#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
INADL	10207	hgsc.bcm.edu	37	1	62330235	62330235	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:62330235A>C	ENST00000371158.2	+	20	2879	c.2765A>C	c.(2764-2766)cAa>cCa	p.Q922P	INADL_ENST00000316485.6_Missense_Mutation_p.Q922P	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	922					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TCCGAGTCTCAAGAGGCAAGA	0.478																																					p.Q922P		Atlas-SNP	.											.	INADL	179	.	0			c.A2765C						.						100.0	105.0	103.0					1																	62330235		2203	4300	6503	SO:0001583	missense	10207	exon20			AGTCTCAAGAGGC	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.2765A>C	chr1.hg19:g.62330235A>C	ENSP00000360200:p.Gln922Pro	83.0	0.0		35.0	19.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	hg19	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	9.052	0.992376	0.18966	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.12984	2.76;2.63	5.18	-4.18	0.03846	.	1.149560	0.06529	N	0.741001	T	0.12603	0.0306	L	0.57536	1.79	0.09310	N	1	B;B;B	0.10296	0.003;0.001;0.003	B;B;B	0.08055	0.003;0.001;0.003	T	0.36601	-0.9741	10	0.30078	T	0.28	.	6.9089	0.24325	0.2472:0.5722:0.0687:0.1119	.	922;922;922	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	P	922	ENSP00000360200:Q922P;ENSP00000326199:Q922P	ENSP00000255202:Q922P	Q	+	2	0	INADL	62102823	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.038000	0.13862	-0.974000	0.03550	-0.501000	0.04562	CAA	.	.		0.478	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
PTPN22	26191	hgsc.bcm.edu	37	1	114380695	114380695	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:114380695G>T	ENST00000359785.5	-	13	1462	c.1327C>A	c.(1327-1329)Cca>Aca	p.P443T	PTPN22_ENST00000528414.1_Missense_Mutation_p.P388T|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000420377.2_Missense_Mutation_p.P443T|PTPN22_ENST00000525799.1_Missense_Mutation_p.P316T|PTPN22_ENST00000538253.1_Missense_Mutation_p.P199T	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	443					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGTGTTATTGGCACCTTTGAA	0.383																																					p.P443T		Atlas-SNP	.											.	PTPN22	90	.	0			c.C1327A						.						82.0	83.0	83.0					1																	114380695		2203	4300	6503	SO:0001583	missense	26191	exon13			TTATTGGCACCTT	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1327C>A	chr1.hg19:g.114380695G>T	ENSP00000352833:p.Pro443Thr	129.0	0.0		38.0	14.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	hg19	CCDS863.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970819	0.53614	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.82	3.91	0.45181	.	0.193747	0.37012	N	0.002281	T	0.30103	0.0754	M	0.71581	2.175	0.19300	N	0.999976	D;D;D;D;D;D	0.89917	1.0;0.999;0.958;0.972;0.99;0.991	D;D;P;P;P;P	0.91635	0.999;0.952;0.776;0.573;0.888;0.856	T	0.11717	-1.0576	10	0.40728	T	0.16	.	8.098	0.30840	0.0803:0.0:0.7616:0.1582	.	199;316;443;388;443;443	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	T	443;388;199;443;316;443	ENSP00000352833:P443T;ENSP00000435176:P388T;ENSP00000439372:P199T;ENSP00000388229:P443T;ENSP00000432674:P316T	ENSP00000346621:P443T	P	-	1	0	PTPN22	114182218	0.954000	0.32549	0.007000	0.13788	0.852000	0.48524	2.823000	0.48081	0.770000	0.33336	0.655000	0.94253	CCA	.	.		0.383	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
GJA8	2703	hgsc.bcm.edu	37	1	147380863	147380863	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:147380863C>T	ENST00000369235.1	+	1	781	c.781C>T	c.(781-783)Cag>Tag	p.Q261*	GJA8_ENST00000240986.4_Nonsense_Mutation_p.Q261*			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	261					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					CTCCTCCATCCAGAAAGCCAA	0.567																																					p.Q261X	Melanoma(76;1255 1795 8195 52096)	Atlas-SNP	.											.	GJA8	108	.	0			c.C781T						.						50.0	52.0	52.0					1																	147380863		2203	4300	6503	SO:0001587	stop_gained	2703	exon2			TCCATCCAGAAAG	U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.781C>T	chr1.hg19:g.147380863C>T	ENSP00000358238:p.Gln261*	74.0	0.0		66.0	31.0	NM_005267	A7L5M5|Q5VVN9|Q9NP25	Nonsense_Mutation	SNP	ENST00000369235.1	hg19	CCDS30834.1	.	.	.	.	.	.	.	.	.	.	c	34	5.391246	0.95988	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	.	.	.	4.4	4.4	0.53042	.	0.501871	0.14206	U	0.334393	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	17.1387	0.86747	0.0:1.0:0.0:0.0	.	.	.	.	X	261	.	ENSP00000240986:Q261X	Q	+	1	0	GJA8	145847487	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.798000	0.69095	2.267000	0.75376	0.313000	0.20887	CAG	.	.		0.567	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060647.1	NM_005267	
GON4L	54856	hgsc.bcm.edu	37	1	155723018	155723018	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:155723018C>T	ENST00000368331.1	-	29	5867	c.5819G>A	c.(5818-5820)aGa>aAa	p.R1940K	GON4L_ENST00000271883.5_Missense_Mutation_p.R1940K|GON4L_ENST00000437809.1_Missense_Mutation_p.R1940K	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1940					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTCTCCCTTTCTGGTGGTCCT	0.567																																					p.R1940K		Atlas-SNP	.											.	GON4L	392	.	0			c.G5819A						.						89.0	98.0	95.0					1																	155723018		2070	4196	6266	SO:0001583	missense	54856	exon29			CCCTTTCTGGTGG	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5819G>A	chr1.hg19:g.155723018C>T	ENSP00000357315:p.Arg1940Lys	264.0	0.0		223.0	28.0	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	hg19		.	.	.	.	.	.	.	.	.	.	C	11.91	1.780102	0.31502	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.12879	2.64;2.64;2.64	5.32	4.41	0.53225	.	0.374424	0.25708	N	0.028831	T	0.03564	0.0102	L	0.29908	0.895	0.09310	N	1	B;B	0.29988	0.172;0.264	B;B	0.31101	0.058;0.124	T	0.37197	-0.9716	10	0.19147	T	0.46	.	11.8523	0.52417	0.0:0.9191:0.0:0.0809	.	1940;1940	Q3T8J9;Q3T8J9-3	GON4L_HUMAN;.	K	1940	ENSP00000396117:R1940K;ENSP00000357315:R1940K;ENSP00000271883:R1940K	ENSP00000271883:R1940K	R	-	2	0	GON4L	153989642	0.051000	0.20477	0.026000	0.17262	0.260000	0.26232	1.482000	0.35486	1.479000	0.48272	0.650000	0.86243	AGA	.	.		0.567	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
DUSP10	11221	hgsc.bcm.edu	37	1	221912367	221912367	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:221912367G>A	ENST00000366899.3	-	2	958	c.720C>T	c.(718-720)acC>acT	p.T240T	DUSP10_ENST00000544095.1_5'Flank|DUSP10_ENST00000468085.1_5'Flank|DUSP10_ENST00000323825.3_Intron	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	240	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		TTGGTTCATTGGTATTCTCAT	0.458																																					p.T240T		Atlas-SNP	.											.	DUSP10	64	.	0			c.C720T						.						129.0	134.0	132.0					1																	221912367		2203	4300	6503	SO:0001819	synonymous_variant	11221	exon2			TTCATTGGTATTC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.720C>T	chr1.hg19:g.221912367G>A		234.0	0.0		156.0	19.0	NM_007207	D3DTB4|Q6GSI4|Q9H9Z5	Silent	SNP	ENST00000366899.3	hg19	CCDS1528.1																																																																																			.	.		0.458	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090716.1	NM_007207	
RYR2	6262	hgsc.bcm.edu	37	1	237948157	237948157	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:237948157T>A	ENST00000366574.2	+	90	13462	c.13145T>A	c.(13144-13146)cTg>cAg	p.L4382Q	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.L4366Q|RYR2_ENST00000360064.6_Missense_Mutation_p.L4388Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4382					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCTTTGGCCTGGATCTGAAG	0.537																																					p.L4382Q		Atlas-SNP	.											.	RYR2	1273	.	0			c.T13145A						.						43.0	42.0	42.0					1																	237948157		1937	4131	6068	SO:0001583	missense	6262	exon90			TTGGCCTGGATCT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13145T>A	chr1.hg19:g.237948157T>A	ENSP00000355533:p.Leu4382Gln	84.0	0.0		77.0	23.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.348097	0.61183	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.95001	-3.58;-3.58;-3.58	5.56	5.56	0.83823	Ryanodine Receptor TM 4-6 (1);	0.241031	0.26582	N	0.023565	D	0.95056	0.8399	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.69824	0.958;0.966	D	0.95781	0.8817	10	0.66056	D	0.02	-10.7165	15.7141	0.77655	0.0:0.0:0.0:1.0	.	1356;4382	B4DGV4;Q92736	.;RYR2_HUMAN	Q	4382;4388;4366;1356	ENSP00000355533:L4382Q;ENSP00000353174:L4388Q;ENSP00000443798:L4366Q	ENSP00000353174:L4388Q	L	+	2	0	RYR2	236014780	1.000000	0.71417	1.000000	0.80357	0.510000	0.34073	7.842000	0.86851	2.112000	0.64535	0.533000	0.62120	CTG	.	.		0.537	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OR2T4	127074	hgsc.bcm.edu	37	1	248525606	248525606	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248525606C>A	ENST00000366475.1	+	1	724	c.724C>A	c.(724-726)Cct>Act	p.P242T		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTCCTCATCCCTGTGGTGAT	0.488																																					p.P242T		Atlas-SNP	.											.	OR2T4	126	.	0			c.C724A						.						159.0	150.0	153.0					1																	248525606		2203	4300	6503	SO:0001583	missense	127074	exon1			CTCATCCCTGTGG	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.724C>A	chr1.hg19:g.248525606C>A	ENSP00000355431:p.Pro242Thr	1155.0	0.0		1004.0	67.0	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	hg19	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	C	8.392	0.839896	0.16891	.	.	ENSG00000196944	ENST00000366475	T	0.56103	0.48	3.09	2.12	0.27331	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000279	T	0.56187	0.1968	L	0.52759	1.655	0.09310	N	1	D	0.58620	0.983	P	0.58013	0.831	T	0.43343	-0.9397	10	0.87932	D	0	.	7.3606	0.26744	0.0:0.7778:0.0:0.2222	.	242	Q8NH00	OR2T4_HUMAN	T	242	ENSP00000355431:P242T	ENSP00000355431:P242T	P	+	1	0	OR2T4	246592229	0.000000	0.05858	0.028000	0.17463	0.130000	0.20726	-1.205000	0.03014	1.543000	0.49345	0.585000	0.79938	CCT	.	.		0.488	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
OR2T6	254879	hgsc.bcm.edu	37	1	248551626	248551626	+	Silent	SNP	C	C	T	rs148186126		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248551626C>T	ENST00000355728.2	+	1	717	c.717C>T	c.(715-717)gcC>gcT	p.A239A		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A239A(1)		endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGCCTTTGCCACCTGCTCTT	0.507																																					p.A239A		Atlas-SNP	.											OR2T6,arm,malignant_melanoma,0,1	OR2T6	101	.	1	Substitution - coding silent(1)	skin(1)	c.C717T						.						271.0	226.0	242.0					1																	248551626		2203	4300	6503	SO:0001819	synonymous_variant	254879	exon1			CTTTGCCACCTGC	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.717C>T	chr1.hg19:g.248551626C>T		307.0	0.0		310.0	86.0	NM_001005471	A6NE36	Silent	SNP	ENST00000355728.2	hg19	CCDS31114.1																																																																																			.	.		0.507	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
OR2G6	391211	hgsc.bcm.edu	37	1	248684959	248684959	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248684959C>T	ENST00000343414.4	+	1	44	c.12C>T	c.(10-12)acC>acT	p.T4T		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T4T(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGAGGAAACCAACAACAGCT	0.398																																					p.T4T		Atlas-SNP	.											OR2G6,NS,carcinoma,0,1	OR2G6	124	.	1	Substitution - coding silent(1)	lung(1)	c.C12T						.						126.0	119.0	122.0					1																	248684959		2203	4300	6503	SO:0001819	synonymous_variant	391211	exon1			GGAAACCAACAAC		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.12C>T	chr1.hg19:g.248684959C>T		250.0	0.0		215.0	74.0	NM_001013355	B2RP33	Silent	SNP	ENST00000343414.4	hg19	CCDS31119.1																																																																																			.	.		0.398	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
OR2T10	127069	hgsc.bcm.edu	37	1	248756794	248756794	+	Silent	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr1:248756794G>T	ENST00000330500.2	-	1	306	c.276C>A	c.(274-276)atC>atA	p.I92I	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAGGACCGAGATGGTCTTGT	0.502																																					p.I92I		Atlas-SNP	.											.	OR2T10	58	.	0			c.C276A						.						64.0	75.0	71.0					1																	248756794		2040	4235	6275	SO:0001819	synonymous_variant	127069	exon1			GACCGAGATGGTC		CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.276C>A	chr1.hg19:g.248756794G>T		219.0	0.0		175.0	30.0	NM_001004693	B2RNK7	Silent	SNP	ENST00000330500.2	hg19	CCDS31121.1																																																																																			.	.		0.502	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	NM_001004693	
SMPD4	55627	hgsc.bcm.edu	37	2	130930247	130930247	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:130930247G>T	ENST00000409031.1	-	7	1723	c.575C>A	c.(574-576)cCg>cAg	p.P192Q	SMPD4_ENST00000431183.2_Missense_Mutation_p.P119Q|SMPD4_ENST00000351288.6_Missense_Mutation_p.P192Q|SMPD4_ENST00000473720.1_Intron|SMPD4_ENST00000452225.2_Intron|SMPD4_ENST00000339679.7_Missense_Mutation_p.P79Q|SMPD4_ENST00000426662.2_Intron|SMPD4_ENST00000443958.2_Intron|SMPD4_ENST00000453750.1_Intron	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	153					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	atactcGAACGGATCTGAGAG	0.587																																					p.P192Q		Atlas-SNP	.											.	SMPD4	67	.	0			c.C575A						.						98.0	104.0	102.0					2																	130930247		2203	4300	6503	SO:0001583	missense	55627	exon7			TCGAACGGATCTG	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.575C>A	chr2.hg19:g.130930247G>T	ENSP00000386531:p.Pro192Gln	184.0	0.0		158.0	34.0	NM_017751	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	ENST00000409031.1	hg19	CCDS42751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.71|14.71	2.617956|2.617956	0.46736|0.46736	.|.	.|.	ENSG00000136699|ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000339679|ENST00000439886	.|.	.|.	.|.	3.5|3.5	3.5|3.5	0.40072|0.40072	.|.	0.199707|.	0.43579|.	D|.	0.000547|.	T|T	0.69593|0.69593	0.3128|0.3128	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	D;D;P;P;D|.	0.58268|.	0.982;0.968;0.955;0.915;0.98|.	P;P;P;P;P|.	0.57960|.	0.708;0.77;0.567;0.801;0.83|.	T|T	0.69939|0.69939	-0.5009|-0.5009	9|5	0.56958|.	D|.	0.05|.	.|.	12.5618|12.5618	0.56286|0.56286	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	119;79;153;153;192|.	E7ESA2;B4E0T5;Q9NXE4-2;Q9NXE4;B1PBA3|.	.;.;.;NSMA3_HUMAN;.|.	Q|S	192;192;119;79|21	.|.	ENSP00000339721:P79Q|.	P|R	-|-	2|1	0|0	SMPD4|SMPD4	130646717|130646717	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.921000|0.921000	0.55340|0.55340	6.881000|6.881000	0.75584|0.75584	1.793000|1.793000	0.52555|0.52555	0.455000|0.455000	0.32223|0.32223	CCG|CGT	.	.		0.587	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254516.3	NM_017751	
PLA2R1	22925	hgsc.bcm.edu	37	2	160807990	160807990	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:160807990G>T	ENST00000283243.7	-	24	3607	c.3401C>A	c.(3400-3402)aCt>aAt	p.T1134N	PLA2R1_ENST00000392771.1_Missense_Mutation_p.T1134N	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1134	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TGCATACCAAGTCATATTTGC	0.408																																					p.T1134N		Atlas-SNP	.											.	PLA2R1	153	.	0			c.C3401A						.						240.0	220.0	227.0					2																	160807990		2203	4300	6503	SO:0001583	missense	22925	exon24			TACCAAGTCATAT	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3401C>A	chr2.hg19:g.160807990G>T	ENSP00000283243:p.Thr1134Asn	574.0	0.0		434.0	137.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	hg19	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951658	0.53186	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.56275	0.47;0.47	5.67	5.67	0.87782	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.057219	0.64402	D	0.000002	T	0.61211	0.2329	L	0.41027	1.25	0.47737	D	0.999507	D;D;D	0.61080	0.989;0.987;0.987	D;P;P	0.68039	0.955;0.843;0.857	T	0.52697	-0.8541	10	0.19147	T	0.46	.	15.2627	0.73637	0.0:0.1399:0.8601:0.0	.	1134;1134;1134	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	N	1134	ENSP00000283243:T1134N;ENSP00000376524:T1134N	ENSP00000283243:T1134N	T	-	2	0	PLA2R1	160516236	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.245000	0.65405	2.680000	0.91292	0.557000	0.71058	ACT	.	.		0.408	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
TRAF3IP1	26146	hgsc.bcm.edu	37	2	239237694	239237694	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr2:239237694G>T	ENST00000373327.4	+	5	848	c.626G>T	c.(625-627)gGa>gTa	p.G209V	TRAF3IP1_ENST00000391994.2_Missense_Mutation_p.G209V|TRAF3IP1_ENST00000391993.3_Missense_Mutation_p.G209V	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	209	Abolishes microtubules-binding when missing.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		gagaatggcggaaacagacac	0.527																																					p.G209V		Atlas-SNP	.											.	TRAF3IP1	58	.	0			c.G626T						.						78.0	63.0	68.0					2																	239237694		2043	3941	5984	SO:0001583	missense	26146	exon5			ATGGCGGAAACAG	AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.626G>T	chr2.hg19:g.239237694G>T	ENSP00000362424:p.Gly209Val	217.0	0.0		203.0	34.0	NM_015650	Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Missense_Mutation	SNP	ENST00000373327.4	hg19	CCDS33415.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756275	0.49362	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	T;T;T	0.13778	2.56;2.56;2.56	4.48	3.6	0.41247	.	0.673120	0.13966	N	0.350493	T	0.08088	0.0202	N	0.14661	0.345	0.28470	N	0.915444	B;B	0.33919	0.378;0.432	B;B	0.34093	0.109;0.175	T	0.26087	-1.0113	10	0.28530	T	0.3	-11.7677	8.465	0.32951	0.1804:0.0:0.8196:0.0	.	209;209	Q8TDR0-2;Q8TDR0	.;MIPT3_HUMAN	V	209	ENSP00000375851:G209V;ENSP00000362424:G209V;ENSP00000375852:G209V	ENSP00000362424:G209V	G	+	2	0	TRAF3IP1	238902433	0.603000	0.26924	0.055000	0.19348	0.349000	0.29174	1.046000	0.30354	1.018000	0.39521	0.655000	0.94253	GGA	.	.		0.527	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000328312.1	NM_015650	
SEMA3F	6405	hgsc.bcm.edu	37	3	50220186	50220186	+	Silent	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:50220186G>T	ENST00000002829.3	+	9	1357	c.873G>T	c.(871-873)gcG>gcT	p.A291A	SEMA3F_ENST00000413852.1_Silent_p.A192A|SEMA3F_ENST00000434342.1_Silent_p.A260A	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	291	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		AGAGCCCCGCGGTGTACGCCC	0.607																																					p.A291A		Atlas-SNP	.											.	SEMA3F	62	.	0			c.G873T						.						51.0	58.0	56.0					3																	50220186		2203	4300	6503	SO:0001819	synonymous_variant	6405	exon9			CCCCGCGGTGTAC	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.873G>T	chr3.hg19:g.50220186G>T		47.0	0.0		24.0	11.0	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	hg19	CCDS2811.1																																																																																			.	.		0.607	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
MRPS22	56945	hgsc.bcm.edu	37	3	139062905	139062905	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:139062905C>T	ENST00000495075.1	+	3	469	c.37C>T	c.(37-39)Ctc>Ttc	p.L13F	MRPS22_ENST00000478464.1_5'Flank|MRPS22_ENST00000310776.4_Missense_Mutation_p.L13F|MRPS22_ENST00000465056.1_Missense_Mutation_p.L13F			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	13						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						GCTGTGGAGCCTCTTGAGGAG	0.587																																					p.L13F		Atlas-SNP	.											.	MRPS22	40	.	0			c.C37T						.						52.0	53.0	52.0					3																	139062905		2203	4300	6503	SO:0001583	missense	56945	exon1			TGGAGCCTCTTGA	AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.37C>T	chr3.hg19:g.139062905C>T	ENSP00000418008:p.Leu13Phe	49.0	0.0		54.0	16.0	NM_020191	Q9H3I1	Missense_Mutation	SNP	ENST00000495075.1	hg19	CCDS3107.1	.	.	.	.	.	.	.	.	.	.	C	7.061	0.566305	0.13560	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000465373	D;D;D;T	0.83250	-1.7;-1.7;-1.7;-1.12	4.01	-2.38	0.06622	.	1.136100	0.06728	N	0.776041	T	0.65481	0.2695	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.46076	-0.9217	10	0.30078	T	0.28	2.9972	4.8869	0.13708	0.0:0.3398:0.1622:0.4979	.	13;13	G5E9V5;P82650	.;RT22_HUMAN	F	13;13;13;9	ENSP00000418008:L13F;ENSP00000310785:L13F;ENSP00000418233:L13F;ENSP00000419920:L9F	ENSP00000310785:L13F	L	+	1	0	MRPS22	140545595	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.295000	0.02764	-0.680000	0.05211	-0.282000	0.10007	CTC	.	.		0.587	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358120.1	NM_020191	
PLS1	5357	hgsc.bcm.edu	37	3	142388293	142388293	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:142388293C>T	ENST00000337777.3	+	3	345	c.132C>T	c.(130-132)agC>agT	p.S44S	PLS1_ENST00000457734.2_Silent_p.S44S|PLS1_ENST00000497002.1_Silent_p.S44S	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	44	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						AGGAAGCAAGCCTTCCTCTGC	0.368																																					p.S44S		Atlas-SNP	.											.	PLS1	71	.	0			c.C132T						.						148.0	148.0	148.0					3																	142388293		2203	4300	6503	SO:0001819	synonymous_variant	5357	exon3			AGCAAGCCTTCCT	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.132C>T	chr3.hg19:g.142388293C>T		107.0	0.0		79.0	9.0	NM_001172312	A8K2Q1|D3DNG3|Q8NEG6	Silent	SNP	ENST00000337777.3	hg19	CCDS3125.1																																																																																			.	.		0.368	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
EIF4G1	1981	hgsc.bcm.edu	37	3	184039489	184039489	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:184039489G>T	ENST00000346169.2	+	10	1388	c.1117G>T	c.(1117-1119)Gag>Tag	p.E373*	EIF4G1_ENST00000434061.2_Nonsense_Mutation_p.E177*|EIF4G1_ENST00000441154.1_Nonsense_Mutation_p.E209*|EIF4G1_ENST00000382330.3_Nonsense_Mutation_p.E380*|EIF4G1_ENST00000424196.1_Nonsense_Mutation_p.E380*|EIF4G1_ENST00000392537.2_Nonsense_Mutation_p.E286*|EIF4G1_ENST00000352767.3_Nonsense_Mutation_p.E380*|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000411531.1_Nonsense_Mutation_p.E333*|EIF4G1_ENST00000319274.6_Nonsense_Mutation_p.E373*|EIF4G1_ENST00000414031.1_Nonsense_Mutation_p.E333*|EIF4G1_ENST00000350481.5_Nonsense_Mutation_p.E209*|EIF4G1_ENST00000342981.4_Nonsense_Mutation_p.E373*|EIF4G1_ENST00000427845.1_Nonsense_Mutation_p.E286*|EIF4G1_ENST00000435046.2_Nonsense_Mutation_p.E177*	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	373					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGGAACCAGAGGTGGAGTC	0.567																																					p.E380X		Atlas-SNP	.											.	EIF4G1	151	.	0			c.G1138T						.						131.0	138.0	136.0					3																	184039489		2203	4300	6503	SO:0001587	stop_gained	1981	exon11			GAACCAGAGGTGG	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1117G>T	chr3.hg19:g.184039489G>T	ENSP00000316879:p.Glu373*	163.0	0.0		135.0	21.0	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Nonsense_Mutation	SNP	ENST00000346169.2	hg19	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974077	0.74246	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000457456;ENST00000435046	.	.	.	5.37	5.37	0.77165	.	0.569134	0.17681	N	0.165603	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-21.7267	12.207	0.54358	0.0:0.171:0.829:0.0	.	.	.	.	X	373;333;286;373;380;380;314;209;380;286;373;373;380;333;209;209;177;177;177	.	ENSP00000323737:E373X	E	+	1	0	EIF4G1	185522183	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.483000	0.66838	2.793000	0.96121	0.563000	0.77884	GAG	.	.		0.567	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
PDE6B	5158	hgsc.bcm.edu	37	4	651215	651215	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:651215A>G	ENST00000496514.1	+	10	1354	c.1333A>G	c.(1333-1335)Aag>Gag	p.K445E	RP11-1191J2.2_ENST00000468356.1_RNA|PDE6B_ENST00000255622.6_Missense_Mutation_p.K445E|PDE6B_ENST00000429163.2_Missense_Mutation_p.K166E|RP11-1191J2.2_ENST00000489312.1_RNA			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	445					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GGAGAACCGCAAGGACATCGC	0.597																																					p.K445E	GBM(71;463 1194 9848 25922 46834)	Atlas-SNP	.											.	PDE6B	80	.	0			c.A1333G						.						216.0	132.0	161.0					4																	651215		2203	4300	6503	SO:0001583	missense	5158	exon10			AACCGCAAGGACA	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.1333A>G	chr4.hg19:g.651215A>G	ENSP00000420295:p.Lys445Glu	173.0	0.0		192.0	32.0	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	hg19	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727402	0.89390	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163	T;T;T	0.69561	-0.41;-0.41;-0.41	4.85	3.62	0.41486	.	0.052152	0.64402	D	0.000001	T	0.81437	0.4822	M	0.88640	2.97	0.53005	D	0.999969	D;D	0.71674	0.997;0.998	P;D	0.68192	0.905;0.956	T	0.81846	-0.0745	10	0.87932	D	0	.	8.9054	0.35521	0.8327:0.0:0.0:0.1673	.	445;445	P35913;P35913-2	PDE6B_HUMAN;.	E	445;445;166	ENSP00000255622:K445E;ENSP00000420295:K445E;ENSP00000406334:K166E	ENSP00000255622:K445E	K	+	1	0	PDE6B	641215	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.695000	0.91298	0.653000	0.30826	0.367000	0.22151	AAG	.	.		0.597	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
CRMP1	1400	hgsc.bcm.edu	37	4	5837733	5837733	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:5837733C>T	ENST00000397890.2	-	11	1404	c.1190G>A	c.(1189-1191)aGg>aAg	p.R397K	CRMP1_ENST00000512574.1_Missense_Mutation_p.R395K|CRMP1_ENST00000324989.7_Missense_Mutation_p.R511K|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	397					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCGCCCTTTCCTTGGGTACAG	0.527																																					p.R511K		Atlas-SNP	.											.	CRMP1	118	.	0			c.G1532A						.						145.0	133.0	137.0					4																	5837733		2203	4300	6503	SO:0001583	missense	1400	exon11			CCTTTCCTTGGGT	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1190G>A	chr4.hg19:g.5837733C>T	ENSP00000380987:p.Arg397Lys	142.0	0.0		91.0	18.0	NM_001014809	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	ENST00000397890.2	hg19	CCDS43207.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719167	0.89205	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.89939	-2.59;-2.59;-2.59	4.33	4.33	0.51752	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.85643	0.5744	N	0.21508	0.67	0.80722	D	1	B;B;B;P	0.42357	0.062;0.214;0.011;0.777	B;B;B;P	0.47346	0.177;0.147;0.042;0.544	D	0.85496	0.1188	10	0.36615	T	0.2	-23.1461	16.3427	0.83092	0.0:1.0:0.0:0.0	.	511;395;397;334	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	K	511;397;397;395	ENSP00000321606:R511K;ENSP00000380987:R397K;ENSP00000425742:R395K	ENSP00000321606:R511K	R	-	2	0	CRMP1	5888634	0.954000	0.32549	0.972000	0.41901	0.949000	0.60115	7.309000	0.78937	2.418000	0.82041	0.508000	0.49915	AGG	.	.		0.527	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
ATP8A1	10396	hgsc.bcm.edu	37	4	42580401	42580401	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:42580401C>T	ENST00000381668.5	-	12	1235	c.1004G>A	c.(1003-1005)gGt>gAt	p.G335D	ATP8A1_ENST00000264449.10_Missense_Mutation_p.G335D	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	335					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	ACTAGCGCCACCATCTGTTGG	0.358																																					p.G335D		Atlas-SNP	.											.	ATP8A1	206	.	0			c.G1004A						.						131.0	130.0	131.0					4																	42580401		2203	4300	6503	SO:0001583	missense	10396	exon12			GCGCCACCATCTG	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1004G>A	chr4.hg19:g.42580401C>T	ENSP00000371084:p.Gly335Asp	117.0	0.0		91.0	14.0	NM_001105529	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	hg19	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	C	2.761	-0.257844	0.05791	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.74947	-0.89;-0.89	5.67	5.67	0.87782	ATPase, P-type, ATPase-associated domain (1);	0.064385	0.64402	D	0.000006	T	0.60599	0.2281	N	0.17764	0.52	0.80722	D	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.13407	0.009;0.005;0.002	T	0.55296	-0.8163	10	0.16420	T	0.52	.	16.0524	0.80774	0.0:0.8659:0.1341:0.0	.	335;335;335	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	D	335	ENSP00000371084:G335D;ENSP00000264449:G335D	ENSP00000264449:G335D	G	-	2	0	ATP8A1	42275158	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	5.687000	0.68219	2.663000	0.90544	0.585000	0.79938	GGT	.	.		0.358	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
PABPC4L	132430	hgsc.bcm.edu	37	4	135121364	135121364	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:135121364G>A	ENST00000421491.3	-	2	1067	c.811C>T	c.(811-813)Cga>Tga	p.R271*	PABPC4L_ENST00000529122.2_Nonsense_Mutation_p.R329*			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	271							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						TCAGCCTGTCGCTCGACTTTC	0.453																																					p.R329X		Atlas-SNP	.											.	PABPC4L	60	.	0			c.C985T						.						78.0	65.0	69.0					4																	135121364		692	1591	2283	SO:0001587	stop_gained	132430	exon2			CCTGTCGCTCGAC	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.811C>T	chr4.hg19:g.135121364G>A	ENSP00000463233:p.Arg271*	94.0	0.0		41.0	7.0	NM_001114734		Nonsense_Mutation	SNP	ENST00000421491.3	hg19																																																																																				.	.		0.453	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
FAM134B	54463	hgsc.bcm.edu	37	5	16474884	16474884	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:16474884G>A	ENST00000306320.9	-	9	1546	c.1460C>T	c.(1459-1461)tCa>tTa	p.S487L	FAM134B_ENST00000399793.2_Missense_Mutation_p.S346L	NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	487					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						AAGGAAACCTGAAGACTTCTT	0.383																																					p.S487L		Atlas-SNP	.											.	FAM134B	72	.	0			c.C1460T						.						123.0	118.0	119.0					5																	16474884		1877	4111	5988	SO:0001583	missense	54463	exon9			AAACCTGAAGACT	BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.1460C>T	chr5.hg19:g.16474884G>A	ENSP00000304642:p.Ser487Leu	135.0	0.0		115.0	54.0	NM_001034850	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Missense_Mutation	SNP	ENST00000306320.9	hg19	CCDS43304.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.317078	0.60524	.	.	ENSG00000154153	ENST00000399793;ENST00000306320	T;T	0.55052	0.63;0.54	5.82	4.96	0.65561	.	0.319926	0.34046	N	0.004312	T	0.50137	0.1598	L	0.55481	1.735	0.48830	D	0.999713	P;B	0.46395	0.877;0.421	B;B	0.40636	0.335;0.221	T	0.56098	-0.8035	10	0.62326	D	0.03	-1.5733	14.657	0.68841	0.0694:0.0:0.9306:0.0	.	487;346	Q9H6L5;Q9H6L5-2	F134B_HUMAN;.	L	346;487	ENSP00000382691:S346L;ENSP00000304642:S487L	ENSP00000304642:S487L	S	-	2	0	FAM134B	16527884	1.000000	0.71417	0.983000	0.44433	0.990000	0.78478	5.819000	0.69243	1.464000	0.47987	0.655000	0.94253	TCA	.	.		0.383	FAM134B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366090.1	NM_001034850	
C5orf22	55322	hgsc.bcm.edu	37	5	31534433	31534433	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:31534433G>C	ENST00000325366.9	+	2	263	c.136G>C	c.(136-138)Gta>Cta	p.V46L	C5orf22_ENST00000355907.3_5'UTR|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000511367.2_5'Flank|DROSHA_ENST00000513349.1_5'Flank	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	46										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						TGCCAGTAATGTAAGTTTTTT	0.408																																					p.V46L		Atlas-SNP	.											.	C5orf22	48	.	0			c.G136C						.						168.0	155.0	160.0					5																	31534433		2203	4300	6503	SO:0001583	missense	55322	exon2			AGTAATGTAAGTT	AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.136G>C	chr5.hg19:g.31534433G>C	ENSP00000326879:p.Val46Leu	505.0	0.0		328.0	64.0	NM_018356	Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	ENST00000325366.9	hg19	CCDS3895.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291638	0.59976	.	.	ENSG00000082213	ENST00000325366;ENST00000507818	T;T	0.40756	1.02;1.02	5.41	4.25	0.50352	.	0.046947	0.85682	D	0.000000	T	0.20740	0.0499	N	0.04203	-0.255	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03863	-1.0997	10	0.23302	T	0.38	-15.2709	11.4383	0.50081	0.9286:0.0:0.0714:0.0	.	46	Q49AR2	CE022_HUMAN	L	46	ENSP00000326879:V46L;ENSP00000430860:V46L	ENSP00000326879:V46L	V	+	1	0	C5orf22	31570190	1.000000	0.71417	0.933000	0.37362	0.873000	0.50193	4.504000	0.60414	0.869000	0.35703	-0.294000	0.09567	GTA	.	.		0.408	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356	
TMEM173	340061	hgsc.bcm.edu	37	5	138855859	138855859	+	Missense_Mutation	SNP	G	G	T	rs370381358		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:138855859G>T	ENST00000330794.4	-	8	1460	c.1127C>A	c.(1126-1128)aCg>aAg	p.T376K	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	376	C-terminal tail (CTT).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGAGAAATCCGTGCGGAGAGG	0.602																																					p.T376K		Atlas-SNP	.											.	TMEM173	19	.	0			c.C1127A						.						43.0	43.0	43.0					5																	138855859		2203	4300	6503	SO:0001583	missense	340061	exon8			AAATCCGTGCGGA		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.1127C>A	chr5.hg19:g.138855859G>T	ENSP00000331288:p.Thr376Lys	116.0	0.0		67.0	31.0	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	hg19	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892396	0.33442	.	.	ENSG00000184584	ENST00000330794	T	0.24908	1.83	5.36	4.48	0.54585	.	0.782790	0.11811	N	0.527174	T	0.24470	0.0593	L	0.34521	1.04	0.09310	N	1	P	0.40638	0.725	B	0.40165	0.321	T	0.10776	-1.0615	10	0.72032	D	0.01	-2.6099	13.2827	0.60224	0.0:0.3784:0.6215:0.0	.	376	Q86WV6	TM173_HUMAN	K	376	ENSP00000331288:T376K	ENSP00000331288:T376K	T	-	2	0	TMEM173	138836043	0.031000	0.19500	0.079000	0.20413	0.099000	0.18886	1.556000	0.36288	1.230000	0.43646	0.462000	0.41574	ACG	.	.		0.602	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
PCDHA10	56139	hgsc.bcm.edu	37	5	140237874	140237874	+	Silent	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:140237874T>C	ENST00000307360.5	+	1	2241	c.2241T>C	c.(2239-2241)tcT>tcC	p.S747S	PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	747	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTGGTCTTACTCGCAGC	0.672																																					p.S747S		Atlas-SNP	.											.	PCDHA10	358	.	0			c.T2241C						.						44.0	49.0	47.0					5																	140237874		1322	2289	3611	SO:0001819	synonymous_variant	56139	exon1			CTGGTCTTACTCG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.2241T>C	chr5.hg19:g.140237874T>C		285.0	0.0		134.0	29.0	NM_031859	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	hg19	CCDS54921.1																																																																																			.	.		0.672	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
PCDHGA5	56110	hgsc.bcm.edu	37	5	140746244	140746244	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr5:140746244G>A	ENST00000518069.1	+	1	2347	c.2347G>A	c.(2347-2349)Gag>Aag	p.E783K	PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	783					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTAGTGAAGAGAGCTGTGA	0.512																																					p.E783K		Atlas-SNP	.											.	PCDHGA5	215	.	0			c.G2347A						.						108.0	121.0	117.0					5																	140746244		2203	4299	6502	SO:0001583	missense	56110	exon1			AGTGAAGAGAGCT	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2347G>A	chr5.hg19:g.140746244G>A	ENSP00000429834:p.Glu783Lys	161.0	0.0		81.0	16.0	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	hg19	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	14.26	2.481816	0.44147	.	.	ENSG00000253485	ENST00000518069	D	0.94613	-3.47	5.3	3.39	0.38822	.	.	.	.	.	D	0.94159	0.8126	M	0.88181	2.935	0.09310	N	1	B;B	0.22541	0.071;0.042	B;B	0.29663	0.105;0.049	D	0.86697	0.1927	9	0.37606	T	0.19	.	6.673	0.23078	0.0963:0.2763:0.6274:0.0	.	783;783	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	K	783	ENSP00000429834:E783K	ENSP00000429834:E783K	E	+	1	0	PCDHGA5	140726428	0.929000	0.31497	0.431000	0.26735	0.736000	0.42039	1.204000	0.32296	2.630000	0.89119	0.655000	0.94253	GAG	.	.		0.512	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
HOXA4	3201	hgsc.bcm.edu	37	7	27168891	27168891	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:27168891G>A	ENST00000360046.5	-	2	981	c.916C>T	c.(916-918)Ccc>Tcc	p.P306S	HOXA4_ENST00000428284.2_Missense_Mutation_p.P306S|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA3_ENST00000521401.1_Intron|HOXA3_ENST00000317201.2_5'Flank|HOXA-AS2_ENST00000521159.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	306					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						tgggggtggggatggaggtgt	0.547																																					p.P306S		Atlas-SNP	.											HOXA4,NS,carcinoma,0,1	HOXA4	21	.	0			c.C916T						.						164.0	161.0	162.0					7																	27168891		2203	4300	6503	SO:0001583	missense	3201	exon2			GGTGGGGATGGAG		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.916C>T	chr7.hg19:g.27168891G>A	ENSP00000353151:p.Pro306Ser	321.0	1.0		343.0	56.0	NM_002141	A4D180|O43366	Missense_Mutation	SNP	ENST00000360046.5	hg19	CCDS5405.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.16|10.16	1.274601|1.274601	0.23307|0.23307	.|.	.|.	ENSG00000197576|ENSG00000197576	ENST00000360046;ENST00000428284|ENST00000511914	D;D|.	0.87491|.	-2.26;-2.26|.	5.38|5.38	2.6|2.6	0.31112|0.31112	.|.	0.185824|.	0.26578|.	N|.	0.023592|.	T|T	0.29389|0.29389	0.0732|0.0732	L|L	0.27053|0.27053	0.805|0.805	0.27216|0.27216	N|N	0.959771|0.959771	B|.	0.25719|.	0.132|.	B|.	0.20767|.	0.031|.	T|T	0.21381|0.21381	-1.0247|-1.0247	10|5	0.62326|.	D|.	0.03|.	.|.	6.2652|6.2652	0.20922|0.20922	0.2128:0.1329:0.6543:0.0|0.2128:0.1329:0.6543:0.0	.|.	306|.	Q00056|.	HXA4_HUMAN|.	S|F	306|125	ENSP00000353151:P306S;ENSP00000408845:P306S|.	ENSP00000353151:P306S|.	P|S	-|-	1|2	0|0	HOXA4|HOXA4	27135416|27135416	.|.	.|.	0.953000|0.953000	0.39169|0.39169	0.864000|0.864000	0.49448|0.49448	.|.	.|.	0.271000|0.271000	0.22005|0.22005	-0.484000|-0.484000	0.04775|0.04775	CCC|TCC	.	.		0.547	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4		
SEMA3D	223117	hgsc.bcm.edu	37	7	84666319	84666319	+	Silent	SNP	C	C	G	rs143217112		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:84666319C>G	ENST00000284136.6	-	10	1120	c.1077G>C	c.(1075-1077)gtG>gtC	p.V359V	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	359	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CCATGCTATACACACAAACAG	0.398																																					p.V359V	Ovarian(63;442 1191 17318 29975 31528)	Atlas-SNP	.											.	SEMA3D	177	.	0			c.G1077C						.						104.0	93.0	97.0					7																	84666319		2203	4300	6503	SO:0001819	synonymous_variant	223117	exon10			GCTATACACACAA	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1077G>C	chr7.hg19:g.84666319C>G		117.0	0.0		66.0	15.0	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	ENST00000284136.6	hg19	CCDS34676.1																																																																																			.	C|1.000;T|0.000		0.398	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
ZSCAN25	221785	hgsc.bcm.edu	37	7	99227217	99227217	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:99227217C>T	ENST00000394152.2	+	8	1536	c.1209C>T	c.(1207-1209)taC>taT	p.Y403Y	ZSCAN25_ENST00000334715.3_Silent_p.Y403Y|ZSCAN25_ENST00000262941.6_Silent_p.Y331Y|ZSCAN25_ENST00000466948.1_Intron	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	403					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGAGGCCCTACGTGTGCAGCG	0.572																																					p.Y403Y		Atlas-SNP	.											.	.	.	.	0			c.C1209T						.						66.0	63.0	64.0					7																	99227217		2203	4300	6503	SO:0001819	synonymous_variant	221785	exon8			GCCCTACGTGTGC	AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.1209C>T	chr7.hg19:g.99227217C>T		77.0	0.0		46.0	11.0	NM_145115	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Silent	SNP	ENST00000394152.2	hg19	CCDS5671.2																																																																																			.	.		0.572	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157203.4	NM_145115	
FLNC	2318	hgsc.bcm.edu	37	7	128489494	128489494	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:128489494G>A	ENST00000325888.8	+	30	5322	c.5061G>A	c.(5059-5061)ggG>ggA	p.G1687G	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.G1687G	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1687					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CGCCGGATGGGGCAGAGCTCG	0.602																																					p.G1687G		Atlas-SNP	.											.	FLNC	339	.	0			c.G5061A						.						93.0	111.0	105.0					7																	128489494		2191	4275	6466	SO:0001819	synonymous_variant	2318	exon30			GGATGGGGCAGAG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5061G>A	chr7.hg19:g.128489494G>A		94.0	0.0		73.0	10.0	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	ENST00000325888.8	hg19	CCDS43644.1																																																																																			.	.		0.602	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
CNOT4	4850	hgsc.bcm.edu	37	7	135107050	135107050	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:135107050T>C	ENST00000315544.5	-	3	506	c.227A>G	c.(226-228)cAa>cGa	p.Q76R	CNOT4_ENST00000451834.1_Missense_Mutation_p.Q76R|CNOT4_ENST00000414802.1_Missense_Mutation_p.Q76R|CNOT4_ENST00000428680.2_Missense_Mutation_p.Q76R|CNOT4_ENST00000361528.4_Missense_Mutation_p.Q76R|CNOT4_ENST00000356162.4_Missense_Mutation_p.Q76R|CNOT4_ENST00000541284.1_Missense_Mutation_p.Q76R|CNOT4_ENST00000423368.2_Missense_Mutation_p.Q76R	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	76					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						CTTTATCCTTTGCAGCTCTTC	0.338																																					p.Q76R	Ovarian(51;766 1130 5502 35047 50875)	Atlas-SNP	.											.	CNOT4	146	.	0			c.A227G						.						120.0	110.0	113.0					7																	135107050		1807	4082	5889	SO:0001583	missense	4850	exon3			ATCCTTTGCAGCT	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.227A>G	chr7.hg19:g.135107050T>C	ENSP00000326731:p.Gln76Arg	272.0	0.0		206.0	34.0	NM_001190850	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	ENST00000315544.5	hg19	CCDS55166.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.305288	0.60305	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528;ENST00000414802;ENST00000356162;ENST00000428680;ENST00000315544	T;T;T;T;T;T;T;T	0.43688	0.95;0.94;0.95;0.95;0.95;0.95;0.94;0.94	5.97	5.97	0.96955	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.48223	0.1488	N	0.20328	0.56	0.80722	D	1	B;B;B;B;P;P	0.48294	0.038;0.022;0.012;0.021;0.908;0.908	B;B;B;B;P;P	0.61397	0.018;0.041;0.006;0.013;0.888;0.888	T	0.45760	-0.9239	10	0.40728	T	0.16	-5.4292	16.1343	0.81471	0.0:0.0:0.0:1.0	.	76;76;76;76;76;76	E7ET38;F8VQP3;O95628;O95628-2;O95628-4;O95628-8	.;.;CNOT4_HUMAN;.;.;.	R	76	ENSP00000445508:Q76R;ENSP00000388491:Q76R;ENSP00000406777:Q76R;ENSP00000354673:Q76R;ENSP00000416532:Q76R;ENSP00000348485:Q76R;ENSP00000399108:Q76R;ENSP00000326731:Q76R	ENSP00000262563:Q76R	Q	-	2	0	CNOT4	134757590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.288000	0.76882	0.533000	0.62120	CAA	.	.		0.338	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
GSTK1	373156	hgsc.bcm.edu	37	7	142964755	142964755	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr7:142964755C>A	ENST00000358406.5	+	6	537	c.466C>A	c.(466-468)Ctg>Atg	p.L156M	AC073342.12_ENST00000427392.1_RNA|GSTK1_ENST00000479303.1_Missense_Mutation_p.L212M|GSTK1_ENST00000409500.3_Missense_Mutation_p.L144M|GSTK1_ENST00000443571.2_Missense_Mutation_p.L113M	NM_015917.2	NP_057001.1	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1	156					epithelial cell differentiation (GO:0030855)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|peroxisome (GO:0005777)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|protein disulfide oxidoreductase activity (GO:0015035)|receptor binding (GO:0005102)			lung(4)	4	Melanoma(164;0.059)				Glutathione(DB00143)	CCAGGGACTTCTGGAAAAGAT	0.507																																					p.L212M		Atlas-SNP	.											.	GSTK1	36	.	0			c.C634A						.						133.0	124.0	127.0					7																	142964755		2203	4300	6503	SO:0001583	missense	373156	exon5			GGACTTCTGGAAA		CCDS5877.1, CCDS47730.1, CCDS47731.1, CCDS47732.1	7q34	2012-06-21			ENSG00000197448	ENSG00000197448	2.5.1.18	"""Glutathione S-transferases / Mitochondrial (kappa)"""	16906	protein-coding gene	gene with protein product		602321				12720545, 14742434	Standard	NM_015917		Approved	GST13	uc003wcj.3	Q9Y2Q3	OTTHUMG00000152637	ENST00000358406.5:c.466C>A	chr7.hg19:g.142964755C>A	ENSP00000351181:p.Leu156Met	103.0	0.0		108.0	42.0	NM_001143679	B4DIH1|B4DSY2|Q6P4H0|Q7Z520|Q9P1S4	Missense_Mutation	SNP	ENST00000358406.5	hg19	CCDS5877.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823752	0.50739	.	.	ENSG00000197448	ENST00000409500;ENST00000443571;ENST00000358406;ENST00000479303	.	.	.	5.28	2.42	0.29668	Protein disulphide isomerase, central domain (1);DSBA-like thioredoxin domain (1);Thioredoxin-like fold (1);	0.140610	0.49305	N	0.000147	T	0.56558	0.1993	M	0.78285	2.405	0.09310	N	0.999999	D;D;D;D	0.89917	0.997;0.999;1.0;0.999	D;D;D;D	0.80764	0.988;0.979;0.994;0.988	T	0.46527	-0.9185	9	0.44086	T	0.13	-10.1516	3.6875	0.08334	0.2986:0.4751:0.1449:0.0813	.	144;113;212;156	Q9Y2Q3-3;Q9Y2Q3-4;Q9Y2Q3-2;Q9Y2Q3	.;.;.;GSTK1_HUMAN	M	144;113;156;212	.	ENSP00000351181:L156M	L	+	1	2	GSTK1	142674877	0.860000	0.29831	0.015000	0.15790	0.090000	0.18270	1.852000	0.39348	0.219000	0.20840	-0.310000	0.09108	CTG	.	.		0.507	GSTK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327091.1	NM_015917	
CYP7A1	1581	hgsc.bcm.edu	37	8	59409293	59409293	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:59409293G>A	ENST00000301645.3	-	3	915	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	260					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				AGAAACATGCGCAGGCTGATC	0.527									Neonatal Giant Cell Hepatitis																												p.R260C		Atlas-SNP	.											.	CYP7A1	76	.	0			c.C778T						.						216.0	217.0	217.0					8																	59409293		2203	4300	6503	SO:0001583	missense	1581	exon3	Familial Cancer Database	Neonatal Hemochromatosis	ACATGCGCAGGCT	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.778C>T	chr8.hg19:g.59409293G>A	ENSP00000301645:p.Arg260Cys	203.0	0.0		172.0	41.0	NM_000780	P78454|Q3MIL8|Q7KZ19	Missense_Mutation	SNP	ENST00000301645.3	hg19	CCDS6171.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185375	0.38609	.	.	ENSG00000167910	ENST00000301645	T	0.12361	2.69	4.16	4.16	0.48862	.	0.141832	0.64402	D	0.000007	T	0.41858	0.1177	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46512	-0.9186	10	0.39692	T	0.17	-10.8183	16.8184	0.85739	0.0:0.0:1.0:0.0	.	260	P22680	CP7A1_HUMAN	C	260	ENSP00000301645:R260C	ENSP00000301645:R260C	R	-	1	0	CYP7A1	59571847	1.000000	0.71417	0.998000	0.56505	0.025000	0.11179	3.613000	0.54152	1.992000	0.58205	0.563000	0.77884	CGC	.	.		0.527	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780	
FOXH1	8928	hgsc.bcm.edu	37	8	145700607	145700607	+	Missense_Mutation	SNP	C	C	A	rs150426097		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr8:145700607C>A	ENST00000377317.4	-	2	790	c.212G>T	c.(211-213)aGg>aTg	p.R71M	FOXH1_ENST00000525197.1_Splice_Site	NM_003923.2	NP_003914.1	O75593	FOXH1_HUMAN	forkhead box H1	71					aorta morphogenesis (GO:0035909)|axial mesoderm development (GO:0048318)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|heart looping (GO:0001947)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular trabecula myocardium morphogenesis (GO:0003222)	activin responsive factor complex (GO:0032444)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|co-SMAD binding (GO:0070410)|enhancer binding (GO:0035326)|protein domain specific binding (GO:0019904)|R-SMAD binding (GO:0070412)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GTAGTCTTCCCTGAAGAAGGG	0.677																																					p.R71M		Atlas-SNP	.											.	FOXH1	17	.	0			c.G212T						.						43.0	42.0	43.0					8																	145700607		2202	4299	6501	SO:0001583	missense	8928	exon2			TCTTCCCTGAAGA	AF076292	CCDS6428.1	8q24.3	2014-08-12			ENSG00000160973			"""Forkhead boxes"""	3814	protein-coding gene	gene with protein product		603621				9702198	Standard	NM_003923		Approved	FAST1	uc003zdc.3	O75593	OTTHUMG00000165172	ENST00000377317.4:c.212G>T	chr8.hg19:g.145700607C>A	ENSP00000366534:p.Arg71Met	59.0	0.0		58.0	13.0	NM_003923	D3DWM4	Missense_Mutation	SNP	ENST00000377317.4	hg19	CCDS6428.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886553	0.51908	.	.	ENSG00000160973	ENST00000377317;ENST00000292541	D	0.96427	-4.01	5.09	0.612	0.17591	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.239729	0.39985	N	0.001219	D	0.94804	0.8322	M	0.89968	3.075	0.36732	D	0.881752	P	0.38617	0.64	B	0.33620	0.167	D	0.92021	0.5626	10	0.87932	D	0	-22.7546	5.9088	0.19016	0.141:0.5887:0.0:0.2703	.	71	O75593	FOXH1_HUMAN	M	71;98	ENSP00000366534:R71M	ENSP00000292541:R98M	R	-	2	0	FOXH1	145671415	0.326000	0.24669	0.999000	0.59377	0.971000	0.66376	0.255000	0.18333	0.177000	0.19895	0.563000	0.77884	AGG	.	C|1.000;T|0.000		0.677	FOXH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382451.1		
IFNW1	3467	hgsc.bcm.edu	37	9	21141286	21141286	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr9:21141286C>A	ENST00000380229.2	-	1	858	c.284G>T	c.(283-285)cGc>cTc	p.R95L		NM_002177.1	NP_002168.1	P05000	IFNW1_HUMAN	interferon, omega 1	95			R -> S (in dbSNP:rs2230055).		adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cell cycle arrest (GO:0007050)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|lung(2)|ovary(1)	5				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		AGCAGAGGAGCGCTCTGTGTG	0.557																																					p.R95L		Atlas-SNP	.											.	IFNW1	20	.	0			c.G284T						.						89.0	86.0	87.0					9																	21141286		2203	4300	6503	SO:0001583	missense	3467	exon1			GAGGAGCGCTCTG		CCDS6496.1	9p22	2010-12-10			ENSG00000177047	ENSG00000177047		"""Interferons"""	5448	protein-coding gene	gene with protein product	"""IFN-omega 1, interferon omega-1"""	147553				1385305	Standard	NM_002177		Approved		uc003zol.1	P05000	OTTHUMG00000019656	ENST00000380229.2:c.284G>T	chr9.hg19:g.21141286C>A	ENSP00000369578:p.Arg95Leu	113.0	0.0		30.0	9.0	NM_002177	Q13168|Q5U802|Q5VWD0|Q7M4P5	Missense_Mutation	SNP	ENST00000380229.2	hg19	CCDS6496.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948608	0.34377	.	.	ENSG00000177047	ENST00000380229	T	0.03413	3.94	4.54	-6.97	0.01616	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.767260	0.02616	N	0.102690	T	0.03871	0.0109	L	0.48642	1.525	0.09310	N	1	B	0.27166	0.17	B	0.29716	0.106	T	0.39121	-0.9629	10	0.48119	T	0.1	.	3.0022	0.06017	0.1055:0.1575:0.2256:0.5113	.	95	P05000	IFNW1_HUMAN	L	95	ENSP00000369578:R95L	ENSP00000369578:R95L	R	-	2	0	IFNW1	21131286	0.000000	0.05858	0.000000	0.03702	0.540000	0.34992	-2.191000	0.01246	-1.121000	0.02949	-1.446000	0.01064	CGC	.	.		0.557	IFNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051885.1	NM_002177	
NOL6	65083	hgsc.bcm.edu	37	9	33468831	33468831	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr9:33468831C>G	ENST00000379471.2	-	8	1153	c.1066G>C	c.(1066-1068)Gtt>Ctt	p.V356L	NOL6_ENST00000455041.2_Missense_Mutation_p.V296L|NOL6_ENST00000464829.1_5'UTR			Q9H6R4	NOL6_HUMAN	nucleolar protein 6 (RNA-associated)	356					rRNA processing (GO:0006364)	condensed nuclear chromosome (GO:0000794)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|skin(2)	27			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AGGAAGACAACCAGCATGGAG	0.562																																					p.V356L		Atlas-SNP	.											.	NOL6	85	.	0			c.G1066C						.						181.0	181.0	181.0					9																	33468831		2203	4300	6503	SO:0001583	missense	65083	exon8			AGACAACCAGCAT	AF361079	CCDS6543.1, CCDS6544.1	9p12	2013-02-22	2013-02-22		ENSG00000165271	ENSG00000165271			19910	protein-coding gene	gene with protein product		611532	"""nucleolar protein family 6 (RNA-associated)"""			11895476, 15590835	Standard	NM_022917		Approved	bA311H10.1, Nrap, FLJ21959, MGC14896, MGC14921, MGC20838, UTP22	uc003zsz.3	Q9H6R4	OTTHUMG00000000394	ENST00000379471.2:c.1066G>C	chr9.hg19:g.33468831C>G	ENSP00000368784:p.Val356Leu	114.0	0.0		63.0	22.0	NM_022917	Q5T5M3|Q5T5M4|Q7L4G6|Q8N6I0|Q8TEY9|Q8TEZ0|Q8TEZ1|Q9H675	Missense_Mutation	SNP	ENST00000379471.2	hg19		.	.	.	.	.	.	.	.	.	.	C	9.620	1.133691	0.21123	.	.	ENSG00000165271	ENST00000353159;ENST00000297990;ENST00000379471;ENST00000325914;ENST00000455041	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	4.88	3.03	0.35002	.	0.354004	0.29579	N	0.011752	T	0.20129	0.0484	L	0.31664	0.95	0.41365	D	0.987458	B;B;B;B;B	0.12013	0.001;0.001;0.001;0.005;0.001	B;B;B;B;B	0.14578	0.011;0.004;0.005;0.011;0.007	T	0.12837	-1.0532	10	0.02654	T	1	.	8.2247	0.31562	0.0:0.751:0.0:0.249	.	296;356;356;356;356	B4DF80;Q9H6R4-4;Q9H6R4-2;Q9H6R4-3;Q9H6R4	.;.;.;.;NOL6_HUMAN	L	356;356;356;356;296	ENSP00000313978:V356L;ENSP00000297990:V356L;ENSP00000368784:V356L;ENSP00000395915:V296L	ENSP00000297990:V356L	V	-	1	0	NOL6	33458831	0.999000	0.42202	1.000000	0.80357	0.941000	0.58515	0.690000	0.25451	0.489000	0.27749	-0.258000	0.10820	GTT	.	.		0.562	NOL6-005	NOVEL	non_canonical_TEC|basic	protein_coding	protein_coding	OTTHUMT00000001019.2	NM_022917	
SFMBT2	57713	hgsc.bcm.edu	37	10	7285628	7285628	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:7285628G>A	ENST00000361972.4	-	9	1102	c.1012C>T	c.(1012-1014)Cta>Tta	p.L338L	SFMBT2_ENST00000397167.1_Silent_p.L338L	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	338					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TCAGGTCTTAGGTCATCAATA	0.383																																					p.L338L		Atlas-SNP	.											.	SFMBT2	209	.	0			c.C1012T						.						68.0	64.0	65.0					10																	7285628		2203	4300	6503	SO:0001819	synonymous_variant	57713	exon9			GTCTTAGGTCATC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1012C>T	chr10.hg19:g.7285628G>A		93.0	0.0		104.0	11.0	NM_001029880	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	hg19	CCDS31138.1																																																																																			.	.		0.383	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
MCM10	55388	hgsc.bcm.edu	37	10	13212934	13212934	+	Missense_Mutation	SNP	A	A	G	rs571506868		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:13212934A>G	ENST00000484800.2	+	3	123	c.20A>G	c.(19-21)aAt>aGt	p.N7S	MCM10_ENST00000378714.3_Missense_Mutation_p.N7S|MCM10_ENST00000378694.1_Missense_Mutation_p.N7S			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	7	N-terminal domain. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GAGGAAGACAATCTGTCTCTG	0.453													A|||	1	0.000199681	0.0	0.0	5008	,	,		20580	0.0		0.001	False		,,,				2504	0.0				p.N7S		Atlas-SNP	.											.	MCM10	76	.	0			c.A20G						.						57.0	59.0	58.0					10																	13212934		2203	4300	6503	SO:0001583	missense	55388	exon3			AAGACAATCTGTC	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.20A>G	chr10.hg19:g.13212934A>G	ENSP00000418268:p.Asn7Ser	168.0	0.0		247.0	127.0	NM_182751	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	hg19	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.784078	0.49997	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.14144	2.53;2.53;2.53	5.91	4.77	0.60923	.	0.140827	0.64402	D	0.000007	T	0.09379	0.0231	N	0.14661	0.345	0.32618	N	0.523713	B;B;B	0.23937	0.094;0.082;0.049	B;B;B	0.21708	0.026;0.036;0.016	T	0.05370	-1.0889	10	0.56958	D	0.05	-0.4625	12.1524	0.54057	0.9332:0.0:0.0668:0.0	.	7;7;7	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	S	7	ENSP00000367986:N7S;ENSP00000418268:N7S;ENSP00000367966:N7S	ENSP00000354945:N7S	N	+	2	0	MCM10	13252940	0.999000	0.42202	0.993000	0.49108	0.943000	0.58893	4.456000	0.60081	1.046000	0.40249	0.533000	0.62120	AAT	.	.		0.453	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37505198	37505198	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:37505198G>C	ENST00000602533.1	+	32	2890	c.2791G>C	c.(2791-2793)Gga>Cga	p.G931R	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.G931R|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.G1050R			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	987					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ACAACGTACAGGAAAAATGGA	0.333																																					p.G931R		Atlas-SNP	.											ANKRD30A_ENST00000602533,NS,carcinoma,-1,1	ANKRD30A	448	.	0			c.G2791C						.						77.0	73.0	74.0					10																	37505198		1815	4067	5882	SO:0001583	missense	91074	exon32			CGTACAGGAAAAA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2791G>C	chr10.hg19:g.37505198G>C	ENSP00000473551:p.Gly931Arg	475.0	0.0		576.0	57.0	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	hg19		.	.	.	.	.	.	.	.	.	.	g	0.052	-1.246677	0.01481	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05258	3.47;3.47	2.63	1.71	0.24356	.	.	.	.	.	T	0.03564	0.0102	N	0.12961	0.28	0.09310	N	1	B	0.26081	0.141	B	0.20955	0.032	T	0.43245	-0.9403	9	0.41790	T	0.15	.	4.5817	0.12262	0.3205:0.0:0.6795:0.0	.	987	Q9BXX3	AN30A_HUMAN	R	931;1050	ENSP00000354432:G931R;ENSP00000363792:G1050R	ENSP00000354432:G931R	G	+	1	0	ANKRD30A	37545204	0.003000	0.15002	0.002000	0.10522	0.003000	0.03518	0.318000	0.19504	0.297000	0.22615	0.313000	0.20887	GGA	.	.		0.333	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
CDHR1	92211	hgsc.bcm.edu	37	10	85955343	85955343	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:85955343T>C	ENST00000372117.3	+	2	252	c.149T>C	c.(148-150)gTa>gCa	p.V50A	CDHR1_ENST00000332904.3_Missense_Mutation_p.V50A	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	50	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						GACACCCCTGTAGGTGAGTAG	0.612																																					p.V50A		Atlas-SNP	.											.	CDHR1	122	.	0			c.T149C						.						99.0	86.0	90.0					10																	85955343		2203	4300	6503	SO:0001583	missense	92211	exon2			CCCCTGTAGGTGA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.149T>C	chr10.hg19:g.85955343T>C	ENSP00000361189:p.Val50Ala	96.0	0.0		66.0	17.0	NM_001171971	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	hg19	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359078	0.82353	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.53206	0.63;0.63	4.78	4.78	0.61160	Cadherin (3);Cadherin-like (1);	0.215283	0.39687	N	0.001291	T	0.61362	0.2341	M	0.62154	1.92	0.80722	D	1	D;D	0.69078	0.996;0.997	P;D	0.66497	0.907;0.944	T	0.58601	-0.7608	10	0.24483	T	0.36	-9.5748	13.3093	0.60370	0.0:0.0:0.0:1.0	.	50;50	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	A	50	ENSP00000331063:V50A;ENSP00000361189:V50A	ENSP00000331063:V50A	V	+	2	0	CDHR1	85945323	1.000000	0.71417	0.946000	0.38457	0.900000	0.52787	6.651000	0.74372	1.782000	0.52362	0.459000	0.35465	GTA	.	.		0.612	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
KNDC1	85442	hgsc.bcm.edu	37	10	135025036	135025036	+	Missense_Mutation	SNP	G	G	T	rs151235501		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:135025036G>T	ENST00000304613.3	+	22	4040	c.4019G>T	c.(4018-4020)gGg>gTg	p.G1340V	KNDC1_ENST00000368572.2_Missense_Mutation_p.G1342V			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1340	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CGGAACAGCGGGCTGCTGGGG	0.667																																					p.G1340V		Atlas-SNP	.											.	KNDC1	155	.	0			c.G4019T						.						88.0	91.0	90.0					10																	135025036		2203	4300	6503	SO:0001583	missense	85442	exon22			ACAGCGGGCTGCT	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.4019G>T	chr10.hg19:g.135025036G>T	ENSP00000304437:p.Gly1340Val	74.0	0.0		65.0	23.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	hg19	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507447	0.27036	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.46451	0.87;0.87	3.96	0.693	0.18056	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.803958	0.11184	U	0.590657	T	0.33089	0.0851	L	0.43152	1.355	0.21147	N	0.999776	P	0.49559	0.925	P	0.44732	0.459	T	0.14282	-1.0478	10	0.33940	T	0.23	-15.4731	4.3895	0.11334	0.229:0.358:0.413:0.0	.	1340	Q76NI1	VKIND_HUMAN	V	1340;1342	ENSP00000304437:G1340V;ENSP00000357561:G1342V	ENSP00000304437:G1340V	G	+	2	0	KNDC1	134875026	0.014000	0.17966	0.080000	0.20451	0.173000	0.22820	0.575000	0.23729	-0.084000	0.12595	0.297000	0.19635	GGG	.	G|1.000;A|0.000		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KCNA5	3741	hgsc.bcm.edu	37	12	5154891	5154891	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:5154891A>T	ENST00000252321.3	+	1	1807	c.1578A>T	c.(1576-1578)gaA>gaT	p.E526D		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	526					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	ACCACCGGGAAACGGATCACG	0.632																																					p.E526D		Atlas-SNP	.											.	KCNA5	138	.	0			c.A1578T						.						75.0	70.0	71.0					12																	5154891		2203	4300	6503	SO:0001583	missense	3741	exon1			CCGGGAAACGGAT	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1578A>T	chr12.hg19:g.5154891A>T	ENSP00000252321:p.Glu526Asp	114.0	0.0		64.0	14.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	hg19	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.177095	0.57692	.	.	ENSG00000130037	ENST00000252321	D	0.97850	-4.57	4.94	3.13	0.36017	.	0.000000	0.85682	U	0.000000	D	0.97408	0.9152	M	0.90483	3.12	0.51482	D	0.999925	P	0.42161	0.772	B	0.43809	0.432	D	0.96105	0.9072	10	0.87932	D	0	.	8.0911	0.30801	0.2461:0.0:0.7539:0.0	.	526	P22460	KCNA5_HUMAN	D	526	ENSP00000252321:E526D	ENSP00000252321:E526D	E	+	3	2	KCNA5	5025152	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.129000	0.31381	0.682000	0.31407	-0.252000	0.11476	GAA	.	.		0.632	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
RAPGEF3	10411	hgsc.bcm.edu	37	12	48135289	48135289	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:48135289A>G	ENST00000449771.2	-	19	2010	c.1922T>C	c.(1921-1923)cTg>cCg	p.L641P	RAPGEF3_ENST00000548919.1_Splice_Site_p.L550P|RP1-197B17.3_ENST00000547799.1_lincRNA|RAPGEF3_ENST00000389212.3_Splice_Site_p.L641P|RAPGEF3_ENST00000405493.2_Splice_Site_p.L599P|RAPGEF3_ENST00000171000.4_Splice_Site_p.L599P|RAPGEF3_ENST00000549151.1_Splice_Site_p.L599P			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	641					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		GGTCCCTACCAGCTCATGCAC	0.602																																					p.L641P		Atlas-SNP	.											.	RAPGEF3	98	.	0			c.T1922C						.						80.0	80.0	80.0					12																	48135289		2203	4300	6503	SO:0001630	splice_region_variant	10411	exon19			CCTACCAGCTCAT	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.1923+1T>C	chr12.hg19:g.48135289A>G		141.0	0.0		143.0	30.0	NM_001098531	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	hg19	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.081437	0.36758	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000541821;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919	T;T;T;T;T;T	0.74737	-0.87;-0.86;-0.87;-0.87;-0.86;-0.87	5.13	3.99	0.46301	Ras guanine nucleotide exchange factor, domain (1);	0.091635	0.45867	D	0.000338	T	0.71736	0.3375	L	0.34521	1.04	0.80722	D	1	D	0.55800	0.973	P	0.53689	0.732	T	0.72877	-0.4159	10	0.87932	D	0	.	9.2448	0.37518	0.913:0.0:0.087:0.0	.	641	O95398	RPGF3_HUMAN	P	599;641;288;599;599;599;641;604;550	ENSP00000384521:L599P;ENSP00000395708:L641P;ENSP00000448619:L599P;ENSP00000171000:L599P;ENSP00000373864:L641P;ENSP00000448480:L550P	ENSP00000171000:L599P	L	-	2	0	RAPGEF3	46421556	1.000000	0.71417	0.995000	0.50966	0.001000	0.01503	3.342000	0.52159	0.919000	0.36945	-0.250000	0.11733	CTG	.	.		0.602	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	Missense_Mutation
OTOGL	283310	hgsc.bcm.edu	37	12	80732951	80732951	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:80732951G>A	ENST00000547103.1	+	42	4900	c.4894G>A	c.(4894-4896)Gga>Aga	p.G1632R	OTOGL_ENST00000458043.2_Missense_Mutation_p.G1644R			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1632	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TACTCCAGCTGGACTAATCAT	0.418																																					p.G1644R		Atlas-SNP	.											.	OTOGL	235	.	0			c.G4930A						.						205.0	203.0	204.0					12																	80732951		1885	4097	5982	SO:0001583	missense	283310	exon42			CCAGCTGGACTAA	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4894G>A	chr12.hg19:g.80732951G>A	ENSP00000447211:p.Gly1632Arg	186.0	0.0		105.0	14.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.34	3.363714	0.61513	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.61859	0.07;0.07	5.72	4.82	0.62117	.	.	.	.	.	T	0.63438	0.2511	L	0.46670	1.46	0.33889	D	0.637099	.	.	.	.	.	.	T	0.72994	-0.4122	7	0.56958	D	0.05	.	14.9976	0.71446	0.0693:0.0:0.9307:0.0	.	.	.	.	R	1632;1644	ENSP00000447211:G1632R;ENSP00000400895:G1644R	ENSP00000400895:G1644R	G	+	1	0	OTOGL	79257082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.410000	0.66381	2.695000	0.91970	0.650000	0.86243	GGA	.	.		0.418	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
ACACB	32	hgsc.bcm.edu	37	12	109637260	109637260	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:109637260C>T	ENST00000338432.7	+	18	2800	c.2681C>T	c.(2680-2682)cCt>cTt	p.P894L	ACACB_ENST00000377848.3_Missense_Mutation_p.P894L|ACACB_ENST00000377854.5_Missense_Mutation_p.P894L			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	894	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GAGAACGATCCTACAGTCCTG	0.557																																					p.P894L		Atlas-SNP	.											.	ACACB	330	.	0			c.C2681T						.						147.0	135.0	139.0					12																	109637260		2203	4300	6503	SO:0001583	missense	32	exon17			ACGATCCTACAGT	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.2681C>T	chr12.hg19:g.109637260C>T	ENSP00000341044:p.Pro894Leu	91.0	0.0		83.0	15.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	hg19	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367611	0.61513	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	D;D;D	0.81908	-1.55;-1.55;-1.55	5.42	3.58	0.41010	Single hybrid motif (1);	0.049411	0.85682	D	0.000000	D	0.86121	0.5857	M	0.91510	3.215	0.80722	D	1	B	0.22080	0.064	B	0.27170	0.077	D	0.84232	0.0467	10	0.87932	D	0	.	11.3371	0.49511	0.0:0.8036:0.1266:0.0698	.	894	O00763	ACACB_HUMAN	L	894;894;894;125	ENSP00000341044:P894L;ENSP00000367079:P894L;ENSP00000367085:P894L	ENSP00000341044:P894L	P	+	2	0	ACACB	108121643	1.000000	0.71417	0.028000	0.17463	0.331000	0.28603	4.851000	0.62896	0.765000	0.33221	0.585000	0.79938	CCT	.	.		0.557	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
HPD	3242	hgsc.bcm.edu	37	12	122284995	122284995	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr12:122284995T>C	ENST00000289004.4	-	10	757	c.722A>G	c.(721-723)aAt>aGt	p.N241S	HPD_ENST00000543869.2_5'UTR|HPD_ENST00000543163.1_Missense_Mutation_p.N202S	NM_002150.2	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	241					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|urinary_tract(1)	18	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	CGCTGGCTCATTGATGGGCAT	0.592																																					p.N241S		Atlas-SNP	.											.	HPD	46	.	0			c.A722G						.						134.0	129.0	131.0					12																	122284995		2203	4300	6503	SO:0001583	missense	3242	exon10			GGCTCATTGATGG	BC014790	CCDS9224.1, CCDS53839.1	12q24.31	2013-09-19			ENSG00000158104	ENSG00000158104	1.13.11.27		5147	protein-coding gene	gene with protein product	"""glyoxalase domain containing 3"""	609695		PPD			Standard	NM_001171993		Approved	4-HPPD, 4HPPD, GLOD3	uc001ubj.3	P32754	OTTHUMG00000169081	ENST00000289004.4:c.722A>G	chr12.hg19:g.122284995T>C	ENSP00000289004:p.Asn241Ser	125.0	0.0		105.0	14.0	NM_002150	A8K461|B3KQ63|Q13234	Missense_Mutation	SNP	ENST00000289004.4	hg19	CCDS9224.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.705334	0.68615	.	.	ENSG00000158104	ENST00000289004;ENST00000545969;ENST00000543163	T;T	0.66638	-0.22;-0.22	5.6	4.44	0.53790	Glyoxalase/fosfomycin resistance/dioxygenase (1);	0.043491	0.85682	D	0.000000	D	0.85048	0.5608	H	0.94582	3.555	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.87778	0.2610	10	0.87932	D	0	-39.5295	12.0552	0.53531	0.1292:0.0:0.0:0.8708	.	241	P32754	HPPD_HUMAN	S	241;238;202	ENSP00000289004:N241S;ENSP00000441677:N202S	ENSP00000289004:N241S	N	-	2	0	HPD	120769378	1.000000	0.71417	0.788000	0.31933	0.567000	0.35839	7.676000	0.84012	0.927000	0.37143	0.533000	0.62120	AAT	.	.		0.592	HPD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402184.1	NM_002150	
CENPJ	55835	hgsc.bcm.edu	37	13	25459431	25459431	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr13:25459431T>A	ENST00000381884.4	-	13	3645	c.3460A>T	c.(3460-3462)Agt>Tgt	p.S1154C	CENPJ_ENST00000493190.1_5'UTR|CENPJ_ENST00000545981.1_3'UTR	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	1154					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TCAGGATGACTGATTTCTCCC	0.363																																					p.S1154C		Atlas-SNP	.											.	CENPJ	116	.	0			c.A3460T						.						143.0	144.0	144.0					13																	25459431		2203	4300	6503	SO:0001583	missense	55835	exon13			GATGACTGATTTC	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.3460A>T	chr13.hg19:g.25459431T>A	ENSP00000371308:p.Ser1154Cys	258.0	0.0		115.0	31.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	hg19	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	T	15.63	2.891335	0.52014	.	.	ENSG00000151849	ENST00000381884	T	0.37584	1.19	5.74	5.74	0.90152	.	0.573254	0.20095	N	0.099351	T	0.40719	0.1128	L	0.60455	1.87	0.80722	D	1	P	0.48503	0.911	B	0.43225	0.412	T	0.38993	-0.9635	10	0.62326	D	0.03	.	15.3236	0.74141	0.0:0.0:0.0:1.0	.	1154	Q9HC77	CENPJ_HUMAN	C	1154	ENSP00000371308:S1154C	ENSP00000371308:S1154C	S	-	1	0	CENPJ	24357431	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	4.665000	0.61547	2.317000	0.78254	0.460000	0.39030	AGT	.	.		0.363	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
TTC5	91875	hgsc.bcm.edu	37	14	20763925	20763925	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:20763925T>C	ENST00000258821.3	-	7	841	c.785A>G	c.(784-786)cAa>cGa	p.Q262R		NM_138376.2	NP_612385.2	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	262					DNA repair (GO:0006281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		TTGCTCTCGTTGCCGGGGCTC	0.488																																					p.Q262R		Atlas-SNP	.											.	TTC5	34	.	0			c.A785G						.						77.0	89.0	85.0					14																	20763925		2203	4300	6503	SO:0001583	missense	91875	exon7			TCTCGTTGCCGGG	BC008647	CCDS9546.1	14q11.2	2013-01-11			ENSG00000136319	ENSG00000136319		"""Tetratricopeptide (TTC) repeat domain containing"""	19274	protein-coding gene	gene with protein product						11511361	Standard	NM_138376		Approved	Strap	uc001vwt.3	Q8N0Z6	OTTHUMG00000029506	ENST00000258821.3:c.785A>G	chr14.hg19:g.20763925T>C	ENSP00000258821:p.Gln262Arg	138.0	0.0		106.0	18.0	NM_138376	A8MQ18|Q96HF9	Missense_Mutation	SNP	ENST00000258821.3	hg19	CCDS9546.1	.	.	.	.	.	.	.	.	.	.	T	9.972	1.225632	0.22542	.	.	ENSG00000136319	ENST00000258821	T	0.73469	-0.75	4.83	3.68	0.42216	Tetratricopeptide-like helical (1);	0.386187	0.28290	N	0.015895	T	0.53498	0.1800	N	0.22421	0.69	0.26438	N	0.975829	B	0.09022	0.002	B	0.06405	0.002	T	0.25328	-1.0135	10	0.16420	T	0.52	.	5.6527	0.17625	0.0:0.09:0.1738:0.7361	.	262	Q8N0Z6	TTC5_HUMAN	R	262	ENSP00000258821:Q262R	ENSP00000258821:Q262R	Q	-	2	0	TTC5	19833765	0.929000	0.31497	0.837000	0.33122	0.995000	0.86356	0.992000	0.29667	1.946000	0.56461	0.533000	0.62120	CAA	.	.		0.488	TTC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073529.4	NM_138376	
MYH6	4624	hgsc.bcm.edu	37	14	23851737	23851737	+	Missense_Mutation	SNP	C	C	A	rs61731171		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:23851737C>A	ENST00000356287.3	-	37	5725	c.5696G>T	c.(5695-5697)cGc>cTc	p.R1899L	MYH6_ENST00000405093.3_Missense_Mutation_p.R1899L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1899					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.R1899H(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CTGCACCTTGCGGAACTTGGA	0.582																																					p.R1899L		Atlas-SNP	.											MYH6,NS,carcinoma,0,1	MYH6	274	.	1	Substitution - Missense(1)	stomach(1)	c.G5696T						.						190.0	160.0	170.0					14																	23851737		2203	4300	6503	SO:0001583	missense	4624	exon38			ACCTTGCGGAACT	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.5696G>T	chr14.hg19:g.23851737C>A	ENSP00000348634:p.Arg1899Leu	199.0	0.0		132.0	26.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	hg19	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	C	32	5.105714	0.94292	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.85171	-1.95;-1.95	4.05	4.05	0.47172	Myosin tail (1);	.	.	.	.	D	0.95121	0.8419	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97038	0.9755	9	0.87932	D	0	.	16.3671	0.83335	0.0:1.0:0.0:0.0	.	1899	P13533	MYH6_HUMAN	L	1899	ENSP00000386041:R1899L;ENSP00000348634:R1899L	ENSP00000348634:R1899L	R	-	2	0	MYH6	22921577	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.644000	0.83416	2.256000	0.74724	0.561000	0.74099	CGC	.	C|0.986;T|0.014		0.582	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
UNC79	57578	hgsc.bcm.edu	37	14	94052959	94052959	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:94052959G>A	ENST00000393151.2	+	21	2821	c.2821G>A	c.(2821-2823)Gaa>Aaa	p.E941K	UNC79_ENST00000555664.1_Missense_Mutation_p.E941K|UNC79_ENST00000553484.1_Missense_Mutation_p.E941K|UNC79_ENST00000256339.4_Missense_Mutation_p.E764K			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	941					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GAATGATACCGAAAGAAAATT	0.338																																					p.E764K		Atlas-SNP	.											UNC79,NS,carcinoma,0,2	UNC79	366	.	0			c.G2290A						.						53.0	52.0	53.0					14																	94052959		2202	4299	6501	SO:0001583	missense	57578	exon21			GATACCGAAAGAA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.2821G>A	chr14.hg19:g.94052959G>A	ENSP00000376858:p.Glu941Lys	208.0	0.0		69.0	19.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	G	20.0	3.930849	0.73327	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	5.94	5.94	0.96194	.	0.061494	0.64402	D	0.000002	T	0.08268	0.0206	N	0.08118	0	0.49687	D	0.999811	P	0.49253	0.921	B	0.33960	0.173	T	0.34502	-0.9826	10	0.09843	T	0.71	-19.9303	20.3736	0.98901	0.0:0.0:1.0:0.0	.	941	C9JQL1	.	K	764;941;941;941;941	ENSP00000256339:E764K;ENSP00000450868:E941K;ENSP00000451360:E941K;ENSP00000376858:E941K	ENSP00000256339:E764K	E	+	1	0	KIAA1409	93122712	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.198000	0.94994	2.820000	0.97059	0.650000	0.86243	GAA	.	.		0.338	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
TDRD9	122402	hgsc.bcm.edu	37	14	104488538	104488538	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr14:104488538C>T	ENST00000409874.4	+	24	2525	c.2477C>T	c.(2476-2478)aCc>aTc	p.T826I	TDRD9_ENST00000339063.5_Missense_Mutation_p.T826I	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	826					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				AGATTTAAAACCCTTCCTGCA	0.363																																					p.T826I		Atlas-SNP	.											.	TDRD9	175	.	0			c.C2477T						.						33.0	31.0	31.0					14																	104488538		2203	4296	6499	SO:0001583	missense	122402	exon24			TTAAAACCCTTCC	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.2477C>T	chr14.hg19:g.104488538C>T	ENSP00000387303:p.Thr826Ile	268.0	0.0		123.0	39.0	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	ENST00000409874.4	hg19	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	C	7.544	0.661388	0.14645	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.03212	4.02;4.01	5.6	3.78	0.43462	.	0.382936	0.24688	N	0.036418	T	0.03608	0.0103	L	0.38531	1.155	0.23361	N	0.997832	B;B	0.22003	0.063;0.004	B;B	0.19946	0.027;0.003	T	0.36138	-0.9760	10	0.40728	T	0.16	.	7.8325	0.29351	0.0:0.7265:0.0:0.2735	.	826;826	Q8NDG6-2;Q8NDG6	.;TDRD9_HUMAN	I	826	ENSP00000387303:T826I;ENSP00000343545:T826I	ENSP00000343545:T826I	T	+	2	0	TDRD9	103558291	0.018000	0.18449	0.014000	0.15608	0.832000	0.47134	0.971000	0.29396	1.370000	0.46153	0.650000	0.86243	ACC	.	.		0.363	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
GABRA5	2558	hgsc.bcm.edu	37	15	27114447	27114447	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:27114447T>G	ENST00000335625.5	+	3	940	c.52T>G	c.(52-54)Ttt>Gtt	p.F18V	GABRA5_ENST00000355395.5_Missense_Mutation_p.F18V|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000557449.1_3'UTR|GABRA5_ENST00000400081.3_Missense_Mutation_p.F18V	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	18					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CCTCCTTCTCTTTTGTATTTC	0.373																																					p.F18V		Atlas-SNP	.											GABRA5,NS,carcinoma,0,1	GABRA5	127	.	0			c.T52G						.						211.0	204.0	206.0					15																	27114447		1890	4111	6001	SO:0001583	missense	2558	exon3			CTTCTCTTTTGTA		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.52T>G	chr15.hg19:g.27114447T>G	ENSP00000335592:p.Phe18Val	409.0	1.0		234.0	48.0	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	ENST00000335625.5	hg19	CCDS45194.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.611593	0.46631	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000557484;ENST00000400081;ENST00000554038;ENST00000554596;ENST00000554599	T;T;T;T;T;T	0.81415	-0.49;-0.49;-0.49;-1.16;-1.17;-1.49	5.82	3.52	0.40303	.	0.319851	0.30723	N	0.009004	T	0.58424	0.2121	N	0.08118	0	0.30420	N	0.778185	B	0.02656	0.0	B	0.01281	0.0	T	0.53322	-0.8455	10	0.44086	T	0.13	.	4.664	0.12657	0.1681:0.087:0.0:0.7449	.	18	P31644	GBRA5_HUMAN	V	18	ENSP00000335592:F18V;ENSP00000347557:F18V;ENSP00000382953:F18V;ENSP00000451527:F18V;ENSP00000450806:F18V;ENSP00000450717:F18V	ENSP00000335592:F18V	F	+	1	0	GABRA5	24665540	0.996000	0.38824	0.999000	0.59377	0.998000	0.95712	0.989000	0.29629	1.006000	0.39211	0.533000	0.62120	TTT	.	.		0.373	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
TRPM1	4308	hgsc.bcm.edu	37	15	31295063	31295063	+	Silent	SNP	A	A	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:31295063A>C	ENST00000256552.6	-	28	3987	c.3840T>G	c.(3838-3840)ctT>ctG	p.L1280L	RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Silent_p.L1258L|TRPM1_ENST00000542188.1_Silent_p.L1297L	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TTTGCCGGAGAAGATACGTTG	0.468																																					p.L1297L		Atlas-SNP	.											.	TRPM1	183	.	0			c.T3891G						.						93.0	94.0	93.0					15																	31295063		2080	4211	6291	SO:0001819	synonymous_variant	4308	exon27			CCGGAGAAGATAC	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3840T>G	chr15.hg19:g.31295063A>C		138.0	0.0		82.0	17.0	NM_001252020		Silent	SNP	ENST00000256552.6	hg19	CCDS58346.1																																																																																			.	.		0.468	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
RYR3	6263	hgsc.bcm.edu	37	15	34105063	34105063	+	Splice_Site	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:34105063G>C	ENST00000389232.4	+	73	10327		c.e73-1		RYR3_ENST00000415757.3_Splice_Site	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3						calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCAATTTTCAGTCTGATGACC	0.428																																					.		Atlas-SNP	.											.	RYR3	760	.	0			c.10243-1G>C						.						78.0	75.0	76.0					15																	34105063		1876	4112	5988	SO:0001630	splice_region_variant	6263	exon72			TTTTCAGTCTGAT		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10258-1G>C	chr15.hg19:g.34105063G>C		87.0	0.0		56.0	11.0	NM_001243996	O15175|Q15412	Splice_Site	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477012	0.84640	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1742	0.89756	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR3	31892355	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	9.601000	0.98297	2.581000	0.87130	0.655000	0.94253	.	.	.		0.428	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		Intron
INO80	54617	hgsc.bcm.edu	37	15	41377743	41377743	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:41377743C>T	ENST00000361937.3	-	7	1121	c.697G>A	c.(697-699)Gaa>Aaa	p.E233K	INO80_ENST00000401393.3_Missense_Mutation_p.E233K			Q9ULG1	INO80_HUMAN	INO80 complex subunit	233	Assembles INO80 complex module consisting of conserved components ACTR8, ACTL6A and YY1.|Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GAAAGTTCTTCATCTCTTCGT	0.443																																					p.E233K		Atlas-SNP	.											.	INO80	122	.	0			c.G697A						.						112.0	110.0	111.0					15																	41377743		2203	4300	6503	SO:0001583	missense	54617	exon7			GTTCTTCATCTCT	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.697G>A	chr15.hg19:g.41377743C>T	ENSP00000355205:p.Glu233Lys	548.0	0.0		315.0	62.0	NM_017553	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	hg19	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.735157	0.89482	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.90563	-2.69;-2.69	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.90669	0.7073	N	0.24115	0.695	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	D	0.84695	0.0725	10	0.05525	T	0.97	.	20.1143	0.97922	0.0:1.0:0.0:0.0	.	233	Q9ULG1	INO80_HUMAN	K	233	ENSP00000355205:E233K;ENSP00000384686:E233K	ENSP00000355205:E233K	E	-	1	0	INO80	39165035	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.765000	0.95021	0.650000	0.86243	GAA	.	.		0.443	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
CSPG4	1464	hgsc.bcm.edu	37	15	75968322	75968322	+	Missense_Mutation	SNP	C	C	T	rs370893364		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr15:75968322C>T	ENST00000308508.5	-	10	6630	c.6538G>A	c.(6538-6540)Gag>Aag	p.E2180K	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2180	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CGGGCGGCCTCGGGGACACTG	0.701																																					p.E2180K		Atlas-SNP	.											.	CSPG4	175	.	0			c.G6538A						.	C	LYS/GLU	1,4389		0,1,2194	20.0	21.0	21.0		6538	4.3	0.9	15		21	0,8584		0,0,4292	no	missense	CSPG4	NM_001897.4	56	0,1,6486	TT,TC,CC		0.0,0.0228,0.0077	benign	2180/2323	75968322	1,12973	2195	4292	6487	SO:0001583	missense	1464	exon10			CGGCCTCGGGGAC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6538G>A	chr15.hg19:g.75968322C>T	ENSP00000312506:p.Glu2180Lys	23.0	0.0		33.0	12.0	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	hg19	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	C	5.218	0.225765	0.09916	2.28E-4	0.0	ENSG00000173546	ENST00000308508;ENST00000537176	T	0.19394	2.15	5.26	4.35	0.52113	.	0.516931	0.18538	N	0.138300	T	0.15609	0.0376	L	0.58101	1.795	0.09310	N	1	P	0.35155	0.487	B	0.16289	0.015	T	0.17561	-1.0365	10	0.25751	T	0.34	.	7.5514	0.27800	0.0:0.7283:0.1811:0.0906	.	2180	Q6UVK1	CSPG4_HUMAN	K	2180;212	ENSP00000312506:E2180K	ENSP00000312506:E2180K	E	-	1	0	CSPG4	73755377	0.015000	0.18098	0.866000	0.34008	0.380000	0.30137	0.295000	0.19065	1.228000	0.43614	0.511000	0.50034	GAG	.	.		0.701	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
RPL13	6137	hgsc.bcm.edu	37	16	89629361	89629361	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr16:89629361C>T	ENST00000393099.3	+	5	796	c.547C>T	c.(547-549)Cgt>Tgt	p.R183C	RPL13_ENST00000567815.1_Missense_Mutation_p.R183C|RPL13_ENST00000311528.5_Missense_Mutation_p.R183C|RPL13_ENST00000452368.3_Missense_Mutation_p.R136C|SNORD68_ENST00000363214.1_RNA	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	183					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		CGCTAGTCTCCGTATGGCCCG	0.488																																					p.R183C		Atlas-SNP	.											.	RPL13	11	.	0			c.C547T						.						38.0	42.0	40.0					16																	89629361		2198	4298	6496	SO:0001583	missense	6137	exon6			AGTCTCCGTATGG	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.547C>T	chr16.hg19:g.89629361C>T	ENSP00000376811:p.Arg183Cys	165.0	0.0		120.0	13.0	NM_000977	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Missense_Mutation	SNP	ENST00000393099.3	hg19	CCDS10979.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656118	0.47467	.	.	ENSG00000167526	ENST00000311528;ENST00000452368;ENST00000393099	T;T;T	0.51071	0.72;0.72;0.72	4.52	3.57	0.40892	.	0.000000	0.85682	U	0.000000	T	0.47377	0.1442	M	0.75447	2.3	0.80722	D	1	B;B	0.32543	0.375;0.027	B;B	0.29785	0.107;0.063	T	0.53158	-0.8478	10	0.62326	D	0.03	-9.6763	12.6145	0.56569	0.0:0.9187:0.0:0.0813	.	136;183	F5H1S2;P26373	.;RL13_HUMAN	C	183;136;183	ENSP00000307889:R183C;ENSP00000438959:R136C;ENSP00000376811:R183C	ENSP00000307889:R183C	R	+	1	0	RPL13	88156862	1.000000	0.71417	0.768000	0.31515	0.452000	0.32318	7.678000	0.84035	1.041000	0.40125	0.462000	0.41574	CGT	.	.		0.488	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
TP53	7157	hgsc.bcm.edu	37	17	7578524	7578524	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:7578524G>A	ENST00000269305.4	-	5	595	c.406C>T	c.(406-408)Caa>Taa	p.Q136*	TP53_ENST00000445888.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q136*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q136*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	136	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> E (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q136*(34)|p.0?(8)|p.C135fs*9(3)|p.Q136E(3)|p.N131fs*27(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.Q136K(1)|p.S127_Q136del10(1)|p.V73fs*9(1)|p.Q43*(1)|p.Y126fs*11(1)|p.Q4*(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.Q136_K139delQLAK(1)|p.Q136fs*34(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)|p.C135_Q136insXXXXXX(1)|p.C135_Q136insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGGCCAGTTGGCAAAACATC	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Q136X	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,4	TP53	33396	.	67	Substitution - Nonsense(36)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(5)|Substitution - Missense(4)|Insertion - In frame(2)|Insertion - Frameshift(1)|Complex - deletion inframe(1)	upper_aerodigestive_tract(9)|ovary(9)|urinary_tract(8)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(6)|stomach(5)|breast(4)|bone(4)|large_intestine(3)|oesophagus(3)|skin(3)|lung(3)|soft_tissue(1)|endometrium(1)|pancreas(1)	c.C406T	GRCh37	CM971503	TP53	M		.						52.0	52.0	52.0					17																	7578524		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCAGTTGGCAAAA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.406C>T	chr17.hg19:g.7578524G>A	ENSP00000269305:p.Gln136*	48.0	0.0		35.0	21.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	34	5.349260	0.95830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.5387	17.2272	0.86973	0.0:0.0:1.0:0.0	.	.	.	.	X	136;136;136;136;136;136;125;43;4;43;4;136	.	ENSP00000269305:Q136X	Q	-	1	0	TP53	7519249	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	9.809000	0.99208	2.733000	0.93635	0.655000	0.94253	CAA	.	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYOCD	93649	hgsc.bcm.edu	37	17	12666487	12666487	+	Silent	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:12666487C>T	ENST00000343344.4	+	13	2343	c.2343C>T	c.(2341-2343)ccC>ccT	p.P781P	MYOCD_ENST00000425538.1_Silent_p.P829P|RP11-1090M7.1_ENST00000584772.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	781					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TCACCAAGCCCTCGGCTTCCT	0.493																																					p.P829P		Atlas-SNP	.											.	MYOCD	291	.	0			c.C2487T						.						106.0	101.0	103.0					17																	12666487		2203	4300	6503	SO:0001819	synonymous_variant	93649	exon14			CAAGCCCTCGGCT	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2343C>T	chr17.hg19:g.12666487C>T		121.0	0.0		56.0	34.0	NM_001146312	Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	hg19	CCDS11163.1																																																																																			.	.		0.493	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
MYO18A	399687	hgsc.bcm.edu	37	17	27449219	27449219	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:27449219T>G	ENST00000527372.1	-	3	1232	c.1052A>C	c.(1051-1053)aAg>aCg	p.K351T	MYO18A_ENST00000533112.1_Missense_Mutation_p.K351T|MYO18A_ENST00000354329.4_Missense_Mutation_p.K351T|MYO18A_ENST00000531253.1_Missense_Mutation_p.K351T	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	351	Mediates nucleotide-independent binding to F-actin and interaction with GOLPH3.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CAGCCACACCTTCTCCGTCTC	0.557																																					p.K351T	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.A1052C						.						67.0	79.0	75.0					17																	27449219		2012	4183	6195	SO:0001583	missense	399687	exon3			CACACCTTCTCCG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1052A>C	chr17.hg19:g.27449219T>G	ENSP00000437073:p.Lys351Thr	262.0	0.0		126.0	74.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	hg19	CCDS45642.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.2|27.2	4.808029|4.808029	0.90707|0.90707	.|.	.|.	ENSG00000196535|ENSG00000196535	ENST00000528564|ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000531686	T|D;D;D;D	0.77489|0.88741	-1.1|-2.31;-2.42;-2.31;-2.31	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93871|0.93871	0.8039|0.8039	M|M	0.79123|0.79123	2.44|2.44	0.45464|0.45464	D|D	0.998438|0.998438	.|D;D;D;D	.|0.89917	.|0.959;0.999;0.999;1.0	.|P;D;D;D	.|0.87578	.|0.749;0.994;0.994;0.998	D|D	0.93890|0.93890	0.7179|0.7179	7|10	0.48119|0.49607	T|T	0.1|0.09	.|.	14.0293|14.0293	0.64606|0.64606	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|20;351;351;351	.|Q92614-2;Q92614-3;Q92614-4;Q92614	.|.;.;.;MY18A_HUMAN	D|T	56|351;351;351;351;351;31	ENSP00000436660:E56D|ENSP00000346291:K351T;ENSP00000435932:K351T;ENSP00000434228:K351T;ENSP00000437073:K351T	ENSP00000436660:E56D|ENSP00000346291:K351T	E|K	-|-	3|2	2|0	MYO18A|MYO18A	24473345|24473345	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.565000|5.565000	0.67365|0.67365	2.145000|2.145000	0.66743|0.66743	0.533000|0.533000	0.62120|0.62120	GAA|AAG	.	.		0.557	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
MED24	9862	hgsc.bcm.edu	37	17	38189358	38189358	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:38189358C>T	ENST00000394128.2	-	8	854	c.773G>A	c.(772-774)gGc>gAc	p.G258D	MED24_ENST00000356271.3_Missense_Mutation_p.G245D|MED24_ENST00000501516.3_Missense_Mutation_p.G277D|MED24_ENST00000394126.1_Missense_Mutation_p.G283D|MED24_ENST00000394127.2_Missense_Mutation_p.G245D|MED24_ENST00000479829.1_5'Flank	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	258					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CTGCGTCTCGCCTGTCAGGTT	0.637																																					p.G258D		Atlas-SNP	.											.	MED24	89	.	0			c.G773A						.						60.0	51.0	54.0					17																	38189358		2203	4300	6503	SO:0001583	missense	9862	exon8			GTCTCGCCTGTCA	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.773G>A	chr17.hg19:g.38189358C>T	ENSP00000377686:p.Gly258Asp	87.0	0.0		37.0	18.0	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	hg19	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.567240	0.45694	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000535508;ENST00000431269;ENST00000428757	T;T;T	0.47177	0.85;0.85;0.85	5.68	5.68	0.88126	Mediator complex, subunit Med24, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66752	0.2821	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.99;1.0;0.988;1.0;0.996;0.997;1.0	D;D;D;P;D;D;D;D	0.97110	0.996;0.921;1.0;0.871;0.99;0.953;0.972;0.99	T	0.65269	-0.6209	10	0.52906	T	0.07	-24.9058	19.807	0.96535	0.0:1.0:0.0:0.0	.	245;208;187;208;168;245;258;200	B9TX65;B4DV99;B4DDR8;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;.;.;MED24_HUMAN;.	D	258;258;258;208;245;200;232;232;168;277	ENSP00000377686:G258D;ENSP00000443344:G208D;ENSP00000377685:G245D	ENSP00000348610:G258D	G	-	2	0	MED24	35442884	1.000000	0.71417	0.943000	0.38184	0.601000	0.36947	5.999000	0.70665	2.690000	0.91761	0.655000	0.94253	GGC	.	.		0.637	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
MTMR4	9110	hgsc.bcm.edu	37	17	56582147	56582147	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:56582147G>A	ENST00000323456.5	-	12	1416	c.1292C>T	c.(1291-1293)aCg>aTg	p.T431M	MTMR4_ENST00000579925.1_Missense_Mutation_p.T431M	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	431	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TACCTCCAACGTCCTGTAATA	0.552																																					p.T431M		Atlas-SNP	.											.	MTMR4	91	.	0			c.C1292T						.						136.0	137.0	137.0					17																	56582147		2203	4300	6503	SO:0001583	missense	9110	exon12			TCCAACGTCCTGT	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1292C>T	chr17.hg19:g.56582147G>A	ENSP00000325285:p.Thr431Met	81.0	0.0		47.0	12.0	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	hg19	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962917	0.92791	.	.	ENSG00000108389	ENST00000323456	D	0.96554	-4.05	5.4	5.4	0.78164	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.99174	0.9714	H	0.99764	4.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98660	1.0683	10	0.87932	D	0	.	18.5101	0.90913	0.0:0.0:1.0:0.0	.	431	Q9NYA4	MTMR4_HUMAN	M	431	ENSP00000325285:T431M	ENSP00000325285:T431M	T	-	2	0	MTMR4	53937146	1.000000	0.71417	0.961000	0.40146	0.964000	0.63967	9.813000	0.99286	2.688000	0.91661	0.591000	0.81541	ACG	.	.		0.552	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
METTL2A	339175	hgsc.bcm.edu	37	17	60501620	60501620	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:60501620G>A	ENST00000311506.5	+	2	187	c.151G>A	c.(151-153)Gag>Aag	p.E51K		NM_181725.3	NP_859076.3	Q96IZ6	MET2A_HUMAN	methyltransferase like 2A	51					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(2)|central_nervous_system(1)|endometrium(1)|upper_aerodigestive_tract(2)	6			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			CGCGGCGGCGGAGAGAAAAGT	0.582											OREG0024635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E51K		Atlas-SNP	.											.	METTL2A	31	.	0			c.G151A						.						66.0	92.0	84.0					17																	60501620		692	1590	2282	SO:0001583	missense	339175	exon2			GCGGCGGAGAGAA	AK000991	CCDS45752.1	17q23.3	2012-12-20		2006-02-10	ENSG00000087995	ENSG00000087995			25755	protein-coding gene	gene with protein product						12477932	Standard	NM_181725		Approved	FLJ12760, METTL2	uc002izv.2	Q96IZ6	OTTHUMG00000164527	ENST00000311506.5:c.151G>A	chr17.hg19:g.60501620G>A	ENSP00000309610:p.Glu51Lys	127.0	0.0	1046	76.0	20.0	NM_181725	A6NNC4|Q9H9G9|Q9NUI8|Q9P0B5	Missense_Mutation	SNP	ENST00000311506.5	hg19	CCDS45752.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.110154	0.37242	.	.	ENSG00000087995	ENST00000311506;ENST00000333483	D	0.82255	-1.59	5.14	3.09	0.35607	.	0.568252	0.21244	N	0.077764	T	0.68705	0.3030	L	0.33189	0.99	0.27932	N	0.937828	B	0.02656	0.0	B	0.08055	0.003	T	0.51387	-0.8712	10	0.14656	T	0.56	-4.2637	5.6823	0.17782	0.1401:0.353:0.5069:0.0	.	51	Q96IZ6	MTL2A_HUMAN	K	51	ENSP00000309610:E51K	ENSP00000309610:E51K	E	+	1	0	METTL2A	57855352	0.698000	0.27777	0.990000	0.47175	0.893000	0.52053	1.356000	0.34079	1.263000	0.44181	0.555000	0.69702	GAG	.	.		0.582	METTL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445130.1	NM_181725	
ENPP7	339221	hgsc.bcm.edu	37	17	77711821	77711821	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr17:77711821G>A	ENST00000328313.5	+	5	1574	c.1353G>A	c.(1351-1353)gtG>gtA	p.V451V		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGGGGACCGTGATTCTTCTGT	0.642																																					p.V451V		Atlas-SNP	.											.	ENPP7	63	.	0			c.G1353A						.						88.0	80.0	83.0					17																	77711821		2203	4300	6503	SO:0001819	synonymous_variant	339221	exon5			GACCGTGATTCTT	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.1353G>A	chr17.hg19:g.77711821G>A		43.0	0.0		38.0	16.0	NM_178543		Silent	SNP	ENST00000328313.5	hg19	CCDS11763.1																																																																																			.	.		0.642	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
SOCS6	9306	hgsc.bcm.edu	37	18	67992724	67992724	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr18:67992724G>C	ENST00000397942.3	+	2	1136	c.820G>C	c.(820-822)Gtt>Ctt	p.V274L	SOCS6_ENST00000582322.1_Missense_Mutation_p.V274L	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	274					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CCAGGACCTAGTTGTCGCCCC	0.572																																					p.V274L	Melanoma(84;1024 1361 24382 36583 42651)	Atlas-SNP	.											.	SOCS6	54	.	0			c.G820C						.						161.0	140.0	147.0					18																	67992724		2203	4300	6503	SO:0001583	missense	9306	exon2			GACCTAGTTGTCG	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.820G>C	chr18.hg19:g.67992724G>C	ENSP00000381034:p.Val274Leu	279.0	0.0		164.0	55.0	NM_004232	Q8WUM3	Missense_Mutation	SNP	ENST00000397942.3	hg19	CCDS11998.1	.	.	.	.	.	.	.	.	.	.	G	6.742	0.505609	0.12822	.	.	ENSG00000170677	ENST00000397942	T	0.27104	1.69	5.0	5.0	0.66597	.	0.808617	0.10957	N	0.615438	T	0.24353	0.0590	L	0.29908	0.895	0.39481	D	0.967887	B	0.06786	0.001	B	0.04013	0.001	T	0.06588	-1.0818	10	0.33940	T	0.23	-4.9182	18.3063	0.90182	0.0:0.0:1.0:0.0	.	274	O14544	SOCS6_HUMAN	L	274	ENSP00000381034:V274L	ENSP00000381034:V274L	V	+	1	0	SOCS6	66143704	1.000000	0.71417	0.016000	0.15963	0.209000	0.24338	5.769000	0.68865	2.309000	0.77851	0.561000	0.74099	GTT	.	.		0.572	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
MISP	126353	hgsc.bcm.edu	37	19	756999	756999	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:756999G>C	ENST00000215582.6	+	2	156	c.53G>C	c.(52-54)gGc>gCc	p.G18A		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	18					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GCACACCGTGGCACCGGCCTG	0.657																																					p.G18A		Atlas-SNP	.											.	C19orf21	56	.	0			c.G53C						.						25.0	24.0	24.0					19																	756999		2201	4297	6498	SO:0001583	missense	126353	exon2			ACCGTGGCACCGG	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.53G>C	chr19.hg19:g.756999G>C	ENSP00000215582:p.Gly18Ala	113.0	0.0		116.0	15.0	NM_173481		Missense_Mutation	SNP	ENST00000215582.6	hg19	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	G	1.285	-0.609135	0.03690	.	.	ENSG00000099812	ENST00000215582	D	0.91577	-2.87	4.27	0.897	0.19258	.	2.194520	0.02204	N	0.062565	T	0.68824	0.3043	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71797	-0.4484	10	0.02654	T	1	-3.176	4.1001	0.10010	0.0:0.2111:0.3661:0.4227	.	18	Q8IVT2	CS021_HUMAN	A	18	ENSP00000215582:G18A	ENSP00000215582:G18A	G	+	2	0	C19orf21	707999	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	0.275000	0.18698	0.156000	0.19299	-1.277000	0.01392	GGC	.	.		0.657	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
PCSK4	54760	hgsc.bcm.edu	37	19	1484101	1484101	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:1484101C>T	ENST00000300954.5	-	9	1155	c.1094G>A	c.(1093-1095)tGc>tAc	p.C365Y	CTB-25B13.6_ENST00000585643.1_RNA	NM_017573.3	NP_060043.2			proprotein convertase subtilisin/kexin type 4											cervix(2)|endometrium(2)|kidney(1)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGTCTGTGCACCCGTGATG	0.662																																					p.C365Y		Atlas-SNP	.											.	PCSK4	44	.	0			c.G1094A						.						10.0	12.0	11.0					19																	1484101		2180	4268	6448	SO:0001583	missense	54760	exon9			TCTGTGCACCCGT	AK057235	CCDS12069.2	19p13.3	2008-02-05			ENSG00000115257	ENSG00000115257			8746	protein-coding gene	gene with protein product		600487				7782070	Standard	XM_005259586		Approved	PC4, SPC5, DKFZp434B217, MGC34749	uc002ltb.1	Q6UW60	OTTHUMG00000128541	ENST00000300954.5:c.1094G>A	chr19.hg19:g.1484101C>T	ENSP00000300954:p.Cys365Tyr	68.0	0.0		128.0	71.0	NM_017573		Missense_Mutation	SNP	ENST00000300954.5	hg19	CCDS12069.2	.	.	.	.	.	.	.	.	.	.	-	14.46	2.543283	0.45280	.	.	ENSG00000115257	ENST00000300954;ENST00000441747	T	0.80566	-1.39	2.76	2.76	0.32466	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.552403	0.16865	N	0.196378	D	0.88228	0.6380	M	0.75447	2.3	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.88770	0.3263	10	0.87932	D	0	.	12.4425	0.55634	0.0:1.0:0.0:0.0	.	365;177	Q6UW60;B3KQ28	PCSK4_HUMAN;.	Y	365;177	ENSP00000300954:C365Y	ENSP00000300954:C365Y	C	-	2	0	PCSK4	1435101	1.000000	0.71417	0.996000	0.52242	0.115000	0.19883	7.590000	0.82653	1.286000	0.44565	0.274000	0.19336	TGC	.	.		0.662	PCSK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449703.1	NM_017573	
SMARCA4	6597	hgsc.bcm.edu	37	19	11143994	11143994	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:11143994G>A	ENST00000429416.3	+	27	3856	c.3575G>A	c.(3574-3576)cGc>cAc	p.R1192H	SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1192H|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1192H|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1192H|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1192H|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1192H|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1192H	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1192	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CGAGCCCACCGCATCGGGCAG	0.612			"""F, N, Mis"""		NSCLC																																p.R1192H		Atlas-SNP	.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4_ENST00000358026,NS,carcinoma,+1,2	SMARCA4	502	.	1	Unknown(1)	lung(1)	c.G3575A						.						63.0	62.0	62.0					19																	11143994		2203	4300	6503	SO:0001583	missense	6597	exon26			CCCACCGCATCGG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3575G>A	chr19.hg19:g.11143994G>A	ENSP00000395654:p.Arg1192His	90.0	0.0		77.0	15.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	hg19	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769759	0.90020	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57;-4.57;-4.57;-4.57	4.74	4.74	0.60224	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99426	0.9797	H	0.99863	4.86	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97804	1.0246	10	0.87932	D	0	-34.1151	16.7067	0.85374	0.0:0.0:1.0:0.0	.	1192;1192;1192;1192;1192;412;1192	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	H	1192;1192;1256;1192;1192;1192;1192;1192	ENSP00000395654:R1192H;ENSP00000350720:R1192H;ENSP00000343896:R1192H;ENSP00000445036:R1192H;ENSP00000392837:R1192H;ENSP00000397783:R1192H;ENSP00000414727:R1192H	ENSP00000343896:R1192H	R	+	2	0	SMARCA4	11004994	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.319000	0.96338	2.488000	0.83962	0.558000	0.71614	CGC	.	.		0.612	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
C19orf80	55908	hgsc.bcm.edu	37	19	11350899	11350899	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:11350899G>T	ENST00000252453.8	+	2	405	c.386G>T	c.(385-387)aGc>aTc	p.S129I	DOCK6_ENST00000294618.7_Intron|DOCK6_ENST00000319867.7_5'Flank|C19orf80_ENST00000591200.1_Missense_Mutation_p.S30I	NM_018687.6	NP_061157.3	Q6UXH0	BETAT_HUMAN	chromosome 19 open reading frame 80	129					cellular lipid metabolic process (GO:0044255)|glucose metabolic process (GO:0006006)|positive regulation of protein processing (GO:0010954)|regulation of lipoprotein metabolic process (GO:0050746)|triglyceride homeostasis (GO:0070328)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|breast(1)|endometrium(2)	4						CTACGGGACAGCGTGCAGCGG	0.597																																					p.S129I		Atlas-SNP	.											.	C19orf80	8	.	0			c.G386T						.						18.0	25.0	23.0					19																	11350899		2042	4195	6237	SO:0001583	missense	55908	exon2			GGGACAGCGTGCA		CCDS54220.1	19p13.2	2014-02-13			ENSG00000130173	ENSG00000130173			24933	protein-coding gene	gene with protein product	"""lipasin"", ""betatrophin"""					22809513, 23150577, 24262987	Standard	NM_018687		Approved	TD26, RIFL, ANGPTL8	uc021upg.1	Q6UXH0		ENST00000252453.8:c.386G>T	chr19.hg19:g.11350899G>T	ENSP00000252453:p.Ser129Ile	89.0	0.0		65.0	26.0	NM_018687	Q9NQZ1	Missense_Mutation	SNP	ENST00000252453.8	hg19	CCDS54220.1	.	.	.	.	.	.	.	.	.	.	G	9.127	1.010432	0.19277	.	.	ENSG00000130173	ENST00000397785;ENST00000252453	T	0.32515	1.45	4.42	-2.17	0.07059	.	0.787466	0.11293	N	0.579067	T	0.18759	0.0450	L	0.38175	1.15	0.09310	N	1	B	0.32467	0.372	B	0.30179	0.112	T	0.15206	-1.0445	10	0.52906	T	0.07	-13.0173	4.5847	0.12277	0.3975:0.1551:0.4473:0.0	.	129	Q6UXH0	TD26_HUMAN	I	54;129	ENSP00000252453:S129I	ENSP00000252453:S129I	S	+	2	0	C19orf80	11211899	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.108000	0.10857	-0.493000	0.06678	-0.391000	0.06502	AGC	.	.		0.597	C19orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453175.1	NM_018687	
SPTBN4	57731	hgsc.bcm.edu	37	19	41073984	41073984	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:41073984G>A	ENST00000352632.3	+	31	6838	c.6752G>A	c.(6751-6753)cGg>cAg	p.R2251Q	SPTBN4_ENST00000392025.1_Missense_Mutation_p.R994Q|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R2251Q			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2251					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGGCCTGAGCGGCAAGAGTCA	0.746																																					p.R2251Q		Atlas-SNP	.											.	SPTBN4	213	.	0			c.G6752A						.						12.0	12.0	12.0					19																	41073984		2102	4131	6233	SO:0001583	missense	57731	exon31			CTGAGCGGCAAGA	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6752G>A	chr19.hg19:g.41073984G>A	ENSP00000263373:p.Arg2251Gln	41.0	0.0		50.0	15.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858181	0.32791	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	T;T	0.77620	-1.11;0.26	4.36	3.32	0.38043	.	0.158713	0.28772	U	0.014193	T	0.55433	0.1920	N	0.14661	0.345	0.21184	N	0.999766	B;B	0.23058	0.079;0.079	B;B	0.10450	0.002;0.005	T	0.40757	-0.9546	10	0.44086	T	0.13	.	4.0106	0.09621	0.2037:0.2073:0.589:0.0	.	994;2251	C9JY79;Q9H254	.;SPTN4_HUMAN	Q	2251;2251;994	ENSP00000263373:R2251Q;ENSP00000375879:R994Q	ENSP00000263373:R2251Q	R	+	2	0	SPTBN4	45765824	0.975000	0.34042	0.935000	0.37517	0.023000	0.10783	3.248000	0.51430	1.955000	0.56771	0.561000	0.74099	CGG	.	.		0.746	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
PSG11	5680	hgsc.bcm.edu	37	19	43529064	43529064	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:43529064C>T	ENST00000401740.1	-	2	312	c.209G>A	c.(208-210)gGg>gAg	p.G70E	PSG11_ENST00000403486.1_Intron|PSG11_ENST00000320078.7_Missense_Mutation_p.G70E|PSG11_ENST00000306322.7_Intron			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	70	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				CCTGATTTGCCCTTTGTACCA	0.438																																					p.G70E		Atlas-SNP	.											.	PSG11	57	.	0			c.G209A						.						130.0	130.0	130.0					19																	43529064		2199	4294	6493	SO:0001583	missense	5680	exon2			ATTTGCCCTTTGT	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.209G>A	chr19.hg19:g.43529064C>T	ENSP00000384995:p.Gly70Glu	250.0	0.0		203.0	27.0	NM_002785	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000401740.1	hg19	CCDS12614.2	.	.	.	.	.	.	.	.	.	.	c	11.49	1.653235	0.29425	.	.	ENSG00000243130	ENST00000320078;ENST00000401740	T;T	0.01705	4.68;4.68	0.929	0.929	0.19449	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10594	0.0259	M	0.90870	3.155	0.09310	N	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.06320	-1.0833	9	0.87932	D	0	.	5.2086	0.15304	0.0:1.0:0.0:0.0	.	70	Q9UQ72	PSG11_HUMAN	E	70	ENSP00000319140:G70E;ENSP00000384995:G70E	ENSP00000319140:G70E	G	-	2	0	PSG11	48220904	0.121000	0.22262	0.139000	0.22197	0.032000	0.12392	0.542000	0.23222	0.795000	0.33922	0.184000	0.17185	GGG	.	.		0.438	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323079.1	NM_002785	
PSG9	5678	hgsc.bcm.edu	37	19	43763032	43763032	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:43763032T>G	ENST00000270077.3	-	4	1061	c.965A>C	c.(964-966)aAc>aCc	p.N322T	PSG9_ENST00000244293.7_Intron|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000593948.1_Intron|PSG9_ENST00000443718.3_Missense_Mutation_p.N229T|PSG9_ENST00000418820.2_Missense_Mutation_p.N229T|PSG9_ENST00000291752.5_Intron	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	322	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GATGACTGGGTTACTGCGGAG	0.493																																					p.N322T		Atlas-SNP	.											.	PSG9	77	.	0			c.A965C						.						105.0	108.0	107.0					19																	43763032		2136	4281	6417	SO:0001583	missense	5678	exon4			ACTGGGTTACTGC	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.965A>C	chr19.hg19:g.43763032T>G	ENSP00000270077:p.Asn322Thr	96.0	0.0		124.0	29.0	NM_002784	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	ENST00000270077.3	hg19	CCDS12618.1	.	.	.	.	.	.	.	.	.	.	N	7.137	0.581148	0.13686	.	.	ENSG00000183668	ENST00000270077;ENST00000443718;ENST00000435220	T;T	0.12774	2.65;2.65	1.39	1.39	0.22231	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10981	0.0268	L	0.39245	1.2	0.09310	N	1	B;B	0.32893	0.389;0.263	B;B	0.41894	0.266;0.369	T	0.32214	-0.9915	9	0.02654	T	1	.	4.833	0.13451	0.0:0.0:0.0:1.0	.	229;322	E7EW65;Q00887	.;PSG9_HUMAN	T	322;229;283	ENSP00000270077:N322T;ENSP00000396753:N229T	ENSP00000270077:N322T	N	-	2	0	PSG9	48454872	0.848000	0.29623	0.036000	0.18154	0.006000	0.05464	1.721000	0.38032	0.620000	0.30215	0.163000	0.16589	AAC	.	.		0.493	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	NM_002784	
LMTK3	114783	hgsc.bcm.edu	37	19	49013717	49013717	+	Splice_Site	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:49013717T>G	ENST00000600059.1	-	2	436	c.209A>C	c.(208-210)aAg>aCg	p.K70T	LMTK3_ENST00000270238.3_Splice_Site_p.K99T|CTC-273B12.10_ENST00000598924.1_lincRNA			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	70					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		GCACCTCACCTTGAAGCCGAC	0.592																																					p.K99T		Atlas-SNP	.											.	LMTK3	125	.	0			c.A296C						.						31.0	40.0	37.0					19																	49013717		2050	4197	6247	SO:0001630	splice_region_variant	114783	exon3			CTCACCTTGAAGC	AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.210+1A>C	chr19.hg19:g.49013717T>G		143.0	0.0		125.0	19.0	NM_001080434	Q4G0U1	Missense_Mutation	SNP	ENST00000600059.1	hg19		.	.	.	.	.	.	.	.	.	.	t	17.24	3.340348	0.60963	.	.	ENSG00000142235	ENST00000270238	T	0.80653	-1.4	3.95	3.95	0.45737	.	0.071329	0.52532	U	0.000063	T	0.77605	0.4155	L	0.47190	1.495	0.41341	D	0.987301	P	0.51791	0.948	P	0.46975	0.533	T	0.80688	-0.1271	10	0.87932	D	0	.	11.1411	0.48402	0.0:0.0:0.0:1.0	.	70	Q96Q04	LMTK3_HUMAN	T	99	ENSP00000270238:K99T	ENSP00000270238:K99T	K	-	2	0	LMTK3	53705529	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.232000	0.78116	1.803000	0.52742	0.235000	0.17854	AAG	.	.		0.592	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000466137.1	NM_052895	Missense_Mutation
TFPT	29844	hgsc.bcm.edu	37	19	54611472	54611472	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:54611472G>A	ENST00000391759.1	-	5	908	c.503C>T	c.(502-504)cCg>cTg	p.P168L	TFPT_ENST00000391758.1_Missense_Mutation_p.P159L|NDUFA3_ENST00000391764.3_Intron|TFPT_ENST00000391757.1_Missense_Mutation_p.R156C	NM_013342.3	NP_037474.1	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner (in childhood Leukemia)	168					apoptotic signaling pathway (GO:0097190)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(2)	4	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					CCTTCTGGGCGGGGACAGTGT	0.701			T	TCF3	pre-B ALL																																p.P168L		Atlas-SNP	.		Dom	yes		19	19q13	29844	TCF3 (E2A) fusion partner (in childhood Leukemia)		L	.	TFPT	17	.	0			c.C503T						.						24.0	27.0	26.0					19																	54611472		2202	4298	6500	SO:0001583	missense	29844	exon5			CTGGGCGGGGACA	AF052052	CCDS12878.1	19q13	2011-07-06			ENSG00000105619	ENSG00000105619		"""INO80 complex subunits"""	13630	protein-coding gene	gene with protein product	"""amida, partner of the E2A"", ""INO80 complex subunit F"""	609519				10644725, 16230350	Standard	NM_013342		Approved	FB1, amida, INO80F	uc010yej.1	P0C1Z6	OTTHUMG00000065906	ENST00000391759.1:c.503C>T	chr19.hg19:g.54611472G>A	ENSP00000375639:p.Pro168Leu	106.0	0.0		93.0	16.0	NM_013342		Missense_Mutation	SNP	ENST00000391759.1	hg19	CCDS12878.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.44|13.44	2.237797|2.237797	0.39598|0.39598	.|.	.|.	ENSG00000105619|ENSG00000105619	ENST00000391759;ENST00000391758|ENST00000391757	.|.	.|.	.|.	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	0.424346|.	0.24927|.	N|.	0.034489|.	T|T	0.42223|0.42223	0.1193|0.1193	L|L	0.36672|0.36672	1.1|1.1	0.24947|0.24947	N|N	0.991819|0.991819	B|.	0.20459|.	0.045|.	B|.	0.11329|.	0.006|.	T|T	0.37033|0.37033	-0.9723|-0.9723	9|6	0.38643|0.62326	T|D	0.18|0.03	-14.0125|-14.0125	11.1157|11.1157	0.48259|0.48259	0.0867:0.0:0.9133:0.0|0.0867:0.0:0.9133:0.0	.|.	168|.	P0C1Z6|.	TFPT_HUMAN|.	L|C	168;159|156	.|.	ENSP00000375638:P159L|ENSP00000375637:R156C	P|R	-|-	2|1	0|0	TFPT|TFPT	59303284|59303284	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.637000|0.637000	0.38172|0.38172	2.972000|2.972000	0.49256|0.49256	2.512000|2.512000	0.84698|0.84698	0.655000|0.655000	0.94253|0.94253	CCG|CGC	.	.		0.701	TFPT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141215.4	NM_013342	
SIRPG	55423	hgsc.bcm.edu	37	20	1629885	1629885	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:1629885T>G	ENST00000303415.3	-	2	307	c.243A>C	c.(241-243)aaA>aaC	p.K81N	RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000344103.4_Missense_Mutation_p.K81N|SIRPG_ENST00000216927.4_Missense_Mutation_p.K81N|SIRPG_ENST00000381583.2_Missense_Mutation_p.K81N|SIRPG_ENST00000381580.1_Missense_Mutation_p.K48N	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	81	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						AGTGGCCTTCTTTTTGATTGT	0.527																																					p.K81N		Atlas-SNP	.											.	SIRPG	61	.	0			c.A243C						.						224.0	198.0	207.0					20																	1629885		2203	4300	6503	SO:0001583	missense	55423	exon2			GCCTTCTTTTTGA	AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.243A>C	chr20.hg19:g.1629885T>G	ENSP00000305529:p.Lys81Asn	1118.0	2.0		816.0	294.0	NM_001039508	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	ENST00000303415.3	hg19	CCDS13020.2	.	.	.	.	.	.	.	.	.	.	.	9.742	1.165088	0.21538	.	.	ENSG00000089012	ENST00000381580;ENST00000344103;ENST00000303415;ENST00000381583;ENST00000216927	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	1.93	0.812	0.18744	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65678	0.2714	L	0.60957	1.885	0.09310	N	1	D;B;P	0.61697	0.99;0.288;0.537	P;B;B	0.59288	0.855;0.043;0.113	T	0.53337	-0.8453	9	0.51188	T	0.08	.	3.5695	0.07912	0.0:0.2117:0.0:0.7883	.	81;81;81	Q9P1W8-3;Q9P1W8-4;Q9P1W8	.;.;SIRPG_HUMAN	N	48;81;81;81;81	ENSP00000370992:K48N;ENSP00000342759:K81N;ENSP00000305529:K81N;ENSP00000370995:K81N;ENSP00000216927:K81N	ENSP00000216927:K81N	K	-	3	2	SIRPG	1577885	0.002000	0.14202	0.005000	0.12908	0.188000	0.23474	0.394000	0.20834	0.212000	0.20703	0.164000	0.16699	AAA	.	.		0.527	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077566.2	NM_018556	
C20orf27	54976	hgsc.bcm.edu	37	20	3735113	3735113	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:3735113C>T	ENST00000379772.3	-	5	1165	c.355G>A	c.(355-357)Gag>Aag	p.E119K	C20orf27_ENST00000217195.8_Missense_Mutation_p.E144K	NM_001258429.1	NP_001245358.1	Q9GZN8	CT027_HUMAN	chromosome 20 open reading frame 27	119										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	7						AGCAGTATCTCCTCTTTGAGG	0.632																																					p.E144K		Atlas-SNP	.											.	C20orf27	17	.	0			c.G430A						.						128.0	104.0	112.0					20																	3735113		2203	4300	6503	SO:0001583	missense	54976	exon5			GTATCTCCTCTTT	AK000557	CCDS33436.1, CCDS58763.1	20p13	2011-01-25			ENSG00000101220	ENSG00000101220			15873	protein-coding gene	gene with protein product	"""hypothetical protein LOC54976"""					11780052	Standard	NM_001258429		Approved	FLJ20550	uc002wjh.2	Q9GZN8	OTTHUMG00000031753	ENST00000379772.3:c.355G>A	chr20.hg19:g.3735113C>T	ENSP00000369097:p.Glu119Lys	61.0	0.0		83.0	30.0	NM_001039140	A8K4J0|D3DVX8|Q5JX81|Q9NWX3	Missense_Mutation	SNP	ENST00000379772.3	hg19	CCDS58763.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081242	0.76528	.	.	ENSG00000101220	ENST00000379772;ENST00000217195;ENST00000399672	.	.	.	4.82	4.82	0.62117	.	0.000000	0.64402	U	0.000002	T	0.56016	0.1957	L	0.55103	1.725	0.58432	D	0.999998	B;P	0.37731	0.23;0.607	B;B	0.40375	0.15;0.327	T	0.53851	-0.8380	9	0.29301	T	0.29	-7.2983	15.8093	0.78543	0.0:1.0:0.0:0.0	.	119;144	Q9GZN8;Q9GZN8-2	CT027_HUMAN;.	K	119;144;119	.	ENSP00000217195:E144K	E	-	1	0	C20orf27	3683113	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.276000	0.72601	2.677000	0.91161	0.561000	0.74099	GAG	.	.		0.632	C20orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077750.2	NM_001039140	
RTFDC1	51507	hgsc.bcm.edu	37	20	55048453	55048453	+	Splice_Site	SNP	T	T	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:55048453T>A	ENST00000023939.4	+	2	271		c.e2+2		RTFDC1_ENST00000395881.3_Splice_Site|snoU13_ENST00000459416.1_RNA|RTFDC1_ENST00000357348.5_Splice_Site	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1																		ACTTGGCAGGTATGGTTTTTA	0.373																																					.		Atlas-SNP	.											.	.	.	.	0			c.164+2T>A						.						95.0	94.0	94.0					20																	55048453		2203	4300	6503	SO:0001630	splice_region_variant	51507	exon2			GGCAGGTATGGTT	AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.164+2T>A	chr20.hg19:g.55048453T>A		84.0	0.0		48.0	11.0	NM_016407	E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Splice_Site	SNP	ENST00000023939.4	hg19	CCDS13453.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.174589	0.78452	.	.	ENSG00000022277	ENST00000023939;ENST00000395881;ENST00000357348;ENST00000449062	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9824	0.71321	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	C20orf43	54481860	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	7.134000	0.77268	2.016000	0.59253	0.477000	0.44152	.	.	.		0.373	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079817.2	NM_016407	Intron
SYNJ1	8867	hgsc.bcm.edu	37	21	34022586	34022586	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr21:34022586C>T	ENST00000322229.7	-	22	2944	c.2945G>A	c.(2944-2946)aGt>aAt	p.S982N	SYNJ1_ENST00000382491.3_Missense_Mutation_p.S977N|SYNJ1_ENST00000357345.3_Missense_Mutation_p.S982N|SYNJ1_ENST00000382499.2_Missense_Mutation_p.S1021N|SYNJ1_ENST00000433931.2_Missense_Mutation_p.S1021N			O43426	SYNJ1_HUMAN	synaptojanin 1	982	Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						TTTCTCTAAACTCATTTCTTC	0.353																																					p.S1021N		Atlas-SNP	.											.	SYNJ1	253	.	0			c.G3062A						.						158.0	160.0	160.0					21																	34022586		2203	4300	6503	SO:0001583	missense	8867	exon23			TCTAAACTCATTT	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.2945G>A	chr21.hg19:g.34022586C>T	ENSP00000322234:p.Ser982Asn	406.0	0.0		237.0	77.0	NM_203446	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	hg19	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.313093	0.23908	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229	D;D;D;D;D	0.93859	-2.42;-3.28;-3.3;-2.49;-2.46	5.65	3.52	0.40303	Domain of unknown function DUF1866 (1);	0.115478	0.85682	D	0.000000	D	0.82898	0.5137	N	0.11201	0.11	0.38489	D	0.947926	B;B;B;B;B	0.12013	0.001;0.001;0.001;0.005;0.0	B;B;B;B;B	0.15484	0.01;0.008;0.002;0.013;0.002	T	0.76085	-0.3088	10	0.13853	T	0.58	.	9.138	0.36886	0.0:0.7065:0.0:0.2935	.	977;1021;982;982;982	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	N	977;982;1021;1021;982	ENSP00000371931:S977N;ENSP00000349903:S982N;ENSP00000371939:S1021N;ENSP00000409667:S1021N;ENSP00000322234:S982N	ENSP00000322234:S982N	S	-	2	0	SYNJ1	32944457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.780000	0.38634	1.400000	0.46741	0.650000	0.86243	AGT	.	.		0.353	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
MICAL3	57553	hgsc.bcm.edu	37	22	18358243	18358243	+	Intron	SNP	G	G	A	rs201286172	byFrequency	TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr22:18358243G>A	ENST00000441493.2	-	17	2594				MICAL3_ENST00000429452.1_Silent_p.P825P|MICAL3_ENST00000383094.3_Intron|MICAL3_ENST00000414725.2_Intron|MICAL3_ENST00000585038.1_Silent_p.P825P|MICAL3_ENST00000400561.2_Intron|MICAL3_ENST00000207726.7_Intron|MICAL3_ENST00000444520.1_Intron	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3						actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		AGGGAGAGGCGGGGCGGGCAG	0.557													G|||	2	0.000399361	0.0008	0.0	5008	,	,		13614	0.0		0.001	False		,,,				2504	0.0				p.P825P		Atlas-SNP	.											.	MICAL3	53	.	0			c.C2475T						.						24.0	34.0	31.0					22																	18358243		1561	3562	5123	SO:0001627	intron_variant	57553	exon19			AGAGGCGGGGCGG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.2242-3454C>T	chr22.hg19:g.18358243G>A		73.0	0.0		59.0	12.0	NM_001136004	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	hg19	CCDS46659.1																																																																																			.	.		0.557	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
TCF20	6942	hgsc.bcm.edu	37	22	42606748	42606748	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr22:42606748A>T	ENST00000359486.3	-	1	4700	c.4564T>A	c.(4564-4566)Tca>Aca	p.S1522T	TCF20_ENST00000335626.4_Missense_Mutation_p.S1522T|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TGCTTCGGTGAAATCGTCACT	0.468																																					p.S1522T		Atlas-SNP	.											.	TCF20	164	.	0			c.T4564A						.						108.0	93.0	98.0					22																	42606748		2203	4300	6503	SO:0001583	missense	6942	exon1			TCGGTGAAATCGT	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.4564T>A	chr22.hg19:g.42606748A>T	ENSP00000352463:p.Ser1522Thr	352.0	0.0		323.0	22.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	hg19	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	A	6.147	0.395309	0.11638	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.59772	0.24;0.24	5.85	5.85	0.93711	.	0.101011	0.44285	D	0.000462	T	0.39655	0.1086	N	0.17082	0.46	0.80722	D	1	B;B	0.12630	0.006;0.003	B;B	0.12156	0.007;0.003	T	0.27331	-1.0077	10	0.29301	T	0.29	-12.5995	10.0749	0.42355	0.7415:0.0:0.0:0.2585	.	1522;1522	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	T	1522	ENSP00000352463:S1522T;ENSP00000335561:S1522T	ENSP00000335561:S1522T	S	-	1	0	TCF20	40936692	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	2.252000	0.43196	2.233000	0.73108	0.533000	0.62120	TCA	.	.		0.468	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
SCML2	10389	hgsc.bcm.edu	37	X	18283818	18283818	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:18283818G>C	ENST00000251900.4	-	8	994	c.835C>G	c.(835-837)Cag>Gag	p.Q279E	SCML2_ENST00000398048.3_Missense_Mutation_p.Q15E	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	279					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CTCCTGACCTGCTGTGTTGGT	0.408																																					p.Q279E	Esophageal Squamous(100;1252 1965 19021 35517)	Atlas-SNP	.											.	SCML2	81	.	0			c.C835G						.						162.0	147.0	152.0					X																	18283818		2203	4300	6503	SO:0001583	missense	10389	exon8			TGACCTGCTGTGT	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.835C>G	chrX.hg19:g.18283818G>C	ENSP00000251900:p.Gln279Glu	461.0	0.0		290.0	62.0	NM_006089	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	hg19	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	G	2.142	-0.396585	0.04899	.	.	ENSG00000102098	ENST00000251900;ENST00000398048;ENST00000442000	T;T	0.42513	2.3;0.97	5.5	2.7	0.31948	.	2.455680	0.01472	N	0.016315	T	0.39835	0.1093	L	0.57536	1.79	0.09310	N	1	B;B;B	0.29716	0.01;0.255;0.147	B;B;B	0.27262	0.004;0.078;0.029	T	0.10636	-1.0621	10	0.23891	T	0.37	.	5.0075	0.14295	0.161:0.0:0.54:0.299	.	247;15;279	B4DZR9;B4DRC2;Q9UQR0	.;.;SCML2_HUMAN	E	279;15;247	ENSP00000251900:Q279E;ENSP00000381126:Q15E	ENSP00000251900:Q279E	Q	-	1	0	SCML2	18193739	0.750000	0.28316	0.000000	0.03702	0.070000	0.16714	1.650000	0.37292	0.131000	0.18576	0.468000	0.43344	CAG	.	.		0.408	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
PHKA2	5256	hgsc.bcm.edu	37	X	18972509	18972509	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:18972509A>C	ENST00000379942.4	-	2	765	c.100T>G	c.(100-102)Tca>Gca	p.S34A		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	34					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TGGCTGGCTGACAGCAGCCCC	0.557																																					p.S34A		Atlas-SNP	.											.	PHKA2	122	.	0			c.T100G						.						77.0	58.0	64.0					X																	18972509		2203	4300	6503	SO:0001583	missense	5256	exon2			TGGCTGACAGCAG		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.100T>G	chrX.hg19:g.18972509A>C	ENSP00000369274:p.Ser34Ala	95.0	0.0		60.0	14.0	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	hg19	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.786777	0.49997	.	.	ENSG00000044446	ENST00000379942	D	0.88354	-2.37	5.65	5.65	0.86999	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.058731	0.64402	D	0.000001	D	0.83101	0.5181	L	0.39020	1.185	0.40299	D	0.978581	B	0.18166	0.026	B	0.19666	0.026	T	0.79264	-0.1875	10	0.45353	T	0.12	-8.5786	9.4666	0.38817	0.9205:0.0:0.0795:0.0	.	34	P46019	KPB2_HUMAN	A	34	ENSP00000369274:S34A	ENSP00000369274:S34A	S	-	1	0	PHKA2	18882430	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	4.211000	0.58507	1.904000	0.55121	0.486000	0.48141	TCA	.	.		0.557	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
PRICKLE3	4007	hgsc.bcm.edu	37	X	49032070	49032070	+	Silent	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:49032070G>A	ENST00000376317.3	-	9	1894	c.1800C>T	c.(1798-1800)cgC>cgT	p.R600R	PRICKLE3_ENST00000540849.1_Silent_p.R532R|PRICKLE3_ENST00000536904.1_Silent_p.R519R|PRICKLE3_ENST00000538114.1_Silent_p.R424R	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	600							zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						GCATCCCTGCGCGAGAGTCCC	0.602																																					p.R600R		Atlas-SNP	.											.	PRICKLE3	59	.	0			c.C1800T						.						50.0	48.0	49.0					X																	49032070		2203	4300	6503	SO:0001819	synonymous_variant	4007	exon9			CCCTGCGCGAGAG	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.1800C>T	chrX.hg19:g.49032070G>A		102.0	0.0		94.0	19.0	NM_006150	B7Z8F2|O76007|Q53XR5	Silent	SNP	ENST00000376317.3	hg19	CCDS14320.1	.	.	.	.	.	.	.	.	.	.	-	5.377	0.254793	0.10185	.	.	ENSG00000012211	ENST00000453382	T	0.70399	-0.48	4.44	0.988	0.19796	.	0.826858	0.10174	N	0.706741	T	0.65606	0.2707	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.54735	-0.8249	6	.	.	.	-4.7242	11.6302	0.51168	0.0:0.6556:0.3444:0.0	.	.	.	.	C	613	ENSP00000388599:R613C	.	R	-	1	0	PRICKLE3	48919014	0.029000	0.19370	0.002000	0.10522	0.123000	0.20343	0.358000	0.20216	0.241000	0.21283	0.455000	0.32223	CGC	.	.		0.602	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150	
SSX7	280658	hgsc.bcm.edu	37	X	52677345	52677345	+	Silent	SNP	T	T	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:52677345T>C	ENST00000298181.5	-	6	590	c.432A>G	c.(430-432)aaA>aaG	p.K144K		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					AGGTACTTGGTTTTCCTGGAG	0.507																																					p.K144K		Atlas-SNP	.											.	SSX7	34	.	0			c.A432G						.						199.0	172.0	181.0					X																	52677345		2203	4300	6503	SO:0001819	synonymous_variant	280658	exon6			ACTTGGTTTTCCT	BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.432A>G	chrX.hg19:g.52677345T>C		1399.0	1.0		1049.0	178.0	NM_173358		Silent	SNP	ENST00000298181.5	hg19	CCDS14343.1																																																																																			.	.		0.507	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056671.1	NM_173358	
KLF8	11279	hgsc.bcm.edu	37	X	56291629	56291629	+	Missense_Mutation	SNP	G	G	A	rs144407506		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:56291629G>A	ENST00000468660.1	+	3	386	c.98G>A	c.(97-99)cGg>cAg	p.R33Q	KLF8_ENST00000374928.3_Missense_Mutation_p.R33Q	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	33					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						GCTTCTGTTCGGAACAGAGAT	0.408																																					p.R33Q		Atlas-SNP	.											.	KLF8	38	.	0			c.G98A						.	G	GLN/ARG,GLN/ARG	0,3835		0,0,1632,571	31.0	28.0	29.0		98,98	-2.2	0.0	X	dbSNP_134	29	1,6727		0,1,2427,1872	yes	missense,missense	KLF8	NM_001159296.1,NM_007250.4	43,43	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	benign,benign	33/258,33/360	56291629	1,10562	2203	4300	6503	SO:0001583	missense	11279	exon4			CTGTTCGGAACAG	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.98G>A	chrX.hg19:g.56291629G>A	ENSP00000417303:p.Arg33Gln	175.0	0.0		108.0	17.0	NM_001159296	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	ENST00000468660.1	hg19	CCDS14373.1	.	.	.	.	.	.	.	.	.	.	G	2.472	-0.321634	0.05386	0.0	1.49E-4	ENSG00000102349	ENST00000374928;ENST00000468660	T	0.05258	3.47	4.68	-2.22	0.06952	.	0.710568	0.12845	N	0.434498	T	0.01523	0.0049	N	0.01874	-0.695	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43426	-0.9392	10	0.07990	T	0.79	.	1.1714	0.01826	0.4887:0.1919:0.1821:0.1372	.	33;33;33	E7EQQ8;B4DJN3;O95600	.;.;KLF8_HUMAN	Q	33	ENSP00000417303:R33Q	ENSP00000431911:R33Q	R	+	2	0	KLF8	56308354	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	-0.020000	0.12525	-0.482000	0.06782	-1.468000	0.01013	CGG	.	G|1.000;A|0.000		0.408	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056887.2	NM_007250	
ABCD1	215	hgsc.bcm.edu	37	X	153001604	153001604	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrX:153001604G>C	ENST00000218104.3	+	3	1519	c.1120G>C	c.(1120-1122)Gag>Cag	p.E374Q	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	374	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGAAAAGAAGGAGGAGGAGCT	0.617																																					p.E374Q		Atlas-SNP	.											.	ABCD1	59	.	0			c.G1120C						.						102.0	96.0	98.0					X																	153001604		2203	4300	6503	SO:0001583	missense	215	exon3			AAGAAGGAGGAGG	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1120G>C	chrX.hg19:g.153001604G>C	ENSP00000218104:p.Glu374Gln	193.0	0.0		129.0	29.0	NM_000033	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	hg19	CCDS14728.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.61|15.61	2.883868|2.883868	0.51908|0.51908	.|.	.|.	ENSG00000101986|ENSG00000101986	ENST00000218104|ENST00000443684	D|.	0.94184|.	-3.37|.	4.85|4.85	3.08|3.08	0.35506|0.35506	.|.	0.221347|.	0.35585|.	N|.	0.003106|.	T|T	0.58595|0.58595	0.2133|0.2133	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	B|.	0.23128|.	0.08|.	B|.	0.20384|.	0.029|.	T|T	0.51403|0.51403	-0.8710|-0.8710	10|5	0.13853|.	T|.	0.58|.	-17.98|-17.98	9.3879|9.3879	0.38354|0.38354	0.1835:0.0:0.8165:0.0|0.1835:0.0:0.8165:0.0	.|.	374|.	P33897|.	ABCD1_HUMAN|.	Q|S	374|41	ENSP00000218104:E374Q|.	ENSP00000218104:E374Q|.	E|R	+|+	1|3	0|2	ABCD1|ABCD1	152654798|152654798	1.000000|1.000000	0.71417|0.71417	0.438000|0.438000	0.26821|0.26821	0.610000|0.610000	0.37248|0.37248	7.600000|7.600000	0.82769|0.82769	0.404000|0.404000	0.25506|0.25506	0.523000|0.523000	0.50628|0.50628	GAG|AGG	.	.		0.617	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061041.1	NM_000033	
MT-ND5	4540	hgsc.bcm.edu	37	M	13718	13718	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrM:13718G>A	ENST00000361567.2	+	1	1382	c.1382G>A	c.(1381-1383)aGc>aAc	p.S461N	MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	461					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GGCAGCCGGAAGCCTATTCGC	0.498																																					p.S461N		Atlas-SNP	.											.	.	.	.	0			c.G1382A						.																																			SO:0001583	missense	0	exon1			CCGGAAGCCTATT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1382G>A	chrM.hg19:g.13718G>A	ENSP00000354813:p.Ser461Asn	624.0	1.0		78.0	26.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.498	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-ND6	4541	hgsc.bcm.edu	37	M	14607	14607	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrM:14607G>A	ENST00000361681.2	-	1	66	c.67C>T	c.(67-69)Cct>Tct	p.P23S	MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	23					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						AATAGGAGAAGGCTTAGAAGA	0.408																																					p.P23S		Atlas-SNP	.											.	.	.	.	0			c.C67T						.																																			SO:0001583	missense	0	exon1			GAGAAGGCTTAGA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.67C>T	chrM.hg19:g.14607G>A	ENSP00000354665:p.Pro23Ser	1100.0	0.0		175.0	11.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.408	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
MT-CYB	4519	hgsc.bcm.edu	37	M	15357	15357	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chrM:15357G>A	ENST00000361789.2	+	1	611	c.611G>A	c.(610-612)gGa>gAa	p.G204E	MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	204					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						GCACGAAACGGGATCAAACAA	0.478											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.G204E		Atlas-SNP	.											.	.	.	.	0			c.G611A						.																																			SO:0001583	missense	0	exon1			AAACGGGATCAAA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.611G>A	chrM.hg19:g.15357G>A	ENSP00000354554:p.Gly204Glu	714.0	1.0	585	94.0	53.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.478	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
BAP1	8314	hgsc.bcm.edu	37	3	52436687	52436688	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:52436687_52436688insA	ENST00000460680.1	-	16	2457_2458	c.1986_1987insT	c.(1984-1989)attgatfs	p.D663fs	BAP1_ENST00000296288.5_Frame_Shift_Ins_p.D645fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CTCTGGTCATCAATCTGTAGGA	0.53			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.D663_D664delinsX	GBM(101;493 1458 7992 21037 25532)	Atlas-Indel,Pindel	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,bladder,carcinoma,0,1	BAP1	371	.	0			c.1987_1988insT						.																																			SO:0001589	frameshift_variant	8314	exon16			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1987dupT	chr3.hg19:g.52436689_52436689dupA	ENSP00000417132:p.Asp663fs	226.0	0.0		89.0	65.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Ins	INS	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.		0.530	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
GAB2	9846	hgsc.bcm.edu	37	11	77937959	77937960	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr11:77937959_77937960insT	ENST00000361507.4	-	4	843_844	c.758_759insA	c.(757-759)aagfs	p.K253fs	GAB2_ENST00000340149.2_Frame_Shift_Ins_p.K215fs|GAB2_ENST00000526030.1_5'Flank	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	253					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GCCGGCTCGGCTTGGGAAGGCT	0.569																																					p.K253fs		Atlas-INDEL	.											.	GAB2	63	.	0			c.759_760insA						.		,	5,4259		0,5,2127					,	3.8	1.0			75	6,8248		0,6,4121	no	frameshift,frameshift	GAB2	NM_080491.2,NM_012296.3	,	0,11,6248	A1A1,A1R,RR		0.0727,0.1173,0.0879	,	,		11,12507				SO:0001589	frameshift_variant	9846	exon4			.	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.759dupA	chr11.hg19:g.77937961_77937961dupT	ENSP00000354952:p.Lys253fs	123.0	0.0		77.0	13.0	NM_080491	A2RRM2|A6NEW9|A7MD36|O60317	Frame_Shift_Ins	INS	ENST00000361507.4	hg19	CCDS8259.1																																																																																			.	.		0.569	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491	
COMMD3	23412	hgsc.bcm.edu	37	10	22606865	22606866	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:22606865_22606866insG	ENST00000376836.3	+	2	636_637	c.192_193insG	c.(193-195)gcafs	p.A65fs	COMMD3-BMI1_ENST00000463409.2_3'UTR|COMMD3_ENST00000483684.1_3'UTR|COMMD3-BMI1_ENST00000602390.1_Frame_Shift_Ins_p.A65fs	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	65										kidney(2)|lung(2)|ovary(1)	5						ATTGTCATGCAGCAGCTGCAAC	0.347																																					p.A64fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.192_193insG						.																																			SO:0001589	frameshift_variant	0	exon2			.	AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.193dupG	chr10.hg19:g.22606866_22606866dupG	ENSP00000366032:p.Ala65fs	305.0	0.0		368.0	63.0	NM_001204062	D3DRU7|Q5T8Y9	Frame_Shift_Ins	INS	ENST00000376836.3	hg19	CCDS7137.1																																																																																			.	.		0.347	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047159.1	NM_012071	
PREX1	57580	hgsc.bcm.edu	37	20	47307517	47307518	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:47307517_47307518insC	ENST00000371941.3	-	9	1175_1176	c.1153_1154insG	c.(1153-1155)gatfs	p.D385fs	PREX1_ENST00000396220.1_Frame_Shift_Ins_p.D385fs	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	385	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GATGATGGCATCCAGCCACTTC	0.599																																					p.D385fs		Atlas-INDEL	.											.	PREX1	441	.	0			c.1154_1155insG						.																																			SO:0001589	frameshift_variant	57580	exon9			.	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1154dupG	chr20.hg19:g.47307519_47307519dupC	ENSP00000361009:p.Asp385fs	185.0	0.0		161.0	10.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Frame_Shift_Ins	INS	ENST00000371941.3	hg19	CCDS13410.1																																																																																			.	.		0.599	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
REXO1	57455	hgsc.bcm.edu	37	19	1828274	1828275	+	Frame_Shift_Ins	INS	-	-	G	rs545604526		TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:1828274_1828275insG	ENST00000170168.4	-	2	607_608	c.513_514insC	c.(511-516)gccgccfs	p.A172fs	REXO1_ENST00000587524.1_5'UTR	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	172						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGCAGGGGCGGCCAGTGGGG	0.698																																					p.A172fs		Atlas-INDEL	.											.	REXO1	55	.	0			c.514_515insC						.																																			SO:0001589	frameshift_variant	57455	exon2			.	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.514dupC	chr19.hg19:g.1828276_1828276dupG	ENSP00000170168:p.Ala172fs	58.0	0.0		51.0	11.0	NM_020695	Q9ULT2	Frame_Shift_Ins	INS	ENST00000170168.4	hg19	CCDS32866.1																																																																																			.	.		0.698	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
DHX36	170506	hgsc.bcm.edu	37	3	154042059	154042060	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr3:154042059_154042060insC	ENST00000496811.1	-	1	226_227	c.146_147insG	c.(145-147)ggcfs	p.G49fs	DHX36_ENST00000544526.1_Frame_Shift_Ins_p.G49fs|DHX36_ENST00000329463.5_Frame_Shift_Ins_p.G49fs|DHX36_ENST00000308361.6_Frame_Shift_Ins_p.G49fs	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	49	Gly-rich.|RNA-binding; sufficient and required for recruitment to cytoplasmic stress granules.				ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GCCGGCCCCTGCCGCCTCGACC	0.678																																					p.G49fs		Atlas-INDEL	.											.	DHX36	98	.	0			c.147_148insG						.																																			SO:0001589	frameshift_variant	170506	exon1			.	AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.147dupG	chr3.hg19:g.154042061_154042061dupC	ENSP00000417078:p.Gly49fs	223.0	0.0		244.0	15.0	NM_020865	B2RB00|Q70JU3|Q8IYE5|Q9P240	Frame_Shift_Ins	INS	ENST00000496811.1	hg19	CCDS3171.1																																																																																			.	.		0.678	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353349.1	NM_020865	
ATP9B	374868	hgsc.bcm.edu	37	18	77108133	77108134	+	Splice_Site	INS	-	-	TG			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr18:77108133_77108134insTG	ENST00000426216.2	+	25	2857_2858	c.2840_2841insTG	c.(2839-2844)gctgtg>gcTGtgtg	p.AV947fs	ATP9B_ENST00000543761.1_Splice_Site_p.AV268fs|ATP9B_ENST00000307671.7_Splice_Site_p.AV947fs	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	947					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TCTCTCCAGGCTGTGTTTTCCT	0.564																																					p.A947fs		Atlas-Indel,Pindel	.											.	ATP9B	96	.	0			c.2840_2841insTG						.																																			SO:0001630	splice_region_variant	374868	exon25			.	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.2839-1->TG	chr18.hg19:g.77108136_77108137dupTG		392.0	0.0		242.0	63.0	NM_198531	O60872|Q08AD8|Q08AD9	Frame_Shift_Ins	INS	ENST00000426216.2	hg19	CCDS12014.1																																																																																			.	.		0.564	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	Frame_Shift_Ins
OTOP1	133060	hgsc.bcm.edu	37	4	4199089	4199090	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr4:4199089_4199090insG	ENST00000296358.4	-	5	1495_1496	c.1471_1472insC	c.(1471-1473)cagfs	p.Q491fs		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	491					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTCCTTGCCCTGGGGAGCCACA	0.584																																					p.Q491fs		Atlas-INDEL	.											.	OTOP1	118	.	0			c.1472_1473insC						.																																			SO:0001589	frameshift_variant	133060	exon5			.	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.1472dupC	chr4.hg19:g.4199093_4199093dupG	ENSP00000296358:p.Gln491fs	219.0	0.0		157.0	13.0	NM_177998	A1L476	Frame_Shift_Ins	INS	ENST00000296358.4	hg19	CCDS3372.1																																																																																			.	.		0.584	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
CPXM1	56265	hgsc.bcm.edu	37	20	2776314	2776315	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr20:2776314_2776315insG	ENST00000380605.2	-	11	1714_1715	c.1650_1651insC	c.(1648-1653)ccctgcfs	p.C551fs		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	551					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TGGCTGTGGCAGGGTCGGCGGC	0.629																																					p.C551fs		Atlas-INDEL	.											.	CPXM1	107	.	0			c.1651_1652insC						.																																			SO:0001589	frameshift_variant	56265	exon11			.	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1651dupC	chr20.hg19:g.2776317_2776317dupG	ENSP00000369979:p.Cys551fs	123.0	0.0		137.0	13.0	NM_019609	Q6P4G8|Q6UW65|Q9NUB5	Frame_Shift_Ins	INS	ENST00000380605.2	hg19	CCDS13033.1																																																																																			.	.		0.629	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
LARP4B	23185	hgsc.bcm.edu	37	10	858938	858939	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr10:858938_858939insC	ENST00000316157.3	-	17	2184_2185	c.2144_2145insG	c.(2143-2145)ggcfs	p.G715fs	LARP4B_ENST00000469487.1_5'Flank	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	715					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						GCGAgggccggccccccgccgg	0.678																																					p.G715fs		Atlas-INDEL	.											.,1	LARP4B	110	.	0			c.2145_2146insG						.																																			SO:0001589	frameshift_variant	23185	exon18			.	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.2145dupG	chr10.hg19:g.858944_858944dupC	ENSP00000326128:p.Gly715fs	66.0	0.0		129.0	12.0	NM_015155	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Frame_Shift_Ins	INS	ENST00000316157.3	hg19	CCDS31131.1																																																																																			.	.		0.678	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	
LGALS14	56891	hgsc.bcm.edu	37	19	40196577	40196757	+	Intron	DEL	CAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCT	CAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCT	-	rs35970410|rs116895043|rs372314443|rs555819746|rs577451269|rs72480733|rs537596492|rs62121662|rs141242714|rs372371300|rs377187330|rs368365662|rs35541195|rs567124884	byFrequency	TCGA-BC-A10R-01A-11D-A12Z-10	TCGA-BC-A10R-11A-11D-A12Z-10	CAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCT	CAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e98ae9b4-4696-4b17-a6ed-b072d679ba40	a458c859-a526-4bd8-a5ff-ed71b5ce571b	g.chr19:40196577_40196757delCAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCT	ENST00000392052.3	+	2	238				LGALS14_ENST00000360675.3_Splice_Site_p.CKYWGCAVSNVCRFWEGRPLPLMIV10fs	NM_020129.2	NP_064514.1	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14						apoptotic process (GO:0006915)	nucleus (GO:0005634)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|stomach(2)	14	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			TTCATTTGTGCAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCTCAAGTCTTGT	0.444																																					p.10_34del		Pindel	.											.	LGALS14	38	.	0			c.29_102del						.																																			SO:0001627	intron_variant	56891	exon2			.	AF267852	CCDS12542.1, CCDS46073.1	19q13.2	2014-03-19			ENSG00000006659	ENSG00000006659		"""Lectins, galactoside-binding"""	30054	protein-coding gene	gene with protein product		607260				11997112	Standard	NM_020129		Approved	PPL13, CLC2	uc002omg.3	Q8TCE9	OTTHUMG00000183143	ENST00000392052.3:c.16-480CAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCT>-	chr19.hg19:g.40196577_40196757delCAAGTACTGGGGCTGTGCTGTCAGTAATGTGTGCCGCTTCTGGGAAGGACGTCCATTGCCCTTGATGATTGTGGTGCGTGTACATCCCACACACAGGGGTTTCCTGTTCTTTCGTCATTTCCCTTTCTCTTTCAACAAGTGTTGTTTCTCACTGGAGTGAATTTTTAAATTCTTTCACCCT		171.0	0.0		106.0	10.0	NM_203471	A8MPV8|B2R530|C5HZ19|Q7Z4X8|Q96KD4|Q96KD5|Q96KD6|Q9NR03	Frame_Shift_Del	DEL	ENST00000392052.3	hg19	CCDS46073.1																																																																																			.	.		0.444	LGALS14-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465222.1	NM_020129	
