#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBE2J2	118424	hgsc.bcm.edu	37	1	1190842	1190842	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:1190842T>A	ENST00000349431.6	-	7	740	c.521A>T	c.(520-522)cAa>cTa	p.Q174L	UBE2J2_ENST00000491779.1_5'Flank|UBE2J2_ENST00000347370.2_Missense_Mutation_p.Q122L|UBE2J2_ENST00000339385.6_Missense_Mutation_p.Q139L|UBE2J2_ENST00000400930.4_Missense_Mutation_p.Q190L|UBE2J2_ENST00000360466.2_Missense_Mutation_p.Q174L|UBE2J2_ENST00000348298.7_Missense_Mutation_p.Q122L|UBE2J2_ENST00000400929.2_Missense_Mutation_p.Q122L	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	174					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		GAGTTCGTCTTGTGCTTTCTG	0.542																																					p.Q190L		Atlas-SNP	.											.	UBE2J2	25	.	0			c.A569T						.						108.0	122.0	117.0					1																	1190842		2203	4300	6503	SO:0001583	missense	118424	exon8			TCGTCTTGTGCTT	AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.521A>T	chr1.hg19:g.1190842T>A	ENSP00000305826:p.Gln174Leu	243.0	0.0		258.0	70.0	NM_194315	A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	ENST00000349431.6	hg19	CCDS14.1	.	.	.	.	.	.	.	.	.	.	T	15.24	2.775239	0.49786	.	.	ENSG00000160087	ENST00000347370;ENST00000349431;ENST00000339385;ENST00000348298;ENST00000400929;ENST00000360466;ENST00000400930;ENST00000435198	T;T;T;T;T;T;T;T	0.72725	0.91;-0.09;0.91;0.91;0.91;-0.09;-0.68;-0.08	5.87	4.75	0.60458	Ubiquitin-conjugating enzyme/RWD-like (1);	0.049900	0.85682	D	0.000000	T	0.59088	0.2168	L	0.40543	1.245	0.80722	D	1	B;B;B;B	0.29253	0.049;0.001;0.0;0.239	B;B;B;B	0.26517	0.014;0.002;0.001;0.07	T	0.53408	-0.8443	10	0.26408	T	0.33	-18.426	10.9167	0.47139	0.0:0.0731:0.0:0.9269	.	122;190;174;207	A6NGS0;A8MYC7;Q8N2K1;B1AME9	.;.;UB2J2_HUMAN;.	L	122;174;139;122;122;174;190;174	ENSP00000344857:Q122L;ENSP00000305826:Q174L;ENSP00000340197:Q139L;ENSP00000342541:Q122L;ENSP00000383718:Q122L;ENSP00000353653:Q174L;ENSP00000383719:Q190L;ENSP00000393301:Q174L	ENSP00000340197:Q139L	Q	-	2	0	UBE2J2	1180705	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	5.912000	0.69948	1.059000	0.40554	0.482000	0.46254	CAA	.	.		0.542	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005430.1	NM_058167	
COL16A1	1307	hgsc.bcm.edu	37	1	32151294	32151294	+	Silent	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:32151294T>G	ENST00000373672.3	-	29	2478	c.1962A>C	c.(1960-1962)ccA>ccC	p.P654P	COL16A1_ENST00000373668.3_Silent_p.P654P|COL16A1_ENST00000271069.6_Silent_p.P653P	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	654	Triple-helical region 6 (COL6) with 1 imperfection.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TCTCTCCGGATGGGCCAGGCA	0.637																																					p.P654P	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.A1962C						.						102.0	110.0	108.0					1																	32151294		1911	4125	6036	SO:0001819	synonymous_variant	1307	exon29			TCCGGATGGGCCA	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.1962A>C	chr1.hg19:g.32151294T>G		107.0	0.0		162.0	36.0	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	hg19	CCDS41297.1																																																																																			.	.		0.637	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
CLCA2	9635	hgsc.bcm.edu	37	1	86916353	86916353	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:86916353A>T	ENST00000370565.4	+	12	2254	c.2092A>T	c.(2092-2094)Agc>Tgc	p.S698C	CLCA2_ENST00000498802.1_3'UTR	NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	698					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TCCCAGCATAAGCACCCCAGC	0.398																																					p.S698C	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Atlas-SNP	.											.	CLCA2	102	.	0			c.A2092T						.						157.0	147.0	150.0					1																	86916353		2203	4300	6503	SO:0001583	missense	9635	exon12			AGCATAAGCACCC		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.2092A>T	chr1.hg19:g.86916353A>T	ENSP00000359596:p.Ser698Cys	165.0	0.0		129.0	14.0	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	hg19	CCDS708.1	.	.	.	.	.	.	.	.	.	.	A	8.310	0.821970	0.16678	.	.	ENSG00000137975	ENST00000370565	T	0.03242	4.0	5.36	4.23	0.50019	.	0.737030	0.13753	N	0.365105	T	0.02342	0.0072	M	0.71581	2.175	0.09310	N	1	B	0.33739	0.422	B	0.36186	0.219	T	0.42275	-0.9461	10	0.72032	D	0.01	-1.2264	6.6844	0.23136	0.75:0.1709:0.0791:0.0	.	698	Q9UQC9	CLCA2_HUMAN	C	698	ENSP00000359596:S698C	ENSP00000359596:S698C	S	+	1	0	CLCA2	86688941	0.001000	0.12720	0.091000	0.20842	0.016000	0.09150	1.240000	0.32731	0.879000	0.35944	0.528000	0.53228	AGC	.	.		0.398	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
VTCN1	79679	hgsc.bcm.edu	37	1	117699311	117699311	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:117699311A>G	ENST00000369458.3	-	3	408	c.330T>C	c.(328-330)gtT>gtC	p.V110V	VTCN1_ENST00000463461.1_5'UTR|VTCN1_ENST00000359008.4_Silent_p.V113V|VTCN1_ENST00000328189.3_Intron|VTCN1_ENST00000539893.1_Silent_p.V15V	NM_024626.3	NP_078902.2			V-set domain containing T cell activation inhibitor 1											large_intestine(7)|lung(4)|upper_aerodigestive_tract(1)	12	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		AGGCATTGCCAACTATCACTT	0.468																																					p.V110V		Atlas-SNP	.											.	VTCN1	26	.	0			c.T330C						.						105.0	99.0	101.0					1																	117699311		2203	4300	6503	SO:0001819	synonymous_variant	79679	exon3			ATTGCCAACTATC	BX648021	CCDS894.1, CCDS58019.1, CCDS58020.1	1p12	2013-01-29			ENSG00000134258	ENSG00000134258		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28873	protein-coding gene	gene with protein product	"""B7 family member, H4"", ""B7 superfamily member 1"""	608162				12818165, 12818166	Standard	NM_024626		Approved	B7-H4, FLJ22418, B7S1, B7X, B7H4	uc001ehb.3	Q7Z7D3	OTTHUMG00000012118	ENST00000369458.3:c.330T>C	chr1.hg19:g.117699311A>G		115.0	0.0		132.0	38.0	NM_024626		Silent	SNP	ENST00000369458.3	hg19	CCDS894.1																																																																																			.	.		0.468	VTCN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000033500.2	NM_024626	
PGLYRP3	114771	hgsc.bcm.edu	37	1	153279733	153279733	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:153279733G>A	ENST00000290722.1	-	2	118	c.66C>T	c.(64-66)acC>acT	p.T22T		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	22					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGGAGACGATGGTGGGAGTAT	0.622																																					p.T22T		Atlas-SNP	.											.	PGLYRP3	55	.	0			c.C66T						.						32.0	31.0	32.0					1																	153279733		2202	4300	6502	SO:0001819	synonymous_variant	114771	exon2			GACGATGGTGGGA	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.66C>T	chr1.hg19:g.153279733G>A		39.0	0.0		45.0	18.0	NM_052891	A1A4U8|Q5SY65	Silent	SNP	ENST00000290722.1	hg19	CCDS1035.1																																																																																			.	.		0.622	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039488.1	NM_052891	
NOS1AP	9722	hgsc.bcm.edu	37	1	162337003	162337003	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:162337003G>T	ENST00000361897.5	+	10	1669	c.1267G>T	c.(1267-1269)Gac>Tac	p.D423Y	NOS1AP_ENST00000454693.1_3'UTR|NOS1AP_ENST00000493151.1_Missense_Mutation_p.D128Y|NOS1AP_ENST00000530878.1_Missense_Mutation_p.D418Y|RP11-565P22.6_ENST00000431696.1_Intron	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	423					regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			AGGTAGGCGCGACTGCTTGGT	0.682																																					p.D423Y		Atlas-SNP	.											.	NOS1AP	139	.	0			c.G1267T						.						51.0	57.0	55.0					1																	162337003		2203	4300	6503	SO:0001583	missense	9722	exon10			AGGCGCGACTGCT	AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.1267G>T	chr1.hg19:g.162337003G>T	ENSP00000355133:p.Asp423Tyr	41.0	0.0		43.0	12.0	NM_014697	B7ZLF5|O43564|Q3T551|Q5VU95	Missense_Mutation	SNP	ENST00000361897.5	hg19	CCDS1237.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.136167	0.77662	.	.	ENSG00000198929	ENST00000530878;ENST00000361897;ENST00000464284;ENST00000493151	T;T	0.78246	-1.16;-1.16	4.96	4.96	0.65561	.	0.741680	0.14378	N	0.323360	T	0.69602	0.3129	N	0.14661	0.345	.	.	.	D;D;P	0.62365	0.986;0.991;0.947	P;P;P	0.55824	0.785;0.615;0.511	T	0.76332	-0.2998	9	0.66056	D	0.02	.	17.1256	0.86713	0.0:0.0:1.0:0.0	.	128;418;423	Q3T551;B7ZLF5;O75052	.;.;CAPON_HUMAN	Y	418;423;79;128	ENSP00000431586:D418Y;ENSP00000355133:D423Y	ENSP00000355133:D423Y	D	+	1	0	NOS1AP	160603627	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.219000	0.51200	2.419000	0.82065	0.655000	0.94253	GAC	.	.		0.682	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060555.2	NM_014697	
KIF21B	23046	hgsc.bcm.edu	37	1	200973575	200973575	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:200973575C>A	ENST00000422435.2	-	7	1225	c.909G>T	c.(907-909)ttG>ttT	p.L303F	KIF21B_ENST00000332129.2_Missense_Mutation_p.L303F|KIF21B_ENST00000360529.5_Missense_Mutation_p.L303F|KIF21B_ENST00000461742.2_Missense_Mutation_p.L303F	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	303	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TCACATTGCCCAAGGCCAGCT	0.602																																					p.L303F		Atlas-SNP	.											.	KIF21B	208	.	0			c.G909T						.						67.0	53.0	58.0					1																	200973575		2203	4298	6501	SO:0001583	missense	23046	exon7			ATTGCCCAAGGCC	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.909G>T	chr1.hg19:g.200973575C>A	ENSP00000411831:p.Leu303Phe	59.0	0.0		95.0	23.0	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	hg19	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	c	25.6	4.652874	0.88056	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	5.59	5.59	0.84812	Kinesin, motor domain (3);	0.000000	0.64402	D	0.000004	D	0.95258	0.8462	M	0.89601	3.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.997	D	0.95779	0.8815	10	0.87932	D	0	.	14.4547	0.67409	0.1472:0.8528:0.0:0.0	.	303;303;303;303	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	F	303	ENSP00000328494:L303F;ENSP00000353724:L303F;ENSP00000433808:L303F;ENSP00000411831:L303F	ENSP00000328494:L303F	L	-	3	2	KIF21B	199240198	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.129000	0.50500	2.632000	0.89209	0.580000	0.79431	TTG	.	.		0.602	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
ZC3H11A	9877	hgsc.bcm.edu	37	1	203816541	203816541	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:203816541A>C	ENST00000545588.1	+	12	5099	c.1272A>C	c.(1270-1272)aaA>aaC	p.K424N	ZC3H11A_ENST00000332127.4_Missense_Mutation_p.K424N|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.K424N|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.K424N|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.K424N	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	424					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGAGACAAAAAAGCAAAAAGG	0.423																																					p.K424N		Atlas-SNP	.											.	ZC3H11A	71	.	0			c.A1272C						.						64.0	68.0	67.0					1																	203816541		2203	4300	6503	SO:0001583	missense	9877	exon15			ACAAAAAAGCAAA		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.1272A>C	chr1.hg19:g.203816541A>C	ENSP00000438527:p.Lys424Asn	167.0	0.0		172.0	37.0	NM_014827	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	ENST00000545588.1	hg19	CCDS30978.1	.	.	.	.	.	.	.	.	.	.	A	13.74	2.326908	0.41197	.	.	ENSG00000058673	ENST00000453771;ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66	5.82	2.25	0.28309	.	0.272209	0.40728	N	0.001034	T	0.34890	0.0913	L	0.43701	1.375	0.33207	D	0.552924	B	0.17667	0.023	B	0.23419	0.046	T	0.30208	-0.9986	10	0.30078	T	0.28	-19.5068	5.597	0.17333	0.6504:0.135:0.2146:0.0	.	424	O75152	ZC11A_HUMAN	N	424;424;370;424;424;424;424	ENSP00000356183:K424N;ENSP00000356181:K424N;ENSP00000333253:K424N;ENSP00000438527:K424N;ENSP00000356179:K424N	ENSP00000333253:K424N	K	+	3	2	ZC3H11A	202083164	0.994000	0.37717	0.977000	0.42913	0.971000	0.66376	3.299000	0.51826	0.137000	0.18759	-0.262000	0.10625	AAA	.	.		0.423	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827	
USH2A	7399	hgsc.bcm.edu	37	1	215916665	215916665	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:215916665G>A	ENST00000307340.3	-	59	11788	c.11402C>T	c.(11401-11403)cCc>cTc	p.P3801L	USH2A_ENST00000366943.2_Missense_Mutation_p.P3801L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3801	Fibronectin type-III 23. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGAATTTCGGGGATGAGGAT	0.393										HNSCC(13;0.011)																											p.P3801L		Atlas-SNP	.											.	USH2A	1168	.	0			c.C11402T						.						91.0	86.0	88.0					1																	215916665		2203	4300	6503	SO:0001583	missense	7399	exon59			ATTTCGGGGATGA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11402C>T	chr1.hg19:g.215916665G>A	ENSP00000305941:p.Pro3801Leu	25.0	0.0		37.0	8.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893444	0.33442	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53857	0.6;0.6	4.94	4.94	0.65067	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.346744	0.21118	N	0.079863	T	0.47377	0.1442	L	0.50919	1.6	0.09310	N	1	P	0.34462	0.454	B	0.38156	0.266	T	0.37384	-0.9708	10	0.25106	T	0.35	.	10.6735	0.45772	0.0952:0.0:0.9048:0.0	.	3801	O75445	USH2A_HUMAN	L	3801	ENSP00000305941:P3801L;ENSP00000355910:P3801L	ENSP00000305941:P3801L	P	-	2	0	USH2A	213983288	0.025000	0.19082	0.025000	0.17156	0.608000	0.37181	1.812000	0.38952	2.706000	0.92434	0.655000	0.94253	CCC	.	.		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USH2A	7399	hgsc.bcm.edu	37	1	216062251	216062251	+	Silent	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:216062251T>A	ENST00000307340.3	-	41	8126	c.7740A>T	c.(7738-7740)ggA>ggT	p.G2580G	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Silent_p.G2580G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2580	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAGTGACATTTCCAGGAGTTC	0.418										HNSCC(13;0.011)																											p.G2580G		Atlas-SNP	.											.	USH2A	1168	.	0			c.A7740T						.						149.0	145.0	146.0					1																	216062251		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon41			GACATTTCCAGGA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7740A>T	chr1.hg19:g.216062251T>A		91.0	0.0		108.0	29.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	hg19	CCDS31025.1																																																																																			.	.		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
RYR2	6262	hgsc.bcm.edu	37	1	237923107	237923107	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:237923107A>C	ENST00000366574.2	+	83	11674	c.11357A>C	c.(11356-11358)gAt>gCt	p.D3786A	RYR2_ENST00000360064.6_Missense_Mutation_p.D3792A|RYR2_ENST00000542537.1_Missense_Mutation_p.D3770A|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3786					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAGAAAAAGGATGTGGGCTTC	0.413																																					p.D3786A		Atlas-SNP	.											.	RYR2	1273	.	0			c.A11357C						.						116.0	113.0	114.0					1																	237923107		1854	4090	5944	SO:0001583	missense	6262	exon83			AAAAGGATGTGGG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11357A>C	chr1.hg19:g.237923107A>C	ENSP00000355533:p.Asp3786Ala	144.0	0.0		166.0	43.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.020179	0.75275	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.89343	-2.5;-2.5;-2.5	5.81	5.81	0.92471	.	0.000000	0.64402	U	0.000006	D	0.90164	0.6926	M	0.79258	2.445	0.80722	D	1	B;B	0.30146	0.27;0.27	B;B	0.34138	0.176;0.092	D	0.89443	0.3725	10	0.66056	D	0.02	-21.7762	16.1616	0.81721	1.0:0.0:0.0:0.0	.	760;3786	B4DGV4;Q92736	.;RYR2_HUMAN	A	3786;3792;3770;760	ENSP00000355533:D3786A;ENSP00000353174:D3792A;ENSP00000443798:D3770A	ENSP00000353174:D3792A	D	+	2	0	RYR2	235989730	1.000000	0.71417	0.980000	0.43619	0.995000	0.86356	9.279000	0.95777	2.218000	0.71995	0.377000	0.23210	GAT	.	.		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
NLRP3	114548	hgsc.bcm.edu	37	1	247582364	247582364	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:247582364G>T	ENST00000336119.3	+	1	1014	c.268G>T	c.(268-270)Gat>Tat	p.D90Y	NLRP3_ENST00000366496.2_Missense_Mutation_p.D90Y|NLRP3_ENST00000348069.2_Missense_Mutation_p.D90Y|NLRP3_ENST00000366497.2_Missense_Mutation_p.D90Y|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Missense_Mutation_p.D90Y|NLRP3_ENST00000391828.3_Missense_Mutation_p.D90Y	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	90	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGCAAAAAGAGATGAGCCGAA	0.423																																					p.D90Y		Atlas-SNP	.											.	NLRP3	286	.	0			c.G268T						.						56.0	54.0	55.0					1																	247582364		2203	4300	6503	SO:0001583	missense	114548	exon1			AAAAGAGATGAGC	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.268G>T	chr1.hg19:g.247582364G>T	ENSP00000337383:p.Asp90Tyr	16.0	0.0		19.0	10.0	NM_183395	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	hg19	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209887	0.39003	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32;0.32	4.49	4.49	0.54785	Pyrin (1);DEATH-like (2);	0.631279	0.15000	N	0.286179	T	0.62684	0.2448	L	0.36672	1.1	0.09310	N	0.999999	P;D;D;P;P	0.65815	0.953;0.972;0.995;0.95;0.916	P;P;P;P;B	0.58520	0.507;0.702;0.84;0.492;0.406	T	0.55623	-0.8112	10	0.87932	D	0	.	12.8787	0.58003	0.0:0.0:1.0:0.0	.	90;90;90;90;90	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	Y	90	ENSP00000375704:D90Y;ENSP00000355453:D90Y;ENSP00000337383:D90Y;ENSP00000294752:D90Y;ENSP00000355452:D90Y;ENSP00000375703:D90Y	ENSP00000337383:D90Y	D	+	1	0	NLRP3	245648987	0.363000	0.24989	0.082000	0.20525	0.423000	0.31445	1.668000	0.37481	2.498000	0.84270	0.561000	0.74099	GAT	.	.		0.423	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
GTF3C2	2976	hgsc.bcm.edu	37	2	27552031	27552031	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:27552031G>C	ENST00000359541.2	-	14	2425	c.1996C>G	c.(1996-1998)Ccc>Gcc	p.P666A	GTF3C2_ENST00000264720.3_Missense_Mutation_p.P666A			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	666					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATTGTAGGGAAGCAGCCAG	0.517																																					p.C666G		Atlas-SNP	.											.	GTF3C2	73	.	0			c.T1996G						.						178.0	181.0	180.0					2																	27552031		2203	4300	6503	SO:0001583	missense	2976	exon15			TGTAGGGAAGCAG	D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.1996C>G	chr2.hg19:g.27552031G>C	ENSP00000352536:p.Pro666Ala	65.0	0.0		97.0	25.0	NM_001521	D6W557|Q16632|Q9BWI7	Missense_Mutation	SNP	ENST00000359541.2	hg19	CCDS1749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.68|10.68	1.417812|1.417812	0.25552|0.25552	.|.	.|.	ENSG00000115207|ENSG00000115207	ENST00000454704;ENST00000415683|ENST00000359541;ENST00000264720	.|T;T	.|0.71934	.|-0.61;-0.61	6.03|6.03	6.03|6.03	0.97812|0.97812	.|WD40 repeat-like-containing domain (1);	.|0.277859	.|0.37393	.|N	.|0.002111	T|T	0.55768|0.55768	0.1941|0.1941	N|N	0.24115|0.24115	0.695|0.695	0.40827|0.40827	D|D	0.983556|0.983556	.|P	.|0.38020	.|0.615	.|B	.|0.33196	.|0.159	T|T	0.55438|0.55438	-0.8141|-0.8141	5|10	.|0.13853	.|T	.|0.58	-15.2787|-15.2787	18.0604|18.0604	0.89375|0.89375	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|666	.|Q8WUA4	.|TF3C2_HUMAN	L|A	174;67|666	.|ENSP00000352536:P666A;ENSP00000264720:P666A	.|ENSP00000264720:P666A	F|P	-|-	3|1	2|0	GTF3C2|GTF3C2	27405535|27405535	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	3.796000|3.796000	0.55507|0.55507	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	TTC|CCC	.	.		0.517	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215028.2		
EIF2B4	8890	hgsc.bcm.edu	37	2	27590024	27590024	+	Silent	SNP	C	C	T	rs373520608		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:27590024C>T	ENST00000347454.4	-	10	1101	c.930G>A	c.(928-930)gaG>gaA	p.E310E	EIF2B4_ENST00000451130.2_Silent_p.E330E|EIF2B4_ENST00000445933.2_Silent_p.E309E|AC074117.10_ENST00000412749.1_RNA|EIF2B4_ENST00000493344.2_Silent_p.E331E	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	310					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCACAATCTTCTCTTGCACAT	0.438																																					p.E330E		Atlas-SNP	.											.	EIF2B4	48	.	0			c.G990A						.	C	,,	0,4406		0,0,2203	209.0	177.0	188.0		930,927,990	5.1	1.0	2		188	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	EIF2B4	NM_001034116.1,NM_015636.3,NM_172195.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	310/524,309/523,330/544	27590024	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8890	exon9			AATCTTCTCTTGC	AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.930G>A	chr2.hg19:g.27590024C>T		79.0	0.0		81.0	22.0	NM_172195	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Silent	SNP	ENST00000347454.4	hg19	CCDS33164.1																																																																																			.	.		0.438	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324448.1		
FAM98A	25940	hgsc.bcm.edu	37	2	33810097	33810097	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:33810097T>C	ENST00000238823.8	-	8	1443	c.1303A>G	c.(1303-1305)Agt>Ggt	p.S435G	FAM98A_ENST00000403368.1_3'UTR|FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000441530.2_Missense_Mutation_p.S240G			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	436	Gly-rich.						poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TGGTATCCACTTCCTGTATAT	0.557																																					p.S435G		Atlas-SNP	.											.	FAM98A	42	.	0			c.A1303G						.						152.0	138.0	143.0					2																	33810097		2203	4300	6503	SO:0001583	missense	25940	exon8			ATCCACTTCCTGT		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.1303A>G	chr2.hg19:g.33810097T>C	ENSP00000238823:p.Ser435Gly	109.0	0.0		116.0	32.0	NM_015475	B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	ENST00000238823.8	hg19	CCDS33179.1	.	.	.	.	.	.	.	.	.	.	T	9.404	1.078689	0.20227	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000441530	T;T	0.51071	0.84;0.72	5.64	5.64	0.86602	.	0.103522	0.64402	D	0.000002	T	0.25082	0.0609	N	0.08118	0	0.46317	D	0.998989	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.14117	-1.0484	10	0.08837	T	0.75	-12.9086	11.7336	0.51752	0.0:0.0705:0.0:0.9295	.	436;266;435;273	Q8NCA5;B4DY25;Q8NCA5-2;B3KTW4	FA98A_HUMAN;.;.;.	G	435;436;240	ENSP00000238823:S435G;ENSP00000408716:S240G	ENSP00000238823:S435G	S	-	1	0	FAM98A	33663601	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.501000	0.45389	2.147000	0.66899	0.533000	0.62120	AGT	.	.		0.557	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
LY75	4065	hgsc.bcm.edu	37	2	160665051	160665051	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:160665051A>T	ENST00000263636.4	-	33	4758	c.4731T>A	c.(4729-4731)gaT>gaA	p.D1577E	LY75-CD302_ENST00000505052.1_Missense_Mutation_p.D1577E|LY75_ENST00000553424.1_Missense_Mutation_p.D1577E|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.D1577E|LY75_ENST00000554112.1_Missense_Mutation_p.D1577E	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1577	C-type lectin 10. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TCTCATCTTCATCTTTTATGG	0.343																																					p.D1577E		Atlas-SNP	.											.	LY75	151	.	0			c.T4731A						.						170.0	167.0	168.0					2																	160665051		2202	4299	6501	SO:0001583	missense	4065	exon33			ATCTTCATCTTTT	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4731T>A	chr2.hg19:g.160665051A>T	ENSP00000263636:p.Asp1577Glu	163.0	0.0		140.0	40.0	NM_002349	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	ENST00000263636.4	hg19	CCDS2211.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.495988	0.64186	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0	5.55	4.35	0.52113	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.462627	0.16025	U	0.233157	T	0.25865	0.0630	M	0.87971	2.92	0.42835	D	0.994038	P;P;B	0.44946	0.846;0.84;0.433	P;P;B	0.48334	0.557;0.574;0.164	T	0.05971	-1.0853	10	0.56958	D	0.05	-13.1038	11.6348	0.51198	0.8671:0.0:0.0:0.1329	.	1577;1577;1577	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	E	1577	ENSP00000451511:D1577E;ENSP00000451446:D1577E;ENSP00000263636:D1577E;ENSP00000423463:D1577E;ENSP00000421035:D1577E	ENSP00000423463:D1577E	D	-	3	2	LY75;LY75-CD302	160373297	1.000000	0.71417	0.996000	0.52242	0.882000	0.50991	2.724000	0.47285	2.105000	0.64084	0.402000	0.26972	GAT	.	.		0.343	LY75-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255035.1		
DFNB59	494513	hgsc.bcm.edu	37	2	179325171	179325171	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:179325171G>C	ENST00000409117.3	+	6	1120	c.764G>C	c.(763-765)aGa>aCa	p.R255T	DFNB59_ENST00000375129.4_Missense_Mutation_p.R255T	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	255					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CTATTTGAAAGAAGTATGTTT	0.353																																					p.R255T		Atlas-SNP	.											.	DFNB59	37	.	0			c.G764C						.						85.0	81.0	82.0					2																	179325171		1833	4085	5918	SO:0001583	missense	494513	exon6			TTGAAAGAAGTAT	BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.764G>C	chr2.hg19:g.179325171G>C	ENSP00000386647:p.Arg255Thr	126.0	0.0		105.0	20.0	NM_001042702	A0PK14|B9EJE2	Missense_Mutation	SNP	ENST00000409117.3	hg19	CCDS42787.1	.	.	.	.	.	.	.	.	.	.	G	15.34	2.803735	0.50315	.	.	ENSG00000204311	ENST00000409117;ENST00000375129	T;T	0.58506	0.33;0.33	5.4	5.4	0.78164	.	0.000000	0.49305	U	0.000141	T	0.44329	0.1288	N	0.22421	0.69	0.49299	D	0.999774	B	0.25441	0.126	B	0.26094	0.066	T	0.32134	-0.9918	10	0.14252	T	0.57	-21.5255	16.9645	0.86282	0.0:0.0:1.0:0.0	.	255	Q0ZLH3	PJVK_HUMAN	T	255	ENSP00000386647:R255T;ENSP00000364271:R255T	ENSP00000364271:R255T	R	+	2	0	DFNB59	179033417	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	4.095000	0.57728	2.538000	0.85594	0.462000	0.41574	AGA	.	.		0.353	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335160.1		
OSGEPL1	64172	hgsc.bcm.edu	37	2	190617632	190617632	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:190617632C>T	ENST00000264151.5	-	6	1139	c.1037G>A	c.(1036-1038)tGc>tAc	p.C346Y	Y_RNA_ENST00000411317.1_RNA|OSGEPL1_ENST00000522700.1_Missense_Mutation_p.C346Y|OSGEPL1_ENST00000519810.1_Missense_Mutation_p.C346Y	NM_022353.2	NP_071748.2			O-sialoglycoprotein endopeptidase-like 1											large_intestine(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			CAACAAAGTGCACTGTGTTGC	0.403																																					p.C346Y		Atlas-SNP	.											.	OSGEPL1	19	.	0			c.G1037A						.						83.0	80.0	81.0					2																	190617632		1895	4127	6022	SO:0001583	missense	64172	exon6			AAAGTGCACTGTG	AJ295148	CCDS46472.1	2q32	2011-08-12			ENSG00000128694	ENSG00000128694			23075	protein-coding gene	gene with protein product						19578062	Standard	NM_022353		Approved	Qri7	uc002uqz.1	Q9H4B0	OTTHUMG00000164096	ENST00000264151.5:c.1037G>A	chr2.hg19:g.190617632C>T	ENSP00000264151:p.Cys346Tyr	312.0	0.0		271.0	60.0	NM_022353		Missense_Mutation	SNP	ENST00000264151.5	hg19	CCDS46472.1	.	.	.	.	.	.	.	.	.	.	C	2.943	-0.218548	0.06101	.	.	ENSG00000128694	ENST00000264151;ENST00000519810;ENST00000522700	T;T;T	0.41400	1.0;1.0;1.0	5.27	5.27	0.74061	Peptidase M22, glycoprotease (1);	0.179938	0.52532	D	0.000076	T	0.19565	0.0470	N	0.12637	0.245	0.29823	N	0.830666	B	0.18461	0.028	B	0.14578	0.011	T	0.21690	-1.0238	10	0.02654	T	1	-4.9742	8.7283	0.34483	0.2661:0.6021:0.1318:0.0	.	346	Q9H4B0	OSGP2_HUMAN	Y	346	ENSP00000264151:C346Y;ENSP00000428859:C346Y;ENSP00000429697:C346Y	ENSP00000264151:C346Y	C	-	2	0	OSGEPL1	190325877	1.000000	0.71417	0.994000	0.49952	0.917000	0.54804	5.380000	0.66202	2.737000	0.93849	0.563000	0.77884	TGC	.	.		0.403	OSGEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377257.1	NM_022353	
PMS1	5378	hgsc.bcm.edu	37	2	190718971	190718971	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:190718971G>A	ENST00000441310.2	+	9	1206	c.973G>A	c.(973-975)Gtt>Att	p.V325I	PMS1_ENST00000432292.3_Missense_Mutation_p.V149I|PMS1_ENST00000418224.3_Missense_Mutation_p.V149I|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000447232.2_Missense_Mutation_p.V325I|PMS1_ENST00000409823.3_Missense_Mutation_p.V286I	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	325					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TTAGGAATCTGTTTTAATTGC	0.249			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																													p.V325I		Atlas-SNP	.	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	.	PMS1	78	.	0			c.G973A						.						26.0	27.0	27.0					2																	190718971		1982	4190	6172	SO:0001583	missense	5378	exon9			GAATCTGTTTTAA		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.973G>A	chr2.hg19:g.190718971G>A	ENSP00000406490:p.Val325Ile	159.0	0.0		133.0	28.0	NM_001128144	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	ENST00000441310.2	hg19	CCDS2302.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924570	0.34002	.	.	ENSG00000064933	ENST00000392338;ENST00000441310;ENST00000418224;ENST00000409823;ENST00000447232;ENST00000432292;ENST00000424307;ENST00000409593	D;D;T;D;D;D;D	0.84944	-1.92;-1.92;-1.42;-1.92;-1.92;-1.92;-1.92	5.29	2.3	0.28687	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);DNA mismatch repair protein, C-terminal (1);	0.163445	0.53938	N	0.000050	T	0.79353	0.4431	L	0.46614	1.455	0.47778	D	0.999516	B;B;B;B;B;B;B	0.28378	0.06;0.058;0.058;0.209;0.033;0.06;0.06	B;B;B;B;B;B;B	0.34385	0.116;0.181;0.181;0.181;0.181;0.116;0.116	T	0.72459	-0.4287	10	0.37606	T	0.19	-13.062	7.6931	0.28579	0.1397:0.253:0.6073:0.0	.	325;286;286;110;286;325;325	Q4VAL4;B4DMF4;Q5FBZ9;Q5FBZ6;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;.;.;PMS1_HUMAN	I	149;325;149;286;325;149;264;110	ENSP00000406490:V325I;ENSP00000404492:V149I;ENSP00000387125:V286I;ENSP00000401064:V325I;ENSP00000398378:V149I;ENSP00000389938:V264I;ENSP00000387169:V110I	ENSP00000376149:V149I	V	+	1	0	PMS1	190427216	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.746000	0.38288	0.762000	0.33152	0.557000	0.71058	GTT	.	.		0.249	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2		
ASIC4	55515	hgsc.bcm.edu	37	2	220379823	220379823	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr2:220379823C>A	ENST00000347842.3	+	1	772	c.758C>A	c.(757-759)tCg>tAg	p.S253*	ASIC4_ENST00000358078.4_Nonsense_Mutation_p.S253*|AC053503.11_ENST00000429882.1_RNA	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	253					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										TTCCGGCATTCGGCACTCAGC	0.672																																					p.S253X		Atlas-SNP	.											.	.	.	.	0			c.C758A						.						42.0	38.0	39.0					2																	220379823		2203	4300	6503	SO:0001587	stop_gained	55515	exon1			GGCATTCGGCACT	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.758C>A	chr2.hg19:g.220379823C>A	ENSP00000326627:p.Ser253*	54.0	0.0		77.0	21.0	NM_182847	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Nonsense_Mutation	SNP	ENST00000347842.3	hg19	CCDS2442.1	.	.	.	.	.	.	.	.	.	.	C	37	6.271920	0.97431	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	.	.	.	4.69	4.69	0.59074	.	0.376783	0.23750	N	0.044926	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.7538	17.4292	0.87534	0.0:1.0:0.0:0.0	.	.	.	.	X	253	.	ENSP00000326627:S253X	S	+	2	0	ACCN4	220088067	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.797000	0.69087	2.431000	0.82371	0.655000	0.94253	TCG	.	.		0.672	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
RBMS3	27303	hgsc.bcm.edu	37	3	29781252	29781252	+	Silent	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:29781252C>G	ENST00000383767.2	+	5	777	c.441C>G	c.(439-441)ctC>ctG	p.L147L	RBMS3_ENST00000273139.9_Silent_p.L147L|RBMS3_ENST00000434693.2_Silent_p.L146L|RBMS3_ENST00000456853.1_Silent_p.L147L|RBMS3_ENST00000396583.3_Silent_p.L147L|RBMS3_ENST00000445033.1_Silent_p.L147L|RBMS3_ENST00000452462.1_Silent_p.L147L|RBMS3_ENST00000383766.2_Silent_p.L146L			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	147	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				TCTCAAATCTCCCCATTTCTA	0.398																																					p.L147L		Atlas-SNP	.											.	RBMS3	62	.	0			c.C441G						.						172.0	166.0	168.0					3																	29781252		2203	4300	6503	SO:0001819	synonymous_variant	27303	exon5			AAATCTCCCCATT	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.441C>G	chr3.hg19:g.29781252C>G		124.0	0.0		98.0	19.0	NM_001003793	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Silent	SNP	ENST00000383767.2	hg19	CCDS33724.1																																																																																			.	.		0.398	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	
VIPR1	7433	hgsc.bcm.edu	37	3	42577594	42577594	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:42577594C>T	ENST00000325123.4	+	13	1308	c.1195C>T	c.(1195-1197)Ctg>Ttg	p.L399L	VIPR1_ENST00000543411.1_Silent_p.L351L|VIPR1-AS1_ENST00000610022.1_RNA|VIPR1-AS1_ENST00000608869.1_RNA|VIPR1-AS1_ENST00000452639.3_RNA|VIPR1_ENST00000438259.2_Silent_p.L189L|VIPR1_ENST00000433647.1_Silent_p.L358L	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	399					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		GCAGGCGGAGCTGAGGCGGAA	0.662																																					p.L399L		Atlas-SNP	.											.	VIPR1	45	.	0			c.C1195T						.						11.0	14.0	13.0					3																	42577594		2187	4277	6464	SO:0001819	synonymous_variant	7433	exon13			GCGGAGCTGAGGC	AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.1195C>T	chr3.hg19:g.42577594C>T		55.0	0.0		56.0	12.0	NM_004624	A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	Silent	SNP	ENST00000325123.4	hg19	CCDS2698.1																																																																																			.	.		0.662	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254728.4	NM_004624	
SACM1L	22908	hgsc.bcm.edu	37	3	45748365	45748365	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:45748365A>G	ENST00000389061.5	+	4	503	c.299A>G	c.(298-300)tAt>tGt	p.Y100C	SACM1L_ENST00000541314.1_Intron|SACM1L_ENST00000418611.1_5'UTR|SACM1L_ENST00000464524.1_3'UTR	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	100					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		GTCCTTTCTTATAAGAAGACA	0.373																																					p.Y100C		Atlas-SNP	.											.	SACM1L	38	.	0			c.A299G						.						90.0	88.0	89.0					3																	45748365		2203	4300	6503	SO:0001583	missense	22908	exon4			TTTCTTATAAGAA	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.299A>G	chr3.hg19:g.45748365A>G	ENSP00000373713:p.Tyr100Cys	240.0	0.0		188.0	52.0	NM_014016	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	hg19	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.424864	0.83667	.	.	ENSG00000211456	ENST00000389061	T	0.56776	0.44	5.52	5.52	0.82312	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	L	0.33485	1.01	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.55872	-0.8072	10	0.21540	T	0.41	-17.1008	15.6379	0.76970	1.0:0.0:0.0:0.0	.	100	Q9NTJ5	SAC1_HUMAN	C	100	ENSP00000373713:Y100C	ENSP00000373713:Y100C	Y	+	2	0	SACM1L	45723369	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.847000	0.92166	2.094000	0.63399	0.482000	0.46254	TAT	.	.		0.373	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	
EPHB1	2047	hgsc.bcm.edu	37	3	134920367	134920367	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:134920367A>T	ENST00000398015.3	+	12	2552	c.2182A>T	c.(2182-2184)Atc>Ttc	p.I728F	EPHB1_ENST00000493838.1_Missense_Mutation_p.I289F	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	728	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						GCTCAGGGGCATCGCTGCTGG	0.512																																					p.I728F		Atlas-SNP	.											.	EPHB1	519	.	0			c.A2182T						.						237.0	236.0	236.0					3																	134920367		2203	4300	6503	SO:0001583	missense	2047	exon12			AGGGGCATCGCTG	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2182A>T	chr3.hg19:g.134920367A>T	ENSP00000381097:p.Ile728Phe	133.0	0.0		153.0	32.0	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	hg19	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	A	31	5.063828	0.93898	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.69435	-0.4;-0.4	5.52	5.52	0.82312	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.150822	0.52532	D	0.000078	D	0.87505	0.6194	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91447	0.5178	10	0.87932	D	0	.	15.6001	0.76616	1.0:0.0:0.0:0.0	.	728	P54762	EPHB1_HUMAN	F	728;289	ENSP00000381097:I728F;ENSP00000419574:I289F	ENSP00000381097:I728F	I	+	1	0	EPHB1	136403057	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	9.263000	0.95617	2.224000	0.72417	0.460000	0.39030	ATC	.	.		0.512	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
AADAC	13	hgsc.bcm.edu	37	3	151545693	151545693	+	Nonsense_Mutation	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:151545693T>G	ENST00000232892.7	+	5	1059	c.933T>G	c.(931-933)taT>taG	p.Y311*	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	311					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CTAAAAAATATCCAGGGTTCC	0.418																																					p.Y311X	Ovarian(30;839 841 2699 32801 46334)	Atlas-SNP	.											.	AADAC	49	.	0			c.T933G						.						46.0	46.0	46.0					3																	151545693		2203	4300	6503	SO:0001587	stop_gained	13	exon5			AAAATATCCAGGG	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.933T>G	chr3.hg19:g.151545693T>G	ENSP00000232892:p.Tyr311*	65.0	0.0		55.0	17.0	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Nonsense_Mutation	SNP	ENST00000232892.7	hg19	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577070	0.86645	.	.	ENSG00000114771	ENST00000232892	.	.	.	4.81	-4.0	0.04057	.	0.581521	0.18265	N	0.146491	.	.	.	.	.	.	0.54753	D	0.999985	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.2852	14.216	0.65792	0.0:0.6926:0.0:0.3074	.	.	.	.	X	311	.	ENSP00000232892:Y311X	Y	+	3	2	AADAC	153028383	0.709000	0.27886	0.084000	0.20598	0.990000	0.78478	-0.243000	0.08915	-0.723000	0.04915	0.482000	0.46254	TAT	.	.		0.418	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
DGKG	1608	hgsc.bcm.edu	37	3	185993350	185993350	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr3:185993350C>T	ENST00000265022.3	-	10	1435	c.896G>A	c.(895-897)gGc>gAc	p.G299D	DGKG_ENST00000382164.4_Missense_Mutation_p.G299D|DGKG_ENST00000344484.4_Missense_Mutation_p.G299D|DGKG_ENST00000544847.1_Missense_Mutation_p.G299D	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	299					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	GCAGCACAGGCCTTGCTTGCG	0.522																																					p.G299D		Atlas-SNP	.											.	DGKG	98	.	0			c.G896A						.						124.0	106.0	112.0					3																	185993350		2203	4300	6503	SO:0001583	missense	1608	exon10			CACAGGCCTTGCT	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.896G>A	chr3.hg19:g.185993350C>T	ENSP00000265022:p.Gly299Asp	46.0	0.0		54.0	17.0	NM_001346	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	ENST00000265022.3	hg19	CCDS3274.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581617	0.86748	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691;ENST00000437018	D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49	5.55	4.63	0.57726	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.058330	0.64402	D	0.000002	D	0.98541	0.9513	H	0.99130	4.44	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	D	0.98959	1.0797	10	0.87932	D	0	.	16.0206	0.80486	0.0:0.8655:0.1345:0.0	.	299;299;299;299	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	D	299;299;299;299;302;50	ENSP00000265022:G299D;ENSP00000339777:G299D;ENSP00000371599:G299D;ENSP00000440507:G299D;ENSP00000395526:G50D	ENSP00000265022:G299D	G	-	2	0	DGKG	187476044	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.699000	0.68310	2.761000	0.94854	0.655000	0.94253	GGC	.	.		0.522	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344800.3		
KDR	3791	hgsc.bcm.edu	37	4	55955862	55955862	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:55955862G>A	ENST00000263923.4	-	24	3595	c.3300C>T	c.(3298-3300)tcC>tcT	p.S1100S	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACTTACCTAAGGAAAATATTT	0.408			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.S1100S		Atlas-SNP	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	307	.	0			c.C3300T						.						123.0	133.0	130.0					4																	55955862		2203	4300	6503	SO:0001819	synonymous_variant	3791	exon24			ACCTAAGGAAAAT	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3300C>T	chr4.hg19:g.55955862G>A		139.0	0.0		120.0	28.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	ENST00000263923.4	hg19	CCDS3497.1																																																																																			.	.		0.408	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
EXOC1	55763	hgsc.bcm.edu	37	4	56759928	56759928	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:56759928G>A	ENST00000381295.2	+	15	2283	c.1935G>A	c.(1933-1935)agG>agA	p.R645R	EXOC1_ENST00000349598.6_Silent_p.R630R|EXOC1_ENST00000346134.7_Silent_p.R645R	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	645					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					CTGTCAAAAGGAACTTTGACA	0.333																																					p.R645R		Atlas-SNP	.											.	EXOC1	103	.	0			c.G1935A						.						68.0	64.0	65.0					4																	56759928		2203	4300	6503	SO:0001819	synonymous_variant	55763	exon15			CAAAAGGAACTTT	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1935G>A	chr4.hg19:g.56759928G>A		78.0	0.0		76.0	23.0	NM_018261	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Silent	SNP	ENST00000381295.2	hg19	CCDS3502.1																																																																																			.	.		0.333	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
AASDH	132949	hgsc.bcm.edu	37	4	57204730	57204730	+	Silent	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:57204730C>A	ENST00000205214.6	-	15	3315	c.3135G>T	c.(3133-3135)ggG>ggT	p.G1045G	AASDH_ENST00000434343.2_Silent_p.G560G|AASDH_ENST00000513376.1_Silent_p.G945G|AASDH_ENST00000451613.1_3'UTR	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	1045					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TCCACACTTTCCCATCAGTAG	0.433																																					p.G1045G		Atlas-SNP	.											.	AASDH	101	.	0			c.G3135T						.						83.0	78.0	80.0					4																	57204730		2203	4300	6503	SO:0001819	synonymous_variant	132949	exon15			CACTTTCCCATCA	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.3135G>T	chr4.hg19:g.57204730C>A		201.0	0.0		222.0	54.0	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Silent	SNP	ENST00000205214.6	hg19	CCDS3504.1																																																																																			.	.		0.433	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
TMPRSS11F	389208	hgsc.bcm.edu	37	4	68934361	68934361	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:68934361G>T	ENST00000356291.2	-	7	789	c.730C>A	c.(730-732)Ctc>Atc	p.L244I	UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000511571.1_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	244	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						GCTGCTGTGAGCAGCCATGTG	0.527																																					p.L244I		Atlas-SNP	.											TMPRSS11F,NS,carcinoma,0,1	TMPRSS11F	79	.	0			c.C730A						.						81.0	71.0	75.0					4																	68934361		2203	4300	6503	SO:0001583	missense	389208	exon7			CTGTGAGCAGCCA	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.730C>A	chr4.hg19:g.68934361G>T	ENSP00000348639:p.Leu244Ile	92.0	0.0		148.0	44.0	NM_207407	A8MXX2	Missense_Mutation	SNP	ENST00000356291.2	hg19	CCDS3520.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.366887	0.41902	.	.	ENSG00000198092	ENST00000356291	D	0.97553	-4.43	5.73	3.91	0.45181	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.133529	0.33631	N	0.004709	D	0.93966	0.8068	L	0.45422	1.42	0.33054	D	0.533191	P	0.38617	0.64	B	0.36567	0.228	D	0.94886	0.8043	10	0.38643	T	0.18	.	11.8022	0.52133	0.0:0.4296:0.5704:0.0	.	244	Q6ZWK6	TM11F_HUMAN	I	244	ENSP00000348639:L244I	ENSP00000348639:L244I	L	-	1	0	TMPRSS11F	68616956	0.998000	0.40836	1.000000	0.80357	0.619000	0.37552	0.779000	0.26746	1.370000	0.46153	0.655000	0.94253	CTC	.	.		0.527	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
RASSF6	166824	hgsc.bcm.edu	37	4	74451010	74451010	+	Silent	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:74451010T>G	ENST00000342081.3	-	6	680	c.550A>C	c.(550-552)Aga>Cga	p.R184R	RASSF6_ENST00000395777.2_Silent_p.R152R|RASSF6_ENST00000307439.5_Silent_p.R152R|RASSF6_ENST00000335049.5_Silent_p.R140R	NM_201431.2	NP_958834.1	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family member 6	184					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)					breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|pancreas(2)|skin(2)	17	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			CTCATGGTTCTATAGAGCACT	0.413																																					p.R184R		Atlas-SNP	.											.	RASSF6	68	.	0			c.A550C						.						153.0	146.0	148.0					4																	74451010		2203	4300	6503	SO:0001819	synonymous_variant	166824	exon6			TGGTTCTATAGAG	AY217664	CCDS3558.1, CCDS3559.1, CCDS58904.1, CCDS58905.1	4q21.1	2008-02-22	2008-02-22		ENSG00000169435	ENSG00000169435			20796	protein-coding gene	gene with protein product		612620					Standard	NM_177532		Approved		uc003hhd.2	Q6ZTQ3	OTTHUMG00000130007	ENST00000342081.3:c.550A>C	chr4.hg19:g.74451010T>G		259.0	0.0		249.0	77.0	NM_201431	Q68DT2|Q6PDA6|Q86WG9|Q86WH0	Silent	SNP	ENST00000342081.3	hg19	CCDS3558.1																																																																																			.	.		0.413	RASSF6-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252279.1	NM_177532	
SLC39A8	64116	hgsc.bcm.edu	37	4	103228652	103228652	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:103228652A>C	ENST00000394833.2	-	3	969	c.493T>G	c.(493-495)Ttt>Gtt	p.F165V	SLC39A8_ENST00000424970.2_Missense_Mutation_p.F165V|SLC39A8_ENST00000510255.1_5'UTR|SLC39A8_ENST00000356736.4_Missense_Mutation_p.F165V	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	165					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		AGCCCCACAAAAAAGGTCAAA	0.368																																					p.F165V		Atlas-SNP	.											.	SLC39A8	24	.	0			c.T493G						.						118.0	134.0	129.0					4																	103228652		2203	4300	6503	SO:0001583	missense	64116	exon3			CCACAAAAAAGGT		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.493T>G	chr4.hg19:g.103228652A>C	ENSP00000378310:p.Phe165Val	364.0	0.0		294.0	80.0	NM_022154	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	ENST00000394833.2	hg19	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	A	31	5.062340	0.93898	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	T;T;T	0.45276	0.9;0.9;0.9	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.64702	0.2622	M	0.75884	2.315	0.80722	D	1	D;D;D	0.76494	0.987;0.999;0.991	D;D;D	0.75484	0.964;0.986;0.915	T	0.68796	-0.5314	10	0.72032	D	0.01	-11.2509	14.8503	0.70292	1.0:0.0:0.0:0.0	.	165;165;98	B4E2H3;Q9C0K1;Q9C0K1-2	.;S39A8_HUMAN;.	V	165	ENSP00000394548:F165V;ENSP00000349174:F165V;ENSP00000378310:F165V	ENSP00000349174:F165V	F	-	1	0	SLC39A8	103447675	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.097000	0.94193	2.108000	0.64289	0.533000	0.62120	TTT	.	.		0.368	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
RBM46	166863	hgsc.bcm.edu	37	4	155719022	155719022	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr4:155719022G>C	ENST00000281722.3	+	3	446	c.211G>C	c.(211-213)Gat>Cat	p.D71H	RBM46_ENST00000514866.1_Missense_Mutation_p.D71H|RBM46_ENST00000510397.1_Missense_Mutation_p.D71H	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	71	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				AATACCTCGTGATATGTATGA	0.373																																					p.D71H		Atlas-SNP	.											.	RBM46	76	.	0			c.G211C						.						122.0	125.0	124.0					4																	155719022		2203	4300	6503	SO:0001583	missense	166863	exon3			CCTCGTGATATGT	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.211G>C	chr4.hg19:g.155719022G>C	ENSP00000281722:p.Asp71His	161.0	0.0		135.0	36.0	NM_144979	B3KWU8|B4DZ27	Missense_Mutation	SNP	ENST00000281722.3	hg19	CCDS3790.1	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540670	0.65085	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397;ENST00000512640	T;T;T;T	0.20200	3.16;2.09;3.16;2.09	5.9	5.9	0.94986	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.045934	0.85682	D	0.000000	T	0.47340	0.1440	M	0.76170	2.325	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.994	D;D;D	0.72075	0.951;0.976;0.964	T	0.42582	-0.9443	10	0.87932	D	0	-29.8799	15.4131	0.74943	0.0681:0.0:0.9319:0.0	.	71;71;71	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	H	71	ENSP00000424500:D71H;ENSP00000281722:D71H;ENSP00000422813:D71H;ENSP00000426672:D71H	ENSP00000281722:D71H	D	+	1	0	RBM46	155938472	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.804000	0.85993	2.793000	0.96121	0.563000	0.77884	GAT	.	.		0.373	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979	
PDZD2	23037	hgsc.bcm.edu	37	5	31983740	31983740	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:31983740A>T	ENST00000438447.1	+	3	1344	c.956A>T	c.(955-957)cAa>cTa	p.Q319L	PDZD2_ENST00000282493.3_Missense_Mutation_p.Q319L			O15018	PDZD2_HUMAN	PDZ domain containing 2	319					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						ACGGACTTCCAATCGAGTGAC	0.478																																					p.Q319L		Atlas-SNP	.											.	PDZD2	306	.	0			c.A956T						.						92.0	97.0	95.0					5																	31983740		2202	4300	6502	SO:0001583	missense	23037	exon2			ACTTCCAATCGAG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.956A>T	chr5.hg19:g.31983740A>T	ENSP00000402033:p.Gln319Leu	164.0	0.0		156.0	45.0	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	hg19	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680327	0.68042	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.06687	3.27;3.27	5.68	5.68	0.88126	PDZ/DHR/GLGF (1);	0.000000	0.44902	D	0.000407	T	0.18130	0.0435	L	0.32530	0.975	0.38661	D	0.952077	D;D	0.63880	0.979;0.993	P;D	0.72338	0.747;0.977	T	0.02202	-1.1196	10	0.52906	T	0.07	.	12.3301	0.55035	1.0:0.0:0.0:0.0	.	145;319	B4E3P2;O15018	.;PDZD2_HUMAN	L	319	ENSP00000402033:Q319L;ENSP00000282493:Q319L	ENSP00000282493:Q319L	Q	+	2	0	PDZD2	32019497	0.985000	0.35326	0.899000	0.35326	0.506000	0.33950	3.118000	0.50414	2.167000	0.68274	0.528000	0.53228	CAA	.	.		0.478	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
MCCC2	64087	hgsc.bcm.edu	37	5	70936898	70936898	+	Silent	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:70936898T>A	ENST00000340941.6	+	11	1197	c.1068T>A	c.(1066-1068)gtT>gtA	p.V356V	MCCC2_ENST00000323375.8_Silent_p.V318V|MCCC2_ENST00000509358.2_Silent_p.V356V	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	356	Acyl-CoA binding. {ECO:0000255}.|Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	ACACATTAGTTACAGGTATAA	0.373																																					p.V356V		Atlas-SNP	.											.	MCCC2	47	.	0			c.T1068A						.						106.0	100.0	102.0					5																	70936898		2203	4300	6503	SO:0001819	synonymous_variant	64087	exon11			ATTAGTTACAGGT	AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.1068T>A	chr5.hg19:g.70936898T>A		88.0	0.0		93.0	19.0	NM_022132	A6NIY9|Q96C27|Q9Y4L7	Silent	SNP	ENST00000340941.6	hg19	CCDS34184.1																																																																																			.	.		0.373	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4		
FBN2	2201	hgsc.bcm.edu	37	5	127727761	127727761	+	Missense_Mutation	SNP	C	C	G	rs35095480		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:127727761C>G	ENST00000508053.1	-	17	2527	c.1553G>C	c.(1552-1554)cGa>cCa	p.R518P	FBN2_ENST00000508989.1_Missense_Mutation_p.R485P|FBN2_ENST00000262464.4_Missense_Mutation_p.R518P			P35556	FBN2_HUMAN	fibrillin 2	518	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCATTCACATCGGTAGCTTGA	0.348																																					p.R518P		Atlas-SNP	.											.	FBN2	858	.	0			c.G1553C						.						142.0	133.0	136.0					5																	127727761		2203	4300	6503	SO:0001583	missense	2201	exon11			TCACATCGGTAGC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1553G>C	chr5.hg19:g.127727761C>G	ENSP00000424571:p.Arg518Pro	171.0	0.0		136.0	24.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253938	0.80135	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.87650	-2.28;-2.28;-2.28	4.14	4.14	0.48551	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.51477	D	0.000087	D	0.94830	0.8330	M	0.92923	3.36	0.58432	D	0.99999	D;D	0.89917	1.0;0.996	D;D	0.72982	0.958;0.979	D	0.95717	0.8763	10	0.62326	D	0.03	.	17.7235	0.88359	0.0:1.0:0.0:0.0	.	485;518	D6RJI3;P35556	.;FBN2_HUMAN	P	518;518;485	ENSP00000262464:R518P;ENSP00000424571:R518P;ENSP00000425596:R485P	ENSP00000262464:R518P	R	-	2	0	FBN2	127755660	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.303000	0.65738	2.592000	0.87571	0.585000	0.79938	CGA	.	.		0.348	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
KDM3B	51780	hgsc.bcm.edu	37	5	137759953	137759954	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:137759953_137759954GG>TT	ENST00000314358.5	+	16	4362_4363	c.4162_4163GG>TT	c.(4162-4164)GGg>TTg	p.G1388L	KDM3B_ENST00000394866.1_Missense_Mutation_p.G1044L|KDM3B_ENST00000542866.1_Missense_Mutation_p.G420L	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1388					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GCTTTGTGATGGGAGGCTTCTG	0.49																																					p.G1388W|p.G1388V		Atlas-SNP	.											.	KDM3B	177	.	0			c.G4162T|c.G4163T						.																																			SO:0001583	missense	51780	exon16			TGTGATGGGAGGC|GTGATGGGAGGCT	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	Exception_encountered	chr5.hg19:g.137759953_137759954delinsTT	ENSP00000326563:p.Gly1388Leu	243.0	0.0		260.0|259.0	74.0|73.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	hg19	CCDS34242.1																																																																																			.	.		0.490	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
PCDHA2	56146	hgsc.bcm.edu	37	5	140176834	140176834	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:140176834A>T	ENST00000526136.1	+	1	2285	c.2285A>T	c.(2284-2286)gAg>gTg	p.E762V	PCDHA2_ENST00000520672.2_Missense_Mutation_p.E762V|PCDHA2_ENST00000378132.1_Missense_Mutation_p.E762V|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	762	5 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTCTGGGGAGGACCCCCCC	0.622																																					p.E762V		Atlas-SNP	.											.	PCDHA2	404	.	0			c.A2285T						.						46.0	50.0	49.0					5																	140176834		2203	4300	6503	SO:0001583	missense	56146	exon1			CTGGGGAGGACCC	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.2285A>T	chr5.hg19:g.140176834A>T	ENSP00000431748:p.Glu762Val	201.0	0.0		225.0	59.0	NM_031495	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	hg19	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	a	16.47	3.132858	0.56828	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.17213	2.29;2.29;2.29	4.0	4.0	0.46444	.	0.371940	0.19003	U	0.125274	T	0.46658	0.1404	M	0.92880	3.355	0.23341	N	0.997877	D;B;D	0.76494	0.985;0.377;0.999	P;B;D	0.76575	0.891;0.206;0.988	T	0.42699	-0.9436	10	0.62326	D	0.03	.	7.8235	0.29300	0.9027:0.0:0.0973:0.0	.	762;762;762	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	V	762	ENSP00000430584:E762V;ENSP00000367372:E762V;ENSP00000431748:E762V	ENSP00000367372:E762V	E	+	2	0	PCDHA2	140157018	0.999000	0.42202	0.998000	0.56505	0.755000	0.42902	3.253000	0.51469	1.584000	0.49913	0.477000	0.44152	GAG	.	.		0.622	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHA6	56142	hgsc.bcm.edu	37	5	140208267	140208267	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:140208267G>A	ENST00000529310.1	+	1	705	c.591G>A	c.(589-591)aaG>aaA	p.K197K	PCDHA6_ENST00000527624.1_Silent_p.K197K|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	197	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.K197N(2)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTATTAAAGAAATCCTTGG	0.433																																					p.K197K		Atlas-SNP	.											PCDHA6_ENST00000529310,colon,carcinoma,0,4	PCDHA6	442	.	2	Substitution - Missense(2)	large_intestine(2)	c.G591A						.						67.0	72.0	70.0					5																	140208267		2203	4300	6503	SO:0001819	synonymous_variant	56142	exon1			ATTAAAGAAATCC	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.591G>A	chr5.hg19:g.140208267G>A		82.0	0.0		74.0	20.0	NM_018909	O75283|Q9NRT8	Silent	SNP	ENST00000529310.1	hg19	CCDS47281.1																																																																																			.	.		0.433	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
KCTD16	57528	hgsc.bcm.edu	37	5	143586733	143586733	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:143586733C>T	ENST00000507359.3	+	2	1547	c.456C>T	c.(454-456)ccC>ccT	p.P152P	KCTD16_ENST00000512467.1_Silent_p.P152P	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	152					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GAATCTGCCCCCCTTCCTCCC	0.547																																					p.P152P		Atlas-SNP	.											.	KCTD16	70	.	0			c.C456T						.						81.0	87.0	85.0					5																	143586733		2203	4300	6503	SO:0001819	synonymous_variant	57528	exon3			CTGCCCCCCTTCC	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.456C>T	chr5.hg19:g.143586733C>T		72.0	0.0		77.0	21.0	NM_020768	Q9P2M9	Silent	SNP	ENST00000507359.3	hg19	CCDS34260.1																																																																																			.	.		0.547	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
SLC36A1	206358	hgsc.bcm.edu	37	5	150843185	150843185	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:150843185T>A	ENST00000243389.3	+	3	438	c.215T>A	c.(214-216)gTg>gAg	p.V72E	SLC36A1_ENST00000521351.1_3'UTR|SLC36A1_ENST00000520701.1_Missense_Mutation_p.V72E|SLC36A1_ENST00000521925.1_Missense_Mutation_p.V72E|SLC36A1_ENST00000429484.2_Missense_Mutation_p.V72E	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	72				V -> A (in Ref. 7; BAB71435). {ECO:0000305}.	amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	CCTCTGGCGGTGAAAAATGCA	0.463																																					p.V72E	Melanoma(151;1534 1860 12947 32979 37872)	Atlas-SNP	.											.	SLC36A1	50	.	0			c.T215A						.						107.0	97.0	101.0					5																	150843185		2203	4300	6503	SO:0001583	missense	206358	exon3			TGGCGGTGAAAAA	AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.215T>A	chr5.hg19:g.150843185T>A	ENSP00000243389:p.Val72Glu	113.0	0.0		109.0	24.0	NM_078483	C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Missense_Mutation	SNP	ENST00000243389.3	hg19	CCDS4316.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.924335	0.92319	.	.	ENSG00000123643	ENST00000520111;ENST00000520701;ENST00000429484;ENST00000243389;ENST00000456739;ENST00000521925	T;T;T;T;T	0.02498	4.27;4.27;4.27;4.27;4.27	6.08	6.08	0.98989	.	0.057095	0.64402	D	0.000002	T	0.17152	0.0412	M	0.84683	2.71	0.58432	D	0.999994	P;D	0.53151	0.956;0.958	D;P	0.63283	0.913;0.826	T	0.00083	-1.2103	10	0.72032	D	0.01	.	16.6438	0.85155	0.0:0.0:0.0:1.0	.	72;72	E7EW39;Q7Z2H8	.;S36A1_HUMAN	E	72	ENSP00000429796:V72E;ENSP00000428140:V72E;ENSP00000395640:V72E;ENSP00000243389:V72E;ENSP00000430305:V72E	ENSP00000243389:V72E	V	+	2	0	SLC36A1	150823378	1.000000	0.71417	0.998000	0.56505	0.933000	0.57130	7.859000	0.86982	2.333000	0.79357	0.533000	0.62120	GTG	.	.		0.463	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252433.1	NM_078483	
SLIT3	6586	hgsc.bcm.edu	37	5	168244433	168244433	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr5:168244433T>A	ENST00000519560.1	-	8	1084	c.665A>T	c.(664-666)cAc>cTc	p.H222L	SLIT3_ENST00000332966.8_Missense_Mutation_p.H222L|SLIT3_ENST00000404867.3_Missense_Mutation_p.H222L	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	222	LRRCT 1.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAGGCCAGGTGGCAGTCGCA	0.617																																					p.H222L	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.A665T						.						60.0	56.0	57.0					5																	168244433		2203	4300	6503	SO:0001583	missense	6586	exon8			GCCAGGTGGCAGT	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.665A>T	chr5.hg19:g.168244433T>A	ENSP00000430333:p.His222Leu	39.0	0.0		70.0	22.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	hg19	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497282	0.85069	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.75938	-0.98;-0.98;-0.97	5.53	4.4	0.53042	Cysteine-rich flanking region, C-terminal (1);	0.180128	0.64402	D	0.000013	D	0.84070	0.5391	M	0.93763	3.455	0.80722	D	1	P;P;B	0.45283	0.688;0.855;0.451	B;P;B	0.49953	0.218;0.627;0.341	D	0.87315	0.2314	10	0.87932	D	0	.	10.0534	0.42230	0.0:0.1081:0.0:0.8919	.	222;222;222	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	L	222	ENSP00000430333:H222L;ENSP00000332164:H222L;ENSP00000384890:H222L	ENSP00000332164:H222L	H	-	2	0	SLIT3	168177011	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.520000	0.53465	2.099000	0.63709	0.459000	0.35465	CAC	.	.		0.617	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SLC17A1	6568	hgsc.bcm.edu	37	6	25811931	25811931	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:25811931G>A	ENST00000244527.4	-	9	1080	c.965C>T	c.(964-966)tCa>tTa	p.S322L	SLC17A1_ENST00000476801.1_Missense_Mutation_p.S322L|SLC17A1_ENST00000468082.1_Missense_Mutation_p.S268L|SLC17A1_ENST00000427328.1_Missense_Mutation_p.S268L	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	322					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)	p.S322*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						GAAGAAGTCTGATAACTGACC	0.448																																					p.S322L		Atlas-SNP	.											SLC17A1,NS,carcinoma,0,1	SLC17A1	71	.	1	Substitution - Nonsense(1)	lung(1)	c.C965T						.						103.0	93.0	96.0					6																	25811931		2203	4300	6503	SO:0001583	missense	6568	exon9			AAGTCTGATAACT		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.965C>T	chr6.hg19:g.25811931G>A	ENSP00000244527:p.Ser322Leu	79.0	0.0		76.0	17.0	NM_005074	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	hg19	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351871	0.24512	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.59502	0.26;0.72;0.26;0.72	3.38	3.38	0.38709	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.211340	0.06268	N	0.695074	T	0.43277	0.1240	L	0.50333	1.59	0.09310	N	1	B;B	0.32467	0.321;0.372	B;B	0.39771	0.205;0.309	T	0.48269	-0.9050	10	0.54805	T	0.06	.	10.5584	0.45131	0.0:0.0:1.0:0.0	.	268;322	Q14916-2;Q14916	.;NPT1_HUMAN	L	322;268;322;268	ENSP00000244527:S322L;ENSP00000410549:S268L;ENSP00000420614:S322L;ENSP00000420546:S268L	ENSP00000244527:S322L	S	-	2	0	SLC17A1	25919910	0.981000	0.34729	0.010000	0.14722	0.350000	0.29205	3.678000	0.54627	2.191000	0.70037	0.650000	0.86243	TCA	.	.		0.448	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2		
HIST1H3B	8358	hgsc.bcm.edu	37	6	26032209	26032209	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:26032209C>T	ENST00000244661.2	-	1	79	c.80G>A	c.(79-81)cGc>cAc	p.R27H		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	27					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						CGCGCTCTTGCGAGCAGCCTT	0.612																																					p.R27H		Atlas-SNP	.											.	HIST1H3B	59	.	0			c.G80A						.						67.0	82.0	77.0					6																	26032209		2161	4211	6372	SO:0001583	missense	8358	exon1			CTCTTGCGAGCAG	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.80G>A	chr6.hg19:g.26032209C>T	ENSP00000244661:p.Arg27His	22.0	0.0		29.0	10.0	NM_003537	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	hg19	CCDS4573.1	.	.	.	.	.	.	.	.	.	.	c	12.66	2.005280	0.35415	.	.	ENSG00000124693	ENST00000244661	T	0.46063	0.88	5.19	5.19	0.71726	.	.	.	.	.	T	0.53029	0.1771	.	.	.	0.43598	D	0.995951	.	.	.	.	.	.	T	0.53208	-0.8471	6	0.51188	T	0.08	.	18.0628	0.89382	0.0:1.0:0.0:0.0	.	.	.	.	H	27	ENSP00000244661:R27H	ENSP00000244661:R27H	R	-	2	0	HIST1H3B	26140188	1.000000	0.71417	0.994000	0.49952	0.013000	0.08279	7.633000	0.83260	2.577000	0.86979	0.561000	0.74099	CGC	.	.		0.612	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537	
GSTA4	2941	hgsc.bcm.edu	37	6	52858985	52858985	+	Silent	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:52858985C>A	ENST00000370959.1	-	2	174	c.57G>T	c.(55-57)gtG>gtT	p.V19V	GSTA4_ENST00000541324.1_5'UTR|GSTA4_ENST00000370960.1_5'UTR|RN7SK_ENST00000365328.1_RNA			O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	19	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(3)|skin(2)|urinary_tract(1)	7	Lung NSC(77;0.103)				Glutathione(DB00143)	AAACCCATCTCACGGACTCCA	0.478																																					p.V19V		Atlas-SNP	.											.	GSTA4	20	.	0			c.G57T						.						85.0	87.0	86.0					6																	52858985		2203	4300	6503	SO:0001819	synonymous_variant	2941	exon2			CCATCTCACGGAC	AF020918	CCDS4948.1	6p12.2	2012-06-21	2008-11-26		ENSG00000170899	ENSG00000170899	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4629	protein-coding gene	gene with protein product		605450	"""glutathione S-transferase A4"""			9480897	Standard	NM_001512		Approved		uc003pbf.3	O15217	OTTHUMG00000014868	ENST00000370959.1:c.57G>T	chr6.hg19:g.52858985C>A		42.0	0.0		55.0	15.0	NM_001512	B2RD15|Q5T7Q8|Q6P4G1|Q9BX18|Q9H414	Silent	SNP	ENST00000370959.1	hg19	CCDS4948.1																																																																																			.	.		0.478	GSTA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040946.1	NM_001512	
IMPG1	3617	hgsc.bcm.edu	37	6	76715138	76715138	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:76715138T>A	ENST00000369950.3	-	10	1190	c.1001A>T	c.(1000-1002)gAa>gTa	p.E334V	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				ATGATAGACTTCCTCACTTTC	0.443																																					p.E334V	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.A1001T						.						181.0	163.0	169.0					6																	76715138		2203	4300	6503	SO:0001583	missense	3617	exon10			TAGACTTCCTCAC	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1001A>T	chr6.hg19:g.76715138T>A	ENSP00000358966:p.Glu334Val	344.0	0.0		358.0	79.0	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	hg19	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	T	2.784	-0.252760	0.05829	.	.	ENSG00000112706	ENST00000369950	T	0.37752	1.18	5.01	1.07	0.20283	SEA (2);	1.053100	0.07418	N	0.893510	T	0.05547	0.0146	N	0.08118	0	0.20764	N	0.999854	B	0.13145	0.007	B	0.13407	0.009	T	0.38520	-0.9657	10	0.30078	T	0.28	.	3.9146	0.09217	0.1611:0.4147:0.0:0.4242	.	334	Q17R60	IMPG1_HUMAN	V	334	ENSP00000358966:E334V	ENSP00000358966:E334V	E	-	2	0	IMPG1	76771858	0.280000	0.24249	0.040000	0.18447	0.273000	0.26683	0.498000	0.22530	-0.088000	0.12506	-0.472000	0.04984	GAA	.	.		0.443	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
SLC22A16	85413	hgsc.bcm.edu	37	6	110763664	110763664	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr6:110763664C>T	ENST00000368919.3	-	4	1032	c.966G>A	c.(964-966)ctG>ctA	p.L322L	RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000439654.1_Silent_p.L322L|SLC22A16_ENST00000330550.4_Silent_p.L288L	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	322					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	AAAGTTCTGACAGTTTACAGG	0.423																																					p.L322L		Atlas-SNP	.											.	SLC22A16	81	.	0			c.G966A						.						104.0	98.0	100.0					6																	110763664		2203	4300	6503	SO:0001819	synonymous_variant	85413	exon4			TTCTGACAGTTTA		CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.966G>A	chr6.hg19:g.110763664C>T		66.0	0.0		76.0	17.0	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Silent	SNP	ENST00000368919.3	hg19	CCDS5084.1																																																																																			.	.		0.423	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
ABCA13	154664	hgsc.bcm.edu	37	7	48318705	48318705	+	Silent	SNP	T	T	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:48318705T>A	ENST00000435803.1	+	18	7938	c.7914T>A	c.(7912-7914)atT>atA	p.I2638I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2638					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGGAAGAAATTGCTGAATTTT	0.323																																					p.I2638I		Atlas-SNP	.											.	ABCA13	1192	.	0			c.T7914A						.						34.0	33.0	33.0					7																	48318705		1812	4070	5882	SO:0001819	synonymous_variant	154664	exon18			AGAAATTGCTGAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7914T>A	chr7.hg19:g.48318705T>A		65.0	0.0		74.0	19.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	hg19	CCDS47584.1																																																																																			.	.		0.323	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
C7orf72	100130988	hgsc.bcm.edu	37	7	50135895	50135895	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:50135895C>T	ENST00000297001.6	+	1	264	c.214C>T	c.(214-216)Cct>Tct	p.P72S		NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	72										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						CCCTTATCCCCCTTCAGTTTT	0.408																																					p.P72S		Atlas-SNP	.											.	C7orf72	26	.	0			c.C214T						.						110.0	99.0	103.0					7																	50135895		692	1591	2283	SO:0001583	missense	100130988	exon1			TATCCCCCTTCAG		CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.214C>T	chr7.hg19:g.50135895C>T	ENSP00000297001:p.Pro72Ser	267.0	0.0		285.0	61.0	NM_001161834	A6NDX9	Missense_Mutation	SNP	ENST00000297001.6	hg19	CCDS47585.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130208	0.56721	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.68	4.69	0.59074	.	.	.	.	.	T	0.34745	0.0908	L	0.33485	1.01	0.26573	N	0.973524	P	0.50943	0.94	P	0.49421	0.61	T	0.08994	-1.0695	7	.	.	.	-9.4796	9.7843	0.40666	0.0:0.8738:0.0:0.1262	.	72	A4D263	CG072_HUMAN	S	72	.	.	P	+	1	0	C7orf72	50106441	0.809000	0.29036	0.993000	0.49108	0.982000	0.71751	2.051000	0.41307	2.678000	0.91216	0.491000	0.48974	CCT	.	.		0.408	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342124.1	NM_001161834	
SPAM1	6677	hgsc.bcm.edu	37	7	123594252	123594252	+	Missense_Mutation	SNP	C	C	T	rs376151172		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:123594252C>T	ENST00000439500.1	+	4	1241	c.628C>T	c.(628-630)Ctt>Ttt	p.L210F	SPAM1_ENST00000223028.7_Missense_Mutation_p.L210F|SPAM1_ENST00000402183.2_Missense_Mutation_p.L210F|SPAM1_ENST00000460182.1_Missense_Mutation_p.L210F|SPAM1_ENST00000340011.5_Missense_Mutation_p.L210F	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	210					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GGGAAAATTACTTCGGCCAAA	0.383																																					p.L210F		Atlas-SNP	.											.	SPAM1	195	.	0			c.C628T						.						78.0	83.0	81.0					7																	123594252		2203	4299	6502	SO:0001583	missense	6677	exon3			AAATTACTTCGGC	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.628C>T	chr7.hg19:g.123594252C>T	ENSP00000402123:p.Leu210Phe	142.0	0.0		115.0	31.0	NM_153189	Q8TC30	Missense_Mutation	SNP	ENST00000439500.1	hg19	CCDS5791.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.990654	0.35131	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	6.17	3.34	0.38264	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.495783	0.20231	N	0.096470	T	0.36799	0.0980	M	0.88842	2.985	0.09310	N	0.999999	P;P	0.40970	0.734;0.734	B;B	0.38378	0.272;0.272	T	0.42068	-0.9473	9	.	.	.	-26.5249	6.3721	0.21487	0.3469:0.5138:0.0:0.1392	.	210;210	Q8TC30;P38567	.;HYALP_HUMAN	F	210	ENSP00000386028:L210F;ENSP00000417934:L210F;ENSP00000345849:L210F;ENSP00000402123:L210F;ENSP00000223028:L210F	.	L	+	1	0	SPAM1	123381488	0.000000	0.05858	0.023000	0.16930	0.770000	0.43624	-0.053000	0.11846	0.901000	0.36495	0.655000	0.94253	CTT	.	.		0.383	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000348309.1		
KDM7A	80853	hgsc.bcm.edu	37	7	139819020	139819020	+	Splice_Site	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:139819020C>A	ENST00000397560.2	-	9	1237		c.e9-1		JHDM1D_ENST00000006967.5_Splice_Site	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN							histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					CTCATAACACCTAAATGAGTT	0.308																																					.		Atlas-SNP	.											.	JHDM1D	54	.	0			c.1140-1G>T						.						76.0	73.0	74.0					7																	139819020		1783	4055	5838	SO:0001630	splice_region_variant	80853	exon10			TAACACCTAAATG																												ENST00000397560.2:c.1140-1G>T	chr7.hg19:g.139819020C>A		110.0	0.0		81.0	23.0	NM_030647	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Splice_Site	SNP	ENST00000397560.2	hg19	CCDS43658.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164077	0.78339	.	.	ENSG00000006459	ENST00000397560;ENST00000006967	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3681	0.98887	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JHDM1D	139465489	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.776000	0.85560	2.890000	0.99128	0.655000	0.94253	.	.	.		0.308	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348460.1		Intron
GPR124	25960	hgsc.bcm.edu	37	8	37693203	37693203	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:37693203C>G	ENST00000412232.2	+	13	1978	c.1965C>G	c.(1963-1965)caC>caG	p.H655Q	GPR124_ENST00000315215.7_Intron	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	655					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCCTCTTCCACAGCCACAGCA	0.647																																					p.H655Q		Atlas-SNP	.											.	GPR124	85	.	0			c.C1965G						.						57.0	63.0	61.0					8																	37693203		2203	4299	6502	SO:0001583	missense	25960	exon13			CTTCCACAGCCAC	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.1965C>G	chr8.hg19:g.37693203C>G	ENSP00000406367:p.His655Gln	21.0	0.0		53.0	13.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	hg19	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	C	14.73	2.621557	0.46736	.	.	ENSG00000020181	ENST00000416514;ENST00000412232	T	0.54279	0.58	5.29	2.02	0.26589	.	0.278824	0.33772	N	0.004561	T	0.25680	0.0625	N	0.08118	0	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.09907	-1.0653	10	0.24483	T	0.36	-27.3241	5.9515	0.19248	0.2893:0.5672:0.0:0.1435	.	655	Q96PE1	GP124_HUMAN	Q	648;655	ENSP00000406367:H655Q	ENSP00000406367:H655Q	H	+	3	2	GPR124	37812361	0.996000	0.38824	1.000000	0.80357	0.901000	0.52897	0.430000	0.21428	1.206000	0.43276	0.655000	0.94253	CAC	.	.		0.647	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
POTEA	340441	hgsc.bcm.edu	37	8	43152221	43152221	+	RNA	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:43152221G>A	ENST00000522175.2	+	0	360							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TCTTCTGCTGGACAGACAATG	0.403																																					p.D120N		Atlas-SNP	.											.	POTEA	87	.	0			c.G358A						.						107.0	105.0	106.0					8																	43152221		2160	4290	6450			340441	exon2			CTGCTGGACAGAC	AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		chr8.hg19:g.43152221G>A		182.0	0.0		145.0	24.0	NM_001005365	A6ND17|A6ND71|Q6S8J6	Missense_Mutation	SNP	ENST00000522175.2	hg19																																																																																				.	.		0.403	POTEA-003	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000383492.1	NM_001002920	
SPIDR	23514	hgsc.bcm.edu	37	8	48508456	48508456	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:48508456C>G	ENST00000297423.4	+	9	1565	c.1181C>G	c.(1180-1182)tCa>tGa	p.S394*	SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Nonsense_Mutation_p.S324*|SPIDR_ENST00000518074.1_Nonsense_Mutation_p.S334*	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	394	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AAAGAAGATTCAGAAAAAACT	0.378																																					p.S394X		Atlas-SNP	.											.	KIAA0146	64	.	0			c.C1181G						.						101.0	94.0	96.0					8																	48508456		1824	4088	5912	SO:0001587	stop_gained	23514	exon9			AAGATTCAGAAAA	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1181C>G	chr8.hg19:g.48508456C>G	ENSP00000297423:p.Ser394*	156.0	0.0		119.0	31.0	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Nonsense_Mutation	SNP	ENST00000297423.4	hg19	CCDS43737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.080166|5.080166	0.94050|0.94050	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000519401|ENST00000297423;ENST00000518074;ENST00000541342;ENST00000524006	.|.	.|.	.|.	5.3|5.3	4.43|4.43	0.53597|0.53597	.|.	.|0.513015	.|0.18585	.|N	.|0.136900	T|.	0.52741|.	0.1753|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.61168|.	-0.7117|.	3|.	.|0.27082	.|T	.|0.32	.|.	11.43|11.43	0.50034|0.50034	0.0:0.9141:0.0:0.0859|0.0:0.9141:0.0:0.0859	.|.	.|.	.|.	.|.	E|X	76|394;334;324;83	.|.	.|ENSP00000297423:S394X	Q|S	+|+	1|2	0|0	KIAA0146|KIAA0146	48671009|48671009	0.915000|0.915000	0.31059|0.31059	0.020000|0.020000	0.16555|0.16555	0.257000|0.257000	0.26127|0.26127	1.656000|1.656000	0.37355|0.37355	1.376000|1.376000	0.46267|0.46267	0.655000|0.655000	0.94253|0.94253	CAG|TCA	.	.		0.378	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
TRPA1	8989	hgsc.bcm.edu	37	8	72975034	72975034	+	Splice_Site	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:72975034C>A	ENST00000262209.4	-	6	1014	c.807G>T	c.(805-807)gaG>gaT	p.E269D		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	269					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GAAGAGTTACCTCCACTGGGT	0.358																																					p.E269D		Atlas-SNP	.											.	TRPA1	256	.	0			c.G807T						.						117.0	109.0	112.0					8																	72975034		2203	4300	6503	SO:0001630	splice_region_variant	8989	exon6			AGTTACCTCCACT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.807+1G>T	chr8.hg19:g.72975034C>A		260.0	0.0		243.0	61.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	hg19	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.999723	0.35320	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.38887	1.11;2.63	5.62	4.72	0.59763	Ankyrin repeat-containing domain (4);	0.097447	0.64402	D	0.000001	T	0.23846	0.0577	N	0.00468	-1.46	0.49051	D	0.999748	D	0.58268	0.982	P	0.57244	0.816	T	0.46484	-0.9188	9	.	.	.	-25.8627	13.7095	0.62659	0.0:0.9231:0.0:0.0769	.	269	O75762	TRPA1_HUMAN	D	121;269	ENSP00000428151:E121D;ENSP00000262209:E269D	.	E	-	3	2	TRPA1	73137588	1.000000	0.71417	0.989000	0.46669	0.074000	0.17049	5.070000	0.64376	1.301000	0.44836	0.650000	0.86243	GAG	.	.		0.358	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	Missense_Mutation
TG	7038	hgsc.bcm.edu	37	8	133941375	133941375	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr8:133941375C>T	ENST00000220616.4	+	23	4794	c.4754C>T	c.(4753-4755)gCt>gTt	p.A1585V	TG_ENST00000542445.1_Missense_Mutation_p.A19V|TG_ENST00000377869.1_Missense_Mutation_p.A1528V	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1585					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GACGCCAATGCTCCTGTGGCT	0.463																																					p.A1585V		Atlas-SNP	.											.	TG	416	.	0			c.C4754T						.						142.0	121.0	128.0					8																	133941375		2203	4300	6503	SO:0001583	missense	7038	exon23			CCAATGCTCCTGT	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4754C>T	chr8.hg19:g.133941375C>T	ENSP00000220616:p.Ala1585Val	144.0	0.0		177.0	52.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	C	8.043	0.764313	0.15914	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445	T;T;T	0.62788	0.0;0.0;0.0	5.5	-1.08	0.09936	.	1.845860	0.02581	N	0.098887	T	0.29321	0.0730	N	0.00926	-1.1	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.15093	-1.0449	10	0.24483	T	0.36	.	3.7294	0.08487	0.2064:0.3661:0.0:0.4275	.	19;1585	F5GWW5;P01266	.;THYG_HUMAN	V	1528;391;1585;19	ENSP00000367100:A1528V;ENSP00000220616:A1585V;ENSP00000441693:A19V	ENSP00000220616:A1585V	A	+	2	0	TG	134010557	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.064000	0.14437	0.015000	0.14971	-0.150000	0.13652	GCT	.	.		0.463	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
BNC2	54796	hgsc.bcm.edu	37	9	16738381	16738381	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:16738381C>A	ENST00000380672.4	-	2	163	c.106G>T	c.(106-108)Ggg>Tgg	p.G36W	BNC2_ENST00000380667.2_Missense_Mutation_p.G36W|BNC2_ENST00000380666.2_Missense_Mutation_p.G36W|BNC2_ENST00000545497.1_Intron	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GTATCAACCCCACAACATGGG	0.423																																					p.G36W		Atlas-SNP	.											.	BNC2	166	.	0			c.G106T						.						172.0	143.0	153.0					9																	16738381		2203	4300	6503	SO:0001583	missense	54796	exon2			CAACCCCACAACA	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.106G>T	chr9.hg19:g.16738381C>A	ENSP00000370047:p.Gly36Trp	168.0	0.0		176.0	59.0	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	hg19	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	10.06	1.247602	0.22880	.	.	ENSG00000173068	ENST00000380672;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000380666;ENST00000540340	T;T;T	0.04156	3.69;3.69;3.69	4.07	-0.347	0.12617	.	1.111260	0.07026	N	0.827613	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	D;B;P	0.54964	0.969;0.336;0.73	P;B;B	0.53224	0.721;0.052;0.058	T	0.44513	-0.9323	10	0.72032	D	0.01	0.2058	6.6548	0.22981	0.0:0.4942:0.0:0.5058	.	36;36;36	Q06HC4;Q6ZN30-2;Q6ZN30	.;.;BNC2_HUMAN	W	36	ENSP00000370047:G36W;ENSP00000370042:G36W;ENSP00000370041:G36W	ENSP00000370041:G36W	G	-	1	0	BNC2	16728381	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	0.016000	0.13377	-0.062000	0.13088	0.579000	0.79373	GGG	.	.		0.423	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
CDC14B	8555	hgsc.bcm.edu	37	9	99285642	99285642	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:99285642C>G	ENST00000375241.1	-	11	1597	c.1146G>C	c.(1144-1146)gaG>gaC	p.E382D	CDC14B_ENST00000481149.1_5'Flank|CDC14B_ENST00000375236.1_Missense_Mutation_p.E382D|CDC14B_ENST00000375242.3_Missense_Mutation_p.E345D|CDC14B_ENST00000265659.2_Missense_Mutation_p.E382D|CDC14B_ENST00000375240.3_Missense_Mutation_p.E382D|CDC14B_ENST00000463569.1_Missense_Mutation_p.E382D	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	382					activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				GTTGTCCATTCTCCTGCCCCT	0.453																																					p.E382D		Atlas-SNP	.											.	CDC14B	64	.	0			c.G1146C						.						110.0	115.0	113.0					9																	99285642		2203	4298	6501	SO:0001583	missense	8555	exon11			TCCATTCTCCTGC	AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.1146G>C	chr9.hg19:g.99285642C>G	ENSP00000364389:p.Glu382Asp	230.0	0.0		222.0	57.0	NM_033331	A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Missense_Mutation	SNP	ENST00000375241.1	hg19	CCDS6722.1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.245333	0.39697	.	.	ENSG00000081377	ENST00000265659;ENST00000375241;ENST00000375240;ENST00000375242;ENST00000463569;ENST00000375236	D;D;D;D;D;D	0.92199	-2.98;-2.99;-2.99;-2.98;-2.99;-2.99	5.29	4.32	0.51571	.	0.438058	0.24633	N	0.036867	D	0.88894	0.6561	L	0.54323	1.7	0.31311	N	0.687097	B;B;B	0.17465	0.022;0.013;0.013	B;B;B	0.23852	0.049;0.028;0.013	D	0.84695	0.0725	10	0.35671	T	0.21	0.0118	10.6986	0.45913	0.0:0.9011:0.0:0.0989	.	382;382;345	O60729-2;O60729;A8MQ20	.;CC14B_HUMAN;.	D	382;382;382;345;382;382	ENSP00000265659:E382D;ENSP00000364389:E382D;ENSP00000364388:E382D;ENSP00000364390:E345D;ENSP00000420572:E382D;ENSP00000364384:E382D	ENSP00000265659:E382D	E	-	3	2	CDC14B	98325463	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.439000	0.35013	2.759000	0.94783	0.555000	0.69702	GAG	.	.		0.453	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2	NM_033331	
FKBP15	23307	hgsc.bcm.edu	37	9	115948581	115948581	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:115948581C>T	ENST00000238256.3	-	15	1563	c.1446G>A	c.(1444-1446)caG>caA	p.Q482Q		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	482					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GCCGAACGGGCTGCAGCTGGG	0.537																																					p.Q482Q		Atlas-SNP	.											.	FKBP15	128	.	0			c.G1446A						.						66.0	78.0	74.0					9																	115948581		2078	4207	6285	SO:0001819	synonymous_variant	23307	exon15			AACGGGCTGCAGC	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.1446G>A	chr9.hg19:g.115948581C>T		76.0	0.0		89.0	26.0	NM_015258	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Silent	SNP	ENST00000238256.3	hg19	CCDS48007.1																																																																																			.	.		0.537	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258	
SFMBT2	57713	hgsc.bcm.edu	37	10	7423775	7423775	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:7423775C>T	ENST00000361972.4	-	2	176	c.86G>A	c.(85-87)gGa>gAa	p.G29E	SFMBT2_ENST00000397167.1_Missense_Mutation_p.G29E|SFMBT2_ENST00000397160.3_Missense_Mutation_p.G29E|SFMBT2_ENST00000379711.2_Missense_Mutation_p.G29E|SFMBT2_ENST00000379713.3_Missense_Mutation_p.G29E	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	29					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						ATCAAGGTCTCCATTTCCATT	0.418																																					p.G29E		Atlas-SNP	.											.	SFMBT2	209	.	0			c.G86A						.						127.0	119.0	122.0					10																	7423775		2203	4300	6503	SO:0001583	missense	57713	exon2			AGGTCTCCATTTC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.86G>A	chr10.hg19:g.7423775C>T	ENSP00000355109:p.Gly29Glu	86.0	0.0		92.0	24.0	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	hg19	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.617098	0.28801	.	.	ENSG00000198879	ENST00000361972;ENST00000397167;ENST00000379713;ENST00000379711;ENST00000397160	T;T;T;T;T	0.31510	2.55;2.55;1.89;1.49;1.49	5.41	4.31	0.51392	.	0.351137	0.21051	N	0.080994	T	0.18923	0.0454	L	0.43152	1.355	0.09310	N	1	B;B	0.33694	0.421;0.22	B;B	0.27715	0.082;0.074	T	0.23226	-1.0194	10	0.02654	T	1	.	9.9855	0.41839	0.0:0.8935:0.0:0.1065	.	29;29	Q5T981;Q5VUG0	.;SMBT2_HUMAN	E	29	ENSP00000355109:G29E;ENSP00000380353:G29E;ENSP00000369035:G29E;ENSP00000369033:G29E;ENSP00000380346:G29E	ENSP00000355109:G29E	G	-	2	0	SFMBT2	7463781	0.471000	0.25862	0.305000	0.25099	0.233000	0.25261	2.278000	0.43426	2.553000	0.86117	0.650000	0.86243	GGA	.	.		0.418	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
SUV39H2	79723	hgsc.bcm.edu	37	10	14938885	14938885	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:14938885A>C	ENST00000354919.6	+	3	218	c.218A>C	c.(217-219)gAt>gCt	p.D73A	SUV39H2_ENST00000313519.5_Missense_Mutation_p.D13A|SUV39H2_ENST00000378325.3_Missense_Mutation_p.D73A	NM_001193424.1	NP_001180353.1	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2 (Drosophila)	73	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cell differentiation (GO:0030154)|chromatin assembly or disassembly (GO:0006333)|chromatin remodeling (GO:0006338)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|male meiosis (GO:0007140)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nuclear heterochromatin (GO:0005720)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)	19						GGATGGCCAGATTCTACAAAT	0.328																																					p.D73A		Atlas-SNP	.											.	SUV39H2	72	.	0			c.A218C						.						69.0	77.0	74.0					10																	14938885		2203	4300	6503	SO:0001583	missense	79723	exon3			GGCCAGATTCTAC	AK027067	CCDS7104.1, CCDS53493.1, CCDS53494.1	10p13	2011-07-01			ENSG00000152455	ENSG00000152455		"""Chromatin-modifying enzymes / K-methyltransferases"""	17287	protein-coding gene	gene with protein product		606503				11094092	Standard	NM_001193424		Approved	FLJ23414, KMT1B	uc021png.1	Q9H5I1	OTTHUMG00000017718	ENST00000354919.6:c.218A>C	chr10.hg19:g.14938885A>C	ENSP00000346997:p.Asp73Ala	68.0	0.0		61.0	12.0	NM_001193426	D3DRT4|Q5JSS4|Q5JSS5|Q6I9Y3|Q8ND06	Missense_Mutation	SNP	ENST00000354919.6	hg19	CCDS53494.1	.	.	.	.	.	.	.	.	.	.	A	16.25	3.069540	0.55539	.	.	ENSG00000152455	ENST00000433779;ENST00000378325;ENST00000354919;ENST00000313519;ENST00000420416;ENST00000412254	T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	5.86	5.86	0.93980	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);Chromo domain, conserved site (1);	0.063070	0.64402	D	0.000005	T	0.64681	0.2620	L	0.45470	1.425	0.58432	D	0.999998	B;B	0.25904	0.04;0.137	B;B	0.26969	0.043;0.075	T	0.59958	-0.7356	10	0.20519	T	0.43	.	15.7408	0.77894	1.0:0.0:0.0:0.0	.	73;73	Q9H5I1;Q9H5I1-3	SUV92_HUMAN;.	A	13;73;73;13;13;13	ENSP00000388968:D13A;ENSP00000367576:D73A;ENSP00000346997:D73A;ENSP00000319208:D13A;ENSP00000392201:D13A;ENSP00000388218:D13A	ENSP00000319208:D13A	D	+	2	0	SUV39H2	14978891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.162000	0.94745	2.367000	0.80283	0.528000	0.53228	GAT	.	.		0.328	SUV39H2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046947.2	NM_024670	
PTCHD3	374308	hgsc.bcm.edu	37	10	27702131	27702131	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:27702131A>G	ENST00000438700.3	-	1	1166	c.1049T>C	c.(1048-1050)tTt>tCt	p.F350S		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	350					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						AATGTTGGTAAATTGATCGAG	0.522																																					p.F350S		Atlas-SNP	.											.	PTCHD3	140	.	0			c.T1049C						.						176.0	187.0	184.0					10																	27702131		2203	4300	6503	SO:0001583	missense	374308	exon1			TTGGTAAATTGAT	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1049T>C	chr10.hg19:g.27702131A>G	ENSP00000417658:p.Phe350Ser	109.0	0.0		129.0	37.0	NM_001034842	I3L499|Q6ZU28	Missense_Mutation	SNP	ENST00000438700.3	hg19	CCDS31173.1	.	.	.	.	.	.	.	.	.	.	A	10.12	1.261729	0.23051	.	.	ENSG00000182077	ENST00000438700	D	0.85258	-1.96	3.98	1.57	0.23409	.	0.331006	0.35151	N	0.003408	T	0.78426	0.4281	L	0.51422	1.61	0.09310	N	1	B	0.16396	0.017	B	0.23150	0.044	T	0.68800	-0.5313	10	0.66056	D	0.02	-3.53	6.1272	0.20186	0.6764:0.0:0.3236:0.0	.	350	Q3KNS1	PTHD3_HUMAN	S	350	ENSP00000417658:F350S	ENSP00000417658:F350S	F	-	2	0	PTCHD3	27742137	0.002000	0.14202	0.000000	0.03702	0.007000	0.05969	1.357000	0.34090	0.206000	0.20587	0.459000	0.35465	TTT	.	.		0.522	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047325.3	XM_370541	
JMJD1C	221037	hgsc.bcm.edu	37	10	64967201	64967202	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr10:64967201_64967202TG>CT	ENST00000399262.2	-	10	4445_4446	c.4227_4228CA>AG	c.(4225-4230)tcCAgc>tcAGgc	p.S1410G	JMJD1C_ENST00000402544.1_Missense_Mutation_p.S1191G|JMJD1C_ENST00000399251.1_Missense_Mutation_p.S1191G|JMJD1C_ENST00000542921.1_Missense_Mutation_p.S1228G	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1410					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCACCCCAGCTGGAAACACTGG	0.436																																					p.S1410G|p.S1409S		Atlas-SNP	.											.	JMJD1C	347	.	0			c.A4228G|c.C4227A						.																																			SO:0001583	missense	221037	exon10			CCCAGCTGGAAAC|CCAGCTGGAAACA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.4227_4228delinsCT	chr10.hg19:g.64967201_64967202delinsCT	ENSP00000382204:p.Ser1410Gly	87.0|89.0	0.0		84.0|86.0	21.0|22.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation|Silent	SNP	ENST00000399262.2	hg19	CCDS41532.1																																																																																			.	.		0.436	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
MUC2	4583	hgsc.bcm.edu	37	11	1078363	1078364	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:1078363_1078364CC>AT	ENST00000441003.2	+	5	677_678	c.650_651CC>AT	c.(649-651)tCC>tAT	p.S217Y	MUC2_ENST00000359061.5_Missense_Mutation_p.S217Y	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	217	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCCCCCGCATCCTGCTCCGAGC	0.653																																					p.S217Y|p.S217S		Atlas-SNP	.											.	MUC2	614	.	0			c.C650A|c.C651T						.																																			SO:0001583	missense	4583	exon5			CCGCATCCTGCTC|CGCATCCTGCTCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	Exception_encountered	chr11.hg19:g.1078363_1078364delinsAT	ENSP00000415183:p.Ser217Tyr	52.0|53.0	0.0		83.0|81.0	29.0|28.0	NM_002457	Q14878	Missense_Mutation|Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.		0.653	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR51G1	79324	hgsc.bcm.edu	37	11	4944842	4944842	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:4944842C>A	ENST00000321961.2	-	1	795	c.728G>T	c.(727-729)tGt>tTt	p.C243F	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGAGAGACACAGGTGTTGAG	0.552																																					p.C243F		Atlas-SNP	.											.	OR51G1	74	.	0			c.G728T						.						164.0	126.0	139.0					11																	4944842		2201	4298	6499	SO:0001583	missense	79324	exon1			GAGACACAGGTGT	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.728G>T	chr11.hg19:g.4944842C>A	ENSP00000322546:p.Cys243Phe	118.0	0.0		119.0	22.0	NM_001005237	B9EGW8|Q6IFH6	Missense_Mutation	SNP	ENST00000321961.2	hg19	CCDS31366.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699620	0.48307	.	.	ENSG00000176879	ENST00000321961	T	0.00368	7.75	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42821	U	0.000656	T	0.01765	0.0056	H	0.96208	3.785	0.50313	D	0.99986	D	0.89917	1.0	D	0.97110	1.0	T	0.31971	-0.9924	10	0.87932	D	0	.	15.9949	0.80232	0.0:1.0:0.0:0.0	.	243	Q8NGK1	O51G1_HUMAN	F	243	ENSP00000322546:C243F	ENSP00000322546:C243F	C	-	2	0	OR51G1	4901418	1.000000	0.71417	0.970000	0.41538	0.156000	0.22039	5.593000	0.67550	2.359000	0.80004	0.557000	0.71058	TGT	.	.		0.552	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142345.1	NM_001005237	
OR1S2	219958	hgsc.bcm.edu	37	11	57970715	57970715	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:57970715G>A	ENST00000302592.6	-	1	938	c.939C>T	c.(937-939)gcC>gcT	p.A313A		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	313						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				GCTTTCTCAGGGCACCTTTCA	0.423																																					p.A313A		Atlas-SNP	.											.	OR1S2	119	.	0			c.C939T						.						136.0	138.0	137.0					11																	57970715		2201	4294	6495	SO:0001819	synonymous_variant	219958	exon1			TCTCAGGGCACCT	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.939C>T	chr11.hg19:g.57970715G>A		115.0	0.0		101.0	27.0	NM_001004459	Q6IFG5|Q96R85	Silent	SNP	ENST00000302592.6	hg19	CCDS31545.1																																																																																			.	.		0.423	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394703.2	NM_001004459	
GLYAT	10249	hgsc.bcm.edu	37	11	58477428	58477428	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:58477428C>G	ENST00000344743.3	-	6	843	c.702G>C	c.(700-702)ttG>ttC	p.L234F	GLYAT_ENST00000529732.1_Missense_Mutation_p.L234F	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	234					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	GGTATTCCGGCAAGGTGCCTG	0.537																																					p.L234F		Atlas-SNP	.											GLYAT,NS,carcinoma,-1,1	GLYAT	53	.	0			c.G702C						.						63.0	61.0	61.0					11																	58477428		2201	4295	6496	SO:0001583	missense	10249	exon6			TTCCGGCAAGGTG	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.702G>C	chr11.hg19:g.58477428C>G	ENSP00000340200:p.Leu234Phe	79.0	0.0		101.0	20.0	NM_201648	O14833|Q96QK7	Missense_Mutation	SNP	ENST00000344743.3	hg19	CCDS7970.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939572	0.34189	.	.	ENSG00000149124	ENST00000344743;ENST00000529732	T;T	0.20463	2.07;2.07	6.06	1.9	0.25705	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	1.421900	0.04581	N	0.394958	T	0.43077	0.1231	M	0.81802	2.56	0.29804	N	0.832157	D	0.52996	0.957	P	0.59221	0.854	T	0.08827	-1.0703	10	0.54805	T	0.06	0.095	5.1614	0.15064	0.0:0.5944:0.1469:0.2587	.	234	Q6IB77	GLYAT_HUMAN	F	234	ENSP00000340200:L234F;ENSP00000431688:L234F	ENSP00000340200:L234F	L	-	3	2	GLYAT	58234004	0.245000	0.23899	0.234000	0.24042	0.060000	0.15804	-0.077000	0.11394	0.407000	0.25591	0.650000	0.86243	TTG	.	.		0.537	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1		
TRPT1	83707	hgsc.bcm.edu	37	11	63992051	63992051	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:63992051C>A	ENST00000317459.6	-	5	634	c.466G>T	c.(466-468)Gcc>Tcc	p.A156S	NUDT22_ENST00000441250.2_5'Flank|NUDT22_ENST00000279206.3_5'Flank|TRPT1_ENST00000394547.3_Missense_Mutation_p.A107S|TRPT1_ENST00000541278.1_Missense_Mutation_p.A156S|TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000546133.1_Missense_Mutation_p.A30S|TRPT1_ENST00000546089.1_Missense_Mutation_p.A107S|TRPT1_ENST00000394546.2_Missense_Mutation_p.A158S			Q86TN4	TRPT1_HUMAN	tRNA phosphotransferase 1	156					regulation of protein kinase activity (GO:0045859)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)		tRNA 2'-phosphotransferase activity (GO:0000215)			lung(2)|skin(1)	3						AGTCCTGGGGCCAGGTGAATG	0.612																																					p.A158S		Atlas-SNP	.											.	TRPT1	14	.	0			c.G472T						.						93.0	85.0	88.0					11																	63992051		2201	4297	6498	SO:0001583	missense	83707	exon5			CTGGGGCCAGGTG		CCDS31595.1, CCDS44639.1, CCDS53652.1, CCDS53653.1	11q13	2012-05-03			ENSG00000149743	ENSG00000149743			20316	protein-coding gene	gene with protein product	"""tRNA splicing 2' phosphotransferase 1"""	610470				14504659	Standard	NM_001160389		Approved	MGC11134	uc010rnc.2	Q86TN4	OTTHUMG00000167844	ENST00000317459.6:c.466G>T	chr11.hg19:g.63992051C>A	ENSP00000314073:p.Ala156Ser	39.0	0.0		69.0	12.0	NM_001160389	A8MU17|A8MYC9|F5H2B2|Q9BSB9	Missense_Mutation	SNP	ENST00000317459.6	hg19	CCDS31595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.58|17.58	3.426213|3.426213	0.62733|0.62733	.|.	.|.	ENSG00000149743|ENSG00000149743	ENST00000394547;ENST00000394546;ENST00000541278;ENST00000546133;ENST00000317459;ENST00000546089;ENST00000545812|ENST00000544286	T;T;T;T;T;T;T|.	0.40756|.	1.02;1.02;1.02;1.02;1.02;1.02;1.02|.	4.75|4.75	3.78|3.78	0.43462|0.43462	.|.	0.188584|.	0.44688|.	D|.	0.000432|.	T|T	0.50292|0.50292	0.1607|0.1607	N|N	0.25890|0.25890	0.77|0.77	0.41567|0.41567	D|D	0.988664|0.988664	B;P;P;B|.	0.45986|.	0.059;0.488;0.87;0.335|.	B;B;P;B|.	0.46796|.	0.182;0.305;0.527;0.206|.	T|T	0.43845|0.43845	-0.9366|-0.9366	10|5	0.33940|.	T|.	0.23|.	-12.5052|-12.5052	12.1479|12.1479	0.54034|0.54034	0.2735:0.7265:0.0:0.0|0.2735:0.7265:0.0:0.0	.|.	156;158;107;156|.	F5H2B2;A8MU17;Q86TN4-2;Q86TN4|.	.;.;.;TRPT1_HUMAN|.	S|V	107;158;156;30;156;107;158|19	ENSP00000378051:A107S;ENSP00000378050:A158S;ENSP00000438683:A156S;ENSP00000439586:A30S;ENSP00000314073:A156S;ENSP00000437741:A107S;ENSP00000442066:A158S|.	ENSP00000314073:A156S|.	A|G	-|-	1|2	0|0	TRPT1|TRPT1	63748627|63748627	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.951000|0.951000	0.60555|0.60555	1.936000|1.936000	0.40183|0.40183	2.380000|2.380000	0.81148|0.81148	0.561000|0.561000	0.74099|0.74099	GCC|GGC	.	.		0.612	TRPT1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396579.1	NM_031472	
PPP2R5B	5526	hgsc.bcm.edu	37	11	64695804	64695804	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:64695804G>A	ENST00000164133.2	+	6	1251	c.629G>A	c.(628-630)cGt>cAt	p.R210H		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	210					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CCCCGGGAGCGTGAGTACCTC	0.587																																					p.R210H		Atlas-SNP	.											.	PPP2R5B	47	.	0			c.G629A						.						82.0	71.0	74.0					11																	64695804		2201	4297	6498	SO:0001583	missense	5526	exon6			GGGAGCGTGAGTA	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.629G>A	chr11.hg19:g.64695804G>A	ENSP00000164133:p.Arg210His	75.0	0.0		89.0	19.0	NM_006244	Q13853	Missense_Mutation	SNP	ENST00000164133.2	hg19	CCDS8085.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.871173	0.91587	.	.	ENSG00000068971	ENST00000164133;ENST00000359279;ENST00000527441	.	.	.	3.56	3.56	0.40772	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87168	0.6110	H	0.97707	4.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91159	0.4959	9	0.87932	D	0	-9.5765	13.5415	0.61676	0.0:0.0:1.0:0.0	.	210	Q15173	2A5B_HUMAN	H	210;237;210	.	ENSP00000164133:R210H	R	+	2	0	PPP2R5B	64452380	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.137000	0.94496	2.322000	0.78497	0.549000	0.68633	CGT	.	.		0.587	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244	
INPPL1	3636	hgsc.bcm.edu	37	11	71948271	71948271	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:71948271C>T	ENST00000298229.2	+	26	3187	c.2983C>T	c.(2983-2985)Cag>Tag	p.Q995*	INPPL1_ENST00000541756.1_Nonsense_Mutation_p.Q753*|INPPL1_ENST00000538751.1_Nonsense_Mutation_p.Q753*|PHOX2A_ENST00000544057.1_5'Flank	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	995	Pro-rich.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GGTCCCGCACCAGCTGCTGCC	0.637																																					p.Q995X		Atlas-SNP	.											.	INPPL1	120	.	0			c.C2983T						.						79.0	95.0	90.0					11																	71948271		2200	4293	6493	SO:0001587	stop_gained	3636	exon26			CCGCACCAGCTGC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.2983C>T	chr11.hg19:g.71948271C>T	ENSP00000298229:p.Gln995*	30.0	0.0		35.0	10.0	NM_001567	B2RTX5|Q13577|Q13578	Nonsense_Mutation	SNP	ENST00000298229.2	hg19	CCDS8213.1	.	.	.	.	.	.	.	.	.	.	c	36	5.719986	0.96839	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751;ENST00000541752	.	.	.	5.19	5.19	0.71726	.	0.075721	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	16.1928	0.82004	0.0:1.0:0.0:0.0	.	.	.	.	X	995;753;753;8	.	ENSP00000298229:Q995X	Q	+	1	0	INPPL1	71625919	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.125000	0.77193	2.414000	0.81942	0.462000	0.41574	CAG	.	.		0.637	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
GRIK4	2900	hgsc.bcm.edu	37	11	120831700	120831700	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr11:120831700A>T	ENST00000527524.2	+	17	2244	c.1957A>T	c.(1957-1959)Att>Ttt	p.I653F	GRIK4_ENST00000438375.2_Missense_Mutation_p.I653F	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	653					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GGATGTGCCCATTGAGTCAGT	0.527																																					p.I653F		Atlas-SNP	.											.	GRIK4	149	.	0			c.A1957T						.						139.0	110.0	120.0					11																	120831700		2203	4299	6502	SO:0001583	missense	2900	exon15			GTGCCCATTGAGT	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1957A>T	chr11.hg19:g.120831700A>T	ENSP00000435648:p.Ile653Phe	81.0	0.0		76.0	22.0	NM_014619	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	hg19	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	A	33	5.202808	0.94997	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.64085	-0.08;-0.08	5.51	5.51	0.81932	Ionotropic glutamate receptor (2);	0.047918	0.85682	D	0.000000	T	0.77130	0.4085	M	0.73598	2.24	0.80722	D	1	P;D	0.62365	0.949;0.991	P;D	0.63033	0.722;0.91	T	0.80061	-0.1540	10	0.66056	D	0.02	.	15.3185	0.74102	1.0:0.0:0.0:0.0	.	653;653	A6H8K8;Q16099	.;GRIK4_HUMAN	F	653	ENSP00000435648:I653F;ENSP00000404063:I653F	ENSP00000404063:I653F	I	+	1	0	GRIK4	120336910	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.097000	0.63578	0.533000	0.62120	ATT	.	.		0.527	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
GUCY2C	2984	hgsc.bcm.edu	37	12	14774139	14774139	+	Silent	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:14774139G>T	ENST00000261170.3	-	23	2749	c.2613C>A	c.(2611-2613)atC>atA	p.I871I	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	871	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	ACGCATCACCGATGGTTTCCA	0.443																																					p.I871I		Atlas-SNP	.											GUCY2C,NS,carcinoma,0,1	GUCY2C	126	.	0			c.C2613A						.						184.0	166.0	172.0					12																	14774139		2203	4300	6503	SO:0001819	synonymous_variant	2984	exon23			ATCACCGATGGTT		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.2613C>A	chr12.hg19:g.14774139G>T		127.0	1.0		153.0	46.0	NM_004963	B2RMY6	Silent	SNP	ENST00000261170.3	hg19	CCDS8664.1																																																																																			.	.		0.443	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
ACVR1B	91	hgsc.bcm.edu	37	12	52374782	52374782	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:52374782G>T	ENST00000257963.4	+	4	687	c.610G>T	c.(610-612)Gcc>Tcc	p.A204S	ACVR1B_ENST00000542485.1_Missense_Mutation_p.A152S|ACVR1B_ENST00000541224.1_Missense_Mutation_p.A204S|ACVR1B_ENST00000415850.2_Missense_Mutation_p.A204S|ACVR1B_ENST00000426655.2_Missense_Mutation_p.A204S	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	204	GS. {ECO:0000255|PROSITE- ProRule:PRU00585}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GCGCACAGTGGCCCGAACCAT	0.483											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A204S		Atlas-SNP	.											.	ACVR1B	167	.	0			c.G610T						.						69.0	67.0	68.0					12																	52374782		2203	4300	6503	SO:0001583	missense	91	exon4			ACAGTGGCCCGAA		CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.610G>T	chr12.hg19:g.52374782G>T	ENSP00000257963:p.Ala204Ser	100.0	0.0	984	122.0	34.0	NM_020328	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	hg19	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223236	0.95139	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01	4.94	4.94	0.65067	Protein kinase-like domain (1);TGF beta receptor, GS motif (3);	0.000000	0.85682	D	0.000000	D	0.98969	0.9649	M	0.84082	2.675	0.80722	D	1	D;D;P;P	0.89917	0.965;1.0;0.846;0.703	P;D;D;D	0.97110	0.872;1.0;0.91;0.932	D	0.99790	1.1031	10	0.66056	D	0.02	.	18.5621	0.91104	0.0:0.0:1.0:0.0	.	204;204;204;204	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	S	204;204;204;204;152	ENSP00000257963:A204S;ENSP00000442656:A204S;ENSP00000390477:A204S;ENSP00000397550:A204S;ENSP00000442885:A152S	ENSP00000257963:A204S	A	+	1	0	ACVR1B	50661049	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.460000	0.83146	0.650000	0.86243	GCC	.	.		0.483	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
KRT72	140807	hgsc.bcm.edu	37	12	52979897	52979897	+	Missense_Mutation	SNP	C	C	A	rs34119325	byFrequency	TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:52979897C>A	ENST00000537672.2	-	9	1415	c.1405G>T	c.(1405-1407)Gcc>Tcc	p.A469S	KRT72_ENST00000354310.4_Missense_Mutation_p.A427S|KRT72_ENST00000398066.3_Missense_Mutation_p.A281S|KRT72_ENST00000293745.2_Missense_Mutation_p.A469S	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	469	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		CTGCTTGAGGCGCCAAAGCCC	0.577																																					p.A469S		Atlas-SNP	.											KRT72,colon,carcinoma,0,1	KRT72	70	.	0			c.G1405T						.						69.0	63.0	65.0					12																	52979897		2203	4300	6503	SO:0001583	missense	140807	exon9			TTGAGGCGCCAAA	AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1405G>T	chr12.hg19:g.52979897C>A	ENSP00000441160:p.Ala469Ser	48.0	0.0		71.0	10.0	NM_001146225	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	ENST00000537672.2	hg19	CCDS8833.1	.	.	.	.	.	.	.	.	.	.	C	0.986	-0.695433	0.03303	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	T;T;D;T	0.81908	-1.48;-1.48;-1.55;-1.21	4.18	-3.48	0.04739	.	0.883800	0.09298	N	0.821369	T	0.68769	0.3037	N	0.24115	0.695	0.09310	N	1	B;B	0.16166	0.013;0.016	B;B	0.12837	0.004;0.008	T	0.51260	-0.8728	10	0.28530	T	0.3	.	10.3711	0.44055	0.0:0.3612:0.0:0.6388	.	427;469	B4DEI8;Q14CN4	.;K2C72_HUMAN	S	469;469;427;281	ENSP00000441160:A469S;ENSP00000293745:A469S;ENSP00000346269:A427S;ENSP00000446151:A281S	ENSP00000293745:A469S	A	-	1	0	KRT72	51266164	0.000000	0.05858	0.005000	0.12908	0.029000	0.11900	-1.188000	0.03064	-0.683000	0.05190	-1.538000	0.00913	GCC	.	C|0.996;T|0.004		0.577	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405693.1	NM_080747	
KIAA1033	23325	hgsc.bcm.edu	37	12	105509006	105509006	+	Splice_Site	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:105509006A>T	ENST00000332180.5	+	5	453	c.366A>T	c.(364-366)ggA>ggT	p.G122G		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						ATGGAGAAGGAGGTAAGTTTA	0.259																																					p.G122G		Atlas-SNP	.											.	KIAA1033	83	.	0			c.A366T						.						64.0	59.0	61.0					12																	105509006		1781	4040	5821	SO:0001630	splice_region_variant	23325	exon5			AGAAGGAGGTAAG	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.367+1A>T	chr12.hg19:g.105509006A>T		562.0	1.0		404.0	80.0	NM_015275		Silent	SNP	ENST00000332180.5	hg19	CCDS41826.1																																																																																			.	.		0.259	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	Silent
RAD9B	144715	hgsc.bcm.edu	37	12	110959986	110959986	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr12:110959986G>A	ENST00000409778.3	+	8	712	c.688G>A	c.(688-690)Gat>Aat	p.D230N	RAD9B_ENST00000409246.1_Missense_Mutation_p.D227N|RAD9B_ENST00000409425.1_Missense_Mutation_p.D227N|RAD9B_ENST00000409300.1_Missense_Mutation_p.D299N|RAD9B_ENST00000392672.4_Missense_Mutation_p.D299N			Q6WBX8	RAD9B_HUMAN	RAD9 homolog B (S. pombe)	296					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	checkpoint clamp complex (GO:0030896)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	7						CCTCAGGTCAGATCTGATTGA	0.358																																					p.D299N		Atlas-SNP	.											.	RAD9B	50	.	0			c.G895A						.						23.0	23.0	23.0					12																	110959986		2203	4297	6500	SO:0001583	missense	144715	exon10			AGGTCAGATCTGA		CCDS9148.2, CCDS66469.1, CCDS73526.1, CCDS73527.1	12q24.13	2008-12-15	2008-12-15		ENSG00000151164	ENSG00000151164			21700	protein-coding gene	gene with protein product		608368					Standard	NM_152442		Approved	FLJ40346	uc001trf.4	Q6WBX8	OTTHUMG00000152952	ENST00000409778.3:c.688G>A	chr12.hg19:g.110959986G>A	ENSP00000386697:p.Asp230Asn	126.0	0.0		141.0	33.0	NM_152442	Q5U5K0|Q6NVJ1|Q6ZVT7|Q8N7T9|Q96LI8	Missense_Mutation	SNP	ENST00000409778.3	hg19		.	.	.	.	.	.	.	.	.	.	G	11.40	1.626729	0.28978	.	.	ENSG00000151164	ENST00000409246;ENST00000392672;ENST00000409300;ENST00000409425;ENST00000409778	T;T;T;T;T	0.22336	1.96;2.25;2.28;1.96;2.19	5.33	2.22	0.28083	.	0.542931	0.16309	N	0.220078	T	0.16214	0.0390	L	0.29908	0.895	0.24084	N	0.995938	P;B;B	0.40970	0.734;0.006;0.001	B;B;B	0.40329	0.326;0.002;0.0	T	0.11397	-1.0589	10	0.23302	T	0.38	-1.093	12.7805	0.57474	0.0:0.4768:0.5232:0.0	.	230;299;296	B4DYM6;B4DX60;Q6WBX8	.;.;RAD9B_HUMAN	N	227;299;299;227;230	ENSP00000387329:D227N;ENSP00000376440:D299N;ENSP00000386434:D299N;ENSP00000386629:D227N;ENSP00000386697:D230N	ENSP00000376440:D299N	D	+	1	0	RAD9B	109444369	0.995000	0.38212	0.938000	0.37757	0.706000	0.40770	0.801000	0.27055	0.578000	0.29487	0.561000	0.74099	GAT	.	.		0.358	RAD9B-009	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404634.1	NM_152442	
PCDH9	5101	hgsc.bcm.edu	37	13	66878891	66878891	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:66878891G>A	ENST00000377865.2	-	4	3744	c.3610C>T	c.(3610-3612)Cat>Tat	p.H1204Y	PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.H1170Y|PCDH9_ENST00000456367.1_Missense_Mutation_p.H1170Y|PCDH9_ENST00000544246.1_Missense_Mutation_p.H1204Y			Q9HC56	PCDH9_HUMAN	protocadherin 9	1204					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TTGTTGAAATGGCCTTCATTG	0.493																																					p.H1204Y		Atlas-SNP	.											.	PCDH9	252	.	0			c.C3610T						.						164.0	131.0	142.0					13																	66878891		2203	4300	6503	SO:0001583	missense	5101	exon5			TGAAATGGCCTTC	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3610C>T	chr13.hg19:g.66878891G>A	ENSP00000367096:p.His1204Tyr	345.0	0.0		365.0	82.0	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	hg19	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181698	0.57800	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.56275	0.53;0.53;0.47;0.47	6.05	6.05	0.98169	.	0.000000	0.48767	D	0.000168	T	0.61949	0.2388	N	0.19112	0.55	0.49687	D	0.999814	P;P;P	0.42039	0.659;0.769;0.659	P;P;P	0.61397	0.775;0.888;0.775	T	0.62272	-0.6889	10	0.59425	D	0.04	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	1162;1170;1204	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	Y	1204;1204;1170;1170	ENSP00000442186:H1204Y;ENSP00000367096:H1204Y;ENSP00000401699:H1170Y;ENSP00000332060:H1170Y	ENSP00000332060:H1170Y	H	-	1	0	PCDH9	65776892	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	CAT	.	.		0.493	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
PCDH9	5101	hgsc.bcm.edu	37	13	67800949	67800949	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:67800949C>T	ENST00000377865.2	-	1	1758	c.1624G>A	c.(1624-1626)Gta>Ata	p.V542I	PCDH9_ENST00000377861.3_Missense_Mutation_p.V542I|PCDH9_ENST00000328454.5_Missense_Mutation_p.V542I|PCDH9_ENST00000456367.1_Missense_Mutation_p.V542I|PCDH9_ENST00000544246.1_Missense_Mutation_p.V542I			Q9HC56	PCDH9_HUMAN	protocadherin 9	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CTGGCAGTTACTGTAAAAATG	0.458																																					p.V542I		Atlas-SNP	.											.	PCDH9	252	.	0			c.G1624A						.						86.0	88.0	87.0					13																	67800949		2203	4300	6503	SO:0001583	missense	5101	exon2			CAGTTACTGTAAA	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1624G>A	chr13.hg19:g.67800949C>T	ENSP00000367096:p.Val542Ile	165.0	0.0		141.0	39.0	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	hg19	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536080	0.27475	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	6.08	6.08	0.98989	Cadherin (5);Cadherin-like (1);	0.058936	0.64402	D	0.000002	T	0.30854	0.0778	L	0.35341	1.055	0.58432	D	0.999999	B;B;B;B	0.31581	0.329;0.01;0.058;0.071	B;B;B;B	0.39738	0.308;0.075;0.065;0.173	T	0.02713	-1.1120	10	0.48119	T	0.1	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	542;542;542;542	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	I	542	ENSP00000442186:V542I;ENSP00000367096:V542I;ENSP00000401699:V542I;ENSP00000332060:V542I;ENSP00000367092:V542I	ENSP00000332060:V542I	V	-	1	0	PCDH9	66698950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.970000	0.63742	2.894000	0.99253	0.655000	0.94253	GTA	.	.		0.458	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
FBXL3	26224	hgsc.bcm.edu	37	13	77581424	77581424	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:77581424C>A	ENST00000355619.5	-	5	1467	c.1143G>T	c.(1141-1143)aaG>aaT	p.K381N	FBXL3_ENST00000477982.1_Intron	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	381					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		CACCACACATCTTCACAAACT	0.413																																					p.K381N		Atlas-SNP	.											.	FBXL3	46	.	0			c.G1143T						.						129.0	121.0	124.0					13																	77581424		2203	4300	6503	SO:0001583	missense	26224	exon5			ACACATCTTCACA	AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.1143G>T	chr13.hg19:g.77581424C>A	ENSP00000347834:p.Lys381Asn	94.0	0.0		103.0	7.0	NM_012158	B2RB04|Q9P122	Missense_Mutation	SNP	ENST00000355619.5	hg19	CCDS9457.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981810	0.53827	.	.	ENSG00000005812	ENST00000355619	T	0.54866	0.55	5.88	4.16	0.48862	.	0.000000	0.85682	D	0.000000	T	0.66066	0.2752	L	0.54323	1.7	0.58432	D	0.999994	D	0.76494	0.999	D	0.80764	0.994	T	0.65393	-0.6179	10	0.49607	T	0.09	-12.8698	12.7458	0.57280	0.0:0.8667:0.0:0.1333	.	381	Q9UKT7	FBXL3_HUMAN	N	381	ENSP00000347834:K381N	ENSP00000347834:K381N	K	-	3	2	FBXL3	76479425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.383000	0.34385	0.826000	0.34661	0.655000	0.94253	AAG	.	.		0.413	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045312.3		
SLC10A2	6555	hgsc.bcm.edu	37	13	103701772	103701772	+	Silent	SNP	C	C	T	rs201412654		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr13:103701772C>T	ENST00000245312.3	-	5	1382	c.786G>A	c.(784-786)acG>acA	p.T262T		NM_000452.2	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 2	262			T -> M (in PBAM; abolishes taurocholate transport; dbSNP:rs72547505). {ECO:0000269|PubMed:9109432}.		bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	bile acid:sodium symporter activity (GO:0008508)			breast(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)				Aciclovir(DB00787)|Cyclosporine(DB00091)|Ursodeoxycholic acid(DB01586)|Valaciclovir(DB00577)	TCTGCATCCCCGTTTCAAAAG	0.418																																					p.T262T		Atlas-SNP	.											.	SLC10A2	67	.	0			c.G786A						.						124.0	94.0	104.0					13																	103701772		2203	4300	6503	SO:0001819	synonymous_variant	6555	exon5			CATCCCCGTTTCA	U10417	CCDS9506.1	13q33	2013-07-18	2013-07-18		ENSG00000125255	ENSG00000125255		"""Solute carriers"""	10906	protein-coding gene	gene with protein product		601295		ASBT, ISBT		8661017	Standard	NM_000452		Approved		uc001vpy.4	Q12908	OTTHUMG00000017313	ENST00000245312.3:c.786G>A	chr13.hg19:g.103701772C>T		90.0	0.0		106.0	28.0	NM_000452	A1L4F4|Q13839	Silent	SNP	ENST00000245312.3	hg19	CCDS9506.1																																																																																			.	.		0.418	SLC10A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045716.1		
SLC22A17	51310	hgsc.bcm.edu	37	14	23816360	23816360	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:23816360G>A	ENST00000206544.8	-	8	1614	c.1278C>T	c.(1276-1278)gcC>gcT	p.A426A	SLC22A17_ENST00000354772.3_Silent_p.A408A|SLC22A17_ENST00000474057.1_5'UTR|SLC22A17_ENST00000397260.3_Silent_p.A297A|SLC22A17_ENST00000397267.1_Silent_p.A426A	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	426					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TGAGGATGGCGGCAGCTTGGG	0.632																																					p.A426A		Atlas-SNP	.											.	SLC22A17	32	.	0			c.C1278T						.						71.0	55.0	60.0					14																	23816360		2203	4300	6503	SO:0001819	synonymous_variant	51310	exon8			GATGGCGGCAGCT	AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1278C>T	chr14.hg19:g.23816360G>A		70.0	0.0		71.0	24.0	NM_020372	A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Silent	SNP	ENST00000206544.8	hg19	CCDS9593.1																																																																																			.	.		0.632	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157223.3	NM_020372	
AKAP6	9472	hgsc.bcm.edu	37	14	33293092	33293092	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:33293092A>G	ENST00000280979.4	+	13	6243	c.6073A>G	c.(6073-6075)Aac>Gac	p.N2025D	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2025					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ACTTGAACAAAACGGAACAGA	0.423																																					p.N2025D	Melanoma(49;821 1200 7288 13647 42351)	Atlas-SNP	.											.	AKAP6	308	.	0			c.A6073G						.						89.0	85.0	86.0					14																	33293092		2203	4300	6503	SO:0001583	missense	9472	exon13			GAACAAAACGGAA	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6073A>G	chr14.hg19:g.33293092A>G	ENSP00000280979:p.Asn2025Asp	32.0	0.0		36.0	8.0	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	hg19	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.085351	0.55861	.	.	ENSG00000151320	ENST00000280979	T	0.06068	3.35	6.11	6.11	0.99139	.	0.298172	0.35495	N	0.003170	T	0.09158	0.0226	L	0.60455	1.87	0.80722	D	1	P	0.34462	0.454	B	0.27262	0.078	T	0.02294	-1.1181	10	0.72032	D	0.01	-12.7363	15.2732	0.73723	1.0:0.0:0.0:0.0	.	2025	Q13023	AKAP6_HUMAN	D	2025	ENSP00000280979:N2025D	ENSP00000280979:N2025D	N	+	1	0	AKAP6	32362843	0.244000	0.23889	0.920000	0.36463	0.814000	0.46013	2.643000	0.46604	2.343000	0.79666	0.533000	0.62120	AAC	.	.		0.423	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
JKAMP	51528	hgsc.bcm.edu	37	14	59965466	59965466	+	Nonsense_Mutation	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:59965466T>G	ENST00000261247.9	+	5	627	c.480T>G	c.(478-480)taT>taG	p.Y160*	RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000356057.5_Nonsense_Mutation_p.Y168*|JKAMP_ENST00000425728.2_Nonsense_Mutation_p.Y154*|JKAMP_ENST00000554271.1_Nonsense_Mutation_p.Y174*	NM_001098625.1|NM_001284203.1|NM_016475.3	NP_001092095.1|NP_001271132.1|NP_057559.2	Q9P055	JKAMP_HUMAN	JNK1/MAPK8-associated membrane protein	175					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|kidney(1)|lung(3)	6						TATTTATCTATTACGCATTCT	0.284																																					p.Y160X		Atlas-SNP	.											.	JKAMP	49	.	0			c.T480G						.						68.0	60.0	63.0					14																	59965466		1810	4074	5884	SO:0001587	stop_gained	51528	exon5			TATCTATTACGCA	AF212245	CCDS45116.1, CCDS45117.1, CCDS61462.1, CCDS61463.1	14q22.3	2014-02-14	2009-08-13	2009-08-13	ENSG00000050130	ENSG00000050130			20184	protein-coding gene	gene with protein product	"""Jun N-terminal kinase 1-associated membrane protein"""	611176	"""chromosome 14 open reading frame 100"""	C14orf100		16166642, 19269966	Standard	NM_001284202		Approved	HSPC213, JAMP, HSPC327, CDA06	uc001xef.4	Q9P055	OTTHUMG00000171054	ENST00000261247.9:c.480T>G	chr14.hg19:g.59965466T>G	ENSP00000261247:p.Tyr160*	140.0	0.0		108.0	29.0	NM_016475	B4DP67|Q6FIB6|Q6IAJ2|Q7Z5D4|Q86SY6|Q9H0Q6|Q9H2W0|Q9HAH5|Q9P0R3	Nonsense_Mutation	SNP	ENST00000261247.9	hg19	CCDS45116.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552834	0.65425	.	.	ENSG00000050130	ENST00000261247;ENST00000425728;ENST00000554271;ENST00000554795;ENST00000356057	.	.	.	5.5	-1.27	0.09347	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-52.5972	10.7707	0.46321	0.0:0.4043:0.0:0.5957	.	.	.	.	X	160;154;174;168;168	.	ENSP00000261247:Y160X	Y	+	3	2	JKAMP	59035219	0.995000	0.38212	0.995000	0.50966	0.988000	0.76386	0.369000	0.20416	-0.137000	0.11455	0.533000	0.62120	TAT	.	.		0.284	JKAMP-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411430.1	NM_001098625	
ELMSAN1	91748	hgsc.bcm.edu	37	14	74189521	74189521	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:74189521C>T	ENST00000286523.5	-	10	3386	c.2604G>A	c.(2602-2604)gtG>gtA	p.V868V	ELMSAN1_ENST00000394071.2_Silent_p.V868V	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	868	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										AGTAGAACTCCACGCACTGGG	0.527																																					p.V868V		Atlas-SNP	.											.	.	.	.	0			c.G2604A						.						225.0	204.0	212.0					14																	74189521		2203	4300	6503	SO:0001819	synonymous_variant	91748	exon10			GAACTCCACGCAC	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.2604G>A	chr14.hg19:g.74189521C>T		87.0	0.0		116.0	36.0	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Silent	SNP	ENST00000286523.5	hg19	CCDS9819.1																																																																																			.	.		0.527	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
NRDE2	55051	hgsc.bcm.edu	37	14	90764607	90764607	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:90764607G>T	ENST00000354366.3	-	8	1895	c.1663C>A	c.(1663-1665)Cca>Aca	p.P555T	NRDE2_ENST00000357904.3_Missense_Mutation_p.P324T	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	555																	GACTTACCTGGGTTGATGACC	0.498																																					p.P555T		Atlas-SNP	.											.	.	.	.	0			c.C1663A						.						94.0	89.0	91.0					14																	90764607		2203	4300	6503	SO:0001583	missense	55051	exon8			TACCTGGGTTGAT	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.1663C>A	chr14.hg19:g.90764607G>T	ENSP00000346335:p.Pro555Thr	29.0	0.0		52.0	10.0	NM_017970	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	ENST00000354366.3	hg19	CCDS9890.1	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765351	0.31228	.	.	ENSG00000119720	ENST00000354366;ENST00000357904;ENST00000554464	T;T	0.34667	1.35;1.35	5.58	4.68	0.58851	.	0.478879	0.22197	N	0.063287	T	0.30792	0.0776	L	0.45581	1.43	0.35821	D	0.824573	B	0.19445	0.036	B	0.24006	0.05	T	0.29058	-1.0024	10	0.25106	T	0.35	.	9.927	0.41498	0.0722:0.14:0.7878:0.0	.	555	Q9H7Z3	CN102_HUMAN	T	555;324;134	ENSP00000346335:P555T;ENSP00000350579:P324T	ENSP00000346335:P555T	P	-	1	0	C14orf102	89834360	1.000000	0.71417	0.878000	0.34440	0.848000	0.48234	4.195000	0.58400	1.341000	0.45600	0.455000	0.32223	CCA	.	.		0.498	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411264.1	NM_017970	
APOPT1	84334	hgsc.bcm.edu	37	14	104040498	104040498	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr14:104040498A>G	ENST00000409074.2	+	3	416	c.415A>G	c.(415-417)Act>Gct	p.T139A	RP11-73M18.2_ENST00000472726.2_Missense_Mutation_p.T139A|APOPT1_ENST00000556253.2_Missense_Mutation_p.T126A|AL139300.1_ENST00000583855.1_RNA|APOPT1_ENST00000477116.1_3'UTR|APOPT1_ENST00000247618.4_Missense_Mutation_p.T126A	NM_032374.3	NP_115750.2	Q96IL0	APOP1_HUMAN	apoptogenic 1, mitochondrial	139					intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)	mitochondrion (GO:0005739)											GGGCCTGAGAACTGAATCAGG	0.368																																					p.T139A		Atlas-SNP	.											.	.	.	.	0			c.A415G						.						211.0	213.0	212.0					14																	104040498		2203	4300	6503	SO:0001583	missense	84334	exon3			CTGAGAACTGAAT	BC007412	CCDS9983.2	14q32.33	2012-06-28	2012-06-28	2011-09-07	ENSG00000256053	ENSG00000256053			20492	protein-coding gene	gene with protein product	"""apoptogenic protein 1"""		"""chromosome 14 open reading frame 153"", ""apoptogenic 1"""	C14orf153		16782708, 18977203	Standard	NM_032374		Approved	MGC2562, APOP-1		Q96IL0	OTTHUMG00000153929	ENST00000409074.2:c.415A>G	chr14.hg19:g.104040498A>G	ENSP00000386485:p.Thr139Ala	621.0	0.0		587.0	149.0	NM_032374	Q53G28	Missense_Mutation	SNP	ENST00000409074.2	hg19	CCDS9983.2	.	.	.	.	.	.	.	.	.	.	A	12.01	1.808741	0.31961	.	.	ENSG00000256053;ENSG00000256053;ENSG00000256500;ENSG00000256500	ENST00000409074;ENST00000495778;ENST00000472726;ENST00000247618	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.97	-9.11	0.00711	.	0.408897	0.24889	N	0.034789	T	0.15739	0.0379	L	0.27053	0.805	0.09310	N	0.999995	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.19943	-1.0290	10	0.15066	T	0.55	.	2.2292	0.03992	0.4662:0.0966:0.2414:0.1957	.	139;139	E7EVH7;Q96IL0	.;APOP1_HUMAN	A	139;101;139;126	ENSP00000386485:T139A;ENSP00000451703:T101A;ENSP00000439065:T139A;ENSP00000247618:T126A	ENSP00000247618:T126A	T	+	1	0	C14orf153;RP11-73M18.2	103110251	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-0.557000	0.05985	-2.387000	0.00589	0.533000	0.62120	ACT	.	.		0.368	APOPT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333060.2	NM_032374	
FMN1	342184	hgsc.bcm.edu	37	15	33359250	33359250	+	Intron	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr15:33359250C>A	ENST00000559047.1	-	3	2043				FMN1_ENST00000334528.9_Missense_Mutation_p.G279V|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000561249.1_Intron|FMN1_ENST00000558197.1_Missense_Mutation_p.G279V			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CACACGAAGCCCACTGAAAAA	0.468																																					p.G279V		Atlas-SNP	.											.	FMN1	174	.	0			c.G836T						.						59.0	60.0	60.0					15																	33359250		1889	4125	6014	SO:0001627	intron_variant	342184	exon1			CGAAGCCCACTGA	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-1975G>T	chr15.hg19:g.33359250C>A		109.0	0.0		125.0	25.0	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.00	2.999301	0.54147	.	.	ENSG00000248905	ENST00000334528	T	0.61158	0.13	5.59	4.66	0.58398	.	.	.	.	.	T	0.76884	0.4050	.	.	.	.	.	.	D;D	0.69078	0.997;0.997	D;D	0.71184	0.972;0.963	T	0.82032	-0.0658	7	0.87932	D	0	.	16.3782	0.83418	0.0:0.8679:0.1321:0.0	.	279;279	Q68DA7-3;Q68DA7-5	.;.	V	279	ENSP00000333950:G279V	ENSP00000333950:G279V	G	-	2	0	FMN1	31146542	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.983000	0.76180	1.340000	0.45581	0.655000	0.94253	GGG	.	.		0.468	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
IQGAP1	8826	hgsc.bcm.edu	37	15	91017734	91017734	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr15:91017734C>T	ENST00000268182.5	+	23	2717	c.2593C>T	c.(2593-2595)Cct>Tct	p.P865S	IQGAP1_ENST00000560020.1_3'UTR|IQGAP1_ENST00000560738.1_Missense_Mutation_p.P293S	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	865					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TGAGGATCCTCCTATGGTTGT	0.433																																					p.P865S		Atlas-SNP	.											.	IQGAP1	140	.	0			c.C2593T						.						98.0	98.0	98.0					15																	91017734		2198	4298	6496	SO:0001583	missense	8826	exon23			GATCCTCCTATGG	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.2593C>T	chr15.hg19:g.91017734C>T	ENSP00000268182:p.Pro865Ser	92.0	0.0		101.0	28.0	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	hg19	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601469	0.87055	.	.	ENSG00000140575	ENST00000268182	T	0.02974	4.09	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.12475	0.0303	M	0.63169	1.94	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.04041	-1.0982	10	0.32370	T	0.25	-15.6881	17.2199	0.86954	0.0:1.0:0.0:0.0	.	865	P46940	IQGA1_HUMAN	S	865	ENSP00000268182:P865S	ENSP00000268182:P865S	P	+	1	0	IQGAP1	88818738	1.000000	0.71417	0.984000	0.44739	0.997000	0.91878	5.781000	0.68964	2.606000	0.88127	0.591000	0.81541	CCT	.	.		0.433	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
TAT	6898	hgsc.bcm.edu	37	16	71606499	71606499	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr16:71606499A>G	ENST00000355962.4	-	5	634	c.501T>C	c.(499-501)ccT>ccC	p.P167P	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	167					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	GAGAGAAACCAGGTCTTGGAA	0.443																																					p.P167P	Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)	Atlas-SNP	.											.	TAT	80	.	0			c.T501C						.						85.0	82.0	83.0					16																	71606499		2198	4300	6498	SO:0001819	synonymous_variant	6898	exon5			GAAACCAGGTCTT		CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.501T>C	chr16.hg19:g.71606499A>G		122.0	0.0		109.0	24.0	NM_000353	B2R8I1|D3DWS2	Silent	SNP	ENST00000355962.4	hg19	CCDS10903.1																																																																																			.	.		0.443	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1		
SREBF1	6720	hgsc.bcm.edu	37	17	17719659	17719659	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:17719659G>A	ENST00000261646.5	-	11	2260	c.2076C>T	c.(2074-2076)gcC>gcT	p.A692A	SREBF1_ENST00000395757.1_Silent_p.A438A|SREBF1_ENST00000583732.1_5'Flank|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000355815.4_Silent_p.A722A|SREBF1_ENST00000338854.5_Silent_p.A692A	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	692					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CCAGGTTGGTGGCAGTGAGGT	0.662																																					p.A722A		Atlas-SNP	.											.	SREBF1	47	.	0			c.C2166T						.						29.0	18.0	22.0					17																	17719659		2192	4297	6489	SO:0001819	synonymous_variant	6720	exon12			GTTGGTGGCAGTG	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2076C>T	chr17.hg19:g.17719659G>A		15.0	0.0		20.0	11.0	NM_001005291	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Silent	SNP	ENST00000261646.5	hg19	CCDS11189.1	.	.	.	.	.	.	.	.	.	.	G	11.50	1.658616	0.29515	.	.	ENSG00000072310	ENST00000395751	.	.	.	5.4	1.54	0.23209	.	.	.	.	.	T	0.55481	0.1923	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44605	-0.9317	4	.	.	.	-10.3203	7.9803	0.30179	0.4089:0.0:0.5911:0.0	.	.	.	.	Y	700	.	.	H	-	1	0	SREBF1	17660384	0.748000	0.28294	0.979000	0.43373	0.926000	0.56050	0.563000	0.23547	0.040000	0.15660	0.561000	0.74099	CAC	.	.		0.662	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131771.1	NM_004176	
RAB34	83871	hgsc.bcm.edu	37	17	27038628	27038628	+	IGR	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:27038628G>T	ENST00000395245.3	-	0	1736				PROCA1_ENST00000439862.3_5'Flank|PROCA1_ENST00000581289.1_Silent_p.T17T|PROCA1_ENST00000579650.1_5'Flank|PROCA1_ENST00000301039.2_Silent_p.T17T	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family						antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					CCTTGGGCTCGGTCTTTTCCT	0.642																																					p.T17T	Pancreas(175;216 2049 29940 32498 41589)	Atlas-SNP	.											.	PROCA1	28	.	0			c.C51A						.						117.0	99.0	105.0					17																	27038628		2203	4300	6503	SO:0001628	intergenic_variant	147011	exon1			GGGCTCGGTCTTT	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680		chr17.hg19:g.27038628G>T		64.0	0.0		82.0	18.0	NM_152465	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Silent	SNP	ENST00000395245.3	hg19	CCDS11240.1																																																																																			.	.		0.642	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345906.1	NM_031934	
AKAP1	8165	hgsc.bcm.edu	37	17	55187484	55187484	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:55187484G>T	ENST00000337714.3	+	3	2046	c.1813G>T	c.(1813-1815)Gtc>Ttc	p.V605F	AKAP1_ENST00000539273.1_Missense_Mutation_p.V605F|AKAP1_ENST00000571629.1_Missense_Mutation_p.V605F|AKAP1_ENST00000572557.1_Missense_Mutation_p.V605F	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	605					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					CCCTAAGAAGGTCGACCTCAT	0.567																																					p.V605F		Atlas-SNP	.											.	AKAP1	73	.	0			c.G1813T						.						94.0	91.0	92.0					17																	55187484		2203	4300	6503	SO:0001583	missense	8165	exon4			AAGAAGGTCGACC	X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.1813G>T	chr17.hg19:g.55187484G>T	ENSP00000337736:p.Val605Phe	59.0	0.0		60.0	17.0	NM_001242902	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	ENST00000337714.3	hg19	CCDS11594.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.498453	0.64298	.	.	ENSG00000121057	ENST00000337714;ENST00000427138;ENST00000539273	T;T	0.63255	-0.03;-0.03	5.18	5.18	0.71444	.	0.235917	0.34802	N	0.003673	T	0.60353	0.2262	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	P	0.59221	0.854	T	0.63386	-0.6649	10	0.56958	D	0.05	-23.2636	10.6762	0.45787	0.0:0.1414:0.7122:0.1464	.	605	Q92667	AKAP1_HUMAN	F	605;647;605	ENSP00000337736:V605F;ENSP00000443139:V605F	ENSP00000337736:V605F	V	+	1	0	AKAP1	52542483	0.998000	0.40836	1.000000	0.80357	0.970000	0.65996	1.354000	0.34056	2.426000	0.82243	0.655000	0.94253	GTC	.	.		0.567	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277069.1		
CACNG4	27092	hgsc.bcm.edu	37	17	65026740	65026740	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:65026740G>T	ENST00000262138.3	+	4	606	c.604G>T	c.(604-606)Gct>Tct	p.A202S	RP11-74H8.1_ENST00000579138.1_RNA|AC005544.1_ENST00000375684.1_5'Flank	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	202					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GGGCGTCCTGGCTGTAAACAT	0.453																																					p.A202S		Atlas-SNP	.											.	CACNG4	44	.	0			c.G604T						.						86.0	83.0	84.0					17																	65026740		2203	4300	6503	SO:0001583	missense	27092	exon4			GTCCTGGCTGTAA	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.604G>T	chr17.hg19:g.65026740G>T	ENSP00000262138:p.Ala202Ser	73.0	0.0		77.0	28.0	NM_014405	B2RCK0	Missense_Mutation	SNP	ENST00000262138.3	hg19	CCDS11667.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383831	0.61845	.	.	ENSG00000075461	ENST00000262138	D	0.89415	-2.51	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.92328	0.7566	L	0.59436	1.845	0.58432	D	0.999998	D	0.63880	0.993	D	0.75484	0.986	D	0.89747	0.3937	10	0.16420	T	0.52	-1.7597	16.3423	0.83085	0.0:0.0:1.0:0.0	.	202	Q9UBN1	CCG4_HUMAN	S	202	ENSP00000262138:A202S	ENSP00000262138:A202S	A	+	1	0	CACNG4	62457202	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.314000	0.96306	2.285000	0.76669	0.556000	0.70494	GCT	.	.		0.453	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
ANKRD30B	374860	hgsc.bcm.edu	37	18	14850260	14850260	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr18:14850260T>C	ENST00000358984.4	+	35	3266	c.3086T>C	c.(3085-3087)tTa>tCa	p.L1029S		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1029										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GTCGATATATTAAAAGAAAAA	0.279																																					p.L1029S		Atlas-SNP	.											.	ANKRD30B	237	.	0			c.T3086C						.						50.0	44.0	45.0					18																	14850260		692	1577	2269	SO:0001583	missense	374860	exon35			ATATATTAAAAGA	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3086T>C	chr18.hg19:g.14850260T>C	ENSP00000351875:p.Leu1029Ser	406.0	0.0		348.0	80.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	ENST00000358984.4	hg19	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	T	7.085	0.570913	0.13623	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.39406	1.08	1.48	1.48	0.22813	.	.	.	.	.	T	0.52108	0.1714	M	0.79258	2.445	0.46241	D	0.998947	D;D	0.69078	0.997;0.995	P;P	0.54889	0.697;0.763	T	0.56414	-0.7983	9	0.87932	D	0	.	7.0503	0.25069	0.0:0.0:0.0:1.0	.	1114;1029	Q9BXX2;F8WAG3	AN30B_HUMAN;.	S	1029;423;449	ENSP00000351875:L1029S	ENSP00000277669:L449S	L	+	2	0	ANKRD30B	14840260	0.031000	0.19500	0.055000	0.19348	0.066000	0.16364	1.168000	0.31859	0.941000	0.37499	0.145000	0.16022	TTA	.	.		0.279	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
SMIM24	284422	hgsc.bcm.edu	37	19	3474916	3474916	+	Silent	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:3474916T>G	ENST00000215531.4	-	4	396	c.318A>C	c.(316-318)ggA>ggC	p.G106G	C19orf77_ENST00000591708.1_Silent_p.G36G|C19orf77_ENST00000587847.1_Silent_p.G36G	NM_001136503.1	NP_001129975.1	O75264	SIM24_HUMAN		106						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											AGTTGCtctctccttcctttg	0.498																																					p.G106G		Atlas-SNP	.											.	C19orf77	6	.	0			c.A318C						.						166.0	147.0	153.0					19																	3474916		692	1591	2283	SO:0001819	synonymous_variant	284422	exon4			GCTCTCTCCTTCC																												ENST00000215531.4:c.318A>C	chr19.hg19:g.3474916T>G		254.0	0.0		227.0	68.0	NM_001136503	B9EJF4|Q9P059	Silent	SNP	ENST00000215531.4	hg19	CCDS45915.1																																																																																			.	.		0.498	C19orf77-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452929.1		
SAFB	6294	hgsc.bcm.edu	37	19	5653399	5653399	+	Silent	SNP	C	C	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:5653399C>T	ENST00000292123.5	+	11	1601	c.1494C>T	c.(1492-1494)gaC>gaT	p.D498D	SAFB_ENST00000592224.1_Silent_p.D498D|SAFB_ENST00000433404.1_Silent_p.D328D|SAFB_ENST00000454510.1_Silent_p.D429D|SAFB_ENST00000588852.1_Silent_p.D498D|SAFB_ENST00000538656.1_Silent_p.D341D	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	498					chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GAGACAGTGACGGGAAAAAGG	0.423																																					p.D498D	Colon(88;338 1345 6184 8214 20897)	Atlas-SNP	.											.	SAFB	74	.	0			c.C1494T						.						57.0	54.0	55.0					19																	5653399		2203	4300	6503	SO:0001819	synonymous_variant	6294	exon11			CAGTGACGGGAAA	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.1494C>T	chr19.hg19:g.5653399C>T		142.0	0.0		189.0	53.0	NM_002967	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Silent	SNP	ENST00000292123.5	hg19	CCDS12142.1																																																																																			.	.		0.423	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451641.2		
TNFSF14	8740	hgsc.bcm.edu	37	19	6670048	6670048	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:6670048A>G	ENST00000599359.1	-	2	414	c.33T>C	c.(31-33)ttT>ttC	p.F11F	TNFSF14_ENST00000245912.3_Silent_p.F11F|TNFSF14_ENST00000326176.9_Silent_p.F11F			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	11					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						CATCCACCACAAACACTGAGG	0.602																																					p.F11F		Atlas-SNP	.											.	TNFSF14	40	.	0			c.T33C						.						117.0	90.0	99.0					19																	6670048		2203	4300	6503	SO:0001819	synonymous_variant	8740	exon2			CACCACAAACACT	AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.33T>C	chr19.hg19:g.6670048A>G		93.0	0.0		86.0	25.0	NM_003807	A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Silent	SNP	ENST00000599359.1	hg19	CCDS12171.1																																																																																			.	.		0.602	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457863.1		
ELAVL1	1994	hgsc.bcm.edu	37	19	8038704	8038704	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:8038704C>A	ENST00000407627.2	-	4	464	c.335G>T	c.(334-336)gGg>gTg	p.G112V	ELAVL1_ENST00000351593.5_Missense_Mutation_p.G139V|ELAVL1_ENST00000593807.1_Missense_Mutation_p.G112V|ELAVL1_ENST00000596459.1_Missense_Mutation_p.G112V	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	112	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						CCGCGGGAGCCCGCTGATGTA	0.557																																					p.G112V		Atlas-SNP	.											.	ELAVL1	44	.	0			c.G335T						.						152.0	117.0	129.0					19																	8038704		2203	4300	6503	SO:0001583	missense	1994	exon4			GGGAGCCCGCTGA	U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.335G>T	chr19.hg19:g.8038704C>A	ENSP00000385269:p.Gly112Val	120.0	0.0		125.0	38.0	NM_001419	B4DVB8|Q53XN6|Q9BTT1	Missense_Mutation	SNP	ENST00000407627.2	hg19	CCDS12193.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782162	0.90282	.	.	ENSG00000066044	ENST00000407627;ENST00000351593	T;T	0.08896	3.04;3.04	5.0	5.0	0.66597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60058	-0.7337	10	0.87932	D	0	.	15.8573	0.78989	0.0:1.0:0.0:0.0	.	112	Q15717	ELAV1_HUMAN	V	112;139	ENSP00000385269:G112V;ENSP00000264073:G139V	ENSP00000264073:G139V	G	-	2	0	ELAVL1	7944704	1.000000	0.71417	0.965000	0.40720	0.925000	0.55904	7.517000	0.81783	2.595000	0.87683	0.655000	0.94253	GGG	.	.		0.557	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461494.3	NM_001419	
ZNF812	729648	hgsc.bcm.edu	37	19	9801514	9801514	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:9801514T>C	ENST00000457674.2	-	5	1183	c.665A>G	c.(664-666)aAg>aGg	p.K222R	ZNF812_ENST00000536819.1_5'UTR	NM_001199814.1	NP_001186743.1	P0C7V5	ZN812_HUMAN	zinc finger protein 812	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1						TTTCTTAGTCTTTTTAGATTT	0.363																																					p.K222R		Atlas-SNP	.											.	ZNF812	27	.	0			c.A665G						.																																			SO:0001583	missense	729648	exon6			TTAGTCTTTTTAG		CCDS54215.1	19p13.2	2014-04-02			ENSG00000224689	ENSG00000224689		"""Zinc fingers, C2H2-type"", ""-"""	33242	protein-coding gene	gene with protein product							Standard	NM_001199814		Approved		uc021uop.1	P0C7V5	OTTHUMG00000167867	ENST00000457674.2:c.665A>G	chr19.hg19:g.9801514T>C	ENSP00000395629:p.Lys222Arg	98.0	0.0		84.0	23.0	NM_001199814		Missense_Mutation	SNP	ENST00000457674.2	hg19	CCDS54215.1	.	.	.	.	.	.	.	.	.	.	t	7.673	0.687299	0.14973	.	.	ENSG00000224689	ENST00000457674	T	0.16324	2.35	1.42	0.235	0.15431	.	.	.	.	.	T	0.10423	0.0255	L	0.39245	1.2	0.09310	N	1	P	0.42871	0.792	B	0.35182	0.197	T	0.22103	-1.0226	9	0.66056	D	0.02	.	2.2527	0.04047	0.2869:0.0:0.2903:0.4228	.	222	P0C7V5	ZN812_HUMAN	R	222	ENSP00000395629:K222R	ENSP00000395629:K222R	K	-	2	0	ZNF812	9662514	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.731000	0.04909	-0.004000	0.14419	0.164000	0.16699	AAG	.	.		0.363	ZNF812-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396726.1		
MAN2B1	4125	hgsc.bcm.edu	37	19	12776599	12776599	+	Silent	SNP	C	C	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:12776599C>G	ENST00000456935.2	-	2	220	c.180G>C	c.(178-180)ccG>ccC	p.P60P	WDR83_ENST00000418543.3_5'Flank|MAN2B1_ENST00000221363.4_Silent_p.P60P|CTD-2192J16.24_ENST00000597961.1_Silent_p.P57P	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	60					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TCAGCATGTTCGGCTGCACTG	0.547																																					p.P60P		Atlas-SNP	.											MAN2B1,colon,carcinoma,0,1	MAN2B1	91	.	0			c.G180C						.						119.0	91.0	100.0					19																	12776599		2203	4300	6503	SO:0001819	synonymous_variant	4125	exon2			CATGTTCGGCTGC		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.180G>C	chr19.hg19:g.12776599C>G		67.0	1.0		100.0	33.0	NM_001173498	G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	ENST00000456935.2	hg19	CCDS32919.1																																																																																			.	.		0.547	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344062.1		
FPR3	2359	hgsc.bcm.edu	37	19	52327451	52327451	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:52327451G>C	ENST00000339223.4	+	2	629	c.450G>C	c.(448-450)tgG>tgC	p.W150C	FPR3_ENST00000595991.1_Missense_Mutation_p.W150C	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	150					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)			NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						CGGGACTCTGGATTTTCACCA	0.478																																					p.W150C		Atlas-SNP	.											.	FPR3	66	.	0			c.G450C						.						103.0	91.0	95.0					19																	52327451		2203	4300	6503	SO:0001583	missense	2359	exon2			ACTCTGGATTTTC		CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.450G>C	chr19.hg19:g.52327451G>C	ENSP00000341821:p.Trp150Cys	141.0	0.0		162.0	11.0	NM_002030		Missense_Mutation	SNP	ENST00000339223.4	hg19	CCDS12841.1	.	.	.	.	.	.	.	.	.	.	.	13.33	2.206216	0.39003	.	.	ENSG00000187474	ENST00000339223	D	0.88818	-2.43	2.34	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.96269	0.8783	H	0.98901	4.365	0.48236	D	0.999612	D	0.89917	1.0	D	0.97110	1.0	D	0.95907	0.8920	10	0.87932	D	0	.	10.3497	0.43927	0.0:0.0:1.0:0.0	.	150	P25089	FPR3_HUMAN	C	150	ENSP00000341821:W150C	ENSP00000341821:W150C	W	+	3	0	FPR3	57019263	1.000000	0.71417	0.027000	0.17364	0.052000	0.14988	6.278000	0.72614	1.323000	0.45263	0.467000	0.42956	TGG	.	.		0.478	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466914.1	NM_002030	
ZNF28	7576	hgsc.bcm.edu	37	19	53304147	53304147	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr19:53304147A>T	ENST00000457749.2	-	4	1070	c.951T>A	c.(949-951)caT>caA	p.H317Q	ZNF28_ENST00000360272.4_Missense_Mutation_p.H264Q|ZNF28_ENST00000438150.2_Missense_Mutation_p.H264Q|ZNF28_ENST00000414252.2_Missense_Mutation_p.H264Q	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	317					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		AAATTATCTTATGTGTTTCAA	0.368																																					p.H317Q		Atlas-SNP	.											.	ZNF28	191	.	0			c.T951A						.						118.0	120.0	120.0					19																	53304147		2203	4300	6503	SO:0001583	missense	7576	exon4			TATCTTATGTGTT	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.951T>A	chr19.hg19:g.53304147A>T	ENSP00000397693:p.His317Gln	112.0	0.0		116.0	27.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	hg19	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	12.71	2.020112	0.35606	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	D;D;D;D;D	0.99974	-10.2;-10.2;-10.2;-10.2;-10.2	1.47	0.341	0.15991	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.99972	0.9991	H	0.95504	3.68	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	D	0.97983	1.0350	9	0.87932	D	0	.	5.3348	0.15951	0.828:0.0:0.172:0.0	.	317	P17035	ZNF28_HUMAN	Q	264;317;264;264;264	ENSP00000412143:H264Q;ENSP00000397693:H317Q;ENSP00000353410:H264Q;ENSP00000444965:H264Q;ENSP00000375661:H264Q	ENSP00000353410:H264Q	H	-	3	2	ZNF28	57995959	0.002000	0.14202	0.001000	0.08648	0.022000	0.10575	-0.269000	0.08596	-0.119000	0.11830	0.156000	0.16432	CAT	.	.		0.368	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
PXMP4	11264	hgsc.bcm.edu	37	20	32298387	32298387	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr20:32298387C>A	ENST00000409299.3	-	3	441	c.349G>T	c.(349-351)Gga>Tga	p.G117*	PXMP4_ENST00000217398.3_Missense_Mutation_p.L123F|PXMP4_ENST00000344022.3_Intron	NM_007238.4	NP_009169.3	Q9Y6I8	PXMP4_HUMAN	peroxisomal membrane protein 4, 24kDa	117						integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|large_intestine(2)|lung(8)	13						TTGTTTTCTCCAAACACCAGG	0.577																																					p.G117X		Atlas-SNP	.											.	PXMP4	20	.	0			c.G349T						.						128.0	116.0	120.0					20																	32298387		2203	4300	6503	SO:0001587	stop_gained	11264	exon3			TTTCTCCAAACAC	AF072864	CCDS13225.1, CCDS13226.1	20q11.22	2008-07-02	2002-08-29		ENSG00000101417	ENSG00000101417			15920	protein-coding gene	gene with protein product	"""24 kDa peroxisomal intrinsic membrane protein"""		"""peroxisomal membrane protein 4 (24kD)"""			10366717	Standard	NM_183397		Approved	PMP24	uc002wzv.3	Q9Y6I8	OTTHUMG00000032273	ENST00000409299.3:c.349G>T	chr20.hg19:g.32298387C>A	ENSP00000386385:p.Gly117*	161.0	0.0		163.0	40.0	NM_007238	A2A2I7|Q9H0T4	Nonsense_Mutation	SNP	ENST00000409299.3	hg19	CCDS13225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.5|29.5	5.009587|5.009587	0.93346|0.93346	.|.	.|.	ENSG00000101417|ENSG00000101417	ENST00000409299|ENST00000217398	.|.	.|.	.|.	5.15|5.15	1.96|1.96	0.26148|0.26148	.|.	0.217610|.	0.47852|.	D|.	0.000215|.	.|T	.|0.62841	.|0.2461	.|.	.|.	.|.	0.26785|0.26785	N|N	0.969518|0.969518	.|D	.|0.76494	.|0.999	.|D	.|0.66979	.|0.948	.|T	.|0.53436	.|-0.8439	.|7	0.62326|0.66056	D|D	0.03|0.02	0.4395|0.4395	9.2112|9.2112	0.37320|0.37320	0.0:0.7447:0.0:0.2553|0.0:0.7447:0.0:0.2553	.|.	.|123	.|B4DWH1	.|.	X|F	117|123	.|.	ENSP00000386385:G117X|ENSP00000217398:L123F	G|L	-|-	1|3	0|2	PXMP4|PXMP4	31762048|31762048	0.998000|0.998000	0.40836|0.40836	0.785000|0.785000	0.31869|0.31869	0.928000|0.928000	0.56348|0.56348	0.734000|0.734000	0.26101|0.26101	0.127000|0.127000	0.18452|0.18452	0.609000|0.609000	0.83330|0.83330	GGA|TTG	.	.		0.577	PXMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078739.2	NM_007238	
NFATC2	4773	hgsc.bcm.edu	37	20	50092056	50092056	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr20:50092056T>G	ENST00000396009.3	-	4	1693	c.1474A>C	c.(1474-1476)Ata>Cta	p.I492L	NFATC2_ENST00000371564.3_Missense_Mutation_p.I492L|NFATC2_ENST00000610033.1_Missense_Mutation_p.I273L|NFATC2_ENST00000414705.1_Missense_Mutation_p.I472L|NFATC2_ENST00000609943.1_Missense_Mutation_p.I472L|NFATC2_ENST00000609507.1_Missense_Mutation_p.I273L	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	492	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					TTGCCCACTATCTTCTCATAG	0.557																																					p.I492L		Atlas-SNP	.											.	NFATC2	112	.	0			c.A1474C						.						225.0	223.0	224.0					20																	50092056		2203	4300	6503	SO:0001583	missense	4773	exon4			CCACTATCTTCTC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1474A>C	chr20.hg19:g.50092056T>G	ENSP00000379330:p.Ile492Leu	308.0	0.0		329.0	83.0	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	hg19	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	T	19.60	3.858656	0.71834	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.41400	1.0;1.0;1.0	5.26	5.26	0.73747	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.195954	0.47093	D	0.000247	T	0.52709	0.1751	N	0.25647	0.755	0.44000	D	0.996704	P;P;B;B	0.42908	0.476;0.793;0.338;0.338	P;D;P;P	0.66497	0.531;0.944;0.531;0.531	T	0.55724	-0.8096	10	0.59425	D	0.04	-8.1108	15.1874	0.73016	0.0:0.0:0.0:1.0	.	472;472;492;492	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	L	492;492;273;472	ENSP00000360619:I492L;ENSP00000379330:I492L;ENSP00000396471:I472L	ENSP00000360619:I492L	I	-	1	0	NFATC2	49525463	1.000000	0.71417	0.979000	0.43373	0.907000	0.53573	1.659000	0.37387	1.983000	0.57843	0.528000	0.53228	ATA	.	.		0.557	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
ITSN1	6453	hgsc.bcm.edu	37	21	35172168	35172168	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr21:35172168G>A	ENST00000381318.3	+	19	2527	c.2239G>A	c.(2239-2241)Gca>Aca	p.A747T	ITSN1_ENST00000399367.3_Missense_Mutation_p.A747T|ITSN1_ENST00000399355.2_Missense_Mutation_p.A747T|ITSN1_ENST00000399326.3_Missense_Mutation_p.A747T|ITSN1_ENST00000381291.4_Missense_Mutation_p.A747T|ITSN1_ENST00000379960.5_Missense_Mutation_p.A747T|ITSN1_ENST00000399349.1_Missense_Mutation_p.A747T|ITSN1_ENST00000399352.1_Missense_Mutation_p.A747T|ITSN1_ENST00000399338.4_Missense_Mutation_p.A747T|ITSN1_ENST00000437442.2_Missense_Mutation_p.A747T|ITSN1_ENST00000381285.4_Missense_Mutation_p.A747T|ITSN1_ENST00000399353.1_Missense_Mutation_p.A710T|AP000304.12_ENST00000429238.1_Intron	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	747	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						GTATTACCGGGCACTGTACCC	0.408																																					p.A747T		Atlas-SNP	.											.	ITSN1	166	.	0			c.G2239A						.						97.0	96.0	97.0					21																	35172168		2203	4300	6503	SO:0001583	missense	6453	exon19			TACCGGGCACTGT	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.2239G>A	chr21.hg19:g.35172168G>A	ENSP00000370719:p.Ala747Thr	44.0	0.0		31.0	8.0	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	hg19	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692345	0.88735	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	5.65	5.65	0.86999	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.84229	0.5426	M	0.83953	2.67	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.997;0.999;1.0;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;0.996;0.999;0.999;0.997;0.999;0.999;0.999;1.0	D	0.85856	0.1407	10	0.87932	D	0	.	19.7272	0.96168	0.0:0.0:1.0:0.0	.	710;710;710;747;747;747;747;747;747;710	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	T	710;747;747;747;747;747;747;747;747;747;747;747;747;747	ENSP00000382290:A710T;ENSP00000370719:A747T;ENSP00000370691:A747T;ENSP00000370685:A747T;ENSP00000382301:A747T;ENSP00000382289:A747T;ENSP00000382292:A747T;ENSP00000382286:A747T;ENSP00000382275:A747T;ENSP00000387377:A747T;ENSP00000382265:A747T;ENSP00000369294:A747T	ENSP00000369294:A747T	A	+	1	0	ITSN1	34094038	1.000000	0.71417	0.854000	0.33618	0.680000	0.39746	8.502000	0.90505	2.673000	0.90976	0.557000	0.71058	GCA	.	.		0.408	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
YBEY	54059	hgsc.bcm.edu	37	21	47711386	47711386	+	Intron	SNP	G	G	C	rs553720951		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr21:47711386G>C	ENST00000329319.3	+	3	737				YBEY_ENST00000397691.1_Intron|YBEY_ENST00000397694.1_Intron|YBEY_ENST00000397701.4_Intron|YBEY_ENST00000339195.6_Intron|YBEY_ENST00000397692.1_Intron	NM_058181.1	NP_478061.1	P58557	YBEY_HUMAN	ybeY metallopeptidase (putative)						rRNA processing (GO:0006364)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)	9						TGTAAGCGGGGATGCTGAAAT	0.458																																					p.D117H		Atlas-SNP	.											.	YBEY	23	.	0			c.G349C						.						80.0	78.0	79.0					21																	47711386		2203	4300	6503	SO:0001627	intron_variant	54059	exon3			AGCGGGGATGCTG	AK294975	CCDS33591.1	21q22.3	2010-12-08	2010-12-08	2010-12-08	ENSG00000182362	ENSG00000182362			1299	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 57"""	C21orf57			Standard	XM_005261155		Approved		uc002ziv.3	P58557	OTTHUMG00000090632	ENST00000329319.3:c.339+10G>C	chr21.hg19:g.47711386G>C		164.0	0.0		147.0	50.0	NM_001006114	B7WPA9|B7WPF7|D3DSN2	Missense_Mutation	SNP	ENST00000329319.3	hg19	CCDS33591.1																																																																																			.	.		0.458	YBEY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207265.1	NM_058181	
KCNJ4	3761	hgsc.bcm.edu	37	22	38823337	38823337	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr22:38823337C>A	ENST00000303592.3	-	2	1059	c.801G>T	c.(799-801)gaG>gaT	p.E267D	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	267					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					GCGGGCTGTCCTCGTCGATCT	0.612																																					p.E267D		Atlas-SNP	.											.	KCNJ4	74	.	0			c.G801T						.						92.0	76.0	82.0					22																	38823337		2203	4300	6503	SO:0001583	missense	3761	exon2			GCTGTCCTCGTCG	U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.801G>T	chr22.hg19:g.38823337C>A	ENSP00000306497:p.Glu267Asp	39.0	0.0		62.0	24.0	NM_004981	Q14D44	Missense_Mutation	SNP	ENST00000303592.3	hg19	CCDS13971.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067975	0.36470	.	.	ENSG00000168135	ENST00000303592	D	0.92595	-3.07	4.94	3.79	0.43588	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.112974	0.64402	D	0.000017	D	0.90256	0.6953	M	0.69523	2.12	0.40481	D	0.980449	B	0.06786	0.001	B	0.12837	0.008	D	0.87653	0.2529	10	0.62326	D	0.03	.	10.6862	0.45843	0.0:0.8325:0.0:0.1675	.	267	P48050	IRK4_HUMAN	D	267	ENSP00000306497:E267D	ENSP00000306497:E267D	E	-	3	2	KCNJ4	37153283	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.255000	0.32909	1.066000	0.40716	0.555000	0.69702	GAG	.	.		0.612	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321447.1	NM_004981	
CELSR1	9620	hgsc.bcm.edu	37	22	46829366	46829366	+	Missense_Mutation	SNP	G	G	A	rs573686247		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr22:46829366G>A	ENST00000262738.3	-	5	4534	c.4535C>T	c.(4534-4536)aCg>aTg	p.T1512M		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1512	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGCCACGGTCGTTGTTGTCTC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		16571	0.0		0.001	False		,,,				2504	0.0				p.T1512M		Atlas-SNP	.											.	CELSR1	242	.	0			c.C4535T						.						61.0	50.0	54.0					22																	46829366		2203	4300	6503	SO:0001583	missense	9620	exon5			ACGGTCGTTGTTG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4535C>T	chr22.hg19:g.46829366G>A	ENSP00000262738:p.Thr1512Met	33.0	0.0		33.0	9.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	hg19	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819755	0.50633	.	.	ENSG00000075275	ENST00000262738	T	0.79845	-1.31	4.62	4.62	0.57501	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.64402	U	0.000001	D	0.89643	0.6774	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90785	0.4682	10	0.59425	D	0.04	.	17.4417	0.87566	0.0:0.0:1.0:0.0	.	1512	Q9NYQ6	CELR1_HUMAN	M	1512	ENSP00000262738:T1512M	ENSP00000262738:T1512M	T	-	2	0	CELSR1	45208030	1.000000	0.71417	0.032000	0.17829	0.018000	0.09664	9.015000	0.93640	2.290000	0.77057	0.655000	0.94253	ACG	.	.		0.622	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
HCCS	3052	hgsc.bcm.edu	37	X	11139892	11139892	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:11139892G>C	ENST00000321143.4	+	7	971	c.769G>C	c.(769-771)Gac>Cac	p.D257H	HCCS_ENST00000380763.3_Missense_Mutation_p.D257H|ARHGAP6_ENST00000534860.1_Intron|HCCS_ENST00000380762.4_Missense_Mutation_p.D257H	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	257					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)	7						GGCAGTATGGGACAGAATGAA	0.403																																					p.D257H	Ovarian(86;1338 1347 1462 10340 37882)	Atlas-SNP	.											.	HCCS	17	.	0			c.G769C						.						127.0	99.0	109.0					X																	11139892		2203	4300	6503	SO:0001583	missense	3052	exon7			GTATGGGACAGAA		CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.769G>C	chrX.hg19:g.11139892G>C	ENSP00000326579:p.Asp257His	33.0	0.0		32.0	15.0	NM_001122608	B3KUS1|Q502X8	Missense_Mutation	SNP	ENST00000321143.4	hg19	CCDS14139.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243512	0.79912	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.83506	-1.73;-1.73;-1.73	5.84	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.93327	0.7873	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94344	0.7573	10	0.66056	D	0.02	-36.3632	12.9185	0.58218	0.0:0.0:0.8366:0.1634	.	257	P53701	CCHL_HUMAN	H	257	ENSP00000326579:D257H;ENSP00000370140:D257H;ENSP00000370139:D257H	ENSP00000326579:D257H	D	+	1	0	HCCS	11049813	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.239000	0.95389	1.197000	0.43143	0.600000	0.82982	GAC	.	.		0.403	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055742.1		
PRPS2	5634	hgsc.bcm.edu	37	X	12838904	12838904	+	Silent	SNP	A	A	G			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:12838904A>G	ENST00000380668.5	+	6	974	c.846A>G	c.(844-846)aaA>aaG	p.K282K	PRPS2_ENST00000398491.2_Silent_p.K285K	NM_001039091.2|NM_002765.4	NP_001034180.1|NP_002756.1	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	282					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|AMP biosynthetic process (GO:0006167)|nucleobase-containing compound metabolic process (GO:0006139)|organ regeneration (GO:0031100)	extracellular vesicular exosome (GO:0070062)|ribose phosphate diphosphokinase complex (GO:0002189)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|carbohydrate binding (GO:0030246)|GDP binding (GO:0019003)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	16						ACAAAATGAAACACTGCACCA	0.448																																					p.K285K		Atlas-SNP	.											.	PRPS2	41	.	0			c.A855G						.						94.0	76.0	82.0					X																	12838904		2203	4300	6503	SO:0001819	synonymous_variant	5634	exon6			AATGAAACACTGC	Y00971	CCDS14150.1, CCDS43918.1	Xp22.2	2012-10-02			ENSG00000101911	ENSG00000101911	2.7.6.1		9465	protein-coding gene	gene with protein product	"""PRS II"", ""ribose-phosphate diphosphokinase 2"""	311860				1962753	Standard	NM_002765		Approved		uc004cva.3	P11908	OTTHUMG00000021139	ENST00000380668.5:c.846A>G	chrX.hg19:g.12838904A>G		35.0	0.0		42.0	23.0	NM_001039091	Q0VDH9|Q0VDI0|Q15245|Q2TAK7	Silent	SNP	ENST00000380668.5	hg19	CCDS14150.1																																																																																			.	.		0.448	PRPS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055772.2	NM_002765	
SLC9A7	84679	hgsc.bcm.edu	37	X	46541903	46541903	+	Silent	SNP	G	G	A			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chrX:46541903G>A	ENST00000328306.4	-	2	418	c.393C>T	c.(391-393)agC>agT	p.S131S		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	131					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						CCTGAGTGCAGCTGAGTGATT	0.488																																					p.S131S	Pancreas(118;454 1696 1930 13865 39976)	Atlas-SNP	.											.	SLC9A7	73	.	0			c.C393T						.						74.0	56.0	62.0					X																	46541903		2203	4300	6503	SO:0001819	synonymous_variant	84679	exon2			AGTGCAGCTGAGT	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.393C>T	chrX.hg19:g.46541903G>A		51.0	0.0		49.0	26.0	NM_001257291	O75827|Q5JXP9	Silent	SNP	ENST00000328306.4	hg19	CCDS14269.1																																																																																			.	.		0.488	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
CBWD5	220869	hgsc.bcm.edu	37	9	70484455	70484455	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr9:70484455delT	ENST00000382405.3	-	3	435	c.258delA	c.(256-258)aaafs	p.K86fs	CBWD5_ENST00000429800.2_Frame_Shift_Del_p.K86fs|CBWD5_ENST00000377395.4_Frame_Shift_Del_p.K86fs|CBWD5_ENST00000430059.2_Frame_Shift_Del_p.K86fs|CBWD5_ENST00000377384.1_Frame_Shift_Del_p.K86fs|CBWD5_ENST00000377392.5_Frame_Shift_Del_p.K50fs			Q5RIA9	CBWD5_HUMAN	COBW domain containing 5	86							ATP binding (GO:0005524)								all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		CAGCTAAGGATTTCTCCAGCG	0.418																																					p.S87fs		Atlas-Indel,Pindel	.											.	CBWD5	1	.	0			c.259delT						.						14.0	13.0	13.0					9																	70484455		2119	4176	6295	SO:0001589	frameshift_variant	220869	exon3			.	BC067803, BC082271	CCDS75841.1, CCDS75843.1, CCDS75844.1	9q13	2005-08-23			ENSG00000147996	ENSG00000147996			24584	protein-coding gene	gene with protein product	"""dopamine responsive protein"""						Standard	XM_005272748		Approved		uc004ack.3	Q5RIA9	OTTHUMG00000013336	ENST00000382405.3:c.258delA	chr9.hg19:g.70484455delT	ENSP00000371842:p.Lys86fs	3248.0	0.0		3127.0	257.0	NM_001024916	Q8N7U8	Frame_Shift_Del	DEL	ENST00000382405.3	hg19																																																																																				.	.		0.418	CBWD5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000037131.2		
MYOM1	8736	hgsc.bcm.edu	37	18	3116449	3116450	+	Frame_Shift_Ins	INS	-	-	G	rs374873325		TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr18:3116449_3116450insG	ENST00000356443.4	-	21	3515_3516	c.3182_3183insC	c.(3181-3183)ccgfs	p.P1061fs	MYOM1_ENST00000400569.3_Frame_Shift_Ins_p.P1061fs|MYOM1_ENST00000261606.7_Frame_Shift_Ins_p.P965fs	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1061	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AGTGGACTGGCGGCTTCCACTG	0.55																																					p.P1061fs		Atlas-INDEL	.											.	MYOM1	192	.	0			c.3183_3184insC						.																																			SO:0001589	frameshift_variant	8736	exon21			.	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.3183dupC	chr18.hg19:g.3116451_3116451dupG	ENSP00000348821:p.Pro1061fs	77.0	0.0		90.0	10.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Frame_Shift_Ins	INS	ENST00000356443.4	hg19	CCDS45824.1																																																																																			.	.		0.550	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227316906	227316908	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	GCA	GCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr1:227316906_227316908delGCA	ENST00000366769.3	-	11	2706_2708	c.1415_1417delTGC	c.(1414-1419)ctgcag>cag	p.L472del	CDC42BPA_ENST00000535525.1_In_Frame_Del_p.L472del|CDC42BPA_ENST00000366766.2_In_Frame_Del_p.L472del|CDC42BPA_ENST00000366767.3_In_Frame_Del_p.L472del|CDC42BPA_ENST00000366764.2_In_Frame_Del_p.L472del|CDC42BPA_ENST00000366765.3_In_Frame_Del_p.L472del|CDC42BPA_ENST00000334218.5_In_Frame_Del_p.L472del	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				GTTGAATACTGCAGAGCTTGGAC	0.271																																					p.472_473del		Atlas-Indel,Pindel	.											.	CDC42BPA	528	.	0			c.1416_1418del						.																																			SO:0001651	inframe_deletion	8476	exon11			.	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.1415_1417delTGC	chr1.hg19:g.227316906_227316908delGCA	ENSP00000355731:p.Leu472del	580.0	0.0		421.0	107.0	NM_003607		In_Frame_Del	DEL	ENST00000366769.3	hg19	CCDS1558.1																																																																																			.	.		0.271	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
RNF133	168433	hgsc.bcm.edu	37	7	122338762	122338763	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr7:122338762_122338763delCT	ENST00000340112.2	-	1	447_448	c.210_211delAG	c.(208-213)agagtgfs	p.RV70fs	CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000449022.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	70	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						ACTCCTGCCACTCTCTTCAAAG	0.431																																					p.71_71del	Colon(198;1778 2057 7449 19869 45985)	Atlas-Indel,Pindel	.											.	RNF133	41	.	0			c.211_212del						.																																			SO:0001589	frameshift_variant	168433	exon1			.	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.210_211delAG	chr7.hg19:g.122338766_122338767delCT	ENSP00000344489:p.Arg70fs	90.0	0.0		84.0	28.0	NM_139175	A4D0W2|Q8N7G7	Frame_Shift_Del	DEL	ENST00000340112.2	hg19	CCDS5784.1																																																																																			.	.		0.431	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
CDC27	996	hgsc.bcm.edu	37	17	45234594	45234729	+	Splice_Site	DEL	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	-	rs149474782|rs113608268|rs370849730|rs78395997|rs76624491|rs370261409|rs75353677|rs368304141|rs376818791|rs372212798|rs375653477|rs374472811|rs76359747|rs147617501|rs374614181|rs78108688|rs142987740|rs143453365|rs75990396|rs144985864|rs367644695|rs202182614|rs139751753|rs11570485|rs372926889|rs140171160|rs368750026|rs201098929|rs199899451|rs75175938|rs200340309|rs537990668	byFrequency	TCGA-BC-4073-01B-02D-A12Z-10	TCGA-BC-4073-10A-01D-A12Z-10	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	CTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcc3deff-4d29-489d-834f-f2c98fd750d8	4af05379-ed6d-488f-932c-43921f43e40b	g.chr17:45234594_45234729delCTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT	ENST00000066544.3	-	6	590_724	c.497_631delAGTTCTTACGGAAACACCCCAGGACACAATTGTAAGTGTCTTATATTCTAGTGTTCAAAATATTATGAAAACTACAAAGAATGATCTGAACTAAATAATATATTGTGAATGACTTGGTAGAAATTTTCTGTTTCAG	c.(496-633)cagttcttacggaaacaccccaggacacaattgtaagtgtcttatattctagtgttcaaaatattatgaaaactacaaagaatgatctgaactaaataatatattgtgaatgacttggtagaaattttctgtttcaga>cga	p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF166fs	CDC27_ENST00000531206.1_Splice_Site_p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF166fs|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000446365.2_Splice_Site_p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF105fs|CDC27_ENST00000527547.1_Splice_Site_p.QFLRKHPRTQL*VSYILVFKIL*KLQRMI*TK*YIVNDLVEIFCF166fs	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	166					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.T167T(7)|p.T171T(3)|p.V201I(2)|p.E199E(2)|p.T200T(2)|p.L173S(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACTGTCTCAGGCTGTCTGTGAGATAAACTATGATTAGGTACTTGTGTTGTGCAAGAGTTGGGCAGACAGTTGCTAAAGTTCTGTAAAGATGTGAATTTAAATGTTTGGTCAGGATC	0.342																																					p.201_211del		Pindel	.											.	CDC27	337	.	17	Substitution - coding silent(14)|Substitution - Missense(3)	large_intestine(6)|prostate(6)|kidney(4)|NS(1)	c.601_631del						.																																			SO:0001630	splice_region_variant	996	exon6			.	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.631-104AGTTCTTACGGAAACACCCCAGGACACAATTGTAAGTGTCTTATATTCTAGTGTTCAAAATATTATGAAAACTACAAAGAATGATCTGAACTAAATAATATATTGTGAATGACTTGGTAGAAATTTTCTGTTTCAG>-	chr17.hg19:g.45234594_45234729delCTGAAACAGAAAATTTCTACCAAGTCATTCACAATATATTATTTAGTTCAGATCATTCTTTGTAGTTTTCATAATATTTTGAACACTAGAATATAAGACACTTACAATTGTGTCCTGGGGTGTTTCCGTAAGAACT		140.0	0.0		153.0	12.0	NM_001114091	G3V1C4|Q16349|Q96F35	Frame_Shift_Del	DEL	ENST00000066544.3	hg19	CCDS11509.1																																																																																			.	.		0.342	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		Frame_Shift_Del
