000371606:p.Cys89Tyr	190.0	0.0		127.0	44.0	NM_001005922		Missense_Mutation	SNP	ENST00000382171.2	hg19	CCDS31330.1	.	.	.	.	.	.	.	.	.	.	C	4.603	0.112000	0.08831	.	.	ENSG00000205869	ENST00000382171	T	0.06528	3.29	3.69	3.69	0.42338	.	.	.	.	.	T	0.25158	0.0611	M	0.83118	2.625	0.27245	N	0.959036	D	0.64830	0.994	D	0.64877	0.93	T	0.03139	-1.1068	9	0.62326	D	0.03	.	13.0905	0.59164	0.0:1.0:0.0:0.0	.	89	Q6L8H4	KRA51_HUMAN	Y	89	ENSP00000371606:C89Y	ENSP00000371606:C89Y	C	-	2	0	KRTAP5-1	1562790	0.018000	0.18449	0.878000	0.34440	0.003000	0.03518	1.365000	0.34182	1.632000	0.50472	0.442000	0.29010	TGT	.	.		0.672	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1	NM_001005922	
KCNK7	10089	hgsc.bcm.edu	37	11	65365864	65365864	+	5'Flank	SNP	G	G	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr11:65365864G>T	ENST00000340313.4	-	0	0				KCNK7_ENST00000394216.2_5'Flank|KCNK7_ENST00000394217.2_5'Flank|KCNK7_ENST00000342202.4_5'Flank|MAP3K11_ENST00000530153.1_Missense_Mutation_p.D557E|MAP3K11_ENST00000534432.1_5'Flank|MAP3K11_ENST00000309100.3_Missense_Mutation_p.D814E|MAP3K11_ENST00000532507.1_Missense_Mutation_p.D230E	NM_033347.1	NP_203133.1	Q9Y2U2	KCNK7_HUMAN	potassium channel, subfamily K, member 7						potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|liver(1)|lung(1)	3						CAGGTGGGGAGTCCCAGAAGG	0.687																																					p.D814E		Atlas-SNP	.											.	MAP3K11	67	.	0			c.C2442A						.						29.0	30.0	29.0					11																	65365864		2201	4297	6498	SO:0001631	upstream_gene_variant	4296	exon10			TGGGGAGTCCCAG	AF110522	CCDS8106.1, CCDS31608.1, CCDS41673.1	11q13	2012-03-07			ENSG00000173338	ENSG00000173338		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6282	protein-coding gene	gene with protein product		603940				10206991, 11256078, 16382106	Standard	NM_033347		Approved	K2p7.1	uc001oes.3	Q9Y2U2	OTTHUMG00000166528		chr11.hg19:g.65365864G>T	Exception_encountered	218.0	0.0		127.0	42.0	NM_002419	Q3SYI2|Q9Y2U3|Q9Y2U4	Missense_Mutation	SNP	ENST00000340313.4	hg19	CCDS31608.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527042	0.85706	.	.	ENSG00000173327	ENST00000309100;ENST00000532507;ENST00000530153	T;T	0.74842	-0.79;-0.88	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000001	T	0.75012	0.3792	N	0.22421	0.69	0.32192	N	0.578959	D;D	0.61697	0.99;0.984	D;D	0.75484	0.986;0.935	T	0.69967	-0.5001	10	0.10636	T	0.68	.	14.7718	0.69684	0.0:0.0:1.0:0.0	.	303;814	B3KQY4;Q16584	.;M3K11_HUMAN	E	814;230;557	ENSP00000309597:D814E;ENSP00000433886:D557E	ENSP00000309597:D814E	D	-	3	2	MAP3K11	65122440	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.052000	0.41316	2.633000	0.89246	0.655000	0.94253	GAC	.	.		0.687	KCNK7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390206.1	NM_005714	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43833794	43833794	+	Missense_Mutation	SNP	T	T	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr12:43833794T>C	ENST00000389420.3	-	17	2368	c.2369A>G	c.(2368-2370)cAa>cGa	p.Q790R	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.Q790R|ADAMTS20_ENST00000395541.2_5'Flank	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	790	Spacer.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TCTTGTTCCTTGCACATTGAT	0.308																																					p.Q790R		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.A2369G						.						83.0	71.0	75.0					12																	43833794		2198	4290	6488	SO:0001583	missense	80070	exon17			GTTCCTTGCACAT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2369A>G	chr12.hg19:g.43833794T>C	ENSP00000374071:p.Gln790Arg	87.0	0.0		56.0	22.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	6.323	0.427626	0.11987	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.51325	0.71;0.71	5.19	4.03	0.46877	ADAM-TS Spacer 1 (1);	0.256819	0.27577	N	0.018744	T	0.34483	0.0899	N	0.24115	0.695	0.80722	D	1	P	0.35383	0.498	B	0.40329	0.326	T	0.04946	-1.0916	10	0.11485	T	0.65	.	11.5753	0.50858	0.0:0.0714:0.0:0.9286	.	790	P59510	ATS20_HUMAN	R	790	ENSP00000374071:Q790R;ENSP00000448341:Q790R	ENSP00000374068:Q790R	Q	-	2	0	ADAMTS20	42120061	1.000000	0.71417	0.999000	0.59377	0.163000	0.22366	3.863000	0.56016	1.057000	0.40506	-0.297000	0.09499	CAA	.	.		0.308	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
SYCP3	50511	hgsc.bcm.edu	37	12	102125389	102125389	+	Missense_Mutation	SNP	T	T	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr12:102125389T>A	ENST00000392927.3	-	7	640	c.509A>T	c.(508-510)cAg>cTg	p.Q170L	SYCP3_ENST00000392924.1_Missense_Mutation_p.Q170L|SYCP3_ENST00000266743.2_Missense_Mutation_p.Q170L	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	170	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q170R(1)		endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TTTCAATCTCTGGCTCTGAAC	0.279																																					p.Q170L		Atlas-SNP	.											SYCP3,NS,carcinoma,0,1	SYCP3	19	.	1	Substitution - Missense(1)	lung(1)	c.A509T						.						58.0	58.0	58.0					12																	102125389		2201	4270	6471	SO:0001583	missense	50511	exon7			AATCTCTGGCTCT	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.509A>T	chr12.hg19:g.102125389T>A	ENSP00000376658:p.Gln170Leu	60.0	0.0		39.0	12.0	NM_001177949		Missense_Mutation	SNP	ENST00000392927.3	hg19	CCDS9087.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785978	0.70337	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.79476	0.4452	M	0.86651	2.83	0.51482	D	0.999925	D	0.76494	0.999	D	0.77004	0.989	T	0.82159	-0.0595	9	0.62326	D	0.03	-0.8602	10.5266	0.44952	0.0:0.0:0.1622:0.8378	.	170	Q8IZU3	SYCP3_HUMAN	L	170	.	ENSP00000266743:Q170L	Q	-	2	0	SYCP3	100649520	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.283000	0.65621	2.023000	0.59567	0.254000	0.18369	CAG	.	.		0.279	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316478.2	NM_153694	
OLFM4	10562	hgsc.bcm.edu	37	13	53624703	53624703	+	Missense_Mutation	SNP	C	C	A	rs542614490	byFrequency	TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr13:53624703C>A	ENST00000219022.2	+	5	1408	c.1330C>A	c.(1330-1332)Cgt>Agt	p.R444S		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	444	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GTATGCCACCCGTACTATGAA	0.413																																					p.R444S		Atlas-SNP	.											.	OLFM4	94	.	0			c.C1330A						.						137.0	124.0	129.0					13																	53624703		2203	4300	6503	SO:0001583	missense	10562	exon5			GCCACCCGTACTA	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1330C>A	chr13.hg19:g.53624703C>A	ENSP00000219022:p.Arg444Ser	161.0	0.0		117.0	43.0	NM_006418	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	hg19	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.088572	0.55968	.	.	ENSG00000102837	ENST00000219022	D	0.89196	-2.48	5.92	4.13	0.48395	Olfactomedin-like (3);	0.043912	0.85682	D	0.000000	D	0.92417	0.7593	M	0.66560	2.04	0.48511	D	0.999668	D	0.89917	1.0	D	0.91635	0.999	D	0.92233	0.5794	10	0.72032	D	0.01	.	8.9069	0.35530	0.3087:0.6165:0.0:0.0748	.	444	Q6UX06	OLFM4_HUMAN	S	444	ENSP00000219022:R444S	ENSP00000219022:R444S	R	+	1	0	OLFM4	52522704	0.771000	0.28555	0.899000	0.35326	0.463000	0.32649	1.607000	0.36836	1.500000	0.48636	0.650000	0.86243	CGT	.	.		0.413	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
HECTD1	25831	hgsc.bcm.edu	37	14	31597196	31597196	+	Silent	SNP	A	A	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr14:31597196A>G	ENST00000399332.1	-	26	5264	c.4776T>C	c.(4774-4776)ggT>ggC	p.G1592G	HECTD1_ENST00000553700.1_Silent_p.G1592G	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1592	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		AACTCTGAGCACCCATAAGAG	0.373																																					p.G1592G		Atlas-SNP	.											.	HECTD1	159	.	0			c.T4776C						.						83.0	75.0	77.0					14																	31597196		1884	4115	5999	SO:0001819	synonymous_variant	25831	exon26			CTGAGCACCCATA	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4776T>C	chr14.hg19:g.31597196A>G		106.0	0.0		79.0	29.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Silent	SNP	ENST00000399332.1	hg19	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	A	3.680	-0.065670	0.07273	.	.	ENSG00000092148	ENST00000557369	.	.	.	6.16	4.98	0.66077	.	.	.	.	.	T	0.59878	0.2226	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58267	-0.7666	4	.	.	.	-16.3884	8.8367	0.35117	0.7421:0.132:0.0:0.1259	.	.	.	.	R	144	.	.	C	-	1	0	HECTD1	30666947	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.578000	0.36525	2.367000	0.80283	0.528000	0.53228	TGC	.	.		0.373	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
MTHFD1	4522	hgsc.bcm.edu	37	14	64920556	64920556	+	Missense_Mutation	SNP	A	A	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr14:64920556A>C	ENST00000545908.1	+	25	2939	c.2710A>C	c.(2710-2712)Aaa>Caa	p.K904Q	MTHFD1_ENST00000556284.1_3'UTR|ZBTB25_ENST00000555424.1_Intron|MTHFD1_ENST00000216605.8_Missense_Mutation_p.K848Q|ZBTB25_ENST00000555220.1_Intron			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	848	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	AGCTCAACACAAAGCTGAAGT	0.443																																					p.K848Q	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	Atlas-SNP	.											.	MTHFD1	61	.	0			c.A2542C						.						165.0	132.0	144.0					14																	64920556		2203	4300	6503	SO:0001583	missense	4522	exon25			CAACACAAAGCTG	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2710A>C	chr14.hg19:g.64920556A>C	ENSP00000438588:p.Lys904Gln	139.0	0.0		127.0	52.0	NM_005956	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	ENST00000545908.1	hg19		.	.	.	.	.	.	.	.	.	.	A	11.83	1.756720	0.31137	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605	T;T;T	0.22336	1.96;1.96;1.96	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.19446	0.0467	L	0.35793	1.09	0.80722	D	1	P;B	0.36249	0.545;0.058	B;B	0.39617	0.305;0.106	T	0.04347	-1.0958	10	0.20519	T	0.43	-20.9854	14.5157	0.67818	1.0:0.0:0.0:0.0	.	904;848	F5H2F4;G3V2B8	.;.	Q	904;848;904	ENSP00000438588:K904Q;ENSP00000450560:K848Q;ENSP00000216605:K904Q	ENSP00000216605:K848Q	K	+	1	0	MTHFD1	63990309	1.000000	0.71417	0.992000	0.48379	0.207000	0.24258	9.083000	0.94067	2.064000	0.61679	0.477000	0.44152	AAA	.	.		0.443	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
PLEKHD1	400224	hgsc.bcm.edu	37	14	69994592	69994592	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr14:69994592C>T	ENST00000322564.7	+	12	1506	c.1294C>T	c.(1294-1296)Cgc>Tgc	p.R432C		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	432										breast(1)|endometrium(1)|kidney(2)	4						GGCAGCCACTCGCCGCATCAA	0.597																																					p.R432C		Atlas-SNP	.											.	PLEKHD1	24	.	0			c.C1294T						.						17.0	22.0	21.0					14																	69994592		692	1591	2283	SO:0001583	missense	400224	exon12			GCCACTCGCCGCA	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.1294C>T	chr14.hg19:g.69994592C>T	ENSP00000317175:p.Arg432Cys	121.0	0.0		90.0	41.0	NM_001161498	B9EJC2	Missense_Mutation	SNP	ENST00000322564.7	hg19	CCDS53903.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170137	0.78452	.	.	ENSG00000175985	ENST00000322564	.	.	.	5.04	4.15	0.48705	.	0.177372	0.34025	N	0.004323	T	0.42381	0.1200	L	0.32530	0.975	0.46954	D	0.999261	B	0.15719	0.014	B	0.10450	0.005	T	0.22521	-1.0214	8	.	.	.	-12.7967	8.9927	0.36033	0.1457:0.779:0.0:0.0752	.	432	B9EJC2	.	C	432	.	.	R	+	1	0	PLEKHD1	69064345	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	5.125000	0.64715	1.250000	0.43966	0.462000	0.41574	CGC	.	.		0.597	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
UNC79	57578	hgsc.bcm.edu	37	14	94139742	94139742	+	Silent	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr14:94139742C>T	ENST00000393151.2	+	42	6799	c.6799C>T	c.(6799-6801)Ctg>Ttg	p.L2267L	UNC79_ENST00000256339.4_Silent_p.L2090L|UNC79_ENST00000555664.1_Silent_p.L2228L|UNC79_ENST00000553484.1_Silent_p.L2289L			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2267					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCTAGAACTTCTGCAGGCCCT	0.358																																					p.L2090L		Atlas-SNP	.											.	UNC79	366	.	0			c.C6268T						.						183.0	176.0	178.0					14																	94139742		2203	4300	6503	SO:0001819	synonymous_variant	57578	exon42			GAACTTCTGCAGG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6799C>T	chr14.hg19:g.94139742C>T		98.0	0.0		84.0	23.0	NM_020818	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	hg19																																																																																				.	.		0.358	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
AHNAK2	113146	hgsc.bcm.edu	37	14	105411351	105411351	+	Silent	SNP	C	C	T	rs556676336		TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr14:105411351C>T	ENST00000333244.5	-	7	10556	c.10437G>A	c.(10435-10437)aaG>aaA	p.K3479K	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3479						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGGAGGGCATCTTGAACTTGG	0.622																																					p.K3479K		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G10437A						.						226.0	241.0	236.0					14																	105411351		1976	4148	6124	SO:0001819	synonymous_variant	113146	exon7			GGGCATCTTGAAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.10437G>A	chr14.hg19:g.105411351C>T		98.0	0.0		83.0	17.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	ENST00000333244.5	hg19	CCDS45177.1																																																																																			.	.		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
BAHD1	22893	hgsc.bcm.edu	37	15	40751536	40751536	+	Silent	SNP	A	A	G	rs144909314	byFrequency	TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr15:40751536A>G	ENST00000416165.1	+	2	944	c.873A>G	c.(871-873)ccA>ccG	p.P291P	BAHD1_ENST00000560846.1_Silent_p.P291P|BAHD1_ENST00000561234.1_Silent_p.P291P	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	291	Pro-rich.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CTTGTGGGCCATCCGTCCAGC	0.662																																					p.P291P		Atlas-SNP	.											.	BAHD1	68	.	0			c.A873G						.						46.0	47.0	47.0					15																	40751536		2202	4295	6497	SO:0001819	synonymous_variant	22893	exon2			TGGGCCATCCGTC	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.873A>G	chr15.hg19:g.40751536A>G		147.0	0.0		106.0	47.0	NM_014952	Q8NDF7|Q9Y2F4	Silent	SNP	ENST00000416165.1	hg19	CCDS10058.1																																																																																			.	A|0.997;C|0.003		0.662	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952	
CORO2B	10391	hgsc.bcm.edu	37	15	69011783	69011783	+	Silent	SNP	T	T	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr15:69011783T>C	ENST00000566799.1	+	11	1232	c.1203T>C	c.(1201-1203)taT>taC	p.Y401Y	CORO2B_ENST00000543950.1_Silent_p.Y396Y|CORO2B_ENST00000540068.1_Silent_p.Y396Y|CORO2B_ENST00000261861.5_Silent_p.Y396Y			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	401					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						AAGAAGGCTATAAGAAGTCCT	0.453																																					p.Y401Y		Atlas-SNP	.											.	CORO2B	68	.	0			c.T1203C						.						142.0	137.0	139.0					15																	69011783		2200	4298	6498	SO:0001819	synonymous_variant	10391	exon11			AGGCTATAAGAAG	AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.1203T>C	chr15.hg19:g.69011783T>C		191.0	0.0		127.0	54.0	NM_006091	A8K0W3|O94767|Q8TAN1	Silent	SNP	ENST00000566799.1	hg19	CCDS10229.2																																																																																			.	.		0.453	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
RCN2	5955	hgsc.bcm.edu	37	15	77224707	77224707	+	Missense_Mutation	SNP	T	T	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr15:77224707T>A	ENST00000394885.3	+	2	373	c.150T>A	c.(148-150)gaT>gaA	p.D50E	RCN2_ENST00000394883.3_Intron|RCN2_ENST00000320963.5_Missense_Mutation_p.D50E	NM_002902.2	NP_002893.1	Q14257	RCN2_HUMAN	reticulocalbin 2, EF-hand calcium binding domain	50						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(2)|large_intestine(2)|lung(1)	7						TAAAGGAAGATGTGGATGAAT	0.473																																					p.D50E		Atlas-SNP	.											.	RCN2	16	.	0			c.T150A						.						64.0	55.0	58.0					15																	77224707		2196	4294	6490	SO:0001583	missense	5955	exon2			GGAAGATGTGGAT	X78669	CCDS10291.1, CCDS61719.1	15q22.33-q24.1	2013-01-10			ENSG00000117906	ENSG00000117906		"""EF-hand domain containing"""	9935	protein-coding gene	gene with protein product	"""Reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD)"""	602584				9533013, 7624774	Standard	NM_002902		Approved	ERC-55, E6BP, ERC55, TCBP49	uc002bcd.3	Q14257	OTTHUMG00000143730	ENST00000394885.3:c.150T>A	chr15.hg19:g.77224707T>A	ENSP00000378349:p.Asp50Glu	68.0	0.0		67.0	23.0	NM_002902	A8MTG6|F8WCY5|Q53XN8	Missense_Mutation	SNP	ENST00000394885.3	hg19	CCDS10291.1	.	.	.	.	.	.	.	.	.	.	T	7.036	0.561666	0.13498	.	.	ENSG00000117906	ENST00000394885;ENST00000320963	T;T	0.73363	-0.74;0.36	5.45	0.164	0.14990	.	0.329961	0.35525	N	0.003142	T	0.33440	0.0863	N	0.01081	-1.03	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.13407	0.009;0.001	T	0.37865	-0.9687	10	0.02654	T	1	-5.953	4.7914	0.13250	0.6145:0.2183:0.066:0.1011	.	50;50	F8WCY5;Q14257	.;RCN2_HUMAN	E	50	ENSP00000378349:D50E;ENSP00000319739:D50E	ENSP00000319739:D50E	D	+	3	2	RCN2	75011762	1.000000	0.71417	0.996000	0.52242	0.856000	0.48823	0.861000	0.27885	-0.237000	0.09739	-0.649000	0.03915	GAT	.	.		0.473	RCN2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289795.1	NM_002902	
PRPF8	10594	hgsc.bcm.edu	37	17	1584082	1584082	+	Missense_Mutation	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:1584082C>A	ENST00000572621.1	-	7	1301	c.1036G>T	c.(1036-1038)Gac>Tac	p.D346Y	PRPF8_ENST00000304992.6_Missense_Mutation_p.D346Y			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	346					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GCTGGCAAGTCAGGATCCTCA	0.473																																					p.D346Y		Atlas-SNP	.											.	PRPF8	169	.	0			c.G1036T						.						133.0	127.0	129.0					17																	1584082		2203	4300	6503	SO:0001583	missense	10594	exon8			GCAAGTCAGGATC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1036G>T	chr17.hg19:g.1584082C>A	ENSP00000460348:p.Asp346Tyr	170.0	0.0		119.0	52.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	hg19	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.181343	0.78677	.	.	ENSG00000174231	ENST00000304992	D	0.81659	-1.52	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.90662	0.7071	M	0.85945	2.785	0.80722	D	1	D	0.64830	0.994	D	0.64506	0.926	D	0.91594	0.5289	10	0.87932	D	0	-14.5378	19.7207	0.96142	0.0:1.0:0.0:0.0	.	346	Q6P2Q9	PRP8_HUMAN	Y	346	ENSP00000304350:D346Y	ENSP00000304350:D346Y	D	-	1	0	PRPF8	1530832	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.780000	0.85658	2.647000	0.89833	0.650000	0.86243	GAC	.	.		0.473	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
TTC19	54902	hgsc.bcm.edu	37	17	15903501	15903501	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:15903501C>T	ENST00000261647.5	+	2	723	c.254C>T	c.(253-255)gCc>gTc	p.A85V	TTC19_ENST00000497842.2_3'UTR|ZSWIM7_ENST00000399280.2_5'Flank|ZSWIM7_ENST00000486655.1_5'Flank|ZSWIM7_ENST00000399277.1_5'Flank|TTC19_ENST00000486880.2_Missense_Mutation_p.A206V|ZSWIM7_ENST00000472495.1_5'Flank	NM_001271420.1|NM_017775.3	NP_001258349.1|NP_060245.3	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19	85					cytokinesis (GO:0000910)|mitochondrial respiratory chain complex III assembly (GO:0034551)	centrosome (GO:0005813)|midbody (GO:0030496)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				central_nervous_system(1)|lung(2)|skin(1)|stomach(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GGGGCCGCTGCCGAGGACGGG	0.741																																					p.A85V		Atlas-SNP	.											.	TTC19	10	.	0			c.C254T						.						9.0	14.0	13.0					17																	15903501		2144	4195	6339	SO:0001583	missense	54902	exon2			CCGCTGCCGAGGA	AK094819	CCDS11174.1, CCDS11174.2	17p11.2	2013-01-11			ENSG00000011295	ENSG00000011295		"""Tetratricopeptide (TTC) repeat domain containing"""	26006	protein-coding gene	gene with protein product		613814					Standard	NM_017775		Approved	FLJ20343, MGC19520	uc002gph.3	Q6DKK2	OTTHUMG00000059306	ENST00000261647.5:c.254C>T	chr17.hg19:g.15903501C>T	ENSP00000261647:p.Ala85Val	1107.0	0.0		867.0	91.0	NM_017775	A8MZ52|B3KP62|B4DN65|Q2M248|Q7L3U8|Q9H6G3|Q9NXB2	Missense_Mutation	SNP	ENST00000261647.5	hg19	CCDS11174.2	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740517	0.30865	.	.	ENSG00000011295	ENST00000261647;ENST00000555605;ENST00000395886	D	0.83992	-1.79	3.98	1.74	0.24563	.	0.882556	0.09519	N	0.791185	T	0.67487	0.2898	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.60732	-0.7205	8	0.56958	D	0.05	0.0576	6.2913	0.21061	0.2127:0.581:0.2063:0.0	.	.	.	.	V	85;206;85	ENSP00000261647:A85V	ENSP00000261647:A206V	A	+	2	0	TTC19	15844226	0.000000	0.05858	0.013000	0.15412	0.484000	0.33280	0.222000	0.17699	1.005000	0.39183	0.498000	0.49722	GCC	.	.		0.741	TTC19-001	NOVEL	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000131725.6	NM_017775	
TAOK1	57551	hgsc.bcm.edu	37	17	27849536	27849536	+	Splice_Site	SNP	A	A	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:27849536A>T	ENST00000261716.3	+	17	2666	c.2147A>T	c.(2146-2148)aAg>aTg	p.K716M	TAOK1_ENST00000536202.1_Intron	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	716					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			AAGAGTTTGAAGGTATGGTTA	0.388																																					p.K716M		Atlas-SNP	.											.	TAOK1	151	.	0			c.A2147T						.						102.0	99.0	100.0					17																	27849536		2203	4300	6503	SO:0001630	splice_region_variant	57551	exon17			GTTTGAAGGTATG	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.2148+1A>T	chr17.hg19:g.27849536A>T		180.0	0.0		114.0	13.0	NM_020791	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	hg19	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.326220	0.81580	.	.	ENSG00000160551	ENST00000261716	T	0.61980	0.06	5.81	5.81	0.92471	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80374	0.4611	M	0.87547	2.89	0.80722	D	1	P	0.52692	0.955	P	0.60286	0.872	D	0.84033	0.0360	10	0.87932	D	0	.	16.1631	0.81732	1.0:0.0:0.0:0.0	.	716	Q7L7X3	TAOK1_HUMAN	M	716	ENSP00000261716:K716M	ENSP00000261716:K716M	K	+	2	0	TAOK1	24873662	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.570000	0.82390	2.217000	0.71921	0.523000	0.50628	AAG	.	.		0.388	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	Missense_Mutation
SLFN14	342618	hgsc.bcm.edu	37	17	33875849	33875849	+	Silent	SNP	A	A	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:33875849A>G	ENST00000415846.3	-	4	2183	c.2148T>C	c.(2146-2148)ctT>ctC	p.L716L		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	716							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ATGGAGGGGGAAGGCCATTGA	0.463																																					p.L716L		Atlas-SNP	.											.	SLFN14	43	.	0			c.T2148C						.						92.0	82.0	85.0					17																	33875849		692	1591	2283	SO:0001819	synonymous_variant	342618	exon4			AGGGGGAAGGCCA		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.2148T>C	chr17.hg19:g.33875849A>G		145.0	0.0		117.0	5.0	NM_001129820	B2RTW9	Silent	SNP	ENST00000415846.3	hg19	CCDS45650.1																																																																																			.	.		0.463	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448928.1	NM_001129820	
ATP6V0A1	535	hgsc.bcm.edu	37	17	40650998	40650998	+	Missense_Mutation	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:40650998G>A	ENST00000343619.4	+	15	1740	c.1617G>A	c.(1615-1617)atG>atA	p.M539I	ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.M185I|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.M539I|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.M496I|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.M546I|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.M539I|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.M496I|RP11-194N12.2_ENST00000591343.1_RNA	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	539					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		AGATGAAGATGTCTGTTATCC	0.368																																					p.M546I		Atlas-SNP	.											.	ATP6V0A1	67	.	0			c.G1638A						.						246.0	221.0	230.0					17																	40650998		2203	4300	6503	SO:0001583	missense	535	exon15			GAAGATGTCTGTT	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1617G>A	chr17.hg19:g.40650998G>A	ENSP00000342951:p.Met539Ile	171.0	0.0		112.0	41.0	NM_001130020	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	hg19	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394617	0.62066	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05;-2.05	5.76	4.8	0.61643	.	0.035003	0.85682	D	0.000000	D	0.86314	0.5903	M	0.76170	2.325	0.80722	D	1	B;B;B;B;B	0.33044	0.001;0.001;0.001;0.134;0.395	B;B;B;B;B	0.38683	0.004;0.013;0.008;0.111;0.279	D	0.85101	0.0957	10	0.40728	T	0.16	-24.1107	14.7293	0.69368	0.0693:0.0:0.9307:0.0	.	496;496;546;539;539	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	I	539;539;539;546;496;185	ENSP00000342951:M539I;ENSP00000444676:M539I;ENSP00000377415:M539I;ENSP00000264649:M546I;ENSP00000443991:M496I;ENSP00000446377:M185I	ENSP00000264649:M546I	M	+	3	0	ATP6V0A1	37904524	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.724000	0.74747	1.443000	0.47586	0.655000	0.94253	ATG	.	.		0.368	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
ABCA5	23461	hgsc.bcm.edu	37	17	67285417	67285417	+	Missense_Mutation	SNP	A	A	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:67285417A>C	ENST00000392676.3	-	14	1867	c.1803T>G	c.(1801-1803)gaT>gaG	p.D601E	ABCA5_ENST00000588877.1_Missense_Mutation_p.D601E|ABCA5_ENST00000392677.2_Missense_Mutation_p.D601E			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	601	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	GCATGTCTAAATCTAGTAAAA	0.289																																					p.D601E		Atlas-SNP	.											.	ABCA5	162	.	0			c.T1803G						.						86.0	83.0	84.0					17																	67285417		2202	4298	6500	SO:0001583	missense	23461	exon13			GTCTAAATCTAGT	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.1803T>G	chr17.hg19:g.67285417A>C	ENSP00000376443:p.Asp601Glu	84.0	0.0		62.0	29.0	NM_018672	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	ENST00000392676.3	hg19	CCDS11685.1	.	.	.	.	.	.	.	.	.	.	A	9.538	1.112497	0.20795	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	D;D	0.93189	-3.18;-3.18	5.09	5.09	0.68999	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000009	D	0.90487	0.7020	N	0.03016	-0.435	0.54753	D	0.999984	D;D	0.89917	0.999;1.0	D;D	0.77004	0.973;0.989	D	0.90276	0.4311	9	.	.	.	.	14.5684	0.68194	1.0:0.0:0.0:0.0	.	601;601	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	E	601	ENSP00000376444:D601E;ENSP00000376443:D601E	.	D	-	3	2	ABCA5	64797012	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.443000	0.52907	1.935000	0.56089	0.397000	0.26171	GAT	.	.		0.289	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
SBNO2	22904	hgsc.bcm.edu	37	19	1109536	1109536	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr19:1109536C>T	ENST00000361757.3	-	28	3422	c.3185G>A	c.(3184-3186)gGc>gAc	p.G1062D	SBNO2_ENST00000587024.1_Missense_Mutation_p.G1052D|SBNO2_ENST00000438103.2_Missense_Mutation_p.G1005D	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	1062					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCATAGGGGCCCGTCAGCGC	0.721																																					p.G1062D		Atlas-SNP	.											.	SBNO2	112	.	0			c.G3185A						.						7.0	9.0	8.0					19																	1109536		1854	4036	5890	SO:0001583	missense	22904	exon28			TAGGGGCCCGTCA	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.3185G>A	chr19.hg19:g.1109536C>T	ENSP00000354733:p.Gly1062Asp	176.0	0.0		106.0	37.0	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	hg19	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566936	0.45694	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	D;D	0.83250	-1.7;-1.7	4.62	4.62	0.57501	.	0.056069	0.64402	D	0.000001	T	0.76849	0.4045	L	0.51422	1.61	0.32387	N	0.553836	P;P	0.39131	0.531;0.661	B;B	0.38378	0.14;0.272	T	0.79729	-0.1681	10	0.29301	T	0.29	-34.4199	10.1785	0.42952	0.0:0.9078:0.0:0.0922	.	1062;1005	Q9Y2G9;Q9Y2G9-3	SBNO2_HUMAN;.	D	1062;1005;1080	ENSP00000354733:G1062D;ENSP00000400762:G1005D	ENSP00000250872:G1080D	G	-	2	0	SBNO2	1060536	0.735000	0.28153	0.057000	0.19452	0.592000	0.36648	2.687000	0.46976	2.121000	0.65114	0.462000	0.41574	GGC	.	.		0.721	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
PTPRS	5802	hgsc.bcm.edu	37	19	5244107	5244107	+	Missense_Mutation	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr19:5244107C>A	ENST00000587303.1	-	10	1474	c.1375G>T	c.(1375-1377)Ggc>Tgc	p.G459C	PTPRS_ENST00000592099.1_Missense_Mutation_p.G446C|PTPRS_ENST00000372412.4_Missense_Mutation_p.G460C|PTPRS_ENST00000348075.2_Missense_Mutation_p.G446C|PTPRS_ENST00000353284.2_Missense_Mutation_p.G446C|PTPRS_ENST00000357368.4_Missense_Mutation_p.G459C|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Missense_Mutation_p.G455C|PTPRS_ENST00000588012.1_Missense_Mutation_p.G446C			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	459	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	ACGCGGTAGCCGCGGATCAGG	0.677																																					p.G459C		Atlas-SNP	.											.	PTPRS	169	.	0			c.G1375T						.						87.0	81.0	83.0					19																	5244107		2203	4300	6503	SO:0001583	missense	5802	exon11			GGTAGCCGCGGAT	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1375G>T	chr19.hg19:g.5244107C>A	ENSP00000467537:p.Gly459Cys	55.0	0.0		40.0	15.0	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	hg19	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018157	0.54576	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08	3.84	3.84	0.44239	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000002	D	0.84960	0.5588	H	0.98612	4.28	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.994;0.997;0.992;1.0;1.0;0.996	D	0.91511	0.5227	10	0.87932	D	0	.	15.9215	0.79580	0.0:1.0:0.0:0.0	.	459;446;450;446;459;472	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	C	472;460;459;459;459;455;446;459;450;446	ENSP00000361489:G460C;ENSP00000349932:G459C;ENSP00000262963:G455C;ENSP00000269907:G446C;ENSP00000327313:G446C	ENSP00000262963:G455C	G	-	1	0	PTPRS	5195107	1.000000	0.71417	0.995000	0.50966	0.097000	0.18754	7.509000	0.81698	1.999000	0.58509	0.462000	0.41574	GGC	.	.		0.677	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
FUT6	2528	hgsc.bcm.edu	37	19	5832522	5832522	+	Silent	SNP	C	C	A	rs371867552		TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr19:5832522C>A	ENST00000318336.4	-	3	1251	c.57G>T	c.(55-57)acG>acT	p.T19T	FUT6_ENST00000592563.1_Silent_p.T19T|FUT6_ENST00000524754.1_Silent_p.T19T|FUT6_ENST00000286955.5_Silent_p.T19T|FUT6_ENST00000527106.1_Silent_p.T19T	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	19					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						GAAACAGCAGCGTGGTCAGAC	0.582																																					p.T19T		Atlas-SNP	.											.	FUT6	30	.	0			c.G57T						.						37.0	31.0	33.0					19																	5832522		2203	4300	6503	SO:0001819	synonymous_variant	2528	exon3			CAGCAGCGTGGTC		CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.57G>T	chr19.hg19:g.5832522C>A		183.0	0.0		113.0	35.0	NM_000150	A6NEX0|D6W637|Q9UND8	Silent	SNP	ENST00000318336.4	hg19	CCDS12152.1																																																																																			.	.		0.582	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394218.2	NM_000150	
CACNA1A	773	hgsc.bcm.edu	37	19	13616903	13616903	+	Silent	SNP	T	T	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr19:13616903T>G	ENST00000360228.5	-	1	135	c.136A>C	c.(136-138)Agg>Cgg	p.R46R	CACNA1A_ENST00000573710.2_Silent_p.R46R	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	46					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TTGTACATCCTTTGCGCCCCG	0.706																																					p.R46R		Atlas-SNP	.											.	CACNA1A	715	.	0			c.A136C						.						69.0	73.0	72.0					19																	13616903		2046	4189	6235	SO:0001819	synonymous_variant	773	exon1			ACATCCTTTGCGC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.136A>C	chr19.hg19:g.13616903T>G		1172.0	1.0		935.0	368.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	ENST00000360228.5	hg19	CCDS45998.1																																																																																			.	.		0.706	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CEACAM5	1048	hgsc.bcm.edu	37	19	42221465	42221465	+	Silent	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr19:42221465G>A	ENST00000221992.6	+	5	1164	c.1050G>A	c.(1048-1050)caG>caA	p.Q350Q	CEACAM5_ENST00000405816.1_Silent_p.Q350Q|CEACAM5_ENST00000398599.4_Silent_p.Q349Q|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	350	Ig-like 4.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CTGAGATTCAGAACACAACCT	0.532																																					p.Q350Q		Atlas-SNP	.											.	CEACAM5	84	.	0			c.G1050A						.						177.0	167.0	170.0					19																	42221465		2203	4300	6503	SO:0001819	synonymous_variant	1048	exon5			GATTCAGAACACA	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1050G>A	chr19.hg19:g.42221465G>A		133.0	0.0		89.0	31.0	NM_004363	H9KVA7	Silent	SNP	ENST00000221992.6	hg19	CCDS12584.1	.	.	.	.	.	.	.	.	.	.	G	5.471	0.272029	0.10349	.	.	ENSG00000105388	ENST00000398599	.	.	.	2.77	-2.34	0.06704	.	.	.	.	.	T	0.21468	0.0517	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30736	-0.9968	4	.	.	.	.	4.3211	0.11018	0.0:0.2213:0.3319:0.4468	.	.	.	.	K	346	.	.	E	+	1	0	CEACAM5	46913305	0.000000	0.05858	0.000000	0.03702	0.370000	0.29829	-0.120000	0.10660	-0.052000	0.13311	0.479000	0.44913	GAA	.	.		0.532	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
LILRB3	11025	hgsc.bcm.edu	37	19	54726002	54726002	+	Splice_Site	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr19:54726002C>A	ENST00000391750.1	-	5	492	c.356G>T	c.(355-357)gGa>gTa	p.G119V	LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000469273.1_5'Flank|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000424807.1_Splice_Site_p.G119V|LILRB3_ENST00000346401.6_Splice_Site_p.G119V|LILRB3_ENST00000245620.9_Splice_Site_p.G119V|LILRA6_ENST00000391735.3_Intron|LILRB3_ENST00000407860.2_Splice_Site_p.G119V|CTB-83J4.1_ENST00000601161.1_lincRNA			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	119	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCTGTAGGCTCCTAGGAGAGA	0.622																																					p.G119V		Atlas-SNP	.											.	LILRB3	67	.	0			c.G356T						.						62.0	40.0	48.0					19																	54726002		2132	3924	6056	SO:0001630	splice_region_variant	11025	exon4			TAGGCTCCTAGGA	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.356-1G>T	chr19.hg19:g.54726002C>A		214.0	0.0		141.0	18.0	NM_006864	C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	ENST00000391750.1	hg19	CCDS33105.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844770	0.32606	.	.	ENSG00000204577	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860;ENST00000445347	T;T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52;2.52	2.87	0.59	0.17458	Immunoglobulin-like fold (1);	0.256125	0.27500	N	0.019096	T	0.42787	0.1218	H	0.97023	3.925	0.23150	N	0.99821	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.993;0.995;0.999;0.985;0.999	T	0.27468	-1.0073	10	0.87932	D	0	.	3.9673	0.09437	0.0:0.6062:0.2496:0.1442	.	119;119;119;119;119	B5MCX0;F8WD89;O75022-2;O75022;O75022-3	.;.;.;LIRB3_HUMAN;.	V	119	ENSP00000375630:G119V;ENSP00000412771:G119V;ENSP00000345184:G119V;ENSP00000245620:G119V;ENSP00000384274:G119V;ENSP00000388199:G119V	ENSP00000245620:G119V	G	-	2	0	LILRB3	59417814	0.108000	0.22018	0.177000	0.23020	0.074000	0.17049	1.354000	0.34056	0.253000	0.21552	-0.253000	0.11424	GGA	.	.		0.622	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	Missense_Mutation
CFAP61	26074	hgsc.bcm.edu	37	20	20144770	20144770	+	Missense_Mutation	SNP	T	T	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr20:20144770T>C	ENST00000245957.5	+	11	1179	c.1103T>C	c.(1102-1104)cTc>cCc	p.L368P	C20orf26_ENST00000377306.1_Missense_Mutation_p.L368P|C20orf26_ENST00000451767.2_Missense_Mutation_p.L368P|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000389656.3_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		368										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TTGGCATCGCTCGTACTGCCT	0.493																																					p.L368P		Atlas-SNP	.											.	C20orf26	188	.	0			c.T1103C						.						131.0	121.0	125.0					20																	20144770		2203	4300	6503	SO:0001583	missense	26074	exon11			CATCGCTCGTACT																												ENST00000245957.5:c.1103T>C	chr20.hg19:g.20144770T>C	ENSP00000245957:p.Leu368Pro	65.0	0.0		67.0	24.0	NM_015585	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	ENST00000245957.5	hg19	CCDS33447.1	.	.	.	.	.	.	.	.	.	.	T	13.22	2.171453	0.38315	.	.	ENSG00000089101	ENST00000340348;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000451767	T;T;T	0.09911	2.93;2.93;2.93	5.05	-1.14	0.09741	.	1.337740	0.04852	N	0.442440	T	0.12092	0.0294	L	0.47716	1.5	0.09310	N	0.999997	P;B;B;B	0.49559	0.925;0.009;0.115;0.255	P;B;B;B	0.45610	0.487;0.023;0.048;0.061	T	0.30707	-0.9969	10	0.33940	T	0.23	.	5.0756	0.14630	0.0:0.384:0.1914:0.4246	.	368;368;323;368	Q8NHU2-3;F8W6K4;F8W6E2;Q8NHU2	.;.;.;CT026_HUMAN	P	323;368;368;368;368	ENSP00000245957:L368P;ENSP00000366521:L368P;ENSP00000414537:L368P	ENSP00000245957:L368P	L	+	2	0	C20orf26	20092770	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.128000	0.10531	-0.103000	0.12175	-0.256000	0.11100	CTC	.	.		0.493	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078228.3		
SYS1	90196	hgsc.bcm.edu	37	20	43995750	43995750	+	Missense_Mutation	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr20:43995750G>A	ENST00000243918.5	+	4	757	c.466G>A	c.(466-468)Gtc>Atc	p.V156I	SYS1_ENST00000372727.1_Missense_Mutation_p.V156I|SYS1_ENST00000414310.1_Missense_Mutation_p.V135I|SYS1-DBNDD2_ENST00000452133.1_Intron|SYS1_ENST00000426004.1_Intron|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1_ENST00000479779.1_3'UTR	NM_033542.3	NP_291020.1	Q8N2H4	SYS1_HUMAN	Sys1 golgi trafficking protein	156					protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|large_intestine(2)|prostate(1)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				TAAATCCAATGTCTAGAATCA	0.567																																					p.V156I		Atlas-SNP	.											.	SYS1	15	.	0			c.G466A						.						97.0	98.0	98.0					20																	43995750		2203	4300	6503	SO:0001583	missense	90196	exon5			TCCAATGTCTAGA	AL021578	CCDS13351.1, CCDS56192.1	20q13.12	2014-05-07	2014-05-07	2006-11-06	ENSG00000204070	ENSG00000204070			16162	protein-coding gene	gene with protein product		612979	"""chromosome 20 open reading frame 169"", ""SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)"""	C20orf169		15077113	Standard	NM_001197129		Approved	dJ453C12.4	uc002xnv.3	Q8N2H4	OTTHUMG00000032579	ENST00000243918.5:c.466G>A	chr20.hg19:g.43995750G>A	ENSP00000243918:p.Val156Ile	106.0	0.0		79.0	35.0	NM_001197129	C9JFB3|E1P620|Q5QPU7|Q96SD8|Q9BQZ2|Q9BQZ4|Q9H1F7	Missense_Mutation	SNP	ENST00000243918.5	hg19	CCDS13351.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844763	0.71603	.	.	ENSG00000204070	ENST00000372727;ENST00000414310;ENST00000243918	.	.	.	6.17	6.17	0.99709	.	0.066463	0.64402	D	0.000010	T	0.62221	0.2410	L	0.54323	1.7	0.39460	D	0.96755	B	0.32302	0.363	B	0.31946	0.138	T	0.61773	-0.6994	9	0.51188	T	0.08	-0.0156	19.8676	0.96824	0.0:0.0:1.0:0.0	.	156	Q8N2H4	SYS1_HUMAN	I	156;135;156	.	ENSP00000243918:V156I	V	+	1	0	SYS1	43429164	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.855000	0.62925	2.941000	0.99782	0.655000	0.94253	GTC	.	.		0.567	SYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079453.2	NM_033542	
KCNB1	3745	hgsc.bcm.edu	37	20	47990403	47990403	+	Missense_Mutation	SNP	A	A	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr20:47990403A>G	ENST00000371741.4	-	2	1860	c.1694T>C	c.(1693-1695)aTc>aCc	p.I565T		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	565					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	GGGGCTGGGGATACTCTCCAT	0.493																																					p.I565T		Atlas-SNP	.											.	KCNB1	142	.	0			c.T1694C						.						117.0	100.0	106.0					20																	47990403		2203	4300	6503	SO:0001583	missense	3745	exon2			CTGGGGATACTCT	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1694T>C	chr20.hg19:g.47990403A>G	ENSP00000360806:p.Ile565Thr	110.0	0.0		94.0	33.0	NM_004975	Q14193	Missense_Mutation	SNP	ENST00000371741.4	hg19	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	A	5.981	0.364907	0.11296	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.26660	1.72	6.07	6.07	0.98685	.	1.730570	0.02606	N	0.101553	T	0.31327	0.0793	L	0.40543	1.245	0.25230	N	0.989838	B	0.23377	0.084	B	0.22753	0.041	T	0.43925	-0.9361	10	0.31617	T	0.26	.	16.3023	0.82830	1.0:0.0:0.0:0.0	.	565	Q14721	KCNB1_HUMAN	T	565;520	ENSP00000360806:I565T	ENSP00000360806:I565T	I	-	2	0	KCNB1	47423810	1.000000	0.71417	0.935000	0.37517	0.221000	0.24807	8.962000	0.93254	2.326000	0.78906	0.533000	0.62120	ATC	.	.		0.493	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
BACH1	571	hgsc.bcm.edu	37	21	30701998	30701998	+	Nonsense_Mutation	SNP	C	C	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr21:30701998C>A	ENST00000399921.1	+	4	2003	c.1760C>A	c.(1759-1761)tCa>tAa	p.S587*	BACH1_ENST00000286800.3_Nonsense_Mutation_p.S587*	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						AATCTTGAATCAGAAATTGAG	0.343																																					p.S587X		Atlas-SNP	.											.	BACH1	66	.	0			c.C1760A						.						23.0	23.0	23.0					21																	30701998		2203	4300	6503	SO:0001587	stop_gained	571	exon4			TTGAATCAGAAAT	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.1760C>A	chr21.hg19:g.30701998C>A	ENSP00000382805:p.Ser587*	175.0	0.0		78.0	40.0	NM_206866	Q3MJE2|Q8NCI5	Nonsense_Mutation	SNP	ENST00000399921.1	hg19	CCDS13585.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.779927|7.779927	0.98486|0.98486	.|.	.|.	ENSG00000156273|ENSG00000156273	ENST00000551628|ENST00000286800;ENST00000399921	.|.	.|.	.|.	5.64|5.64	4.57|4.57	0.56435|0.56435	.|.	.|0.185391	.|0.38217	.|N	.|0.001764	T|.	0.35098|.	0.0920|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.13150|.	-1.0520|.	4|.	.|0.06365	.|T	.|0.9	-15.5547|-15.5547	10.9688|10.9688	0.47428|0.47428	0.0:0.7883:0.1331:0.0786|0.0:0.7883:0.1331:0.0786	.|.	.|.	.|.	.|.	K|X	81|587	.|.	.|ENSP00000286800:S587X	Q|S	+|+	1|2	0|0	BACH1|BACH1	29623869|29623869	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	2.121000|2.121000	0.41977|0.41977	2.660000|2.660000	0.90430|0.90430	0.650000|0.650000	0.86243|0.86243	CAG|TCA	.	.		0.343	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
IFNAR2	3455	hgsc.bcm.edu	37	21	34635391	34635391	+	Silent	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr21:34635391C>T	ENST00000342136.4	+	9	1460	c.1134C>T	c.(1132-1134)ccC>ccT	p.P378P	IFNAR2_ENST00000404220.3_3'UTR|IFNAR2_ENST00000382241.3_Silent_p.P378P|IL10RB-AS1_ENST00000411998.1_RNA|IFNAR2_ENST00000342101.3_3'UTR|AP000295.9_ENST00000433395.2_Intron			P48551	INAR2_HUMAN	interferon (alpha, beta and omega) receptor 2	378					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|type I interferon binding (GO:0019962)|type I interferon receptor activity (GO:0004905)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	11					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	TGGAGCTCCCCACGATGCCAA	0.587																																					p.P378P		Atlas-SNP	.											.	IFNAR2	44	.	0			c.C1134T						.						63.0	67.0	65.0					21																	34635391		2203	4300	6503	SO:0001819	synonymous_variant	3455	exon9			GCTCCCCACGATG		CCDS13621.1, CCDS13622.1, CCDS74782.1	21q22.1	2010-08-17			ENSG00000159110	ENSG00000159110		"""Interferons"""	5433	protein-coding gene	gene with protein product		602376		IFNABR		8181059	Standard	NM_207585		Approved		uc002yrd.3	P48551	OTTHUMG00000065127	ENST00000342136.4:c.1134C>T	chr21.hg19:g.34635391C>T		138.0	0.0		66.0	42.0	NM_207585	A8KAJ4|D3DSE8|D3DSE9|Q15467|Q6FHD7	Silent	SNP	ENST00000342136.4	hg19	CCDS13621.1																																																																																			.	.		0.587	IFNAR2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139825.1		
SFI1	9814	hgsc.bcm.edu	37	22	32009644	32009644	+	Silent	SNP	A	A	G			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr22:32009644A>G	ENST00000400288.2	+	27	2904	c.2799A>G	c.(2797-2799)aaA>aaG	p.K933K	SFI1_ENST00000443326.1_Silent_p.K851K|SFI1_ENST00000540643.1_Silent_p.K878K|SFI1_ENST00000414585.1_Silent_p.K780K|SFI1_ENST00000443011.1_Silent_p.K780K|SFI1_ENST00000400289.1_Silent_p.K851K|SFI1_ENST00000432498.1_Silent_p.K902K	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	933					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGAAACAGAAAGTGCTGGGCC	0.642																																					p.K933K		Atlas-SNP	.											.	SFI1	78	.	0			c.A2799G						.						17.0	21.0	20.0					22																	32009644		2034	4175	6209	SO:0001819	synonymous_variant	9814	exon27			ACAGAAAGTGCTG	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2799A>G	chr22.hg19:g.32009644A>G		135.0	0.0		110.0	35.0	NM_001007467	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Silent	SNP	ENST00000400288.2	hg19	CCDS43004.1																																																																																			.	.		0.642	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
AFF2	2334	hgsc.bcm.edu	37	X	148037839	148037839	+	Missense_Mutation	SNP	C	C	T			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chrX:148037839C>T	ENST00000370460.2	+	11	2743	c.2264C>T	c.(2263-2265)aCc>aTc	p.T755I	AFF2_ENST00000286437.5_Missense_Mutation_p.T396I|AFF2_ENST00000370457.5_Missense_Mutation_p.T722I|AFF2_ENST00000342251.3_Missense_Mutation_p.T722I	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	755					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.T755N(2)|p.T396N(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GCCAGCCTGACCCTCAGCACC	0.453																																					p.T755I		Atlas-SNP	.											.	AFF2	679	.	3	Substitution - Missense(3)	lung(3)	c.C2264T						.						95.0	86.0	89.0					X																	148037839		2203	4300	6503	SO:0001583	missense	2334	exon11			GCCTGACCCTCAG	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2264C>T	chrX.hg19:g.148037839C>T	ENSP00000359489:p.Thr755Ile	128.0	0.0		162.0	69.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	hg19	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	5.362	0.252128	0.10185	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.93	3.0	0.34707	.	0.372648	0.27193	N	0.020496	T	0.45994	0.1370	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B;B	0.10296	0.003;0.002;0.002;0.002;0.002;0.003	B;B;B;B;B;B	0.13407	0.009;0.005;0.005;0.005;0.005;0.009	T	0.17776	-1.0358	10	0.40728	T	0.16	.	4.0132	0.09632	0.1239:0.4075:0.374:0.0947	.	396;720;722;716;745;755	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	I	755;722;722;396	ENSP00000359489:T755I;ENSP00000359486:T722I;ENSP00000345459:T722I;ENSP00000286437:T396I	ENSP00000286437:T396I	T	+	2	0	AFF2	147845539	1.000000	0.71417	0.016000	0.15963	0.042000	0.13812	2.973000	0.49264	2.498000	0.84270	0.600000	0.82982	ACC	.	.		0.453	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
MT-ND4L	4539	hgsc.bcm.edu	37	M	10725	10725	+	Missense_Mutation	SNP	G	G	A			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chrM:10725G>A	ENST00000361335.1	+	1	256	c.256G>A	c.(256-258)Ggc>Agc	p.G86S	MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TR_ENST00000387439.1_RNA			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	86					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						CCAACACATATGGCCTAGACT	0.443																																					p.G86S		Atlas-SNP	.											.	.	.	.	0			c.G256A						.																																			SO:0001583	missense	0	exon1			ACATATGGCCTAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.256G>A	chrM.hg19:g.10725G>A	ENSP00000354728:p.Gly86Ser	52.0	0.0		63.0	14.0	ENST00000361335		Missense_Mutation	SNP	ENST00000361335.1	hg19																																																																																				.	.		0.443	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024034	
RRM2	6241	hgsc.bcm.edu	37	2	10262771	10262797	+	5'Flank	DEL	AGCCAATGGGAAGGGCCGGGGCACCAA	AGCCAATGGGAAGGGCCGGGGCACCAA	-			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	AGCCAATGGGAAGGGCCGGGGCACCAA	AGCCAATGGGAAGGGCCGGGGCACCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr2:10262771_10262797delAGCCAATGGGAAGGGCCGGGGCACCAA	ENST00000304567.5	+	0	0				RP11-254F7.4_ENST00000607140.1_lincRNA|RRM2_ENST00000360566.2_In_Frame_Del_p.PMGRAGAPK10del	NM_001034.3	NP_001025.1	P31350	RIR2_HUMAN	ribonucleotide reductase M2						deoxyribonucleoside diphosphate metabolic process (GO:0009186)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|skin(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)|OV - Ovarian serous cystadenocarcinoma(76;0.221)	Cladribine(DB00242)|Gallium nitrate(DB05260)	GGCATGGCACAGCCAATGGGAAGGGCCGGGGCACCAAAGCCAATGGG	0.705																																					p.9_17del		Atlas-Indel,Pindel	.											.	RRM2	63	.	0			c.25_51del						.																																			SO:0001631	upstream_gene_variant	6241	exon1			.		CCDS1669.1, CCDS54334.1	2p25-p24	2012-10-02	2009-07-10		ENSG00000171848	ENSG00000171848	1.17.4.1		10452	protein-coding gene	gene with protein product		180390	"""ribonucleotide reductase M2 polypeptide"""				Standard	NM_001034		Approved		uc021vdr.1	P31350	OTTHUMG00000090449		chr2.hg19:g.10262771_10262797delAGCCAATGGGAAGGGCCGGGGCACCAA	Exception_encountered	265.0	0.0		192.0	45.0	NM_001165931	B2R9B5|J3KP43|Q5WRU7	In_Frame_Del	DEL	ENST00000304567.5	hg19	CCDS1669.1																																																																																			.	.		0.705	RRM2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364902.2		
HMCN1	83872	hgsc.bcm.edu	37	1	185986178	185986179	+	Frame_Shift_Ins	INS	-	-	C			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr1:185986178_185986179insC	ENST00000271588.4	+	33	5504_5505	c.5275_5276insC	c.(5275-5277)acafs	p.T1759fs	HMCN1_ENST00000367492.2_Frame_Shift_Ins_p.T1759fs	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1759	Ig-like C2-type 15.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTGTCATGTGACAGGCTCTCCC	0.396																																					p.T1759fs		Atlas-Indel,Pindel	.											.	HMCN1	797	.	0			c.5275_5276insC						.																																			SO:0001589	frameshift_variant	83872	exon33			.	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5276dupC	chr1.hg19:g.185986179_185986179dupC	ENSP00000271588:p.Thr1759fs	148.0	0.0		250.0	112.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Frame_Shift_Ins	INS	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.396	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
ATG5	9474	hgsc.bcm.edu	37	6	106764056	106764058	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr6:106764056_106764058delCTC	ENST00000369076.3	-	2	349_351	c.26_28delGAG	c.(25-30)cgagat>cat	p.9_10RD>H	ATG5_ENST00000369070.1_5'UTR|ATG5_ENST00000360666.4_In_Frame_Del_p.9_10RD>H|ATG5_ENST00000343245.3_In_Frame_Del_p.9_10RD>H	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	9					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		AACCACACATCTCGAAGCACATC	0.379																																					p.9_10del		Atlas-Indel,Pindel	.											.	ATG5	23	.	0			c.27_29del						.																																			SO:0001651	inframe_deletion	9474	exon2			.	Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.26_28delGAG	chr6.hg19:g.106764056_106764058delCTC	ENSP00000358072:p.Arg9_Asp10delinsHis	117.0	0.0		39.0	28.0	NM_004849	O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	In_Frame_Del	DEL	ENST00000369076.3	hg19	CCDS5055.1																																																																																			.	.		0.379	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043476.1	NM_004849	
NCOR1	9611	hgsc.bcm.edu	37	17	16029431	16029435	+	Frame_Shift_Del	DEL	TTTCT	TTTCT	-			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	TTTCT	TTTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:16029431_16029435delTTTCT	ENST00000268712.3	-	15	1852_1856	c.1595_1599delAGAAA	c.(1594-1599)aagaaafs	p.KK532fs	NCOR1_ENST00000395848.1_Frame_Shift_Del_p.KK423fs|NCOR1_ENST00000395851.1_Frame_Shift_Del_p.KK532fs	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	532					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		cctcttcatctttcttttcttcttc	0.268																																					p.532_534del		Atlas-Indel,Pindel	.											.	NCOR1	240	.	0			c.1596_1600del						.																																			SO:0001589	frameshift_variant	9611	exon14			.	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.1595_1599delAGAAA	chr17.hg19:g.16029436_16029440delTTTCT	ENSP00000268712:p.Lys532fs	314.0	0.0		292.0	21.0	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Frame_Shift_Del	DEL	ENST00000268712.3	hg19	CCDS11175.1																																																																																			.	.		0.268	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
MAP2K4	6416	hgsc.bcm.edu	37	17	12016647	12016648	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr17:12016647_12016648delAA	ENST00000353533.5	+	7	846_847	c.783_784delAA	c.(781-786)acaagafs	p.R262fs	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Frame_Shift_Del_p.R273fs	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TTGCCAAGACAAGAGATGCTGG	0.465			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.261_261del		Atlas-Indel,Pindel	.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	MAP2K4	176	.	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)	c.782_783del						.																																			SO:0001589	frameshift_variant	6416	exon7			.	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.783_784delAA	chr17.hg19:g.12016647_12016648delAA	ENSP00000262445:p.Arg262fs	93.0	0.0		66.0	23.0	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Frame_Shift_Del	DEL	ENST00000353533.5	hg19	CCDS11162.1																																																																																			.	.		0.465	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
MUC4	4585	hgsc.bcm.edu	37	3	195506454	195506549	+	In_Frame_Del	DEL	GGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGGGGGGTGGCGTGACCTGTGGATGCTGAGGAACGGCTGGTGACAGGAAGAGA	GGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGGGGGGTGGCGTGACCTGTGGATGCTGAGGAACGGCTGGTGACAGGAAGAGA	-	rs202207620|rs200996132|rs566561255|rs546685353|rs545209449|rs374482509|rs560897359|rs542643120|rs201186756|rs113130007|rs202026273|rs554582566|rs530867213|rs199752829|rs199960521|rs536593912|rs199874579|rs201272097|rs72499648|rs536201992|rs557168139|rs113936020|rs201375109|rs187734372|rs577270484|rs199834488|rs201922637|rs533946041|rs575589813|rs538446461|rs200746179|rs201820103|rs547195540|rs200412534|rs200504670|rs199910419|rs539240288|rs563397158|rs199498802|rs200681198|rs532552592|rs374319950	byFrequency	TCGA-5R-AA1C-01A-11D-A40R-10	TCGA-5R-AA1C-10A-01D-A40U-10	GGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGGGGGGTGGCGTGACCTGTGGATGCTGAGGAACGGCTGGTGACAGGAAGAGA	GGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGGGGGGTGGCGTGACCTGTGGATGCTGAGGAACGGCTGGTGACAGGAAGAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d37f1231-13b4-442e-8844-8e3980be1ef0	da5a5303-fdce-40d4-86d1-4cf45f39aa20	g.chr3:195506454_195506549delGGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGGGGGGTGGCGTGACCTGTGGATGCTGAGGAACGGCTGGTGACAGGAAGAGA	ENST00000463781.3	-	2	12361_12456	c.11902_11997delTCTCTTCCTGTCACCAGCCGTTCCTCAGCATCCACAGGTCACGCCACCCCCCTTCCTGTCACCGACACTTCCTCAGTATCCACAGGTCACGCCACC	c.(11902-11997)tctcttcctgtcaccagccgttcctcagcatccacaggtcacgccaccccccttcctgtcaccgacacttcctcagtatccacaggtcacgccaccdel	p.SLPVTSRSSASTGHATPLPVTDTSSVSTGHAT3968del	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_In_Frame_Del_p.SLPVTSRSSASTGHATPLPVTDTSSVSTGHAT3968del|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H3997Q(2)|p.P3984P(1)|p.T3990P(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGGGGGGTGGCGTGACCTGTGGATGCTGAGGAACGGCTGGTGACAGGAAGAGAGGTGGCGTGA	0.598																																					p.3968_4000del		Pindel	.											MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4	1505	.	4	Substitution - Missense(3)|Substitution - coding silent(1)	endometrium(2)|stomach(1)|kidney(1)	c.11903_11998del						.																																			SO:0001651	inframe_deletion	4585	exon2			.	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11902_11997delTCTCTTCCTGTCACCAGCCGTTCCTCAGCATCCACAGGTCACGCCACCCCCCTTCCTGTCACCGACACTTCCTCAGTATCCACAGGTCACGCCACC	chr3.hg19:g.195506454_195506549delGGTGGCGTGACCTGTGGATACTGAGGAAGTGTCGGTGACAGGAAGGGGGGTGGCGTGACCTGTGGATGCTGAGGAACGGCTGGTGACAGGAAGAGA	ENSP00000417498:p.Ser3968_Thr3999del	82.0	0.0		89.0	11.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	In_Frame_Del	DEL	ENST00000463781.3	hg19	CCDS54700.1																																																																																			.	.		0.598	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
