#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBE2J2	118424	hgsc.bcm.edu	37	1	1192490	1192490	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:1192490T>C	ENST00000349431.6	-	5	515	c.296A>G	c.(295-297)gAt>gGt	p.D99G	UBE2J2_ENST00000400929.2_Missense_Mutation_p.D47G|UBE2J2_ENST00000348298.7_Missense_Mutation_p.D47G|UBE2J2_ENST00000491779.1_5'UTR|UBE2J2_ENST00000339385.6_Missense_Mutation_p.D64G|UBE2J2_ENST00000400930.4_Missense_Mutation_p.D115G|UBE2J2_ENST00000360466.2_Missense_Mutation_p.D99G|UBE2J2_ENST00000347370.2_Missense_Mutation_p.D47G	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	99					protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		CGGGTGGAAATCCGTGATAGA	0.632																																					p.D115G		Atlas-SNP	.											.	UBE2J2	25	.	0			c.A344G						.						79.0	91.0	86.0					1																	1192490		2203	4300	6503	SO:0001583	missense	118424	exon6			TGGAAATCCGTGA	AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.296A>G	chr1.hg19:g.1192490T>C	ENSP00000305826:p.Asp99Gly	93.0	0.0		48.0	4.0	NM_194315	A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	ENST00000349431.6	hg19	CCDS14.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.509712	0.85282	.	.	ENSG00000160087	ENST00000347370;ENST00000349431;ENST00000339385;ENST00000348298;ENST00000400929;ENST00000360466;ENST00000400930;ENST00000435198	T;T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.52	4.38	0.52667	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.042296	0.85682	D	0.000000	T	0.56292	0.1975	L	0.56280	1.765	0.80722	D	1	D;B;D;D	0.89917	1.0;0.218;0.997;1.0	D;B;D;D	0.97110	1.0;0.199;0.992;0.989	T	0.50608	-0.8808	10	0.27785	T	0.31	-17.1661	11.9834	0.53133	0.0:0.0:0.1452:0.8548	.	47;115;99;132	A6NGS0;A8MYC7;Q8N2K1;B1AME9	.;.;UB2J2_HUMAN;.	G	47;99;64;47;47;99;115;99	ENSP00000344857:D47G;ENSP00000305826:D99G;ENSP00000340197:D64G;ENSP00000342541:D47G;ENSP00000383718:D47G;ENSP00000353653:D99G;ENSP00000383719:D115G;ENSP00000393301:D99G	ENSP00000340197:D64G	D	-	2	0	UBE2J2	1182353	1.000000	0.71417	0.890000	0.34922	0.928000	0.56348	7.613000	0.82986	0.914000	0.36822	-0.328000	0.08392	GAT	.	.		0.632	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005430.1	NM_058167	
PRKCZ	5590	hgsc.bcm.edu	37	1	2105426	2105426	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:2105426A>G	ENST00000400921.2	+	11	1510	c.827A>G	c.(826-828)gAc>gGc	p.D276G	PRKCZ_ENST00000400920.1_Missense_Mutation_p.D276G|PRKCZ_ENST00000479263.1_3'UTR	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	459	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	GACAACCCGGACATGAACACA	0.592											OREG0013007	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D459G		Atlas-SNP	.											.	PRKCZ	84	.	0			c.A1376G						.						136.0	116.0	122.0					1																	2105426		2203	4300	6503	SO:0001583	missense	5590	exon14			ACCCGGACATGAA	BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.827A>G	chr1.hg19:g.2105426A>G	ENSP00000383712:p.Asp276Gly	198.0	0.0	601	100.0	4.0	NM_002744	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Missense_Mutation	SNP	ENST00000400921.2	hg19	CCDS41229.1	.	.	.	.	.	.	.	.	.	.	A	18.43	3.622554	0.66787	.	.	ENSG00000067606	ENST00000378567;ENST00000400921;ENST00000461106;ENST00000400920	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	4.93	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.097591	0.64402	D	0.000002	T	0.25901	0.0631	N	0.10916	0.065	0.58432	D	0.999999	P;D;P;D	0.58970	0.956;0.962;0.956;0.984	D;D;D;D	0.68039	0.955;0.919;0.955;0.925	T	0.20107	-1.0285	10	0.87932	D	0	.	12.8492	0.57848	1.0:0.0:0.0:0.0	.	355;283;355;459	E9PCW2;B3KUN5;B7Z2J7;Q05513	.;.;.;KPCZ_HUMAN	G	459;276;355;276	ENSP00000367830:D459G;ENSP00000383712:D276G;ENSP00000426412:D355G;ENSP00000383711:D276G	ENSP00000367830:D459G	D	+	2	0	PRKCZ	2095286	1.000000	0.71417	0.961000	0.40146	0.024000	0.10985	8.187000	0.89708	1.986000	0.57962	0.477000	0.44152	GAC	.	.		0.592	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
NPHP4	261734	hgsc.bcm.edu	37	1	5934637	5934637	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:5934637T>C	ENST00000378156.4	-	22	3390	c.3125A>G	c.(3124-3126)cAc>cGc	p.H1042R	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	1042					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GCCACGCAGGTGGAACATGTC	0.657																																					p.H1042R		Atlas-SNP	.											.	NPHP4	119	.	0			c.A3125G						.						25.0	28.0	27.0					1																	5934637		2151	4241	6392	SO:0001583	missense	261734	exon22			CGCAGGTGGAACA	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.3125A>G	chr1.hg19:g.5934637T>C	ENSP00000367398:p.His1042Arg	144.0	0.0		85.0	7.0	NM_015102	Q8IWC0	Missense_Mutation	SNP	ENST00000378156.4	hg19	CCDS44052.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.163444	0.38217	.	.	ENSG00000131697	ENST00000378156	T	0.72835	-0.69	5.38	-1.55	0.08558	.	0.272597	0.33895	N	0.004443	T	0.60945	0.2308	L	0.55834	1.745	0.33568	D	0.598298	B	0.22080	0.064	B	0.21917	0.037	T	0.56438	-0.7979	10	0.52906	T	0.07	.	10.085	0.42412	0.0:0.3804:0.0:0.6196	.	1042	O75161	NPHP4_HUMAN	R	1042	ENSP00000367398:H1042R	ENSP00000367398:H1042R	H	-	2	0	NPHP4	5857224	1.000000	0.71417	0.247000	0.24249	0.651000	0.38670	3.233000	0.51311	-0.562000	0.06086	0.528000	0.53228	CAC	.	.		0.657	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2		
CHD5	26038	hgsc.bcm.edu	37	1	6188597	6188597	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:6188597G>A	ENST00000262450.3	-	24	3791	c.3692C>T	c.(3691-3693)gCc>gTc	p.A1231V	CHD5_ENST00000378021.1_Missense_Mutation_p.A88V	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGCACTGGCGGCCAAGTTCCC	0.627																																					p.A1231V		Atlas-SNP	.											.	CHD5	267	.	0			c.C3692T						.						58.0	61.0	60.0					1																	6188597		2203	4300	6503	SO:0001583	missense	26038	exon24			CTGGCGGCCAAGT	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3692C>T	chr1.hg19:g.6188597G>A	ENSP00000262450:p.Ala1231Val	153.0	0.0		79.0	4.0	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	hg19	CCDS57.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.172138	0.57584	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.90620	-2.7;2.27	4.48	4.48	0.54585	.	1.006430	0.07998	N	0.988353	D	0.83940	0.5363	N	0.19112	0.55	0.19300	N	0.99997	B;B	0.15719	0.014;0.008	B;B	0.14023	0.01;0.004	T	0.64651	-0.6357	10	0.11182	T	0.66	-1.0944	14.289	0.66265	0.0:0.0:1.0:0.0	.	1231;88	Q8TDI0;Q5TG85	CHD5_HUMAN;.	V	1231;747;88;639;639;88	ENSP00000262450:A1231V;ENSP00000367260:A88V	ENSP00000262450:A1231V	A	-	2	0	CHD5	6111184	0.950000	0.32346	0.760000	0.31359	0.688000	0.40055	5.667000	0.68067	2.045000	0.60652	0.313000	0.20887	GCC	.	.		0.627	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
NOL9	79707	hgsc.bcm.edu	37	1	6589090	6589090	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:6589090G>A	ENST00000377705.5	-	10	1821	c.1789C>T	c.(1789-1791)Ctt>Ttt	p.L597F		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	597					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		GTCTGGGCAAGCAGGATGGGC	0.483																																					p.L597F		Atlas-SNP	.											.	NOL9	49	.	0			c.C1789T						.						115.0	102.0	107.0					1																	6589090		2203	4300	6503	SO:0001583	missense	79707	exon10			GGGCAAGCAGGAT	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.1789C>T	chr1.hg19:g.6589090G>A	ENSP00000366934:p.Leu597Phe	176.0	0.0		95.0	4.0	NM_024654	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	hg19	CCDS80.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361468	0.82353	.	.	ENSG00000162408	ENST00000377705	T	0.47528	0.84	5.77	5.77	0.91146	Pre-mRNA cleavage complex II Clp1 (1);	0.000000	0.64402	D	0.000002	T	0.63486	0.2515	M	0.73962	2.25	0.46749	D	0.999189	D	0.89917	1.0	D	0.91635	0.999	T	0.59521	-0.7439	10	0.13108	T	0.6	-25.1663	10.8478	0.46753	0.0848:0.0:0.9152:0.0	.	597	Q5SY16	NOL9_HUMAN	F	597	ENSP00000366934:L597F	ENSP00000366934:L597F	L	-	1	0	NOL9	6511677	1.000000	0.71417	0.969000	0.41365	0.983000	0.72400	6.374000	0.73132	2.724000	0.93272	0.561000	0.74099	CTT	.	.		0.483	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
ENO1	2023	hgsc.bcm.edu	37	1	8930511	8930511	+	Splice_Site	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:8930511C>T	ENST00000234590.4	-	4	359	c.240G>A	c.(238-240)aaG>aaA	p.K80K		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	80					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CAGGTCCTACCTTGCTAACCA	0.458																																					p.K80K	Esophageal Squamous(21;302 608 19946 22210 33560)	Atlas-SNP	.											.	ENO1	38	.	0			c.G240A						.						96.0	82.0	87.0					1																	8930511		2203	4300	6503	SO:0001630	splice_region_variant	2023	exon4			TCCTACCTTGCTA	BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.240+1G>A	chr1.hg19:g.8930511C>T		85.0	0.0		54.0	4.0	NM_001428	B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Silent	SNP	ENST00000234590.4	hg19	CCDS97.1																																																																																			.	.		0.458	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004945.1	NM_001428	Silent
HNRNPCL1	343069	hgsc.bcm.edu	37	1	12908011	12908011	+	Silent	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:12908011C>T	ENST00000317869.6	-	2	357	c.132G>A	c.(130-132)gcG>gcA	p.A44A		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	44	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A44A(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CAGAGCAGCCCGCAATTTTGC	0.478																																					p.A44A		Atlas-SNP	.											.	HNRNPCL1	68	.	1	Substitution - coding silent(1)	lung(1)	c.G132A						.						117.0	112.0	114.0					1																	12908011		2203	4300	6503	SO:0001819	synonymous_variant	343069	exon2			GCAGCCCGCAATT	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.132G>A	chr1.hg19:g.12908011C>T		495.0	0.0		301.0	60.0	NM_001013631	B2RP44	Silent	SNP	ENST00000317869.6	hg19	CCDS30591.1																																																																																			.	.		0.478	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
CLCNKB	1188	hgsc.bcm.edu	37	1	16377074	16377074	+	Silent	SNP	C	C	T	rs375017657		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:16377074C>T	ENST00000375679.4	+	11	1143	c.1032C>T	c.(1030-1032)gcC>gcT	p.A344A	CLCNKB_ENST00000375667.3_Silent_p.A175A	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	344					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CACCCAGCGCCGGCCGCTTCC	0.627																																					p.A344A		Atlas-SNP	.											.	CLCNKB	50	.	0			c.C1032T						.	C	,	1,4405	2.1+/-5.4	0,1,2202	106.0	93.0	97.0		1032,525	0.8	0.1	1		97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CLCNKB	NM_000085.3,NM_001165945.1	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	344/688,175/519	16377074	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1188	exon11			CAGCGCCGGCCGC	AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.1032C>T	chr1.hg19:g.16377074C>T		102.0	0.0		74.0	4.0	NM_000085	B3KUY3|Q5T5Q7|Q5T5Q8	Silent	SNP	ENST00000375679.4	hg19	CCDS168.1																																																																																			.	.		0.627	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026331.1	NM_000085	
UBR4	23352	hgsc.bcm.edu	37	1	19446726	19446726	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:19446726T>C	ENST00000375254.3	-	69	10285	c.10258A>G	c.(10258-10260)Aat>Gat	p.N3420D	UBR4_ENST00000375267.2_Missense_Mutation_p.N3420D|UBR4_ENST00000375226.2_Missense_Mutation_p.N3396D|UBR4_ENST00000375218.3_5'Flank|UBR4_ENST00000375217.2_Missense_Mutation_p.N3413D	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3420					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GAGGAAGAATTGGACTCTAAC	0.552																																					p.N3420D		Atlas-SNP	.											.	UBR4	415	.	0			c.A10258G						.						125.0	110.0	115.0					1																	19446726		2203	4300	6503	SO:0001583	missense	23352	exon69			AAGAATTGGACTC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.10258A>G	chr1.hg19:g.19446726T>C	ENSP00000364403:p.Asn3420Asp	136.0	0.0		62.0	4.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	hg19	CCDS189.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216399	0.79352	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.78136	0.4236	M	0.79258	2.445	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.80890	-0.1180	10	0.72032	D	0.01	.	14.586	0.68326	0.0:0.0:0.0:1.0	.	3420	Q5T4S7	UBR4_HUMAN	D	3420;3420;3413;3396	ENSP00000364403:N3420D;ENSP00000364416:N3420D;ENSP00000364365:N3413D;ENSP00000364374:N3396D	ENSP00000364365:N3413D	N	-	1	0	UBR4	19319313	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.525000	0.81892	2.302000	0.77476	0.533000	0.62120	AAT	.	.		0.552	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
UBR4	23352	hgsc.bcm.edu	37	1	19518865	19518865	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:19518865T>C	ENST00000375254.3	-	11	1238	c.1211A>G	c.(1210-1212)cAg>cGg	p.Q404R	UBR4_ENST00000375267.2_Missense_Mutation_p.Q404R|UBR4_ENST00000375226.2_Missense_Mutation_p.Q404R|UBR4_ENST00000375217.2_Missense_Mutation_p.Q404R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	404					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TTGGAAATTCTGATAGTGCTG	0.413																																					p.Q404R		Atlas-SNP	.											.	UBR4	415	.	0			c.A1211G						.						75.0	77.0	76.0					1																	19518865		2203	4300	6503	SO:0001583	missense	23352	exon11			AAATTCTGATAGT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1211A>G	chr1.hg19:g.19518865T>C	ENSP00000364403:p.Gln404Arg	114.0	0.0		64.0	4.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	hg19	CCDS189.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337165	0.81911	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.34072	1.41;1.41;1.39;1.38	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.49830	0.1580	L	0.50333	1.59	0.80722	D	1	P	0.45126	0.851	P	0.55391	0.775	T	0.50890	-0.8774	10	0.87932	D	0	.	14.6068	0.68486	0.0:0.0:0.0:1.0	.	404	Q5T4S7	UBR4_HUMAN	R	404	ENSP00000364403:Q404R;ENSP00000364416:Q404R;ENSP00000364365:Q404R;ENSP00000364374:Q404R	ENSP00000364365:Q404R	Q	-	2	0	UBR4	19391452	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.649000	0.83500	2.125000	0.65367	0.482000	0.46254	CAG	.	.		0.413	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
RAP1GAP	5909	hgsc.bcm.edu	37	1	21936087	21936087	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:21936087T>C	ENST00000374765.4	-	15	1252	c.1052A>G	c.(1051-1053)gAc>gGc	p.D351G	RAP1GAP_ENST00000374761.2_Missense_Mutation_p.D382G|RAP1GAP_ENST00000290101.4_Missense_Mutation_p.D415G|RAP1GAP_ENST00000374763.2_Missense_Mutation_p.D351G|RAP1GAP_ENST00000542643.2_Missense_Mutation_p.D351G	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	351	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		CACAGCGGGGTCCGGGAGGGG	0.622																																					p.D415G		Atlas-SNP	.											.	RAP1GAP	119	.	0			c.A1244G						.						66.0	72.0	70.0					1																	21936087		2203	4300	6503	SO:0001583	missense	5909	exon15			GCGGGGTCCGGGA	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.1052A>G	chr1.hg19:g.21936087T>C	ENSP00000363897:p.Asp351Gly	145.0	0.0		88.0	5.0	NM_001145658	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	ENST00000374765.4	hg19	CCDS218.1	.	.	.	.	.	.	.	.	.	.	T	12.18	1.861278	0.32884	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758	D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56	5.71	4.57	0.56435	Rap/ran-GAP (2);	0.201409	0.46758	D	0.000261	D	0.91050	0.7184	L	0.41236	1.265	0.38914	D	0.957595	B;B;B;B	0.26002	0.002;0.139;0.02;0.139	B;B;B;B	0.29598	0.006;0.104;0.049;0.104	D	0.88131	0.2838	10	0.49607	T	0.09	-34.6276	11.2196	0.48846	0.0:0.0:0.1539:0.8461	.	351;351;381;351	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	G	415;382;351;351;381;351	ENSP00000290101:D415G;ENSP00000363893:D382G;ENSP00000441661:D351G;ENSP00000363897:D351G	ENSP00000290101:D415G	D	-	2	0	RAP1GAP	21808674	1.000000	0.71417	0.979000	0.43373	0.129000	0.20672	5.853000	0.69496	0.982000	0.38575	-0.316000	0.08728	GAC	.	.		0.622	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885	
HSPG2	3339	hgsc.bcm.edu	37	1	22191789	22191789	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:22191789T>C	ENST00000374695.3	-	35	4463	c.4384A>G	c.(4384-4386)Atg>Gtg	p.M1462V		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1462	Laminin IV type A 3. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TCTCGGAACATGATCTCGTAG	0.602																																					p.M1462V		Atlas-SNP	.											.	HSPG2	311	.	0			c.A4384G						.						119.0	110.0	113.0					1																	22191789		2203	4300	6503	SO:0001583	missense	3339	exon35			GGAACATGATCTC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.4384A>G	chr1.hg19:g.22191789T>C	ENSP00000363827:p.Met1462Val	165.0	0.0		95.0	4.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.987245	0.00443	.	.	ENSG00000142798	ENST00000374695	T	0.34859	1.34	5.57	-9.5	0.00584	Laminin B type IV (2);Laminin B, subgroup (1);	1.020000	0.07886	N	0.970325	T	0.09247	0.0228	N	0.01219	-0.95	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41106	-0.9527	10	0.02654	T	1	.	12.5266	0.56089	0.0:0.2321:0.0824:0.6855	.	1462	P98160	PGBM_HUMAN	V	1462	ENSP00000363827:M1462V	ENSP00000363827:M1462V	M	-	1	0	HSPG2	22064376	0.000000	0.05858	0.053000	0.19242	0.005000	0.04900	-2.593000	0.00897	-1.971000	0.01002	-1.840000	0.00586	ATG	.	.		0.602	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
KDM1A	23028	hgsc.bcm.edu	37	1	23409728	23409728	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:23409728A>G	ENST00000356634.3	+	19	2579	c.2430A>G	c.(2428-2430)acA>acG	p.T810T	KDM1A_ENST00000400181.4_Silent_p.T834T|RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000542151.1_Silent_p.T834T	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	810	Demethylase activity.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						ACCCAGCCACAGTGCATGGTG	0.532																																					p.T834T		Atlas-SNP	.											.	KDM1A	49	.	0			c.A2502G						.						94.0	82.0	86.0					1																	23409728		2203	4300	6503	SO:0001819	synonymous_variant	23028	exon21			AGCCACAGTGCAT	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.2430A>G	chr1.hg19:g.23409728A>G		199.0	0.0		84.0	5.0	NM_001009999	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Silent	SNP	ENST00000356634.3	hg19	CCDS30627.1																																																																																			.	.		0.532	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013	
CNKSR1	10256	hgsc.bcm.edu	37	1	26514760	26514760	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:26514760A>G	ENST00000374253.5	+	17	1550	c.1511A>G	c.(1510-1512)tAc>tGc	p.Y504C	CATSPER4_ENST00000456354.2_5'Flank|CNKSR1_ENST00000531191.1_Missense_Mutation_p.Y239C|CNKSR1_ENST00000361530.6_Missense_Mutation_p.Y497C	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	504					Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		ATCTCCAAGTACCAGTCTCCA	0.607																																					p.Y497C	NSCLC(180;1396 2109 28270 30756 34275)	Atlas-SNP	.											.	CNKSR1	66	.	0			c.A1490G						.						85.0	83.0	84.0					1																	26514760		2203	4300	6503	SO:0001583	missense	10256	exon17			CCAAGTACCAGTC	AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1511A>G	chr1.hg19:g.26514760A>G	ENSP00000363371:p.Tyr504Cys	118.0	0.0		78.0	42.0	NM_006314	B1AMW9|O95381	Missense_Mutation	SNP	ENST00000374253.5	hg19		.	.	.	.	.	.	.	.	.	.	A	21.0	4.078803	0.76528	.	.	ENSG00000142675	ENST00000361530;ENST00000374253;ENST00000531191	T;T;T	0.16597	2.36;2.37;2.33	5.82	4.7	0.59300	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.119371	0.56097	D	0.000021	T	0.36276	0.0961	M	0.63428	1.95	0.39724	D	0.971518	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	T	0.16394	-1.0404	10	0.72032	D	0.01	-21.9064	10.4071	0.44266	0.9263:0.0:0.0737:0.0	.	504;497	Q969H4;Q53GM7	CNKR1_HUMAN;.	C	497;504;239	ENSP00000354609:Y497C;ENSP00000363371:Y504C;ENSP00000431817:Y239C	ENSP00000354609:Y497C	Y	+	2	0	CNKSR1	26387347	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.837000	0.55820	1.041000	0.40125	0.533000	0.62120	TAC	.	.		0.607	CNKSR1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000089943.2	NM_006314	
ARID1A	8289	hgsc.bcm.edu	37	1	27056354	27056354	+	Splice_Site	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:27056354G>A	ENST00000324856.7	+	2	1721	c.1350G>A	c.(1348-1350)caG>caA	p.Q450Q	ARID1A_ENST00000374152.2_Splice_Site_p.Q67Q|ARID1A_ENST00000457599.2_Splice_Site_p.Q450Q	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	450					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ATACACAGCAGGTAGATGGTG	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q450Q		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.G1350A						.						32.0	35.0	34.0					1																	27056354		2203	4300	6503	SO:0001630	splice_region_variant	8289	exon2			ACAGCAGGTAGAT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1350+1G>A	chr1.hg19:g.27056354G>A		315.0	1.0		223.0	129.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	Silent
SLC9A1	6548	hgsc.bcm.edu	37	1	27429041	27429041	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:27429041C>T	ENST00000263980.3	-	8	2230	c.1655G>A	c.(1654-1656)cGg>cAg	p.R552Q	SLC9A1_ENST00000490329.1_5'Flank|SLC9A1_ENST00000545949.1_Missense_Mutation_p.R213Q	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	552					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CTTATTAAACCGGTTGAGCCT	0.592											OREG0013277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R552Q		Atlas-SNP	.											SLC9A1,NS,carcinoma,0,1	SLC9A1	68	.	0			c.G1655A						.						69.0	76.0	74.0					1																	27429041		2203	4300	6503	SO:0001583	missense	6548	exon8			TTAAACCGGTTGA	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.1655G>A	chr1.hg19:g.27429041C>T	ENSP00000263980:p.Arg552Gln	42.0	0.0	794	18.0	2.0	NM_003047	B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	ENST00000263980.3	hg19	CCDS295.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854202	0.91355	.	.	ENSG00000090020	ENST00000263980;ENST00000374089;ENST00000545949	T;T	0.45668	0.89;1.5	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.32823	0.0842	L	0.41492	1.28	0.80722	D	1	P	0.38223	0.623	B	0.24848	0.056	T	0.21280	-1.0250	10	0.44086	T	0.13	.	18.1634	0.89717	0.0:1.0:0.0:0.0	.	552	P19634	SL9A1_HUMAN	Q	552;56;213	ENSP00000263980:R552Q;ENSP00000445520:R213Q	ENSP00000263980:R552Q	R	-	2	0	SLC9A1	27301628	0.987000	0.35691	1.000000	0.80357	0.961000	0.63080	2.509000	0.45459	2.623000	0.88846	0.561000	0.74099	CGG	.	.		0.592	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
PTPRU	10076	hgsc.bcm.edu	37	1	29641992	29641992	+	Silent	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:29641992C>T	ENST00000345512.3	+	24	3495	c.3366C>T	c.(3364-3366)tcC>tcT	p.S1122S	PTPRU_ENST00000428026.2_Silent_p.S1109S|PTPRU_ENST00000356870.3_Silent_p.S1118S|PTPRU_ENST00000460170.2_Silent_p.S1118S|PTPRU_ENST00000373779.3_Silent_p.S1112S|PTPRU_ENST00000323874.8_Silent_p.S1118S	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1122	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CTCTCTGCTCCCGGCGTGTCA	0.562																																					p.S1122S		Atlas-SNP	.											.	PTPRU	374	.	0			c.C3366T						.						132.0	122.0	126.0					1																	29641992		2203	4300	6503	SO:0001819	synonymous_variant	10076	exon24			CTGCTCCCGGCGT	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3366C>T	chr1.hg19:g.29641992C>T		161.0	0.0		82.0	48.0	NM_005704	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	ENST00000345512.3	hg19	CCDS334.1																																																																																			.	.		0.562	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
NKAIN1	79570	hgsc.bcm.edu	37	1	31656794	31656794	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:31656794C>A	ENST00000373736.2	-	4	347	c.341G>T	c.(340-342)gGc>gTc	p.G114V	NKAIN1_ENST00000528449.1_5'Flank|NKAIN1_ENST00000263693.1_Missense_Mutation_p.G70V|NKAIN1_ENST00000398657.2_Missense_Mutation_p.G43V	NM_024522.2	NP_078798.2	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|ovary(1)|prostate(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)		CACCAGGCAGCCTGGCCCATT	0.592											OREG0004725	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G114V		Atlas-SNP	.											.	NKAIN1	21	.	0			c.G341T						.						101.0	75.0	83.0					1																	31656794		2203	4300	6503	SO:0001583	missense	79570	exon4			AGGCAGCCTGGCC	AK022712	CCDS339.1, CCDS339.2	1p35.2	2010-06-25	2007-10-04	2007-10-04	ENSG00000084628	ENSG00000084628		"""Na+/K+ transporting ATPase interacting"""	25743	protein-coding gene	gene with protein product		612871	"""family with sequence similarity 77, member C"""	FAM77C		17606467	Standard	NM_024522		Approved	FLJ12650	uc010ogd.2	Q4KMZ8	OTTHUMG00000003788	ENST00000373736.2:c.341G>T	chr1.hg19:g.31656794C>A	ENSP00000362841:p.Gly114Val	112.0	0.0	826	88.0	4.0	NM_024522	A2VDJ3|B7Z5F5|B7Z5W9|Q9H9M7	Missense_Mutation	SNP	ENST00000373736.2	hg19	CCDS339.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.16|19.16	3.773464|3.773464	0.69992|0.69992	.|.	.|.	ENSG00000084628|ENSG00000084628	ENST00000526106|ENST00000373736;ENST00000263693;ENST00000398657	.|T;T;T	.|0.38722	.|1.12;1.12;1.12	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72211|0.72211	0.3432|0.3432	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	T|T	0.77525|0.77525	-0.2555|-0.2555	5|10	.|0.87932	.|D	.|0	-10.5819|-10.5819	19.5743|19.5743	0.95436|0.95436	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|114;43	.|Q4KMZ8;B7Z5F5	.|NKAI1_HUMAN;.	S|V	58|114;70;43	.|ENSP00000362841:G114V;ENSP00000263693:G70V;ENSP00000381650:G43V	.|ENSP00000263693:G70V	A|G	-|-	1|2	0|0	NKAIN1|NKAIN1	31429381|31429381	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.281000|0.281000	0.26958|0.26958	7.487000|7.487000	0.81328|0.81328	2.611000|2.611000	0.88343|0.88343	0.655000|0.655000	0.94253|0.94253	GCT|GGC	.	.		0.592	NKAIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010655.2	NM_024522	
COL16A1	1307	hgsc.bcm.edu	37	1	32149600	32149600	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:32149600T>C	ENST00000373672.3	-	33	2804	c.2288A>G	c.(2287-2289)cAa>cGa	p.Q763R	COL16A1_ENST00000373668.3_Missense_Mutation_p.Q763R|COL16A1_ENST00000271069.6_Missense_Mutation_p.Q762R	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	763	Triple-helical region 5 (COL5) with 3 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		TAGACCGGGTTGGCCCTAAAA	0.647																																					p.Q763R	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.A2288G						.						46.0	51.0	50.0					1																	32149600		1966	4130	6096	SO:0001583	missense	1307	exon33			CCGGGTTGGCCCT	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2288A>G	chr1.hg19:g.32149600T>C	ENSP00000362776:p.Gln763Arg	164.0	0.0		105.0	5.0	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	hg19	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	T	16.21	3.059818	0.55325	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	D;D;D	0.93547	-3.24;-3.24;-3.24	4.92	4.92	0.64577	.	0.222271	0.37906	N	0.001885	D	0.87912	0.6297	L	0.28014	0.82	0.33396	D	0.576764	B;B;B	0.23650	0.089;0.043;0.073	B;B;B	0.29077	0.098;0.01;0.022	D	0.86160	0.1593	10	0.17369	T	0.5	.	12.7489	0.57298	0.0:0.0:0.0:1.0	.	763;763;763	A6NCT7;Q07092;Q07092-2	.;COGA1_HUMAN;.	R	763;762;763	ENSP00000362776:Q763R;ENSP00000271069:Q762R;ENSP00000362772:Q763R	ENSP00000271069:Q762R	Q	-	2	0	COL16A1	31922187	0.996000	0.38824	1.000000	0.80357	0.958000	0.62258	1.164000	0.31810	2.152000	0.67230	0.402000	0.26972	CAA	.	.		0.647	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
SPOCD1	90853	hgsc.bcm.edu	37	1	32280899	32280899	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:32280899T>C	ENST00000360482.2	-	2	165	c.36A>G	c.(34-36)acA>acG	p.T12T	SPOCD1_ENST00000373648.2_Silent_p.T12T|SPOCD1_ENST00000533231.1_Silent_p.T12T|SPOCD1_ENST00000257100.3_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	12					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CAGGGTCTCCTGTGCTGGGGC	0.592																																					p.T12T		Atlas-SNP	.											.	SPOCD1	109	.	0			c.A36G						.						38.0	41.0	40.0					1																	32280899		2203	4300	6503	SO:0001819	synonymous_variant	90853	exon2			GTCTCCTGTGCTG	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.36A>G	chr1.hg19:g.32280899T>C		102.0	0.0		59.0	4.0	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Silent	SNP	ENST00000360482.2	hg19	CCDS347.1																																																																																			.	.		0.592	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
KPNA6	23633	hgsc.bcm.edu	37	1	32631794	32631794	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:32631794T>C	ENST00000373625.3	+	11	1172	c.1079T>C	c.(1078-1080)aTt>aCt	p.I360T	KPNA6_ENST00000545542.1_Missense_Mutation_p.I365T|KPNA6_ENST00000537234.1_Missense_Mutation_p.I357T	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	360	NLS binding site (minor). {ECO:0000250}.				maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				TGCTGGACTATTTCAAATATT	0.473																																					p.I360T		Atlas-SNP	.											.	KPNA6	34	.	0			c.T1079C						.						95.0	89.0	91.0					1																	32631794		2203	4300	6503	SO:0001583	missense	23633	exon11			GGACTATTTCAAA	AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.1079T>C	chr1.hg19:g.32631794T>C	ENSP00000362728:p.Ile360Thr	142.0	0.0		91.0	4.0	NM_012316	B2RDC7|D3DPP5|Q5VVU3	Missense_Mutation	SNP	ENST00000373625.3	hg19	CCDS352.1	.	.	.	.	.	.	.	.	.	.	T	28.1	4.893297	0.91889	.	.	ENSG00000025800	ENST00000373625;ENST00000373617;ENST00000537234;ENST00000545542;ENST00000446515	T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6	5.11	5.11	0.69529	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89588	0.6758	H	0.98199	4.17	0.80722	D	1	D;D;D	0.58970	0.98;0.984;0.96	P;D;D	0.66979	0.897;0.938;0.948	D	0.93410	0.6768	10	0.87932	D	0	-10.365	15.6231	0.76824	0.0:0.0:0.0:1.0	.	365;365;360	F5GYL8;B4DWX3;O60684	.;.;IMA7_HUMAN	T	360;290;357;365;267	ENSP00000362728:I360T;ENSP00000444930:I357T;ENSP00000440609:I365T;ENSP00000415677:I267T	ENSP00000362719:I290T	I	+	2	0	KPNA6	32404381	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.993000	0.88291	2.234000	0.73211	0.528000	0.53228	ATT	.	.		0.473	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000012527.4	NM_012316	
IQCC	55721	hgsc.bcm.edu	37	1	32673299	32673299	+	Silent	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:32673299G>A	ENST00000291358.6	+	5	1038	c.1017G>A	c.(1015-1017)agG>agA	p.R339R	RP4-622L5.7_ENST00000373604.4_RNA|RP4-622L5.7_ENST00000421616.1_RNA|DCDC2B_ENST00000409358.1_5'Flank|IQCC_ENST00000537469.1_Silent_p.R419R	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	339										endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGAAGTCCAGGACACAGCTGT	0.507																																					p.R419R		Atlas-SNP	.											.	IQCC	46	.	0			c.G1257A						.						66.0	74.0	71.0					1																	32673299		2203	4300	6503	SO:0001819	synonymous_variant	55721	exon5			GTCCAGGACACAG	AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.1017G>A	chr1.hg19:g.32673299G>A		139.0	0.0		72.0	4.0	NM_001160042	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Silent	SNP	ENST00000291358.6	hg19	CCDS355.1																																																																																			.	.		0.507	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134	
ZBTB8B	728116	hgsc.bcm.edu	37	1	32950745	32950745	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:32950745G>T	ENST00000609129.1	+	4	1292	c.1214G>T	c.(1213-1215)aGa>aTa	p.R405I	RP1-27O5.3_ENST00000480336.1_Missense_Mutation_p.R405I	NM_001145720.1	NP_001139192.1	Q8NAP8	ZBT8B_HUMAN	zinc finger and BTB domain containing 8B	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)	1						GGCTGCAGGAGAACATTCACG	0.522																																					p.R405I		Atlas-SNP	.											.	ZBTB8B	28	.	0			c.G1214T						.						55.0	45.0	48.0					1																	32950745		692	1591	2283	SO:0001583	missense	728116	exon4			GCAGGAGAACATT	AL442095	CCDS44104.1	1p35.1	2013-01-08			ENSG00000215897	ENSG00000273274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	37057	protein-coding gene	gene with protein product							Standard	NM_001145720		Approved	RP1-27O5.1, DKFZp547H154, ZNF916B	uc001bvl.4	Q8NAP8	OTTHUMG00000167087	ENST00000609129.1:c.1214G>T	chr1.hg19:g.32950745G>T	ENSP00000476499:p.Arg405Ile	165.0	0.0		113.0	5.0	NM_001145720	Q15DG5|Q5VXR5|Q69YT7	Missense_Mutation	SNP	ENST00000609129.1	hg19	CCDS44104.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739369	0.89573	.	.	ENSG00000215897	ENST00000415091	T	0.16073	2.37	5.08	5.08	0.68730	.	0.047414	0.85682	D	0.000000	T	0.11324	0.0276	N	0.08118	0	0.53688	D	0.999979	P	0.45902	0.868	B	0.39805	0.31	T	0.12553	-1.0543	10	0.66056	D	0.02	.	18.3603	0.90372	0.0:0.0:1.0:0.0	.	405	Q8NAP8	ZBT8B_HUMAN	I	405	ENSP00000400836:R405I	ENSP00000435749:R405I	R	+	2	0	ZBTB8B	32723332	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.258000	0.78371	2.756000	0.94617	0.655000	0.94253	AGA	.	.		0.522	ZBTB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392986.2	NM_001145720	
AK2	204	hgsc.bcm.edu	37	1	33478978	33478978	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:33478978C>T	ENST00000373449.2	-	6	565	c.524G>A	c.(523-525)cGa>cAa	p.R175Q	AK2_ENST00000548033.1_Missense_Mutation_p.R133Q|AK2_ENST00000480134.1_3'UTR|AK2_ENST00000467905.1_Missense_Mutation_p.R175Q|AK2_ENST00000491241.1_5'Flank|RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000354858.6_Missense_Mutation_p.R175Q	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				ATCATCTGATCGACGGATCAA	0.488																																					p.R175Q		Atlas-SNP	.											.	AK2	27	.	0			c.G524A						.						69.0	65.0	66.0					1																	33478978		2203	4300	6503	SO:0001583	missense	204	exon6			TCTGATCGACGGA	U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.524G>A	chr1.hg19:g.33478978C>T	ENSP00000362548:p.Arg175Gln	161.0	0.0		109.0	44.0	NM_013411		Missense_Mutation	SNP	ENST00000373449.2	hg19	CCDS373.1	.	.	.	.	.	.	.	.	.	.	C	33	5.260021	0.95368	.	.	ENSG00000004455	ENST00000373449;ENST00000548033;ENST00000467905;ENST00000354858;ENST00000398192	D;D;D;D	0.96716	-4.1;-4.1;-4.1;-4.1	5.17	4.26	0.50523	Adenylate kinase, active site lid domain (1);	0.000000	0.85682	D	0.000000	D	0.98732	0.9574	H	0.96889	3.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.998	D	0.99655	1.0992	10	0.87932	D	0	-7.9968	14.7526	0.69536	0.0:0.929:0.0:0.071	.	167;133;175;175	P54819-5;F8VY04;P54819;P54819-2	.;.;KAD2_HUMAN;.	Q	175;133;175;175;175	ENSP00000362548:R175Q;ENSP00000449003:R133Q;ENSP00000447082:R175Q;ENSP00000346921:R175Q	ENSP00000346921:R175Q	R	-	2	0	AK2	33251565	1.000000	0.71417	0.974000	0.42286	0.976000	0.68499	7.786000	0.85741	1.504000	0.48704	0.563000	0.77884	CGA	.	.		0.488	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011884.1	NM_001625	
CSMD2	114784	hgsc.bcm.edu	37	1	34035040	34035040	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:34035040C>T	ENST00000373381.4	-	52	8241	c.8065G>A	c.(8065-8067)Gtg>Atg	p.V2689M		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2691	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTGGAGCCCACCAGTGTGTAT	0.597																																					p.V2691M		Atlas-SNP	.											.	CSMD2	946	.	0			c.G8071A						.						92.0	82.0	85.0					1																	34035040		2203	4300	6503	SO:0001583	missense	114784	exon53			AGCCCACCAGTGT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8065G>A	chr1.hg19:g.34035040C>T	ENSP00000362479:p.Val2689Met	98.0	0.0		77.0	4.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	hg19		.	.	.	.	.	.	.	.	.	.	C	18.31	3.595133	0.66219	.	.	ENSG00000121904	ENST00000373381	T	0.65364	-0.15	5.47	5.47	0.80525	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.78916	0.4359	M	0.71871	2.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.984	T	0.78314	-0.2252	10	0.45353	T	0.12	.	18.3184	0.90229	0.0:1.0:0.0:0.0	.	2691;2689	Q7Z408;E7EUA6	CSMD2_HUMAN;.	M	2689	ENSP00000362479:V2689M	ENSP00000241312:V2691M	V	-	1	0	CSMD2	33807627	1.000000	0.71417	0.998000	0.56505	0.024000	0.10985	7.818000	0.86416	2.566000	0.86566	0.655000	0.94253	GTG	.	.		0.597	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
STK40	83931	hgsc.bcm.edu	37	1	36814304	36814304	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:36814304T>C	ENST00000373129.3	-	8	1142	c.736A>G	c.(736-738)Agc>Ggc	p.S246G	STK40_ENST00000373132.3_Missense_Mutation_p.S246G|STK40_ENST00000373130.3_Missense_Mutation_p.S251G|STK40_ENST00000359297.2_Missense_Mutation_p.S246G	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	246	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				CACGTACCGCTGAGCACGTCG	0.587																																					p.S246G		Atlas-SNP	.											.	STK40	53	.	0			c.A736G						.						97.0	74.0	81.0					1																	36814304		2203	4300	6503	SO:0001583	missense	83931	exon8			TACCGCTGAGCAC	BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.736A>G	chr1.hg19:g.36814304T>C	ENSP00000362221:p.Ser246Gly	94.0	0.0		92.0	4.0	NM_032017	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Missense_Mutation	SNP	ENST00000373129.3	hg19	CCDS407.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179122	0.57800	.	.	ENSG00000196182	ENST00000373129;ENST00000359297;ENST00000373130;ENST00000373132	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.24	5.24	0.73138	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.113452	0.85682	D	0.000000	T	0.51329	0.1668	L	0.28740	0.885	0.58432	D	0.999996	B;B;B	0.16603	0.018;0.005;0.007	B;B;B	0.15052	0.011;0.007;0.012	T	0.48747	-0.9008	10	0.48119	T	0.1	.	14.3227	0.66496	0.0:0.0:0.0:1.0	.	246;251;246	Q8N2I9-3;Q8N2I9-4;Q8N2I9	.;.;STK40_HUMAN	G	246;246;251;246	ENSP00000362221:S246G;ENSP00000352245:S246G;ENSP00000362222:S251G;ENSP00000362224:S246G	ENSP00000352245:S246G	S	-	1	0	STK40	36586891	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	7.662000	0.83803	1.969000	0.57287	0.533000	0.62120	AGC	.	.		0.587	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022592.1	NM_032017	
EPHA10	284656	hgsc.bcm.edu	37	1	38186511	38186511	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:38186511T>C	ENST00000373048.4	-	12	2151	c.2152A>G	c.(2152-2154)Acc>Gcc	p.T718A	EPHA10_ENST00000540011.1_3'UTR|EPHA10_ENST00000330210.7_Missense_Mutation_p.T213A|EPHA10_ENST00000427468.2_Missense_Mutation_p.T718A|EPHA10_ENST00000446149.2_5'UTR	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	718	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ATCATCAAGGTGCTTCCTGTG	0.582																																					p.T718A		Atlas-SNP	.											.	EPHA10	120	.	0			c.A2152G						.						72.0	80.0	77.0					1																	38186511		2047	4189	6236	SO:0001583	missense	284656	exon12			TCAAGGTGCTTCC	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.2152A>G	chr1.hg19:g.38186511T>C	ENSP00000362139:p.Thr718Ala	94.0	0.0		84.0	5.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	ENST00000373048.4	hg19	CCDS41305.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.947019	0.34377	.	.	ENSG00000183317	ENST00000330210;ENST00000427468;ENST00000373048	D;D;D	0.82255	-1.59;-1.59;-1.59	4.57	0.998	0.19857	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.373991	0.16770	N	0.200224	T	0.72382	0.3453	N	0.13327	0.33	0.80722	D	1	B	0.21381	0.055	B	0.29942	0.109	T	0.64613	-0.6366	10	0.66056	D	0.02	.	14.1443	0.65339	0.0:0.0:0.695:0.305	.	718	Q5JZY3	EPHAA_HUMAN	A	213;718;718	ENSP00000330379:T213A;ENSP00000397746:T718A;ENSP00000362139:T718A	ENSP00000330379:T213A	T	-	1	0	EPHA10	37959098	1.000000	0.71417	0.948000	0.38648	0.651000	0.38670	1.168000	0.31859	-0.003000	0.14444	-0.435000	0.05868	ACC	.	.		0.582	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
MTF1	4520	hgsc.bcm.edu	37	1	38281033	38281033	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:38281033A>G	ENST00000373036.4	-	11	2177	c.2037T>C	c.(2035-2037)tcT>tcC	p.S679S		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	679					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CAGGGGCTGAAGAGAAAGTCT	0.607																																					p.S679S		Atlas-SNP	.											.	MTF1	67	.	0			c.T2037C						.						70.0	75.0	73.0					1																	38281033		2203	4300	6503	SO:0001819	synonymous_variant	4520	exon11			GGCTGAAGAGAAA	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.2037T>C	chr1.hg19:g.38281033A>G		126.0	0.0		97.0	4.0	NM_005955	B2RAK6|Q96CB1	Silent	SNP	ENST00000373036.4	hg19	CCDS30676.1																																																																																			.	.		0.607	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
FHL3	2275	hgsc.bcm.edu	37	1	38463119	38463119	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:38463119T>C	ENST00000373016.3	-	6	969	c.801A>G	c.(799-801)ggA>ggG	p.G267G	FHL3_ENST00000485803.1_5'UTR	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	267	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GCACTTGGTCTCCATCCGGTA	0.627																																					p.G267G		Atlas-SNP	.											.	FHL3	9	.	0			c.A801G						.						71.0	74.0	73.0					1																	38463119		2203	4300	6503	SO:0001819	synonymous_variant	2275	exon6			TTGGTCTCCATCC	BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.801A>G	chr1.hg19:g.38463119T>C		86.0	0.0		76.0	4.0	NM_004468	D3DPT6|Q6I9T0|Q9BVA2	Silent	SNP	ENST00000373016.3	hg19	CCDS30678.1																																																																																			.	.		0.627	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012958.1	NM_004468	
SCMH1	22955	hgsc.bcm.edu	37	1	41493981	41493981	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:41493981C>A	ENST00000326197.7	-	15	2167	c.1868G>T	c.(1867-1869)gGc>gTc	p.G623V	SCMH1_ENST00000472037.1_5'UTR|SCMH1_ENST00000402904.2_Missense_Mutation_p.G623V|SCMH1_ENST00000361705.3_Missense_Mutation_p.G554V|SCMH1_ENST00000456518.2_Missense_Mutation_p.G443V|SCMH1_ENST00000397174.2_Missense_Mutation_p.G581V|SCMH1_ENST00000372596.1_Missense_Mutation_p.G540V|SCMH1_ENST00000372597.1_Missense_Mutation_p.G554V|SCMH1_ENST00000361191.5_Missense_Mutation_p.G540V|SCMH1_ENST00000397171.2_Missense_Mutation_p.G540V|SCMH1_ENST00000337495.5_Missense_Mutation_p.G611V|SCMH1_ENST00000372595.1_Missense_Mutation_p.G562V					sex comb on midleg homolog 1 (Drosophila)											breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(2)|pancreas(2)|upper_aerodigestive_tract(1)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				CAGGGCCTTGCCATCGATCTC	0.587																																					p.G623V		Atlas-SNP	.											.	SCMH1	120	.	0			c.G1868T						.						47.0	45.0	46.0					1																	41493981		2203	4300	6503	SO:0001583	missense	22955	exon16			GCCTTGCCATCGA	AF149045	CCDS461.1, CCDS30688.1, CCDS53301.1, CCDS53302.1, CCDS53303.1, CCDS53304.1	1p34	2013-01-10			ENSG00000010803	ENSG00000010803		"""Sterile alpha motif (SAM) domain containing"""	19003	protein-coding gene	gene with protein product						10524249	Standard	NM_012236		Approved	Scml3	uc001cgs.3	Q96GD3	OTTHUMG00000005720	ENST00000326197.7:c.1868G>T	chr1.hg19:g.41493981C>A	ENSP00000318094:p.Gly623Val	145.0	0.0		94.0	4.0	NM_001031694		Missense_Mutation	SNP	ENST00000326197.7	hg19	CCDS30688.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404886	0.83230	.	.	ENSG00000010803	ENST00000361705;ENST00000456518;ENST00000402904;ENST00000397174;ENST00000397171;ENST00000361191;ENST00000372597;ENST00000372596;ENST00000337495;ENST00000372595;ENST00000326197	D;D;D;D;D;D;D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6;-2.6;-2.6;-2.6;-2.6;-2.6;-2.6	4.97	4.97	0.65823	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.063082	0.64402	D	0.000007	D	0.96987	0.9016	H	0.98818	4.34	0.80722	D	1	P;P;D;D	0.89917	0.904;0.603;1.0;1.0	P;B;D;D	0.97110	0.757;0.352;0.999;1.0	D	0.98561	1.0641	10	0.87932	D	0	.	16.9727	0.86304	0.0:1.0:0.0:0.0	.	443;611;554;623	B4DRQ8;Q96GD3-2;Q96GD3-4;Q96GD3	.;.;.;SCMH1_HUMAN	V	554;443;623;581;540;540;554;540;611;562;623	ENSP00000354996:G554V;ENSP00000403974:G443V;ENSP00000386079:G623V;ENSP00000380359:G581V;ENSP00000380356:G540V;ENSP00000354656:G540V;ENSP00000361678:G554V;ENSP00000361677:G540V;ENSP00000337352:G611V;ENSP00000361676:G562V;ENSP00000318094:G623V	ENSP00000318094:G623V	G	-	2	0	SCMH1	41266568	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.151000	0.77411	2.575000	0.86900	0.563000	0.77884	GGC	.	.		0.587	SCMH1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015656.1		
BTBD19	149478	hgsc.bcm.edu	37	1	45275896	45275896	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:45275896T>C	ENST00000450269.1	+	2	437	c.98T>C	c.(97-99)tTc>tCc	p.F33S	TCTEX1D4_ENST00000372200.1_5'Flank|BTBD19_ENST00000409335.2_Missense_Mutation_p.F33S|BTBD19_ENST00000453418.1_Missense_Mutation_p.F33S	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19	33	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(1)|endometrium(1)	2						GATGTTTGCTTCGTGGTTGGT	0.592																																					p.F33S		Atlas-SNP	.											.	BTBD19	16	.	0			c.T98C						.						54.0	48.0	50.0					1																	45275896		692	1591	2283	SO:0001583	missense	149478	exon2			TTTGCTTCGTGGT			1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.98T>C	chr1.hg19:g.45275896T>C	ENSP00000395461:p.Phe33Ser	65.0	0.0		80.0	4.0	NM_001136537	B4E384|B7ZC36|B7ZC37	Missense_Mutation	SNP	ENST00000450269.1	hg19		.	.	.	.	.	.	.	.	.	.	T	23.4	4.412191	0.83340	.	.	ENSG00000222009	ENST00000450269;ENST00000453418;ENST00000409335	T;T;T	0.73258	-0.73;-0.73;-0.73	5.1	5.1	0.69264	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	D	0.87229	0.6125	M	0.92317	3.295	0.36378	D	0.861704	D	0.76494	0.999	D	0.87578	0.998	D	0.92635	0.6119	9	0.87932	D	0	-10.9258	14.091	0.64990	0.0:0.0:0.0:1.0	.	33	C9JJ37	BTBDJ_HUMAN	S	33	ENSP00000395461:F33S;ENSP00000405193:F33S;ENSP00000386506:F33S	ENSP00000386506:F33S	F	+	2	0	BTBD19	45048483	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.741000	0.68638	1.911000	0.55334	0.459000	0.35465	TTC	.	.		0.592	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001136537	
TTC4	7268	hgsc.bcm.edu	37	1	55194027	55194027	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:55194027A>G	ENST00000371281.3	+	6	690	c.603A>G	c.(601-603)gaA>gaG	p.E201E	TTC4_ENST00000371284.5_3'UTR|MROH7-TTC4_ENST00000414150.2_3'UTR	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	201										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						AGCGAATTGAACAGAGGGATG	0.418																																					p.E201E		Atlas-SNP	.											.	TTC4	21	.	0			c.A603G						.						96.0	97.0	97.0					1																	55194027		2203	4300	6503	SO:0001819	synonymous_variant	7268	exon6			AATTGAACAGAGG		CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.603A>G	chr1.hg19:g.55194027A>G		72.0	0.0		165.0	7.0	NM_004623	Q53Y95|Q5TA96|Q9H3I2	Silent	SNP	ENST00000371281.3	hg19	CCDS596.1																																																																																			.	.		0.418	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027432.1	NM_004623	
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77334294	77334294	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:77334294A>G	ENST00000477717.1	+	2	363	c.128A>G	c.(127-129)cAg>cGg	p.Q43R	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	43	Poly-Gln.				glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						cagcagcagcagcagcaacag	0.711																																					p.Q43R		Atlas-SNP	.											.	ST6GALNAC5	59	.	0			c.A128G						.						13.0	13.0	13.0					1																	77334294		2070	3983	6053	SO:0001583	missense	81849	exon2			AGCAGCAGCAGCA		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.128A>G	chr1.hg19:g.77334294A>G	ENSP00000417583:p.Gln43Arg	62.0	0.0		190.0	8.0	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	hg19	CCDS673.1	.	.	.	.	.	.	.	.	.	.	A	8.625	0.892423	0.17613	.	.	ENSG00000117069	ENST00000477717	T	0.24723	1.84	3.99	1.48	0.22813	.	0.692175	0.11394	U	0.568467	T	0.03651	0.0104	N	0.14661	0.345	0.30364	N	0.783559	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.45948	-0.9226	10	0.16420	T	0.52	.	5.3205	0.15879	0.7257:0.1772:0.0971:0.0	.	43;43	B4DV27;Q9BVH7	.;SIA7E_HUMAN	R	43	ENSP00000417583:Q43R	ENSP00000436263:Q43R	Q	+	2	0	ST6GALNAC5	77106882	0.539000	0.26402	0.983000	0.44433	0.222000	0.24845	0.577000	0.23758	0.070000	0.16634	0.334000	0.21626	CAG	.	.		0.711	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
COL11A1	1301	hgsc.bcm.edu	37	1	103364262	103364262	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:103364262T>A	ENST00000370096.3	-	56	4520	c.4208A>T	c.(4207-4209)aAg>aTg	p.K1403M	COL11A1_ENST00000512756.1_Missense_Mutation_p.K1287M|COL11A1_ENST00000353414.4_Missense_Mutation_p.K1364M|COL11A1_ENST00000358392.2_Missense_Mutation_p.K1415M	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1403	Collagen-like 6.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGGACCAGGCTTTCCTGCAGG	0.458																																					p.K1415M		Atlas-SNP	.											.	COL11A1	972	.	0			c.A4244T						.						45.0	48.0	47.0					1																	103364262		2203	4300	6503	SO:0001583	missense	1301	exon56			CCAGGCTTTCCTG	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4208A>T	chr1.hg19:g.103364262T>A	ENSP00000359114:p.Lys1403Met	202.0	0.0		421.0	63.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.160808	0.78226	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.93012	0.7776	N	0.21448	0.665	0.80722	D	1	D;D;B;D;D	0.89917	1.0;1.0;0.126;1.0;1.0	D;D;P;D;D	0.91635	0.999;0.998;0.766;0.999;0.998	D	0.94853	0.8015	10	0.72032	D	0.01	.	16.6245	0.84952	0.0:0.0:0.0:1.0	.	1287;1364;1415;1403;623	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	M	1403;1415;1364;623;1287	ENSP00000359114:K1403M;ENSP00000351163:K1415M;ENSP00000302551:K1364M;ENSP00000426533:K1287M	ENSP00000302551:K1364M	K	-	2	0	COL11A1	103136850	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.968000	0.87980	2.323000	0.78572	0.528000	0.53228	AAG	.	.		0.458	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
NOTCH2	4853	hgsc.bcm.edu	37	1	120461034	120461034	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:120461034T>C	ENST00000256646.2	-	32	6143	c.5924A>G	c.(5923-5925)gAc>gGc	p.D1975G		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1975					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.D1975G(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTACCATGGTCATCCACTGC	0.527			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.D1975G		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	NOTCH2,colon,carcinoma,0,1	NOTCH2	348	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5924G						.						136.0	109.0	118.0					1																	120461034		2203	4300	6503	SO:0001583	missense	4853	exon32	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	CCATGGTCATCCA	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5924A>G	chr1.hg19:g.120461034T>C	ENSP00000256646:p.Asp1975Gly	100.0	0.0		181.0	9.0	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	hg19	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.852764	0.91355	.	.	ENSG00000134250	ENST00000256646	T	0.64991	-0.13	5.76	5.76	0.90799	Ankyrin repeat-containing domain (4);	0.000000	0.39985	U	0.001214	T	0.63094	0.2482	L	0.31926	0.97	0.80722	D	1	D	0.67145	0.996	D	0.70935	0.971	T	0.68565	-0.5375	10	0.62326	D	0.03	.	15.2578	0.73599	0.0:0.0:0.0:1.0	.	1975	Q04721	NOTC2_HUMAN	G	1975	ENSP00000256646:D1975G	ENSP00000256646:D1975G	D	-	2	0	NOTCH2	120262557	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.698000	0.84413	2.202000	0.70862	0.533000	0.62120	GAC	.	.		0.527	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NOTCH2	4853	hgsc.bcm.edu	37	1	120539927	120539927	+	Silent	SNP	G	G	A	rs587603360		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:120539927G>A	ENST00000256646.2	-	4	663	c.444C>T	c.(442-444)tgC>tgT	p.C148C	NOTCH2_ENST00000602566.1_Silent_p.C109C	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	148	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GATGAGACAGGCAGGCATCCG	0.502			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				G|||	1	0.000199681	0.0008	0.0	5008	,	,		27585	0.0		0.0	False		,,,				2504	0.0				p.C148C		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.C444T						.						124.0	98.0	107.0					1																	120539927		2201	4299	6500	SO:0001819	synonymous_variant	4853	exon4	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGACAGGCAGGCA	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.444C>T	chr1.hg19:g.120539927G>A		317.0	1.0		614.0	406.0	NM_001200001	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	hg19	CCDS908.1																																																																																			.	.		0.502	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
LIX1L	128077	hgsc.bcm.edu	37	1	145497479	145497479	+	Silent	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:145497479G>A	ENST00000369308.3	+	4	758	c.684G>A	c.(682-684)ttG>ttA	p.L228L	RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA	NM_153713.1	NP_714924.1	Q8IVB5	LIX1L_HUMAN	Lix1 homolog (chicken) like	228										large_intestine(4)|lung(6)|ovary(2)|skin(1)	13	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AATCAATGTTGGAGTTCCAGG	0.453																																					p.L228L		Atlas-SNP	.											.	LIX1L	28	.	0			c.G684A						.						81.0	66.0	71.0					1																	145497479		2203	4300	6503	SO:0001819	synonymous_variant	128077	exon4			AATGTTGGAGTTC	AK128733	CCDS72873.1	1q21.1	2014-07-15	2014-07-15		ENSG00000152022	ENSG00000271601			28715	protein-coding gene	gene with protein product			"""Lix1 homolog (mouse) like"", ""Lix1 homolog (chicken)-like"""			12477932	Standard	NM_153713		Approved	MGC46719	uc001enr.3	Q8IVB5	OTTHUMG00000013741	ENST00000369308.3:c.684G>A	chr1.hg19:g.145497479G>A		205.0	0.0		537.0	73.0	NM_153713	Q6AI36	Silent	SNP	ENST00000369308.3	hg19	CCDS915.1																																																																																			.	.		0.453	LIX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038513.1	NM_153713	
ITGA10	8515	hgsc.bcm.edu	37	1	145530929	145530929	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:145530929G>T	ENST00000369304.3	+	7	836	c.661G>T	c.(661-663)Gat>Tat	p.D221Y	ITGA10_ENST00000538811.1_Missense_Mutation_p.D90Y|ITGA10_ENST00000539363.1_Missense_Mutation_p.D78Y	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	221	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTCCCTGGGAGATTTCCGAAC	0.522																																					p.D221Y		Atlas-SNP	.											ITGA10,NS,carcinoma,0,1	ITGA10	131	.	0			c.G661T						.						102.0	98.0	99.0					1																	145530929		2203	4300	6503	SO:0001583	missense	8515	exon7			CTGGGAGATTTCC	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.661G>T	chr1.hg19:g.145530929G>T	ENSP00000358310:p.Asp221Tyr	175.0	0.0		482.0	23.0	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	hg19	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984862	0.74474	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	D;D;D	0.85013	-1.93;-1.93;-1.93	5.4	5.4	0.78164	von Willebrand factor, type A (3);	0.068341	0.56097	D	0.000039	D	0.90655	0.7069	M	0.81802	2.56	0.50171	D	0.999856	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.85130	0.993;0.993;0.986;0.997	D	0.91702	0.5374	10	0.87932	D	0	.	12.4144	0.55486	0.0:0.1691:0.8308:0.0	.	187;90;78;221	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	Y	221;187;78;90	ENSP00000358310:D221Y;ENSP00000439894:D78Y;ENSP00000440011:D90Y	ENSP00000358310:D221Y	D	+	1	0	ITGA10	144242286	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.758000	0.62220	2.539000	0.85634	0.655000	0.94253	GAT	.	.		0.522	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
CTSK	1513	hgsc.bcm.edu	37	1	150778691	150778691	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:150778691T>C	ENST00000271651.3	-	3	240	c.130A>G	c.(130-132)Atc>Gtc	p.I44V	CTSK_ENST00000480670.1_Intron	NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K	44					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CGCCGAGAGATTTCATCCACC	0.368																																					p.I44V		Atlas-SNP	.											.	CTSK	27	.	0			c.A130G						.						51.0	52.0	52.0					1																	150778691		2203	4300	6503	SO:0001583	missense	1513	exon3			GAGAGATTTCATC	BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.130A>G	chr1.hg19:g.150778691T>C	ENSP00000271651:p.Ile44Val	133.0	1.0		341.0	258.0	NM_000396	Q6FHS6	Missense_Mutation	SNP	ENST00000271651.3	hg19	CCDS969.1	.	.	.	.	.	.	.	.	.	.	T	7.890	0.732120	0.15507	.	.	ENSG00000143387	ENST00000271651;ENST00000443913	D;D	0.85339	-1.97;-1.97	5.57	3.21	0.36854	Proteinase inhibitor I29, cathepsin propeptide (2);	0.596147	0.18243	N	0.147179	T	0.38852	0.1056	N	0.02142	-0.665	0.33544	D	0.595303	B	0.02656	0.0	B	0.01281	0.0	T	0.03202	-1.1061	10	0.14656	T	0.56	.	6.2491	0.20835	0.0:0.0804:0.3058:0.6137	.	44	P43235	CATK_HUMAN	V	44;103	ENSP00000271651:I44V;ENSP00000405083:I103V	ENSP00000271651:I44V	I	-	1	0	CTSK	149045315	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	0.138000	0.16016	0.382000	0.24878	0.459000	0.35465	ATC	.	.		0.368	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084732.1	NM_000396	
LCE1F	353137	hgsc.bcm.edu	37	1	152748869	152748869	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:152748869C>A	ENST00000334371.2	+	1	22	c.22C>A	c.(22-24)Cag>Aag	p.Q8K		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	8					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCAGAGCCAGCAGCAGTGCCA	0.617																																					p.Q8K		Atlas-SNP	.											.	LCE1F	42	.	0			c.C22A						.						60.0	60.0	60.0					1																	152748869		2203	4300	6503	SO:0001583	missense	353137	exon1			AGCCAGCAGCAGT		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.22C>A	chr1.hg19:g.152748869C>A	ENSP00000334187:p.Gln8Lys	260.0	0.0		841.0	640.0	NM_178354		Missense_Mutation	SNP	ENST00000334371.2	hg19	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049933	0.36181	.	.	ENSG00000240386	ENST00000334371	T	0.04194	3.68	4.28	4.28	0.50868	.	0.000000	0.33534	N	0.004804	T	0.10078	0.0247	M	0.70595	2.14	0.26403	N	0.976398	P	0.52577	0.954	D	0.65140	0.932	T	0.00867	-1.1534	10	0.87932	D	0	.	12.392	0.55364	0.0:1.0:0.0:0.0	.	8	Q5T754	LCE1F_HUMAN	K	8	ENSP00000334187:Q8K	ENSP00000334187:Q8K	Q	+	1	0	LCE1F	151015493	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.596000	0.54024	2.356000	0.79943	0.563000	0.77884	CAG	.	.		0.617	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156909536	156909536	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:156909536A>G	ENST00000361409.2	-	36	4522	c.3780T>C	c.(3778-3780)ggT>ggC	p.G1260G	ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000315174.8_Silent_p.G676G|ARHGEF11_ENST00000368194.3_Silent_p.G1300G	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1260					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGTCCCCTTCACCCCCAGGGG	0.642																																					p.G1300G		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.T3900C						.						44.0	48.0	47.0					1																	156909536		2203	4300	6503	SO:0001819	synonymous_variant	9826	exon37			CCCTTCACCCCCA	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3780T>C	chr1.hg19:g.156909536A>G		71.0	0.0		164.0	7.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	hg19	CCDS1162.1																																																																																			.	.		0.642	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
KLHDC9	126823	hgsc.bcm.edu	37	1	161068368	161068368	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:161068368T>C	ENST00000368011.4	+	1	185	c.43T>C	c.(43-45)Tgg>Cgg	p.W15R	PFDN2_ENST00000468311.1_5'Flank|KLHDC9_ENST00000392192.2_Missense_Mutation_p.W15R|KLHDC9_ENST00000490724.2_Intron	NM_152366.4	NP_689579.3	Q8NEP7	KLDC9_HUMAN	kelch domain containing 9	15										lung(5)|upper_aerodigestive_tract(1)	6	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			AGGCTCAGGCTGGGCCTGGAG	0.692																																					p.W15R		Atlas-SNP	.											.	KLHDC9	16	.	0			c.T43C						.						12.0	13.0	13.0					1																	161068368		2193	4282	6475	SO:0001583	missense	126823	exon1			TCAGGCTGGGCCT	BC022077	CCDS30919.1, CCDS41425.1	1q23.3	2008-02-05			ENSG00000162755	ENSG00000162755			28489	protein-coding gene	gene with protein product	"""kelch/ankyrin repeat containing cyclin A1 interacting protein"""					15159402	Standard	NM_152366		Approved	KARCA1	uc001fxr.3	Q8NEP7	OTTHUMG00000031479	ENST00000368011.4:c.43T>C	chr1.hg19:g.161068368T>C	ENSP00000356990:p.Trp15Arg	79.0	0.0		345.0	17.0	NM_001007255	Q5SY56|Q6NXT9|Q6PKN4|Q8N5E1|Q8NA16	Missense_Mutation	SNP	ENST00000368011.4	hg19	CCDS30919.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.310336	0.60414	.	.	ENSG00000162755	ENST00000368011;ENST00000392192	T;T	0.55413	1.57;0.52	3.99	3.99	0.46301	.	0.000000	0.49916	D	0.000129	T	0.50548	0.1622	L	0.32530	0.975	0.42632	D	0.993383	D;D	0.76494	0.999;0.998	D;D	0.85130	0.997;0.993	T	0.57871	-0.7736	10	0.87932	D	0	-12.1303	11.1743	0.48590	0.0:0.0:0.0:1.0	.	15;15	Q8NEP7-2;Q8NEP7	.;KLDC9_HUMAN	R	15	ENSP00000356990:W15R;ENSP00000376030:W15R	ENSP00000356990:W15R	W	+	1	0	KLHDC9	159334992	1.000000	0.71417	0.961000	0.40146	0.662000	0.39071	4.381000	0.59587	1.787000	0.52448	0.260000	0.18958	TGG	.	.		0.692	KLHDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077092.1	NM_152366	
SLC9C2	284525	hgsc.bcm.edu	37	1	173526509	173526509	+	Silent	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:173526509G>A	ENST00000367714.3	-	10	1607	c.1185C>T	c.(1183-1185)ctC>ctT	p.L395L	SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Silent_p.L293L|RP3-436N22.3_ENST00000431459.1_RNA	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	395					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.L395L(2)									TTCGTTCAGCGAGATTATAAA	0.348																																					p.L395L		Atlas-SNP	.											SLC9A11,NS,carcinoma,0,1	.	.	.	2	Substitution - coding silent(2)	lung(2)	c.C1185T						.						107.0	118.0	114.0					1																	173526509		2203	4300	6503	SO:0001819	synonymous_variant	284525	exon10			TTCAGCGAGATTA	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.1185C>T	chr1.hg19:g.173526509G>A		366.0	1.0		1002.0	105.0	NM_178527	Q86UF3	Silent	SNP	ENST00000367714.3	hg19	CCDS1308.1																																																																																			.	.		0.348	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
PAPPA2	60676	hgsc.bcm.edu	37	1	176668293	176668293	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:176668293T>C	ENST00000367662.3	+	8	3968	c.2804T>C	c.(2803-2805)gTc>gCc	p.V935A		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	935					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						AGCCCTGAGGTCCACCTGTAC	0.587																																					p.V935A		Atlas-SNP	.											.	PAPPA2	665	.	0			c.T2804C						.						87.0	87.0	87.0					1																	176668293		1958	4130	6088	SO:0001583	missense	60676	exon8			CTGAGGTCCACCT	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2804T>C	chr1.hg19:g.176668293T>C	ENSP00000356634:p.Val935Ala	68.0	0.0		196.0	9.0	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	hg19	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.565586	0.45694	.	.	ENSG00000116183	ENST00000367662	T	0.01505	4.82	5.14	5.14	0.70334	Fibronectin, type III (2);	0.144286	0.51477	D	0.000086	T	0.01489	0.0048	N	0.11064	0.09	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.64232	-0.6456	10	0.30078	T	0.28	-15.6357	14.7864	0.69806	0.0:0.0:0.0:1.0	.	935	Q9BXP8	PAPP2_HUMAN	A	935	ENSP00000356634:V935A	ENSP00000356634:V935A	V	+	2	0	PAPPA2	174934916	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.656000	0.67988	2.141000	0.66446	0.533000	0.62120	GTC	.	.		0.587	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
HMCN1	83872	hgsc.bcm.edu	37	1	186064493	186064493	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:186064493A>G	ENST00000271588.4	+	68	10642	c.10413A>G	c.(10411-10413)agA>agG	p.R3471R	HMCN1_ENST00000367492.2_Silent_p.R3471R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3471	Ig-like C2-type 33.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CCTGGCTTAGAGATGGCCAGC	0.517																																					p.R3471R		Atlas-SNP	.											.	HMCN1	797	.	0			c.A10413G						.						61.0	57.0	59.0					1																	186064493		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon68			GCTTAGAGATGGC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10413A>G	chr1.hg19:g.186064493A>G		78.0	0.0		168.0	7.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.517	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
CFH	3075	hgsc.bcm.edu	37	1	196705955	196705955	+	Splice_Site	SNP	G	G	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:196705955G>T	ENST00000367429.4	+	16	2655	c.2415G>T	c.(2413-2415)atG>atT	p.M805I		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	805	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						attttttaGTGGCACAAATAC	0.234																																					p.M805I		Atlas-SNP	.											.	CFH	251	.	0			c.G2415T						.						23.0	22.0	22.0					1																	196705955		2202	4296	6498	SO:0001630	splice_region_variant	3075	exon16			TTTAGTGGCACAA	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2414-1G>T	chr1.hg19:g.196705955G>T		59.0	0.0		105.0	6.0	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	hg19	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	G	9.135	1.012351	0.19277	.	.	ENSG00000000971	ENST00000367429	T	0.28454	1.61	5.12	-1.88	0.07713	Sushi/SCR/CCP (1);	.	.	.	.	T	0.15955	0.0384	N	0.22421	0.69	0.09310	N	1	B	0.26547	0.152	B	0.24701	0.055	T	0.23297	-1.0192	9	0.33940	T	0.23	.	3.6277	0.08119	0.3475:0.0:0.2456:0.4069	.	805	P08603	CFAH_HUMAN	I	805	ENSP00000356399:M805I	ENSP00000356399:M805I	M	+	3	0	CFH	194972578	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.150000	0.16263	-0.418000	0.07450	-1.069000	0.02264	ATG	.	.		0.234	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	Missense_Mutation
TMEM206	55248	hgsc.bcm.edu	37	1	212558758	212558758	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:212558758A>G	ENST00000261455.4	-	4	490	c.353T>C	c.(352-354)tTg>tCg	p.L118S	TMEM206_ENST00000471937.1_5'UTR|TMEM206_ENST00000535273.1_Missense_Mutation_p.L179S	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	118						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		ACCGGGGTACAAGGCAATACC	0.532																																					p.L179S		Atlas-SNP	.											TMEM206,NS,carcinoma,0,1	TMEM206	41	.	0			c.T536C						.						78.0	73.0	75.0					1																	212558758		2203	4300	6503	SO:0001583	missense	55248	exon5			GGGTACAAGGCAA	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.353T>C	chr1.hg19:g.212558758A>G	ENSP00000261455:p.Leu118Ser	132.0	0.0		74.0	3.0	NM_001198862	B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	ENST00000261455.4	hg19	CCDS1504.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.174854	0.78564	.	.	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	5.43	5.43	0.79202	.	0.148190	0.46442	D	0.000294	T	0.65544	0.2701	L	0.32530	0.975	0.44447	D	0.997379	D;P	0.67145	0.996;0.912	D;P	0.64410	0.925;0.678	T	0.69533	-0.5120	9	0.87932	D	0	-15.2815	15.4672	0.75409	1.0:0.0:0.0:0.0	.	179;118	B7Z4D6;Q9H813	.;TM206_HUMAN	S	118;179	.	ENSP00000261455:L118S	L	-	2	0	TMEM206	210625381	1.000000	0.71417	0.995000	0.50966	0.618000	0.37518	8.248000	0.89832	2.047000	0.60756	0.533000	0.62120	TTG	.	.		0.532	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
PROX1	5629	hgsc.bcm.edu	37	1	214171377	214171377	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:214171377C>T	ENST00000366958.4	+	2	2107	c.1499C>T	c.(1498-1500)cCc>cTc	p.P500L	PROX1_ENST00000435016.1_Missense_Mutation_p.P500L|PROX1_ENST00000261454.4_Missense_Mutation_p.P500L|PROX1_ENST00000498508.2_Missense_Mutation_p.P500L	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	500					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TTAGGTGCTCCCTCCGGCTCC	0.562																																					p.P500L		Atlas-SNP	.											.	PROX1	124	.	0			c.C1499T						.						76.0	84.0	81.0					1																	214171377		2203	4300	6503	SO:0001583	missense	5629	exon2			GTGCTCCCTCCGG	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1499C>T	chr1.hg19:g.214171377C>T	ENSP00000355925:p.Pro500Leu	86.0	0.0		61.0	4.0	NM_001270616	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	hg19	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615348	0.46631	.	.	ENSG00000117707	ENST00000541470;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.44083	0.95;0.93;0.95;0.95	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	L	0.41632	1.29	0.80722	D	1	D	0.56746	0.977	P	0.57057	0.812	T	0.22487	-1.0215	10	0.07482	T	0.82	-4.6478	19.8546	0.96752	0.0:1.0:0.0:0.0	.	500	Q92786	PROX1_HUMAN	L	72;500;500;500;500	ENSP00000420283:P500L;ENSP00000355925:P500L;ENSP00000400694:P500L;ENSP00000261454:P500L	ENSP00000261454:P500L	P	+	2	0	PROX1	212238000	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.963000	0.70372	2.697000	0.92050	0.655000	0.94253	CCC	.	.		0.562	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
USH2A	7399	hgsc.bcm.edu	37	1	216373309	216373309	+	Silent	SNP	G	G	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:216373309G>T	ENST00000307340.3	-	17	3857	c.3471C>A	c.(3469-3471)atC>atA	p.I1157I	USH2A_ENST00000366942.3_Silent_p.I1157I|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366943.2_Silent_p.I1157I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1157	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAATAGGAATGATATAACTTA	0.438										HNSCC(13;0.011)																											p.I1157I		Atlas-SNP	.											.	USH2A	1168	.	0			c.C3471A						.						106.0	105.0	106.0					1																	216373309		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon17			AGGAATGATATAA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3471C>A	chr1.hg19:g.216373309G>T		189.0	0.0		116.0	5.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	hg19	CCDS31025.1																																																																																			.	.		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
SPATA17	128153	hgsc.bcm.edu	37	1	217947703	217947703	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:217947703A>G	ENST00000366933.4	+	7	602	c.547A>G	c.(547-549)Aga>Gga	p.R183G		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	183						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TTCACCCTTCAGAAAAGAGCC	0.378																																					p.R183G		Atlas-SNP	.											.	SPATA17	59	.	0			c.A547G						.						83.0	81.0	82.0					1																	217947703		2203	4300	6503	SO:0001583	missense	128153	exon7			CCCTTCAGAAAAG	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.547A>G	chr1.hg19:g.217947703A>G	ENSP00000355900:p.Arg183Gly	94.0	0.0		90.0	4.0	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	hg19	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.190224	0.78789	.	.	ENSG00000162814	ENST00000366933	T	0.46819	0.86	5.45	4.3	0.51218	.	0.048454	0.85682	D	0.000000	T	0.65606	0.2707	M	0.78916	2.43	0.38615	D	0.951005	D	0.69078	0.997	D	0.63033	0.91	T	0.71892	-0.4455	10	0.66056	D	0.02	-11.2255	12.556	0.56254	0.8559:0.1441:0.0:0.0	.	183	Q96L03	SPT17_HUMAN	G	183	ENSP00000355900:R183G	ENSP00000355900:R183G	R	+	1	2	SPATA17	216014326	1.000000	0.71417	0.913000	0.36048	0.983000	0.72400	2.377000	0.44300	0.983000	0.38602	0.460000	0.39030	AGA	.	.		0.378	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
TGFB2	7042	hgsc.bcm.edu	37	1	218578636	218578636	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:218578636A>G	ENST00000366930.4	+	2	939	c.472A>G	c.(472-474)Aaa>Gaa	p.K158E	TGFB2_ENST00000366929.4_Missense_Mutation_p.K186E	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	158					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		GCAGAACCCAAAAGCCAGAGT	0.408																																					p.K186E		Atlas-SNP	.											.	TGFB2	102	.	0			c.A556G						.						189.0	182.0	185.0					1																	218578636		2203	4300	6503	SO:0001583	missense	7042	exon3			AACCCAAAAGCCA	M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.472A>G	chr1.hg19:g.218578636A>G	ENSP00000355897:p.Lys158Glu	135.0	0.0		61.0	4.0	NM_001135599	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Missense_Mutation	SNP	ENST00000366930.4	hg19	CCDS1521.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.209081	0.39003	.	.	ENSG00000092969	ENST00000366930;ENST00000366929	T;T	0.63913	-0.07;-0.07	5.09	5.09	0.68999	Transforming growth factor-beta, N-terminal (1);	0.239182	0.42964	D	0.000631	T	0.60327	0.2260	L	0.28556	0.865	0.44807	D	0.997815	B;B;D	0.59357	0.217;0.042;0.985	B;B;P	0.58013	0.138;0.103;0.831	T	0.56637	-0.7946	10	0.05721	T	0.95	.	14.9051	0.70711	1.0:0.0:0.0:0.0	.	186;158;187	P61812-2;P61812;Q59EG9	.;TGFB2_HUMAN;.	E	158;186	ENSP00000355897:K158E;ENSP00000355896:K186E	ENSP00000355896:K186E	K	+	1	0	TGFB2	216645259	1.000000	0.71417	0.802000	0.32245	0.960000	0.62799	4.886000	0.63149	1.916000	0.55485	0.528000	0.53228	AAA	.	.		0.408	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
ACTA1	58	hgsc.bcm.edu	37	1	229568488	229568488	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:229568488T>C	ENST00000366684.3	-	3	371	c.269A>G	c.(268-270)cAc>cGc	p.H90R	ACTA1_ENST00000366683.2_Missense_Mutation_p.H90R	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	90					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				GTAGAAGGTGTGGTGCCAGAT	0.602																																					p.H90R		Atlas-SNP	.											.	ACTA1	65	.	0			c.A269G						.						93.0	90.0	91.0					1																	229568488		2203	4300	6503	SO:0001583	missense	58	exon3			AAGGTGTGGTGCC	J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.269A>G	chr1.hg19:g.229568488T>C	ENSP00000355645:p.His90Arg	132.0	0.0		100.0	4.0	NM_001100	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	ENST00000366684.3	hg19	CCDS1578.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.870248	0.51588	.	.	ENSG00000143632	ENST00000366684;ENST00000308794;ENST00000366683;ENST00000342787	D;D	0.97404	-4.37;-3.43	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.98899	0.9627	H	0.96633	3.855	0.39113	D	0.961516	D	0.53619	0.961	D	0.71414	0.973	D	0.99915	1.1222	10	0.62326	D	0.03	.	13.7356	0.62815	0.0:0.0:0.0:1.0	.	90	P68133	ACTS_HUMAN	R	90	ENSP00000355645:H90R;ENSP00000355644:H90R	ENSP00000312351:H90R	H	-	2	0	ACTA1	227635111	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.861000	0.87004	1.913000	0.55393	0.460000	0.39030	CAC	.	.		0.602	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092781.1	NM_001100	
ABCB10	23456	hgsc.bcm.edu	37	1	229666086	229666086	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:229666086G>A	ENST00000344517.4	-	8	1547	c.1505C>T	c.(1504-1506)cCa>cTa	p.P502L		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	502	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TGGGCGAGCTGGATAGGCAAA	0.448																																					p.P502L		Atlas-SNP	.											.	ABCB10	71	.	0			c.C1505T						.						134.0	134.0	134.0					1																	229666086		2203	4300	6503	SO:0001583	missense	23456	exon8			CGAGCTGGATAGG	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1505C>T	chr1.hg19:g.229666086G>A	ENSP00000355637:p.Pro502Leu	119.0	0.0		90.0	5.0	NM_012089	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	ENST00000344517.4	hg19	CCDS1580.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761626	0.89932	.	.	ENSG00000135776	ENST00000344517	D	0.91124	-2.79	5.83	5.83	0.93111	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.94918	0.8357	M	0.62209	1.925	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94792	0.7963	10	0.87932	D	0	-27.3017	20.1082	0.97900	0.0:0.0:1.0:0.0	.	502	Q9NRK6	ABCBA_HUMAN	L	502	ENSP00000355637:P502L	ENSP00000355637:P502L	P	-	2	0	ABCB10	227732709	1.000000	0.71417	0.437000	0.26809	0.788000	0.44548	8.643000	0.91040	2.745000	0.94114	0.563000	0.77884	CCA	.	.		0.448	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089	
PGBD5	79605	hgsc.bcm.edu	37	1	230492867	230492867	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:230492867T>C	ENST00000525115.1	-	2	348	c.325A>G	c.(325-327)Agc>Ggc	p.S109G	PGBD5_ENST00000391860.1_Missense_Mutation_p.S63G|PGBD5_ENST00000321327.2_Missense_Mutation_p.S208G			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	109						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		TGGGAGATGCTGGTGGAGATC	0.612																																					p.S178G		Atlas-SNP	.											.	PGBD5	73	.	0			c.A532G						.						126.0	100.0	109.0					1																	230492867		2203	4300	6503	SO:0001583	missense	79605	exon2			AGATGCTGGTGGA	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.325A>G	chr1.hg19:g.230492867T>C	ENSP00000431404:p.Ser109Gly	123.0	0.0		69.0	4.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.74	1.728776	0.30593	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.10005	2.92;2.92;2.92	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	N	0.19112	0.55	0.58432	D	0.999992	P	0.44429	0.835	P	0.46685	0.524	T	0.05007	-1.0912	10	0.02654	T	1	-44.9623	16.1303	0.81428	0.0:0.0:0.0:1.0	.	109	Q8N414	PGBD5_HUMAN	G	63;208;109	ENSP00000375733:S63G;ENSP00000322530:S208G;ENSP00000431404:S109G	ENSP00000322530:S208G	S	-	1	0	PGBD5	228559490	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.268000	0.72552	2.218000	0.71995	0.533000	0.62120	AGC	.	.		0.612	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
C1orf198	84886	hgsc.bcm.edu	37	1	230979276	230979276	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:230979276C>A	ENST00000366663.5	-	3	891	c.751G>T	c.(751-753)Gag>Tag	p.E251*	C1orf198_ENST00000427697.2_Nonsense_Mutation_p.E34*|C1orf198_ENST00000470540.1_Nonsense_Mutation_p.E213*|C1orf198_ENST00000523410.1_Nonsense_Mutation_p.E121*	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	251						cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GGACGCTGCTCCTGACGGAGG	0.647																																					p.E251X		Atlas-SNP	.											C1orf198,NS,carcinoma,0,1	C1orf198	29	.	0			c.G751T						.						55.0	53.0	54.0					1																	230979276		2203	4300	6503	SO:0001587	stop_gained	84886	exon3			GCTGCTCCTGACG	BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.751G>T	chr1.hg19:g.230979276C>A	ENSP00000355623:p.Glu251*	84.0	0.0		48.0	2.0	NM_032800	A8K8R8|B3KTW1|G5EA08	Nonsense_Mutation	SNP	ENST00000366663.5	hg19	CCDS1587.1	.	.	.	.	.	.	.	.	.	.	C	33	5.205788	0.95033	.	.	ENSG00000119280	ENST00000366663;ENST00000470540;ENST00000427697;ENST00000523410	.	.	.	4.46	4.46	0.54185	.	0.133192	0.50627	D	0.000115	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-25.1385	10.7508	0.46209	0.0:0.9118:0.0:0.0882	.	.	.	.	X	251;213;34;121	.	ENSP00000355623:E251X	E	-	1	0	C1orf198	229045899	1.000000	0.71417	0.914000	0.36105	0.819000	0.46315	3.152000	0.50677	2.017000	0.59298	0.462000	0.41574	GAG	.	.		0.647	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2	NM_032800	
C1orf198	84886	hgsc.bcm.edu	37	1	231004122	231004122	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:231004122T>C	ENST00000366663.5	-	1	277	c.137A>G	c.(136-138)gAc>gGc	p.D46G	C1orf198_ENST00000427697.2_Intron|C1orf198_ENST00000470540.1_Missense_Mutation_p.D8G	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	46						cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				CTTCTCCTTGTCCTGCATGAT	0.677																																					p.D46G		Atlas-SNP	.											.	C1orf198	29	.	0			c.A137G						.						24.0	28.0	27.0					1																	231004122		2203	4300	6503	SO:0001583	missense	84886	exon1			TCCTTGTCCTGCA	BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.137A>G	chr1.hg19:g.231004122T>C	ENSP00000355623:p.Asp46Gly	110.0	0.0		108.0	5.0	NM_032800	A8K8R8|B3KTW1|G5EA08	Missense_Mutation	SNP	ENST00000366663.5	hg19	CCDS1587.1	.	.	.	.	.	.	.	.	.	.	t	32	5.154254	0.94645	.	.	ENSG00000119280	ENST00000366663;ENST00000470540;ENST00000522201	T;T	0.38401	1.14;1.24	3.71	3.71	0.42584	.	0.068933	0.56097	U	0.000025	T	0.50718	0.1632	M	0.65975	2.015	0.80722	D	1	D	0.58268	0.982	P	0.57425	0.82	T	0.56282	-0.8005	10	0.72032	D	0.01	.	12.2062	0.54353	0.0:0.0:0.0:1.0	.	46	Q9H425	CA198_HUMAN	G	46;8;3	ENSP00000355623:D46G;ENSP00000428172:D8G	ENSP00000355623:D46G	D	-	2	0	C1orf198	229070745	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.745000	0.62125	1.526000	0.49068	0.375000	0.23000	GAC	.	.		0.677	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092236.2	NM_032800	
LYST	1130	hgsc.bcm.edu	37	1	235922305	235922305	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:235922305T>C	ENST00000389794.3	-	23	7022	c.6848A>G	c.(6847-6849)gAg>gGg	p.E2283G	LYST_ENST00000389793.2_Missense_Mutation_p.E2283G			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2283					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GTAATTTGGCTCATAACCAAG	0.418																																					p.E2283G		Atlas-SNP	.											.	LYST	370	.	0			c.A6848G						.						79.0	72.0	75.0					1																	235922305		2203	4300	6503	SO:0001583	missense	1130	exon23			TTTGGCTCATAAC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6848A>G	chr1.hg19:g.235922305T>C	ENSP00000374444:p.Glu2283Gly	126.0	0.0		85.0	5.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	hg19	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	14.79	2.640388	0.47153	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.65364	-0.15;-0.15	4.93	2.58	0.30949	.	1.094320	0.06799	N	0.788353	T	0.53465	0.1798	L	0.36672	1.1	0.80722	D	1	B	0.16166	0.016	B	0.12837	0.008	T	0.46205	-0.9208	10	0.66056	D	0.02	.	8.822	0.35032	0.0:0.1556:0.0:0.8444	.	2283	Q99698	LYST_HUMAN	G	2283	ENSP00000374444:E2283G;ENSP00000374443:E2283G	ENSP00000374443:E2283G	E	-	2	0	LYST	233988928	0.996000	0.38824	0.631000	0.29282	0.969000	0.65631	3.596000	0.54024	0.839000	0.34971	0.456000	0.33151	GAG	.	.		0.418	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
FMN2	56776	hgsc.bcm.edu	37	1	240370245	240370245	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:240370245T>C	ENST00000319653.9	+	5	2363	c.2133T>C	c.(2131-2133)ctT>ctC	p.L711L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	711					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ATCAAGGGCTTGAGAATGGAG	0.488																																					p.L711L		Atlas-SNP	.											.	FMN2	451	.	0			c.T2133C						.						73.0	72.0	73.0					1																	240370245		2203	4300	6503	SO:0001819	synonymous_variant	56776	exon5			AGGGCTTGAGAAT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2133T>C	chr1.hg19:g.240370245T>C		142.0	0.0		73.0	4.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	hg19	CCDS31069.2																																																																																			.	.		0.488	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
ZBTB18	10472	hgsc.bcm.edu	37	1	244218512	244218512	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:244218512G>A	ENST00000358704.4	+	2	1585	c.1436G>A	c.(1435-1437)tGg>tAg	p.W479*		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	470					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GCCTGCAAGTGGTGCGAGCGC	0.602																																					p.W479X		Atlas-SNP	.											.	.	.	.	0			c.G1436A						.						62.0	62.0	62.0					1																	244218512		2203	4300	6503	SO:0001587	stop_gained	10472	exon2			GCAAGTGGTGCGA	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1436G>A	chr1.hg19:g.244218512G>A	ENSP00000351539:p.Trp479*	105.0	0.0		76.0	4.0	NM_205768	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Nonsense_Mutation	SNP	ENST00000358704.4	hg19	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	G	37	6.512571	0.97629	.	.	ENSG00000179456	ENST00000358704	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0124	0.97464	0.0:0.0:1.0:0.0	.	.	.	.	X	479	.	ENSP00000351539:W479X	W	+	2	0	ZNF238	242285135	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.863000	0.87023	2.749000	0.94314	0.655000	0.94253	TGG	.	.		0.602	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768	
TFB2M	64216	hgsc.bcm.edu	37	1	246727677	246727677	+	Missense_Mutation	SNP	T	T	C	rs567380020	byFrequency	TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:246727677T>C	ENST00000366514.4	-	2	558	c.373A>G	c.(373-375)Agt>Ggt	p.S125G	CNST_ENST00000366513.4_5'Flank|TFB2M_ENST00000544618.1_Missense_Mutation_p.S125G|CNST_ENST00000366512.3_5'Flank	NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	125					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			GTTTTGTCACTTTCGAGCGCA	0.373													T|||	13	0.00259585	0.0	0.0	5008	,	,		19545	0.0		0.0	False		,,,				2504	0.0133				p.S125G		Atlas-SNP	.											.	TFB2M	46	.	0			c.A373G						.						86.0	80.0	82.0					1																	246727677		2203	4300	6503	SO:0001583	missense	64216	exon2			TGTCACTTTCGAG	AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.373A>G	chr1.hg19:g.246727677T>C	ENSP00000355471:p.Ser125Gly	128.0	0.0		90.0	4.0	NM_022366	Q9H626	Missense_Mutation	SNP	ENST00000366514.4	hg19	CCDS1627.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812315	0.70912	.	.	ENSG00000162851	ENST00000366514;ENST00000544618	T;T	0.30182	1.54;1.54	5.73	4.6	0.57074	.	0.107611	0.64402	D	0.000004	T	0.34919	0.0914	L	0.58669	1.825	0.47374	D	0.9994	P	0.48294	0.908	P	0.46917	0.531	T	0.05370	-1.0889	10	0.30854	T	0.27	-16.0732	11.2522	0.49032	0.137:0.0:0.0:0.863	.	125	Q9H5Q4	TFB2M_HUMAN	G	125	ENSP00000355471:S125G;ENSP00000442426:S125G	ENSP00000355471:S125G	S	-	1	0	TFB2M	244794300	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	3.176000	0.50863	0.987000	0.38709	0.533000	0.62120	AGT	.	.		0.373	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096673.1	NM_022366	
OR6F1	343169	hgsc.bcm.edu	37	1	247875175	247875175	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:247875175T>A	ENST00000302084.2	-	1	930	c.883A>T	c.(883-885)Aag>Tag	p.K295*	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CTTACTTCCTTATTACGAAGC	0.428																																					p.K295X		Atlas-SNP	.											.	OR6F1	88	.	0			c.A883T						.						123.0	122.0	122.0					1																	247875175		2203	4300	6503	SO:0001587	stop_gained	343169	exon1			CTTCCTTATTACG	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.883A>T	chr1.hg19:g.247875175T>A	ENSP00000305640:p.Lys295*	166.0	0.0		84.0	4.0	NM_001005286	B2RNV6|Q6IF02|Q96R39	Nonsense_Mutation	SNP	ENST00000302084.2	hg19	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.990218	0.54041	.	.	ENSG00000169214	ENST00000302084	.	.	.	3.49	0.938	0.19500	.	0.000000	0.45606	D	0.000343	.	.	.	.	.	.	0.47905	D	0.999546	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.0213	11.2106	0.48795	0.0:0.0:0.6421:0.3579	.	.	.	.	X	295	.	ENSP00000305640:K295X	K	-	1	0	OR6F1	245941798	0.001000	0.12720	0.055000	0.19348	0.012000	0.07955	0.311000	0.19380	0.055000	0.16094	0.482000	0.46254	AAG	.	.		0.428	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
PXDN	7837	hgsc.bcm.edu	37	2	1652432	1652432	+	Silent	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:1652432C>T	ENST00000252804.4	-	17	3170	c.3120G>A	c.(3118-3120)ggG>ggA	p.G1040G		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	1040					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TGCCCACCTCCCCCAGGATCT	0.622																																					p.G1040G		Atlas-SNP	.											.	PXDN	255	.	0			c.G3120A						.						35.0	41.0	39.0					2																	1652432		2191	4277	6468	SO:0001819	synonymous_variant	7837	exon17			CACCTCCCCCAGG	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.3120G>A	chr2.hg19:g.1652432C>T		96.0	0.0		80.0	4.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	hg19	CCDS46221.1																																																																																			.	.		0.622	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
ASAP2	8853	hgsc.bcm.edu	37	2	9541497	9541497	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:9541497T>C	ENST00000281419.3	+	27	3258	c.2918T>C	c.(2917-2919)gTg>gCg	p.V973A	ASAP2_ENST00000315273.4_Missense_Mutation_p.V928A	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	973	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						GTGATCATCGTGGACGGGGAG	0.622																																					p.V973A		Atlas-SNP	.											.	ASAP2	91	.	0			c.T2918C						.						74.0	80.0	78.0					2																	9541497		2198	4297	6495	SO:0001583	missense	8853	exon27			TCATCGTGGACGG	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2918T>C	chr2.hg19:g.9541497T>C	ENSP00000281419:p.Val973Ala	138.0	0.0		148.0	7.0	NM_003887	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	hg19	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	T	32	5.158533	0.94686	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.59906	0.23;0.23	5.66	5.66	0.87406	Src homology-3 domain (4);	0.057951	0.64402	D	0.000002	D	0.82577	0.5067	H	0.94542	3.55	0.58432	D	0.999998	D;P	0.67145	0.996;0.881	D;P	0.76071	0.987;0.777	D	0.87726	0.2576	10	0.87932	D	0	.	15.8923	0.79309	0.0:0.0:0.0:1.0	.	928;973	O43150-2;O43150	.;ASAP2_HUMAN	A	973;928	ENSP00000281419:V973A;ENSP00000316404:V928A	ENSP00000281419:V973A	V	+	2	0	ASAP2	9458948	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	7.679000	0.84048	2.157000	0.67596	0.533000	0.62120	GTG	.	.		0.622	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
E2F6	1876	hgsc.bcm.edu	37	2	11587894	11587894	+	Missense_Mutation	SNP	T	T	C	rs371114161		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:11587894T>C	ENST00000381525.3	-	6	927	c.658A>G	c.(658-660)Atc>Gtc	p.I220V	E2F6_ENST00000546212.1_Missense_Mutation_p.I145V|E2F6_ENST00000362009.4_Silent_p.L129L|E2F6_ENST00000542100.1_Missense_Mutation_p.I145V|E2F6_ENST00000307236.4_Missense_Mutation_p.I188V	NM_198256.2	NP_937987.2	O75461	E2F6_HUMAN	E2F transcription factor 6	220	Dimerization. {ECO:0000255}.|Transcription repression.			I -> V (in Ref. 10; AAC14694). {ECO:0000305}.	negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			cervix(1)|kidney(1)|lung(3)|prostate(1)|skin(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.114)|OV - Ovarian serous cystadenocarcinoma(76;0.168)		TGCACTGTGATAGAGTCCTAG	0.413																																					p.I220V		Atlas-SNP	.											.	E2F6	17	.	0			c.A658G						.	T	VAL/ILE	1,3783		0,1,1891	59.0	52.0	54.0		658	4.1	0.6	2		54	0,8254		0,0,4127	no	missense	E2F6	NM_198256.2	29	0,1,6018	CC,CT,TT		0.0,0.0264,0.0083	benign	220/282	11587894	1,12037	1892	4127	6019	SO:0001583	missense	1876	exon6			CTGTGATAGAGTC	AF041381	CCDS1680.2, CCDS62858.1, CCDS62859.1	2p25.1	2008-02-05			ENSG00000169016	ENSG00000169016			3120	protein-coding gene	gene with protein product		602944				9501179	Standard	NM_198256		Approved	E2F-6	uc002rbh.4	O75461	OTTHUMG00000090565	ENST00000381525.3:c.658A>G	chr2.hg19:g.11587894T>C	ENSP00000370936:p.Ile220Val	265.0	0.0		141.0	55.0	NM_198256	A8K2Z8|G5E936|O60544|Q53QY9|Q6Q9Z6|Q7Z2H6	Missense_Mutation	SNP	ENST00000381525.3	hg19	CCDS1680.2	.	.	.	.	.	.	.	.	.	.	T	12.81	2.050901	0.36181	2.64E-4	0.0	ENSG00000169016	ENST00000381525;ENST00000307236;ENST00000542100;ENST00000546212	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	5.21	4.05	0.47172	.	0.092120	0.64402	N	0.000001	D	0.82765	0.5108	M	0.62723	1.935	0.80722	D	1	B;B	0.21452	0.004;0.056	B;B	0.17722	0.006;0.019	T	0.75434	-0.3319	10	0.24483	T	0.36	-33.8571	9.0229	0.36211	0.0:0.0941:0.0:0.9059	.	220;188	O75461;G5E936	E2F6_HUMAN;.	V	220;188;145;145	ENSP00000370936:I220V;ENSP00000302159:I188V;ENSP00000446315:I145V;ENSP00000438864:I145V	ENSP00000302159:I188V	I	-	1	0	E2F6	11505345	0.963000	0.33076	0.622000	0.29159	0.904000	0.53231	1.662000	0.37418	0.923000	0.37045	0.533000	0.62120	ATC	.	.		0.413	E2F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207101.2	NM_001952	
NBAS	51594	hgsc.bcm.edu	37	2	15514800	15514800	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:15514800T>C	ENST00000281513.5	-	31	3660	c.3635A>G	c.(3634-3636)gAg>gGg	p.E1212G	NBAS_ENST00000441750.1_Missense_Mutation_p.E1092G	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1212					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ATCTAGCTCCTCTTGAATGGC	0.383																																					p.E1212G		Atlas-SNP	.											.	NBAS	246	.	0			c.A3635G						.						137.0	144.0	142.0					2																	15514800		2203	4300	6503	SO:0001583	missense	51594	exon31			AGCTCCTCTTGAA	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3635A>G	chr2.hg19:g.15514800T>C	ENSP00000281513:p.Glu1212Gly	100.0	0.0		119.0	5.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	hg19	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.2|28.2	4.901282|4.901282	0.92035|0.92035	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000441755|ENST00000442506	T;T;T|.	0.20069|.	2.1;2.1;2.1|.	5.73|5.73	5.73|5.73	0.89815|0.89815	Secretory pathway Sec39 (1);|.	0.045450|.	0.85682|.	D|.	0.000000|.	T|T	0.74230|0.74230	0.3689|0.3689	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.992;0.999|.	D;D|.	0.77004|.	0.921;0.989|.	T|T	0.74203|0.74203	-0.3741|-0.3741	10|5	0.87932|.	D|.	0|.	.|.	16.0173|16.0173	0.80450|0.80450	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1092;1212|.	A2RRP1-2;A2RRP1|.	.;NBAS_HUMAN|.	G|G	1092;1212;259|260	ENSP00000413201:E1092G;ENSP00000281513:E1212G;ENSP00000396501:E259G|.	ENSP00000281513:E1212G|.	E|R	-|-	2|1	0|2	NBAS|NBAS	15432251|15432251	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.629000|6.629000	0.74267|0.74267	2.181000|2.181000	0.69327|0.69327	0.533000|0.533000	0.62120|0.62120	GAG|AGG	.	.		0.383	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
NBAS	51594	hgsc.bcm.edu	37	2	15534402	15534402	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:15534402G>T	ENST00000281513.5	-	28	3231	c.3206C>A	c.(3205-3207)tCa>tAa	p.S1069*	NBAS_ENST00000441750.1_Nonsense_Mutation_p.S949*	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1069					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TGCCTCTTCTGAGCTAGATTG	0.338																																					p.S1069X		Atlas-SNP	.											.	NBAS	246	.	0			c.C3206A						.						57.0	55.0	56.0					2																	15534402		2203	4298	6501	SO:0001587	stop_gained	51594	exon28			TCTTCTGAGCTAG	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3206C>A	chr2.hg19:g.15534402G>T	ENSP00000281513:p.Ser1069*	143.0	0.0		130.0	6.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Nonsense_Mutation	SNP	ENST00000281513.5	hg19	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.211634|6.211634	0.97380|0.97380	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000442506|ENST00000441750;ENST00000281513;ENST00000441755	.|.	.|.	.|.	5.48|5.48	3.69|3.69	0.42338|0.42338	.|.	.|0.618852	.|0.17033	.|N	.|0.189625	T|.	0.66046|.	0.2750|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.75280|.	-0.3373|.	3|.	.|0.87932	.|D	.|0	.|.	11.3888|11.3888	0.49802|0.49802	0.1293:0.0:0.8707:0.0|0.1293:0.0:0.8707:0.0	.|.	.|.	.|.	.|.	K|X	117|949;1069;116	.|.	.|ENSP00000281513:S1069X	Q|S	-|-	1|2	0|0	NBAS|NBAS	15451853|15451853	0.031000|0.031000	0.19500|0.19500	0.024000|0.024000	0.17045|0.17045	0.598000|0.598000	0.36846|0.36846	2.190000|2.190000	0.42630|0.42630	0.688000|0.688000	0.31529|0.31529	0.655000|0.655000	0.94253|0.94253	CAG|TCA	.	.		0.338	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
OTOF	9381	hgsc.bcm.edu	37	2	26693459	26693459	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:26693459A>G	ENST00000272371.2	-	32	4150		c.e32+1		OTOF_ENST00000338581.6_Splice_Site|OTOF_ENST00000403946.3_Splice_Site|OTOF_ENST00000402415.3_Splice_Site|OTOF_ENST00000339598.3_Splice_Site	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin						membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGAGGTCTCACCTCCTTCAT	0.602																																					.	GBM(102;732 1451 20652 24062 31372)	Atlas-SNP	.											.	OTOF	524	.	0			c.4023+2T>C						.						226.0	193.0	204.0					2																	26693459		2203	4300	6503	SO:0001630	splice_region_variant	9381	exon33			GGTCTCACCTCCT	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4023+1T>C	chr2.hg19:g.26693459A>G		131.0	0.0		97.0	4.0	NM_194248	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Splice_Site	SNP	ENST00000272371.2	hg19	CCDS1725.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.610958	0.87258	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7917	0.78369	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	OTOF	26546963	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.404000	0.79996	2.218000	0.71995	0.533000	0.62120	.	.	.		0.602	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		Intron
C2orf16	84226	hgsc.bcm.edu	37	2	27803857	27803857	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:27803857A>G	ENST00000408964.2	+	1	4469	c.4418A>G	c.(4417-4419)cAg>cGg	p.Q1473R	ZNF512_ENST00000355467.4_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000556601.1_5'Flank|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1473						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TCAGTGGGGCAGCCTCTGAGA	0.473																																					p.Q1473R		Atlas-SNP	.											.	C2orf16	357	.	0			c.A4418G						.						99.0	101.0	100.0					2																	27803857		1860	4106	5966	SO:0001583	missense	84226	exon1			TGGGGCAGCCTCT	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.4418A>G	chr2.hg19:g.27803857A>G	ENSP00000386190:p.Gln1473Arg	78.0	0.0		74.0	5.0	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	hg19	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.852837	0.32699	.	.	ENSG00000221843	ENST00000408964	T	0.59364	0.27	4.13	0.24	0.15489	.	.	.	.	.	T	0.42063	0.1186	N	0.24115	0.695	0.09310	N	1	D	0.58268	0.982	P	0.47573	0.55	T	0.25606	-1.0127	9	0.28530	T	0.3	.	4.7413	0.13013	0.5099:0.3846:0.1055:0.0	.	1473	Q68DN1	CB016_HUMAN	R	1473	ENSP00000386190:Q1473R	ENSP00000386190:Q1473R	Q	+	2	0	C2orf16	27657361	0.009000	0.17119	0.000000	0.03702	0.010000	0.07245	1.739000	0.38217	-0.039000	0.13602	0.379000	0.24179	CAG	.	.		0.473	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
FOSL2	2355	hgsc.bcm.edu	37	2	28627206	28627206	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:28627206G>A	ENST00000264716.4	+	2	1198	c.335G>A	c.(334-336)cGc>cAc	p.R112H	FOSL2_ENST00000379619.1_Missense_Mutation_p.R87H|FOSL2_ENST00000460736.1_3'UTR|FOSL2_ENST00000545753.1_Missense_Mutation_p.R73H	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	112					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R112H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					ACCGTGGGCCGCAGGAGGAGA	0.627																																					p.R112H		Atlas-SNP	.											FOSL2,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	FOSL2	39	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.G335A						.						68.0	73.0	72.0					2																	28627206		2203	4300	6503	SO:0001583	missense	2355	exon2			TGGGCCGCAGGAG		CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.335G>A	chr2.hg19:g.28627206G>A	ENSP00000264716:p.Arg112His	67.0	0.0		70.0	3.0	NM_005253	B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	ENST00000264716.4	hg19	CCDS1766.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774822	0.90108	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000436647;ENST00000545753	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.84120	0.5402	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	P	0.61800	0.894	D	0.86203	0.1620	10	0.87932	D	0	-21.3146	19.3052	0.94158	0.0:0.0:1.0:0.0	.	112	P15408	FOSL2_HUMAN	H	87;112;73;73	ENSP00000368939:R87H;ENSP00000264716:R112H;ENSP00000396497:R73H;ENSP00000439303:R73H	ENSP00000264716:R112H	R	+	2	0	FOSL2	28480710	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.953000	0.70290	2.555000	0.86185	0.563000	0.77884	CGC	.	.		0.627	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215116.2	NM_005253	
THADA	63892	hgsc.bcm.edu	37	2	43519292	43519292	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:43519292T>C	ENST00000405006.4	-	33	5239	c.4888A>G	c.(4888-4890)Acc>Gcc	p.T1630A	THADA_ENST00000405975.2_Missense_Mutation_p.T1630A|THADA_ENST00000330266.7_Intron|THADA_ENST00000415080.2_Missense_Mutation_p.T1311A	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1630										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TCCTTTGGGGTCAGATGGACA	0.488																																					p.T1630A		Atlas-SNP	.											.	THADA	131	.	0			c.A4888G						.						55.0	58.0	57.0					2																	43519292		1949	4137	6086	SO:0001583	missense	63892	exon33			TTGGGGTCAGATG	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.4888A>G	chr2.hg19:g.43519292T>C	ENSP00000385995:p.Thr1630Ala	120.0	0.0		104.0	5.0	NM_001083953	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	hg19	CCDS46268.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.43|14.43	2.532561|2.532561	0.45073|0.45073	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006|ENST00000407351	T;T;T|.	0.11930|.	2.91;2.73;2.91|.	5.18|5.18	3.99|3.99	0.46301|0.46301	.|.	0.527792|.	0.19381|.	N|.	0.115658|.	T|.	0.32315|.	0.0825|.	L|L	0.27053|0.27053	0.805|0.805	0.22896|0.22896	N|N	0.998592|0.998592	P;B|.	0.35844|.	0.524;0.104|.	B;B|.	0.37091|.	0.241;0.023|.	T|.	0.18871|.	-1.0323|.	10|.	0.09843|.	T|.	0.71|.	.|.	8.9455|8.9455	0.35756|0.35756	0.1718:0.0:0.0:0.8282|0.1718:0.0:0.0:0.8282	.|.	1557;1630|.	B6ZDQ0;Q6YHU6|.	.;THADA_HUMAN|.	A|W	1630;1557;1311;1630|869	ENSP00000386088:T1630A;ENSP00000416048:T1311A;ENSP00000385995:T1630A|.	ENSP00000349464:T1557A|.	T|X	-|-	1|3	0|0	THADA|THADA	43372796|43372796	0.993000|0.993000	0.37304|0.37304	0.828000|0.828000	0.32881|0.32881	0.870000|0.870000	0.49936|0.49936	2.704000|2.704000	0.47118|0.47118	0.778000|0.778000	0.33520|0.33520	0.524000|0.524000	0.50904|0.50904	ACC|TGA	.	.		0.488	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326070.3	NM_022065	
FBXO11	80204	hgsc.bcm.edu	37	2	48037548	48037548	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:48037548C>A	ENST00000403359.3	-	19	2317	c.2245G>T	c.(2245-2247)Gat>Tat	p.D749Y	FBXO11_ENST00000434523.2_Missense_Mutation_p.D173Y|FBXO11_ENST00000402508.1_Missense_Mutation_p.D665Y|FBXO11_ENST00000316377.4_Missense_Mutation_p.D665Y|FBXO11_ENST00000405808.1_5'Flank	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	749					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTGAAAATATCATTTTCTTCA	0.333			"""Mis, F, D"""		DLBCL																																p.D749Y		Atlas-SNP	.		Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11	127	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.G2245T						.						61.0	62.0	62.0					2																	48037548		2203	4300	6503	SO:0001583	missense	80204	exon19			AAATATCATTTTC	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.2245G>T	chr2.hg19:g.48037548C>A	ENSP00000384823:p.Asp749Tyr	99.0	0.0		85.0	4.0	NM_001190274	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	hg19	CCDS54357.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826362	0.90955	.	.	ENSG00000138081	ENST00000402508;ENST00000403359;ENST00000316377;ENST00000434523	T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.88328	0.6407	L	0.49126	1.545	0.80722	D	1	D	0.60160	0.987	D	0.79108	0.992	D	0.87734	0.2581	10	0.87932	D	0	-0.5037	20.8598	0.99761	0.0:1.0:0.0:0.0	.	173	B3KUR1	.	Y	665;749;665;173	ENSP00000385398:D665Y;ENSP00000384823:D749Y;ENSP00000323822:D665Y;ENSP00000397359:D173Y	ENSP00000323822:D665Y	D	-	1	0	FBXO11	47891052	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.937000	0.99478	0.650000	0.86243	GAT	.	.		0.333	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251181.3	NM_012167, NM_018693, NM_025133	
PSME4	23198	hgsc.bcm.edu	37	2	54122147	54122147	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:54122147T>C	ENST00000404125.1	-	34	3964	c.3909A>G	c.(3907-3909)acA>acG	p.T1303T	PSME4_ENST00000421748.2_Silent_p.T447T	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1303					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGCTTACCTCTGTCATATCCT	0.388																																					p.T1303T		Atlas-SNP	.											.	PSME4	247	.	0			c.A3909G						.						202.0	176.0	185.0					2																	54122147		2203	4300	6503	SO:0001819	synonymous_variant	23198	exon34			TACCTCTGTCATA	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3909A>G	chr2.hg19:g.54122147T>C		95.0	0.0		95.0	4.0	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	ENST00000404125.1	hg19	CCDS33197.2																																																																																			.	.		0.388	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
PUS10	150962	hgsc.bcm.edu	37	2	61175283	61175283	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:61175283A>G	ENST00000316752.6	-	16	1607	c.1346T>C	c.(1345-1347)cTt>cCt	p.L449P	PUS10_ENST00000407787.1_Missense_Mutation_p.L449P	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	449	RNA binding thumb loop. {ECO:0000255}.				pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			CCTTCGGTGAAGGACGCGCAA	0.527																																					p.L449P		Atlas-SNP	.											.	PUS10	49	.	0			c.T1346C						.						171.0	171.0	171.0					2																	61175283		2203	4300	6503	SO:0001583	missense	150962	exon16			CGGTGAAGGACGC	AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.1346T>C	chr2.hg19:g.61175283A>G	ENSP00000326003:p.Leu449Pro	152.0	0.0		123.0	5.0	NM_144709	Q5JPJ5|Q96MI8	Missense_Mutation	SNP	ENST00000316752.6	hg19	CCDS1865.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.713327	0.89112	.	.	ENSG00000162927	ENST00000316752;ENST00000407787	D;D	0.89123	-2.47;-2.47	6.16	6.16	0.99307	Pseudouridine synthase, catalytic domain (1);	0.065114	0.64402	D	0.000006	D	0.95411	0.8510	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.95812	0.8842	10	0.66056	D	0.02	-2.398	16.8061	0.85666	1.0:0.0:0.0:0.0	.	449;449	A8K6R4;Q3MIT2	.;PUS10_HUMAN	P	449	ENSP00000326003:L449P;ENSP00000386074:L449P	ENSP00000326003:L449P	L	-	2	0	PUS10	61028787	1.000000	0.71417	0.986000	0.45419	0.906000	0.53458	8.962000	0.93254	2.367000	0.80283	0.528000	0.53228	CTT	.	.		0.527	PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251582.2	NM_144709	
XPO1	7514	hgsc.bcm.edu	37	2	61706090	61706090	+	Silent	SNP	A	A	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:61706090A>C	ENST00000401558.2	-	25	3808	c.3081T>G	c.(3079-3081)ggT>ggG	p.G1027G	RP11-355B11.2_ENST00000603199.1_RNA|RP11-355B11.2_ENST00000603028.1_RNA|RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603652.1_RNA|XPO1_ENST00000406957.1_Silent_p.G1027G|XPO1_ENST00000404992.2_Silent_p.G1027G	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	1027					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AAGTGTCTTCACCTGCAAATT	0.373			Mis		CLL																																p.G1027G		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1	108	.	0			c.T3081G						.						114.0	110.0	111.0					2																	61706090		2203	4300	6503	SO:0001819	synonymous_variant	7514	exon25			GTCTTCACCTGCA	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.3081T>G	chr2.hg19:g.61706090A>C		241.0	0.0		189.0	59.0	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Silent	SNP	ENST00000401558.2	hg19	CCDS33205.1																																																																																			.	.		0.373	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
ARHGAP25	9938	hgsc.bcm.edu	37	2	69053300	69053300	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:69053300A>G	ENST00000295381.3	+	11	2331	c.1912A>G	c.(1912-1914)Atg>Gtg	p.M638V	ARHGAP25_ENST00000409202.3_Missense_Mutation_p.M639V|ARHGAP25_ENST00000467265.1_Missense_Mutation_p.M599V|ARHGAP25_ENST00000409030.3_Missense_Mutation_p.M631V|ARHGAP25_ENST00000479844.1_Missense_Mutation_p.M332V|ARHGAP25_ENST00000409220.1_Missense_Mutation_p.M632V	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25	638					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						TGTCAAATCCATGAAGGAACC	0.547																																					p.M639V		Atlas-SNP	.											.	ARHGAP25	175	.	0			c.A1915G						.						76.0	80.0	79.0					2																	69053300		2203	4300	6503	SO:0001583	missense	9938	exon11			AAATCCATGAAGG	D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.1912A>G	chr2.hg19:g.69053300A>G	ENSP00000295381:p.Met638Val	102.0	0.0		67.0	4.0	NM_001007231	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Missense_Mutation	SNP	ENST00000295381.3	hg19		.	.	.	.	.	.	.	.	.	.	A	11.11	1.542141	0.27563	.	.	ENSG00000163219	ENST00000295381;ENST00000409202;ENST00000467265;ENST00000409030;ENST00000409220;ENST00000543533;ENST00000479844	T;T;T;T;T;T	0.16457	2.93;2.93;2.67;2.93;2.93;2.34	5.95	-2.02	0.07388	.	0.321333	0.30649	N	0.009176	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.06405	0.0;0.0;0.0;0.0;0.002	T	0.17837	-1.0356	10	0.52906	T	0.07	.	2.262	0.04069	0.5152:0.116:0.2572:0.1116	.	599;639;632;631;638	E9PFQ7;P42331-4;G5E9G2;P42331-3;P42331	.;.;.;.;RHG25_HUMAN	V	638;639;599;631;632;623;332	ENSP00000295381:M638V;ENSP00000386911:M639V;ENSP00000420583:M599V;ENSP00000386863:M631V;ENSP00000386241:M632V;ENSP00000417467:M332V	ENSP00000295381:M638V	M	+	1	0	ARHGAP25	68906804	0.003000	0.15002	0.023000	0.16930	0.823000	0.46562	0.493000	0.22451	-0.324000	0.08589	-0.250000	0.11733	ATG	.	.		0.547	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882	
ADD2	119	hgsc.bcm.edu	37	2	70919547	70919547	+	Silent	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:70919547C>T	ENST00000264436.4	-	7	1137	c.693G>A	c.(691-693)ccG>ccA	p.P231P	ADD2_ENST00000355733.3_Silent_p.P231P|ADD2_ENST00000413157.2_Silent_p.P231P|AC007395.3_ENST00000457851.1_RNA|ADD2_ENST00000407644.2_Silent_p.P231P|ADD2_ENST00000430656.1_Silent_p.P247P	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	231					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						CTGCTGTGGCCGGTGTGTGCA	0.582																																					p.P247P		Atlas-SNP	.											.	ADD2	261	.	0			c.G741A						.						55.0	51.0	52.0					2																	70919547		2203	4300	6503	SO:0001819	synonymous_variant	119	exon6			TGTGGCCGGTGTG	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.693G>A	chr2.hg19:g.70919547C>T		78.0	0.0		92.0	4.0	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	hg19	CCDS1906.1																																																																																			.	.		0.582	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
LOXL3	84695	hgsc.bcm.edu	37	2	74763252	74763252	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:74763252T>C	ENST00000264094.3	-	7	1190	c.1119A>G	c.(1117-1119)gaA>gaG	p.E373E	LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409986.1_Silent_p.E228E|LOXL3_ENST00000393937.2_Silent_p.E228E|LOXL3_ENST00000409549.1_Silent_p.E373E	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	373	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						AGCAGCGAACTTCACTCAGGT	0.542																																					p.E373E		Atlas-SNP	.											.	LOXL3	73	.	0			c.A1119G						.						81.0	83.0	82.0					2																	74763252		2203	4300	6503	SO:0001819	synonymous_variant	84695	exon7			GCGAACTTCACTC	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1119A>G	chr2.hg19:g.74763252T>C		73.0	0.0		61.0	4.0	NM_032603	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	hg19	CCDS1953.1	.	.	.	.	.	.	.	.	.	.	T	6.948	0.544686	0.13312	.	.	ENSG00000115318	ENST00000420535	.	.	.	5.09	-2.87	0.05700	.	.	.	.	.	T	0.50718	0.1632	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47032	-0.9148	4	.	.	.	.	7.337	0.26615	0.0:0.5076:0.1569:0.3355	.	.	.	.	G	100	.	.	S	-	1	0	LOXL3	74616760	0.998000	0.40836	0.909000	0.35828	0.986000	0.74619	0.600000	0.24104	-0.339000	0.08401	0.450000	0.29827	AGT	.	.		0.542	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
HK2	3099	hgsc.bcm.edu	37	2	75113635	75113635	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:75113635G>T	ENST00000290573.2	+	15	2654	c.2054G>T	c.(2053-2055)tGc>tTc	p.C685F	HK2_ENST00000409174.1_Missense_Mutation_p.C657F	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	685	Catalytic.|Hexokinase type-2 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						AGCAATGCCTGCTACATGGAG	0.587																																					p.C685F		Atlas-SNP	.											.	HK2	85	.	0			c.G2054T						.						105.0	98.0	101.0					2																	75113635		2203	4300	6503	SO:0001583	missense	3099	exon15			ATGCCTGCTACAT		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2054G>T	chr2.hg19:g.75113635G>T	ENSP00000290573:p.Cys685Phe	143.0	0.0		129.0	50.0	NM_000189	D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	ENST00000290573.2	hg19	CCDS1956.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571500	0.86542	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.98701	-5.08;-5.08	5.49	5.49	0.81192	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	H	0.97806	4.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98130	1.0430	10	0.87932	D	0	-25.4229	16.9239	0.86170	0.0:0.0:1.0:0.0	.	685	P52789	HXK2_HUMAN	F	685;685;657	ENSP00000290573:C685F;ENSP00000387140:C657F	ENSP00000290573:C685F	C	+	2	0	HK2	74967143	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.584000	0.98220	2.865000	0.98341	0.655000	0.94253	TGC	.	.		0.587	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	NM_000189	
DNAH6	1768	hgsc.bcm.edu	37	2	84949784	84949784	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:84949784A>G	ENST00000237449.6	+	59	9836	c.9828A>G	c.(9826-9828)gaA>gaG	p.E3276E	DNAH6_ENST00000389394.3_Silent_p.E3276E			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3276					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GGCTGGAAGAAGCAGAGTCCA	0.443																																					p.E3276E		Atlas-SNP	.											.	DNAH6	194	.	0			c.A9828G						.						94.0	85.0	87.0					2																	84949784		692	1591	2283	SO:0001819	synonymous_variant	1768	exon60			GGAAGAAGCAGAG	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.9828A>G	chr2.hg19:g.84949784A>G		112.0	0.0		97.0	4.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	hg19	CCDS46348.1																																																																																			.	.		0.443	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
CD8A	925	hgsc.bcm.edu	37	2	87013062	87013062	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:87013062A>G	ENST00000409511.2	-	9	1719	c.689T>C	c.(688-690)cTt>cCt	p.L230P	CD8A_ENST00000456996.2_Missense_Mutation_p.L193P|CD8A_ENST00000409781.1_Missense_Mutation_p.L193P|CD8A_ENST00000352580.3_Missense_Mutation_p.L193P|CD8A_ENST00000538832.1_Missense_Mutation_p.L271P|CD8A_ENST00000283635.3_Missense_Mutation_p.L230P	NM_001145873.1	NP_001139345.1	P01732	CD8A_HUMAN	CD8a molecule	230					antigen processing and presentation (GO:0019882)|cytotoxic T cell differentiation (GO:0045065)|defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of calcium-mediated signaling (GO:0050850)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|T cell mediated immunity (GO:0002456)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	8						TCTCGCCGAAAGGCTGGGCTT	0.512																																					p.L230P		Atlas-SNP	.											.	CD8A	28	.	0			c.T689C						.						188.0	184.0	185.0					2																	87013062		2203	4300	6503	SO:0001583	missense	925	exon9			GCCGAAAGGCTGG		CCDS1992.1, CCDS1993.1	2p12	2014-09-17	2006-03-28		ENSG00000153563	ENSG00000153563		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1706	protein-coding gene	gene with protein product		186910	"""CD8 antigen, alpha polypeptide (p32)"", ""T-cell surface glycoprotein CD8 alpha chain"""	CD8		1541829	Standard	NM_171827		Approved		uc002sru.3	P01732	OTTHUMG00000130265	ENST00000409511.2:c.689T>C	chr2.hg19:g.87013062A>G	ENSP00000386559:p.Leu230Pro	105.0	0.0		107.0	5.0	NM_001145873	B4DT80|D6W5M8|Q13970|Q4ZG17	Missense_Mutation	SNP	ENST00000409511.2	hg19	CCDS1992.1	.	.	.	.	.	.	.	.	.	.	A	8.538	0.872529	0.17322	.	.	ENSG00000153563	ENST00000456996;ENST00000352580;ENST00000283635;ENST00000409511;ENST00000442577;ENST00000538832;ENST00000409781	T;T;T;T;T;T	0.77620	-0.94;-0.94;-1.02;-1.02;-1.11;-1.07	4.03	-2.39	0.06602	.	1.967440	0.02026	N	0.048205	T	0.47266	0.1436	N	0.00985	-1.075	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.39781	-0.9597	10	0.37606	T	0.19	4.5251	3.0785	0.06254	0.4029:0.0:0.2808:0.3163	.	271;193;230	B4DT80;P01732-2;P01732	.;.;CD8A_HUMAN	P	193;193;230;230;215;271;193	ENSP00000398868:L193P;ENSP00000321631:L193P;ENSP00000283635:L230P;ENSP00000386559:L230P;ENSP00000438371:L271P;ENSP00000387314:L193P	ENSP00000283635:L230P	L	-	2	0	CD8A	86866573	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.464000	0.06688	-0.536000	0.06298	-1.252000	0.01501	CTT	.	.		0.512	CD8A-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330784.3	NM_001768	
NCAPH	23397	hgsc.bcm.edu	37	2	97009872	97009872	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:97009872A>G	ENST00000240423.4	+	6	668	c.625A>G	c.(625-627)Aaa>Gaa	p.K209E	NCAPH_ENST00000455200.1_Missense_Mutation_p.K198E|NCAPH_ENST00000427946.1_Missense_Mutation_p.K73E	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	209					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				GGGAACAACCAAAAAGGCTGT	0.418																																					p.K209E		Atlas-SNP	.											.	NCAPH	67	.	0			c.A625G						.						98.0	89.0	92.0					2																	97009872		2203	4300	6503	SO:0001583	missense	23397	exon6			ACAACCAAAAAGG	BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.625A>G	chr2.hg19:g.97009872A>G	ENSP00000240423:p.Lys209Glu	101.0	0.0		97.0	4.0	NM_015341	B4E189|Q8TB87	Missense_Mutation	SNP	ENST00000240423.4	hg19	CCDS2021.1	.	.	.	.	.	.	.	.	.	.	A	10.38	1.333114	0.24167	.	.	ENSG00000121152	ENST00000240423;ENST00000427946;ENST00000435975;ENST00000455200	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.17	2.71	0.32032	.	0.569443	0.19541	N	0.111803	T	0.29556	0.0737	L	0.45698	1.435	0.26974	N	0.965517	B;B;P;B	0.36837	0.234;0.234;0.571;0.234	B;B;B;B	0.34038	0.158;0.158;0.174;0.158	T	0.17592	-1.0364	10	0.07325	T	0.83	-9.6048	10.8058	0.46516	0.6971:0.3029:0.0:0.0	.	185;198;198;209	B4DRG7;E9PHA2;C9J470;Q15003	.;.;.;CND2_HUMAN	E	209;73;198;198	ENSP00000240423:K209E;ENSP00000400774:K73E;ENSP00000405237:K198E;ENSP00000407308:K198E	ENSP00000240423:K209E	K	+	1	0	NCAPH	96373599	1.000000	0.71417	0.901000	0.35422	0.853000	0.48598	4.128000	0.57951	0.353000	0.24079	-0.328000	0.08392	AAA	.	.		0.418	NCAPH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252842.2	NM_015341	
TMEM131	23505	hgsc.bcm.edu	37	2	98410005	98410005	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:98410005A>G	ENST00000186436.5	-	30	3626	c.3398T>C	c.(3397-3399)cTt>cCt	p.L1133P		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1133						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						AATGACCAAAAGAAACAGTGC	0.438																																					p.L1133P		Atlas-SNP	.											.	TMEM131	258	.	0			c.T3398C						.						34.0	34.0	34.0					2																	98410005		1830	4079	5909	SO:0001583	missense	23505	exon30			ACCAAAAGAAACA	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3398T>C	chr2.hg19:g.98410005A>G	ENSP00000186436:p.Leu1133Pro	107.0	0.0		104.0	7.0	NM_015348		Missense_Mutation	SNP	ENST00000186436.5	hg19	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.440541	0.83993	.	.	ENSG00000075568	ENST00000186436;ENST00000409721	T	0.39229	1.09	5.77	5.77	0.91146	.	0.061214	0.64402	D	0.000002	T	0.61813	0.2377	M	0.61703	1.905	0.80722	D	1	D	0.76494	0.999	D	0.67231	0.95	T	0.64668	-0.6353	10	0.87932	D	0	-14.6149	16.3948	0.83586	1.0:0.0:0.0:0.0	.	1133	Q92545	TM131_HUMAN	P	1133;50	ENSP00000186436:L1133P	ENSP00000186436:L1133P	L	-	2	0	TMEM131	97776437	1.000000	0.71417	0.938000	0.37757	0.993000	0.82548	8.678000	0.91211	2.326000	0.78906	0.533000	0.62120	CTT	.	.		0.438	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542	
VWA3B	200403	hgsc.bcm.edu	37	2	98750292	98750292	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:98750292A>G	ENST00000477737.1	+	7	1082	c.878A>G	c.(877-879)cAc>cGc	p.H293R	VWA3B_ENST00000451075.2_Missense_Mutation_p.H143R|VWA3B_ENST00000435344.1_Missense_Mutation_p.H293R	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	293										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TTCAGATTCCACGCATTTGCC	0.473																																					p.H293R		Atlas-SNP	.											.	VWA3B	138	.	0			c.A878G						.						284.0	269.0	274.0					2																	98750292		2100	4230	6330	SO:0001583	missense	200403	exon7			GATTCCACGCATT	AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.878A>G	chr2.hg19:g.98750292A>G	ENSP00000417955:p.His293Arg	89.0	0.0		78.0	4.0	NM_144992	B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	ENST00000477737.1	hg19	CCDS42718.1	.	.	.	.	.	.	.	.	.	.	A	15.00	2.704507	0.48412	.	.	ENSG00000168658	ENST00000435344;ENST00000477737;ENST00000451075	T;T;T	0.49720	7.42;7.42;0.77	5.66	5.66	0.87406	.	0.088339	0.48767	D	0.000172	T	0.69700	0.3140	M	0.80982	2.52	0.35522	D	0.801546	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.988;0.959;0.996	T	0.80384	-0.1405	10	0.87932	D	0	.	13.4291	0.61044	1.0:0.0:0.0:0.0	.	143;293;293	B7Z7Q7;Q502W6;Q502W6-8	.;VWA3B_HUMAN;.	R	293;293;143	ENSP00000401959:H293R;ENSP00000417955:H293R;ENSP00000389463:H143R	ENSP00000411168:H293R	H	+	2	0	VWA3B	98116724	0.999000	0.42202	0.921000	0.36526	0.045000	0.14185	5.314000	0.65804	2.154000	0.67381	0.533000	0.62120	CAC	.	.		0.473	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353469.2	NM_144992	
AFF3	3899	hgsc.bcm.edu	37	2	100343586	100343586	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:100343586T>C	ENST00000409236.2	-	9	1156	c.1044A>G	c.(1042-1044)aaA>aaG	p.K348K	AFF3_ENST00000356421.2_Silent_p.K373K|AFF3_ENST00000317233.4_Silent_p.K348K|AFF3_ENST00000409579.1_Silent_p.K373K			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	348					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						CTGCATCACCTTTCTCTTAAA	0.348																																					p.K373K		Atlas-SNP	.											.	AFF3	164	.	0			c.A1119G						.						74.0	74.0	74.0					2																	100343586		2203	4300	6503	SO:0001819	synonymous_variant	3899	exon10			ATCACCTTTCTCT	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1044A>G	chr2.hg19:g.100343586T>C		83.0	0.0		80.0	4.0	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	ENST00000409236.2	hg19	CCDS42723.1																																																																																			.	.		0.348	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
TGFBRAP1	9392	hgsc.bcm.edu	37	2	105885829	105885829	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:105885829A>G	ENST00000393359.2	-	11	2732	c.2306T>C	c.(2305-2307)tTc>tCc	p.F769S	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.F769S			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	769					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						CCCCATCAGGAATGGGCAGAG	0.602																																					p.F769S	Esophageal Squamous(183;794 2019 9730 21801 48859)	Atlas-SNP	.											.	TGFBRAP1	70	.	0			c.T2306C						.						38.0	38.0	38.0					2																	105885829		2203	4300	6503	SO:0001583	missense	9392	exon11			ATCAGGAATGGGC	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.2306T>C	chr2.hg19:g.105885829A>G	ENSP00000377027:p.Phe769Ser	123.0	0.0		119.0	5.0	NM_004257	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	hg19	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	A	19.87	3.906747	0.72868	.	.	ENSG00000135966	ENST00000393359;ENST00000258449;ENST00000543724	T;T	0.58060	0.36;0.36	5.36	5.36	0.76844	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.77651	0.4162	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.82694	-0.0330	10	0.66056	D	0.02	-31.4532	15.6465	0.77061	1.0:0.0:0.0:0.0	.	224;769	B3KMM9;Q8WUH2	.;TGFA1_HUMAN	S	769;769;224	ENSP00000377027:F769S;ENSP00000258449:F769S	ENSP00000258449:F769S	F	-	2	0	TGFBRAP1	105252261	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	8.910000	0.92685	2.164000	0.68074	0.459000	0.35465	TTC	.	.		0.602	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
ST6GAL2	84620	hgsc.bcm.edu	37	2	107459744	107459744	+	Silent	SNP	G	G	A	rs144265287		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:107459744G>A	ENST00000409382.3	-	2	1300	c.690C>T	c.(688-690)acC>acT	p.T230T	AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000361686.4_Silent_p.T230T|ST6GAL2_ENST00000409087.3_Silent_p.T230T	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	230					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						GCTTGTTGGCGGTCAGGTAAT	0.672																																					p.T230T		Atlas-SNP	.											.	ST6GAL2	159	.	0			c.C690T						.						27.0	28.0	28.0					2																	107459744		2202	4300	6502	SO:0001819	synonymous_variant	84620	exon2			GTTGGCGGTCAGG	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.690C>T	chr2.hg19:g.107459744G>A		31.0	0.0		51.0	4.0	NM_032528	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	hg19	CCDS2073.1																																																																																			.	G|1.000;C|0.000		0.672	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
NPHP1	4867	hgsc.bcm.edu	37	2	110881571	110881571	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:110881571A>G	ENST00000393272.3	-	20	2093	c.1996T>C	c.(1996-1998)Tcc>Ccc	p.S666P	NPHP1_ENST00000417665.1_Missense_Mutation_p.S645P|NPHP1_ENST00000316534.4_Missense_Mutation_p.S667P|NPHP1_ENST00000445609.2_Missense_Mutation_p.S611P|AC013268.1_ENST00000390802.1_RNA|NPHP1_ENST00000355301.4_Missense_Mutation_p.S548P	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	666					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						AGGCGTGTGGAGTGGAGAAGT	0.498																																					p.S667P		Atlas-SNP	.											.	NPHP1	68	.	0			c.T1999C						.						119.0	119.0	119.0					2																	110881571		2203	4300	6503	SO:0001583	missense	4867	exon20			GTGTGGAGTGGAG	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.1996T>C	chr2.hg19:g.110881571A>G	ENSP00000376953:p.Ser666Pro	105.0	0.0		66.0	4.0	NM_000272	O14837	Missense_Mutation	SNP	ENST00000393272.3	hg19	CCDS46385.1	.	.	.	.	.	.	.	.	.	.	A	15.66	2.899515	0.52227	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	T;T;T;T;T	0.69926	-0.06;-0.05;-0.06;-0.04;-0.44	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.82167	0.4978	M	0.79805	2.47	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999	D	0.84741	0.0751	10	0.72032	D	0.01	-14.5899	14.4178	0.67163	1.0:0.0:0.0:0.0	.	610;548;666;611;667	B4DQY0;O15259-3;O15259;O15259-2;O15259-4	.;.;NPHP1_HUMAN;.;.	P	667;611;666;548;645	ENSP00000313169:S667P;ENSP00000389879:S611P;ENSP00000376953:S666P;ENSP00000347452:S548P;ENSP00000402176:S645P	ENSP00000313169:S667P	S	-	1	0	NPHP1	110238860	0.987000	0.35691	0.074000	0.20217	0.159000	0.22180	2.865000	0.48412	2.086000	0.62901	0.379000	0.24179	TCC	.	.		0.498	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272	
PSD4	23550	hgsc.bcm.edu	37	2	113958938	113958938	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:113958938A>G	ENST00000245796.6	+	17	3312	c.3117A>G	c.(3115-3117)tcA>tcG	p.S1039S	PSD4_ENST00000441564.3_Silent_p.S1010S	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	1039					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCAACATCTCAGAGCGCAGAA	0.607																																					p.S1039S		Atlas-SNP	.											.	PSD4	74	.	0			c.A3117G						.						106.0	93.0	98.0					2																	113958938		2203	4300	6503	SO:0001819	synonymous_variant	23550	exon17			CATCTCAGAGCGC	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.3117A>G	chr2.hg19:g.113958938A>G		70.0	0.0		69.0	4.0	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Silent	SNP	ENST00000245796.6	hg19	CCDS33276.1																																																																																			.	.		0.607	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
CLASP1	23332	hgsc.bcm.edu	37	2	122227423	122227423	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:122227423G>A	ENST00000263710.4	-	9	1215	c.826C>T	c.(826-828)Cgc>Tgc	p.R276C	CLASP1_ENST00000430234.1_5'UTR|CLASP1_ENST00000455322.2_Missense_Mutation_p.R276C|CLASP1_ENST00000409078.3_Missense_Mutation_p.R276C|CLASP1_ENST00000397587.3_Missense_Mutation_p.R276C|CLASP1_ENST00000541859.1_Missense_Mutation_p.R45C|CLASP1_ENST00000541377.1_Missense_Mutation_p.R276C|CLASP1_ENST00000545861.1_Missense_Mutation_p.R44C	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	276					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					CCAAGCCGGCGGGTGGTTCCC	0.517																																					p.R276C		Atlas-SNP	.											.	CLASP1	135	.	0			c.C826T						.						68.0	70.0	69.0					2																	122227423		1904	4138	6042	SO:0001583	missense	23332	exon9			GCCGGCGGGTGGT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.826C>T	chr2.hg19:g.122227423G>A	ENSP00000263710:p.Arg276Cys	96.0	0.0		108.0	6.0	NM_001207051	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	hg19		.	.	.	.	.	.	.	.	.	.	G	21.4	4.140626	0.77775	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861;ENST00000418989;ENST00000449975	T;T;T;T;T;T;T;T	0.50813	1.99;2.01;2.0;2.02;0.73;2.01;0.73;0.75	4.75	4.75	0.60458	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67183	0.2866	M	0.61703	1.905	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.993;0.997;0.995;0.997	T	0.70044	-0.4980	10	0.59425	D	0.04	-19.0472	18.1235	0.89579	0.0:0.0:1.0:0.0	.	276;276;276;276	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	C	276;276;276;276;45;276;44;45;45	ENSP00000263710:R276C;ENSP00000389372:R276C;ENSP00000380717:R276C;ENSP00000441625:R276C;ENSP00000441770:R45C;ENSP00000386442:R276C;ENSP00000392886:R45C;ENSP00000402101:R45C	ENSP00000263710:R276C	R	-	1	0	CLASP1	121943893	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	3.889000	0.56212	2.363000	0.80096	0.460000	0.39030	CGC	.	.		0.517	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125204453	125204453	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:125204453A>G	ENST00000431078.1	+	6	1221	c.857A>G	c.(856-858)gAc>gGc	p.D286G		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	286	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTCACGGTGGACAAGCACACA	0.602																																					p.D286G		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.A857G						.						114.0	116.0	115.0					2																	125204453		2172	4281	6453	SO:0001583	missense	129684	exon6			CGGTGGACAAGCA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.857A>G	chr2.hg19:g.125204453A>G	ENSP00000399013:p.Asp286Gly	182.0	0.0		149.0	6.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.959204	0.92726	.	.	ENSG00000155052	ENST00000431078	D	0.88354	-2.37	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.53938	D	0.000052	D	0.95906	0.8667	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96862	0.9633	10	0.87932	D	0	.	15.5785	0.76414	1.0:0.0:0.0:0.0	.	286	Q8WYK1	CNTP5_HUMAN	G	286	ENSP00000399013:D286G	ENSP00000399013:D286G	D	+	2	0	CNTNAP5	124920923	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.153000	0.94687	2.333000	0.79357	0.533000	0.62120	GAC	.	.		0.602	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CYP27C1	339761	hgsc.bcm.edu	37	2	127958787	127958787	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:127958787T>G	ENST00000335247.7	-	3	429	c.299A>C	c.(298-300)tAt>tCt	p.Y100S	CYP27C1_ENST00000409327.1_Missense_Mutation_p.Y100S	NM_001001665.3	NP_001001665.3	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C, polypeptide 1	100						membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	16	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		GGCGCCTGCATACATGGAGGT	0.537																																					p.Y100S		Atlas-SNP	.											.	CYP27C1	52	.	0			c.A299C						.						116.0	117.0	116.0					2																	127958787		2203	4300	6503	SO:0001583	missense	339761	exon3			CCTGCATACATGG	AC027142	CCDS33285.1	2q14.3	2008-05-14	2007-05-18		ENSG00000186684	ENSG00000186684		"""Cytochrome P450s"""	33480	protein-coding gene	gene with protein product							Standard	NM_001001665		Approved	FLJ16008	uc002tod.2	Q4G0S4	OTTHUMG00000153400	ENST00000335247.7:c.299A>C	chr2.hg19:g.127958787T>G	ENSP00000334128:p.Tyr100Ser	94.0	0.0		88.0	31.0	NM_001001665	Q6ZNI7	Missense_Mutation	SNP	ENST00000335247.7	hg19	CCDS33285.1	.	.	.	.	.	.	.	.	.	.	T	17.01	3.280568	0.59758	.	.	ENSG00000186684	ENST00000335247;ENST00000409327	T;T	0.67171	-0.25;-0.25	4.04	2.82	0.32997	.	0.072732	0.56097	D	0.000023	T	0.61999	0.2392	L	0.35487	1.065	0.44719	D	0.99771	P	0.51240	0.943	P	0.52109	0.69	T	0.59241	-0.7491	10	0.51188	T	0.08	-10.4256	8.4863	0.33074	0.0:0.1022:0.0:0.8978	.	100	Q4G0S4	C27C1_HUMAN	S	100	ENSP00000334128:Y100S;ENSP00000387198:Y100S	ENSP00000334128:Y100S	Y	-	2	0	CYP27C1	127675257	1.000000	0.71417	0.529000	0.27951	0.866000	0.49608	2.923000	0.48868	0.394000	0.25230	-0.366000	0.07423	TAT	.	.		0.537	CYP27C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331046.1	NM_001001665	
PROC	5624	hgsc.bcm.edu	37	2	128186428	128186428	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:128186428A>G	ENST00000234071.3	+	9	1379	c.1292A>G	c.(1291-1293)aAc>aGc	p.N431S	PROC_ENST00000422777.3_Missense_Mutation_p.N431S|PROC_ENST00000453608.2_Missense_Mutation_p.N486S|PROC_ENST00000409048.1_Missense_Mutation_p.N465S	NM_000312.3	NP_000303.1	P04070	PROC_HUMAN	protein C (inactivator of coagulation factors Va and VIIIa)	431	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood coagulation (GO:0030195)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	CTCCTTCACAACTACGGCGTT	0.637																																					p.N431S		Atlas-SNP	.											.	PROC	31	.	0			c.A1292G						.						90.0	96.0	94.0					2																	128186428		2203	4300	6503	SO:0001583	missense	5624	exon9			TTCACAACTACGG	X02750	CCDS2145.1	2q13-q14	2014-01-30			ENSG00000115718	ENSG00000115718		"""Endogenous ligands"""	9451	protein-coding gene	gene with protein product	"""prepro-protein C"""	612283				2991887, 2437584	Standard	NM_000312		Approved		uc002tok.3	P04070	OTTHUMG00000131528	ENST00000234071.3:c.1292A>G	chr2.hg19:g.128186428A>G	ENSP00000234071:p.Asn431Ser	63.0	0.0		73.0	4.0	NM_000312	B4DPQ7|Q15189|Q15190|Q16001|Q53S74|Q9UC55	Missense_Mutation	SNP	ENST00000234071.3	hg19	CCDS2145.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.46|17.46	3.394261|3.394261	0.62066|0.62066	.|.	.|.	ENSG00000115718|ENSG00000115718	ENST00000234071;ENST00000537436;ENST00000453608;ENST00000409048;ENST00000422777|ENST00000402125	D;D;D;D|.	0.88431|.	-2.38;-2.38;-2.38;-2.38|.	5.16|5.16	3.95|3.95	0.45737|0.45737	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.000000|.	0.47852|.	D|.	0.000203|.	T|T	0.31575|0.31575	0.0801|0.0801	N|N	0.03891|0.03891	-0.335|-0.335	0.43719|0.43719	D|D	0.996194|0.996194	P;P;B;P|.	0.51537|.	0.946;0.87;0.017;0.939|.	P;P;B;P|.	0.61003|.	0.882;0.728;0.126;0.8|.	T|T	0.15607|0.15607	-1.0431|-1.0431	10|5	0.38643|.	T|.	0.18|.	.|.	12.2975|12.2975	0.54857|0.54857	0.859:0.141:0.0:0.0|0.859:0.141:0.0:0.0	.|.	486;487;465;431|.	B4DPQ7;B4DPQ3;E7END6;P04070|.	.;.;.;PROC_HUMAN|.	S|A	431;390;486;465;431|206	ENSP00000234071:N431S;ENSP00000404030:N486S;ENSP00000386679:N465S;ENSP00000409543:N431S|.	ENSP00000234071:N431S|.	N|T	+|+	2|1	0|0	PROC|PROC	127902898|127902898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	5.935000|5.935000	0.70145|0.70145	2.177000|2.177000	0.69029|0.69029	0.533000|0.533000	0.62120|0.62120	AAC|ACT	.	.		0.637	PROC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254385.2	NM_000312	
MYO7B	4648	hgsc.bcm.edu	37	2	128338357	128338357	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:128338357T>C	ENST00000409816.2	+	9	1072	c.1040T>C	c.(1039-1041)aTg>aCg	p.M347T	MYO7B_ENST00000428314.1_Missense_Mutation_p.M347T|MYO7B_ENST00000389524.4_Missense_Mutation_p.M347T			Q6PIF6	MYO7B_HUMAN	myosin VIIB	347	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		TCAGACGTGATGGAGACGCCC	0.597																																					p.M347T		Atlas-SNP	.											.	MYO7B	359	.	0			c.T1040C						.						55.0	57.0	57.0					2																	128338357		1985	4163	6148	SO:0001583	missense	4648	exon10			ACGTGATGGAGAC		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1040T>C	chr2.hg19:g.128338357T>C	ENSP00000386461:p.Met347Thr	93.0	0.0		83.0	4.0	NM_001080527	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	hg19	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	T	0.350	-0.945258	0.02304	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.86627	-2.15;-2.15;-2.15	5.27	2.84	0.33178	Myosin head, motor domain (2);	0.403000	0.27622	N	0.018543	T	0.65995	0.2745	N	0.02736	-0.51	0.30694	N	0.750989	P	0.37573	0.6	B	0.37091	0.241	T	0.64241	-0.6454	10	0.14656	T	0.56	.	6.4617	0.21960	0.0:0.0803:0.1571:0.7625	.	347	Q6PIF6	MYO7B_HUMAN	T	347	ENSP00000374175:M347T;ENSP00000415090:M347T;ENSP00000386461:M347T	ENSP00000374175:M347T	M	+	2	0	MYO7B	128054827	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	1.729000	0.38115	0.392000	0.25172	-0.376000	0.06991	ATG	.	.		0.597	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
GPR148	344561	hgsc.bcm.edu	37	2	131487061	131487061	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:131487061G>A	ENST00000309926.4	+	1	419	c.337G>A	c.(337-339)Ggc>Agc	p.G113S		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					CAGCCTGGGTGGCTGGGAGCT	0.622																																					p.G113S		Atlas-SNP	.											.	GPR148	54	.	0			c.G337A						.						53.0	58.0	56.0					2																	131487061		2203	4300	6503	SO:0001583	missense	344561	exon1			CTGGGTGGCTGGG	AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.337G>A	chr2.hg19:g.131487061G>A	ENSP00000308908:p.Gly113Ser	166.0	0.0		140.0	7.0	NM_207364	Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	ENST00000309926.4	hg19	CCDS2163.1	.	.	.	.	.	.	.	.	.	.	.	3.436	-0.115181	0.06881	.	.	ENSG00000173302	ENST00000309926	T	0.36340	1.26	3.15	-0.467	0.12150	GPCR, rhodopsin-like superfamily (1);	0.226724	0.26995	N	0.021450	T	0.17874	0.0429	N	0.19112	0.55	0.09310	N	1	B	0.23937	0.094	B	0.31614	0.133	T	0.13845	-1.0494	10	0.22109	T	0.4	-0.2022	2.1136	0.03708	0.1305:0.3404:0.3565:0.1726	.	113	Q8TDV2	GP148_HUMAN	S	113	ENSP00000308908:G113S	ENSP00000308908:G113S	G	+	1	0	GPR148	131203531	0.006000	0.16342	0.532000	0.27989	0.166000	0.22503	0.010000	0.13242	-0.176000	0.10707	0.462000	0.41574	GGC	.	.		0.622	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254552.3	XM_293092	
R3HDM1	23518	hgsc.bcm.edu	37	2	136481779	136481779	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:136481779A>G	ENST00000264160.4	+	26	3587	c.3217A>G	c.(3217-3219)Att>Gtt	p.I1073V	R3HDM1_ENST00000409478.1_Missense_Mutation_p.I945V|R3HDM1_ENST00000329971.3_Missense_Mutation_p.I944V|R3HDM1_ENST00000409606.1_Missense_Mutation_p.I1074V|R3HDM1_ENST00000410054.1_Missense_Mutation_p.I1018V	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	1073							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		GAAGAAACAAATTAACTCAGT	0.458																																					p.I1073V		Atlas-SNP	.											.	R3HDM1	84	.	0			c.A3217G						.						71.0	67.0	68.0					2																	136481779		2203	4300	6503	SO:0001583	missense	23518	exon26			AAACAAATTAACT	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.3217A>G	chr2.hg19:g.136481779A>G	ENSP00000264160:p.Ile1073Val	124.0	0.0		87.0	4.0	NM_015361	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	ENST00000264160.4	hg19	CCDS2177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.581|1.581	-0.531644|-0.531644	0.04112|0.04112	.|.	.|.	ENSG00000048991|ENSG00000048991	ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606|ENST00000429703	T;T;T;T;T|.	0.28454|.	1.61;1.62;1.61;1.61;1.62|.	5.74|5.74	4.58|4.58	0.56647|0.56647	.|.	0.181695|.	0.45867|.	N|.	0.000334|.	T|T	0.47451|0.47451	0.1446|0.1446	L|L	0.44542|0.44542	1.39|1.39	0.30052|0.30052	N|N	0.811708|0.811708	B;B;B;B|.	0.17667|.	0.023;0.003;0.0;0.003|.	B;B;B;B|.	0.12837|.	0.008;0.002;0.0;0.003|.	T|T	0.46527|0.46527	-0.9185|-0.9185	10|5	0.45353|.	T|.	0.12|.	-8.0449|-8.0449	12.1509|12.1509	0.54050|0.54050	0.9327:0.0:0.0673:0.0|0.9327:0.0:0.0673:0.0	.|.	945;1074;1018;1073|.	G5E9G8;E9PBB4;E9PG42;Q15032|.	.;.;.;R3HD1_HUMAN|.	V|S	945;1073;944;1018;1074|796	ENSP00000386457:I945V;ENSP00000264160:I1073V;ENSP00000331396:I944V;ENSP00000386877:I1018V;ENSP00000387010:I1074V|.	ENSP00000264160:I1073V|.	I|N	+|+	1|2	0|0	R3HDM1|R3HDM1	136198249|136198249	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.985000|0.985000	0.73830|0.73830	4.709000|4.709000	0.61867|0.61867	1.097000|1.097000	0.41459|0.41459	0.459000|0.459000	0.35465|0.35465	ATT|AAT	.	.		0.458	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254659.1	NM_015361	
CXCR4	7852	hgsc.bcm.edu	37	2	136872711	136872711	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:136872711A>G	ENST00000241393.3	-	2	891	c.787T>C	c.(787-789)Tcc>Ccc	p.S263P	CXCR4_ENST00000409817.1_Missense_Mutation_p.S267P|CXCR4_ENST00000466288.1_5'UTR	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	263					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	AGGATGAAGGAGTCGATGCTG	0.522																																					p.S267P		Atlas-SNP	.											.	CXCR4	51	.	0			c.T799C						.						226.0	214.0	218.0					2																	136872711		2203	4300	6503	SO:0001583	missense	7852	exon1			TGAAGGAGTCGAT	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.787T>C	chr2.hg19:g.136872711A>G	ENSP00000241393:p.Ser263Pro	109.0	0.0		80.0	4.0	NM_001008540	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	hg19	CCDS46420.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.567435	0.45694	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	T;T	0.37752	1.18;1.18	6.17	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.137085	0.64402	D	0.000003	T	0.36663	0.0975	L	0.35249	1.045	0.45194	D	0.9982	D;P	0.58268	0.982;0.878	P;B	0.55455	0.776;0.092	T	0.20140	-1.0284	10	0.87932	D	0	.	5.7662	0.18227	0.5395:0.1107:0.0:0.3498	.	263;267	P61073;P61073-2	CXCR4_HUMAN;.	P	267;263;133	ENSP00000386884:S267P;ENSP00000241393:S263P	ENSP00000241393:S263P	S	-	1	0	CXCR4	136589181	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.818000	0.55678	1.137000	0.42214	0.533000	0.62120	TCC	.	.		0.522	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
FIGN	55137	hgsc.bcm.edu	37	2	164466794	164466794	+	Silent	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:164466794C>A	ENST00000333129.3	-	3	1862	c.1548G>T	c.(1546-1548)acG>acT	p.T516T	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	516					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GAGGTAAGGCCGTCAGTCCAC	0.507																																					p.T516T		Atlas-SNP	.											.	FIGN	106	.	0			c.G1548T						.						96.0	90.0	92.0					2																	164466794		1995	4167	6162	SO:0001819	synonymous_variant	55137	exon3			TAAGGCCGTCAGT	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1548G>T	chr2.hg19:g.164466794C>A		175.0	0.0		148.0	55.0	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Silent	SNP	ENST00000333129.3	hg19	CCDS2221.2																																																																																			.	.		0.507	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
COBLL1	22837	hgsc.bcm.edu	37	2	165552127	165552127	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:165552127T>C	ENST00000392717.2	-	13	2007	c.2003A>G	c.(2002-2004)aAt>aGt	p.N668S	COBLL1_ENST00000194871.6_Missense_Mutation_p.N697S|COBLL1_ENST00000409184.3_Missense_Mutation_p.N630S|COBLL1_ENST00000342193.4_Missense_Mutation_p.N630S|COBLL1_ENST00000375458.2_Missense_Mutation_p.N592S			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	668						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						ACTGGGTTGATTCAGTTTTTG	0.398																																					p.N630S		Atlas-SNP	.											.	COBLL1	122	.	0			c.A1889G						.						304.0	298.0	300.0					2																	165552127		2203	4300	6503	SO:0001583	missense	22837	exon12			GGTTGATTCAGTT	AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.2003A>G	chr2.hg19:g.165552127T>C	ENSP00000376478:p.Asn668Ser	668.0	0.0		654.0	232.0	NM_014900	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	hg19		.	.	.	.	.	.	.	.	.	.	T	5.660	0.306376	0.10733	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	6.06	0.816	0.18768	.	0.379490	0.28290	N	0.015888	T	0.26666	0.0652	L	0.44542	1.39	0.09310	N	1	B;B;B	0.20671	0.028;0.028;0.047	B;B;B	0.22152	0.017;0.019;0.038	T	0.24048	-1.0171	9	0.09338	T	0.73	-10.2753	5.9997	0.19513	0.1127:0.2637:0.0:0.6236	.	668;697;630	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	S	592;630;630;668;697	.	ENSP00000194871:N697S	N	-	2	0	COBLL1	165260373	0.920000	0.31207	0.789000	0.31954	0.744000	0.42396	0.644000	0.24766	0.148000	0.19059	0.533000	0.62120	AAT	.	.		0.398	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900	
LRP2	4036	hgsc.bcm.edu	37	2	170031784	170031784	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:170031784C>T	ENST00000263816.3	-	55	10972	c.10687G>A	c.(10687-10689)Ggc>Agc	p.G3563S	LRP2_ENST00000461418.1_5'Flank	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3563	LDL-receptor class A 27. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTGCAGTTGCCGTCACTGCAC	0.527																																					p.G3563S		Atlas-SNP	.											.	LRP2	751	.	0			c.G10687A						.						81.0	80.0	80.0					2																	170031784		2203	4300	6503	SO:0001583	missense	4036	exon55			AGTTGCCGTCACT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10687G>A	chr2.hg19:g.170031784C>T	ENSP00000263816:p.Gly3563Ser	213.0	0.0		200.0	88.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352685	0.61293	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.92595	-3.07	5.71	3.9	0.45041	.	0.050715	0.85682	D	0.000000	D	0.95503	0.8539	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93670	0.6989	10	0.25751	T	0.34	.	11.4275	0.50020	0.0:0.8052:0.1269:0.0679	.	3563	P98164	LRP2_HUMAN	S	3563;258	ENSP00000263816:G3563S	ENSP00000263816:G3563S	G	-	1	0	LRP2	169740030	1.000000	0.71417	0.861000	0.33841	0.116000	0.19942	6.089000	0.71384	0.746000	0.32786	-0.300000	0.09419	GGC	.	.		0.527	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
MYO3B	140469	hgsc.bcm.edu	37	2	171323061	171323061	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:171323061C>T	ENST00000408978.4	+	25	2997	c.2854C>T	c.(2854-2856)Cac>Tac	p.H952Y	MYO3B_ENST00000602629.1_Intron|MYO3B_ENST00000409044.3_Missense_Mutation_p.H952Y|MYO3B_ENST00000334231.6_Missense_Mutation_p.H961Y	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	952	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TGGACAGCCCCACTTTGTGCG	0.527																																					p.H952Y		Atlas-SNP	.											.	MYO3B	320	.	0			c.C2854T						.						97.0	100.0	99.0					2																	171323061		1931	4134	6065	SO:0001583	missense	140469	exon25			CAGCCCCACTTTG		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2854C>T	chr2.hg19:g.171323061C>T	ENSP00000386213:p.His952Tyr	71.0	0.0		75.0	4.0	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	hg19	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800726	0.90538	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	5.03	5.03	0.67393	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.87071	0.6086	M	0.80508	2.5	0.80722	D	1	D;P;D	0.89917	0.999;0.929;1.0	D;P;D	0.81914	0.979;0.729;0.995	D	0.89015	0.3431	10	0.87932	D	0	.	18.3721	0.90411	0.0:1.0:0.0:0.0	.	952;952;952	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	Y	952;952;951;961;961	ENSP00000386497:H952Y;ENSP00000386213:H952Y;ENSP00000446237:H961Y;ENSP00000335100:H961Y	ENSP00000314213:H951Y	H	+	1	0	MYO3B	171031307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.731000	0.84895	2.348000	0.79779	0.563000	0.77884	CAC	.	.		0.527	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
GAD1	2571	hgsc.bcm.edu	37	2	171710458	171710458	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:171710458G>A	ENST00000358196.3	+	14	1889	c.1339G>A	c.(1339-1341)Gac>Aac	p.D447N		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	447					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						TGTCTCCTACGACACCGGGGA	0.478																																					p.D447N		Atlas-SNP	.											.	GAD1	79	.	0			c.G1339A						.						154.0	141.0	145.0					2																	171710458		2203	4300	6503	SO:0001583	missense	2571	exon14			TCCTACGACACCG		CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.1339G>A	chr2.hg19:g.171710458G>A	ENSP00000350928:p.Asp447Asn	134.0	0.0		99.0	5.0	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	hg19	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	G	35	5.533135	0.96460	.	.	ENSG00000128683	ENST00000358196	T	0.57273	0.41	5.5	5.5	0.81552	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.043255	0.85682	D	0.000000	T	0.71375	0.3332	L	0.58510	1.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72666	-0.4224	10	0.87932	D	0	-25.3619	19.7739	0.96383	0.0:0.0:1.0:0.0	.	447	Q99259	DCE1_HUMAN	N	447	ENSP00000350928:D447N	ENSP00000350928:D447N	D	+	1	0	GAD1	171418704	1.000000	0.71417	0.957000	0.39632	0.965000	0.64279	9.420000	0.97426	2.744000	0.94065	0.655000	0.94253	GAC	.	.		0.478	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
OLA1	29789	hgsc.bcm.edu	37	2	174945976	174945976	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:174945976A>G	ENST00000409546.1	-	9	1560	c.930T>C	c.(928-930)agT>agC	p.S310S	OLA1_ENST00000284719.3_Splice_Site_p.S290S|OLA1_ENST00000428402.2_Intron|OLA1_ENST00000392560.2_5'UTR|OLA1_ENST00000344357.5_Splice_Site_p.S132S					Obg-like ATPase 1											breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						TTGGCAAAGCACTGAAATCAA	0.388																																					p.S290S		Atlas-SNP	.											.	OLA1	37	.	0			c.T870C						.						63.0	56.0	58.0					2																	174945976		2203	4299	6502	SO:0001630	splice_region_variant	29789	exon9			CAAAGCACTGAAA		CCDS2255.1, CCDS42779.1	2q31.1	2014-06-24	2007-07-27	2007-07-27	ENSG00000138430	ENSG00000138430			28833	protein-coding gene	gene with protein product		611175	"""GTP-binding protein 9 (putative)"""	GTPBP9		17430889, 24486488	Standard	NM_013341		Approved	PTD004	uc002uih.3	Q9NTK5	OTTHUMG00000132335	ENST00000409546.1:c.930-1T>C	chr2.hg19:g.174945976A>G		97.0	0.0		112.0	5.0	NM_013341		Silent	SNP	ENST00000409546.1	hg19																																																																																				.	.		0.388	OLA1-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333877.1	NM_013341	Silent
DNAH7	56171	hgsc.bcm.edu	37	2	196750867	196750867	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:196750867C>T	ENST00000312428.6	-	34	5636	c.5536G>A	c.(5536-5538)Gag>Aag	p.E1846K		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1846					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GACCTTACCTCAAGCAAAGAG	0.408																																					p.E1846K		Atlas-SNP	.											.	DNAH7	512	.	0			c.G5536A						.						153.0	153.0	153.0					2																	196750867		1880	4120	6000	SO:0001583	missense	56171	exon34			TTACCTCAAGCAA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5536G>A	chr2.hg19:g.196750867C>T	ENSP00000311273:p.Glu1846Lys	100.0	0.0		88.0	4.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.866593	0.72065	.	.	ENSG00000118997	ENST00000312428	T	0.26067	1.76	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.55832	0.1945	M	0.85099	2.735	0.80722	D	1	D	0.64830	0.994	D	0.70227	0.968	T	0.61667	-0.7016	10	0.49607	T	0.09	.	17.8593	0.88776	0.0:1.0:0.0:0.0	.	1846	Q8WXX0	DYH7_HUMAN	K	1846	ENSP00000311273:E1846K	ENSP00000311273:E1846K	E	-	1	0	DNAH7	196459112	1.000000	0.71417	0.986000	0.45419	0.360000	0.29518	6.944000	0.75940	2.377000	0.81083	0.557000	0.71058	GAG	.	.		0.408	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
CCDC150	284992	hgsc.bcm.edu	37	2	197521794	197521794	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:197521794A>G	ENST00000389175.4	+	4	645	c.510A>G	c.(508-510)gaA>gaG	p.E170E	CCDC150_ENST00000423093.2_Intron|CCDC150_ENST00000272831.7_Intron|CCDC150_ENST00000472405.2_Silent_p.E67E	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	170										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TAAAAGAGGAAGAAGACAAGG	0.443																																					p.E170E		Atlas-SNP	.											.	CCDC150	96	.	0			c.A510G						.						92.0	94.0	94.0					2																	197521794		1999	4172	6171	SO:0001819	synonymous_variant	284992	exon4			AGAGGAAGAAGAC		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.510A>G	chr2.hg19:g.197521794A>G		148.0	0.0		98.0	4.0	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Silent	SNP	ENST00000389175.4	hg19	CCDS46478.1																																																																																			.	.		0.443	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
GTF3C3	9330	hgsc.bcm.edu	37	2	197664292	197664292	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:197664292T>C	ENST00000263956.3	-	1	133	c.44A>G	c.(43-45)aAa>aGa	p.K15R	GTF3C3_ENST00000409364.3_Missense_Mutation_p.K15R	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	15					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						AAAGGAGATTTTCCCTTCCAA	0.542																																					p.K15R		Atlas-SNP	.											.	GTF3C3	96	.	0			c.A44G						.						121.0	129.0	126.0					2																	197664292		2203	4300	6503	SO:0001583	missense	9330	exon1			GAGATTTTCCCTT	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.44A>G	chr2.hg19:g.197664292T>C	ENSP00000263956:p.Lys15Arg	102.0	0.0		94.0	4.0	NM_001206774	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	hg19	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.908198	0.52333	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	T;T	0.44881	0.91;0.98	5.36	5.36	0.76844	.	0.054636	0.64402	D	0.000001	T	0.32793	0.0841	N	0.25647	0.755	0.43467	D	0.995674	B;B	0.27625	0.183;0.006	B;B	0.28011	0.085;0.014	T	0.09596	-1.0667	10	0.34782	T	0.22	-26.2667	15.1834	0.72978	0.0:0.0:0.0:1.0	.	15;15	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	R	15	ENSP00000263956:K15R;ENSP00000386465:K15R	ENSP00000263956:K15R	K	-	2	0	GTF3C3	197372537	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.575000	0.53870	2.250000	0.74265	0.477000	0.44152	AAA	.	.		0.542	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
CASP8	841	hgsc.bcm.edu	37	2	202134252	202134252	+	Intron	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:202134252A>G	ENST00000432109.2	+	4	494				CASP8_ENST00000358485.4_Intron|CASP8_ENST00000323492.7_Intron|CASP8_ENST00000264274.9_Intron|CASP8_ENST00000392259.2_Intron|CASP8_ENST00000392266.3_Intron|CASP8_ENST00000392258.3_Intron|CASP8_ENST00000264275.5_Missense_Mutation_p.S109G	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase						activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						CTGCCGCATGAGCTGGGCTGA	0.502										HNSCC(4;0.00038)																											p.S109G	Melanoma(82;831 1348 20716 36952 40159)	Atlas-SNP	.											.	CASP8	272	.	0			c.A325G						.						65.0	67.0	66.0					2																	202134252		1908	4128	6036	SO:0001627	intron_variant	841	exon4			CGCATGAGCTGGG	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.306-1987A>G	chr2.hg19:g.202134252A>G		98.0	0.0		98.0	6.0	NM_001228	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	hg19	CCDS2342.1	.	.	.	.	.	.	.	.	.	.	A	8.347	0.830110	0.16749	.	.	ENSG00000064012	ENST00000264275	D	0.83250	-1.7	2.54	-3.27	0.05048	.	.	.	.	.	T	0.66117	0.2757	.	.	.	0.09310	N	0.999998	B	0.06786	0.001	B	0.08055	0.003	T	0.47328	-0.9126	8	0.27785	T	0.31	.	3.8432	0.08923	0.363:0.3948:0.2421:0.0	.	109	Q14790-4	.	G	109	ENSP00000264275:S109G	ENSP00000264275:S109G	S	+	1	0	CASP8	201842497	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.279000	0.08479	-0.772000	0.04602	0.421000	0.28195	AGC	.	.		0.502	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
GPR1	2825	hgsc.bcm.edu	37	2	207041288	207041288	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:207041288A>G	ENST00000407325.2	-	3	1046	c.684T>C	c.(682-684)tgT>tgC	p.C228C	GPR1_ENST00000437420.1_Silent_p.C228C	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	228					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)	p.C228C(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		TGAAGATGAGACACAAGTAGC	0.443																																					p.C228C		Atlas-SNP	.											GPR1,NS,carcinoma,0,1	GPR1	38	.	1	Substitution - coding silent(1)	kidney(1)	c.T684C						.						106.0	105.0	105.0					2																	207041288		2203	4300	6503	SO:0001819	synonymous_variant	2825	exon3			GATGAGACACAAG		CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.684T>C	chr2.hg19:g.207041288A>G		102.0	0.0		75.0	3.0	NM_001098199	A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Silent	SNP	ENST00000407325.2	hg19	CCDS2368.1																																																																																			.	.		0.443	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256394.2	NM_001098199	
PIKFYVE	200576	hgsc.bcm.edu	37	2	209217489	209217490	+	Missense_Mutation	DNP	GG	GG	TC	rs191717036		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:209217489_209217490GG>TC	ENST00000264380.4	+	39	5985_5986	c.5827_5828GG>TC	c.(5827-5829)GGg>TCg	p.G1943S		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1943	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TCTTTTCTACGGGAGAAAGATG	0.376																																					p.G1943W|p.G1943A		Atlas-SNP	.											.	PIKFYVE	223	.	0			c.G5827T|c.G5828C						.																																			SO:0001583	missense	200576	exon39			TTCTACGGGAGAA|TCTACGGGAGAAA	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	Exception_encountered	chr2.hg19:g.209217489_209217490delinsTC	ENSP00000264380:p.Gly1943Ser	67.0	0.0		53.0|54.0	15.0	NM_015040	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	hg19	CCDS2382.1																																																																																			.	G|1.000;A|0.000|.		0.376	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
MAP2	4133	hgsc.bcm.edu	37	2	210558811	210558811	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:210558811T>C	ENST00000360351.4	+	7	2423	c.1917T>C	c.(1915-1917)acT>acC	p.T639T	MAP2_ENST00000447185.1_Silent_p.T635T|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	639					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GGTACAGCACTCTCGCACAGA	0.443																																					p.T639T	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											.	MAP2	372	.	0			c.T1917C						.						60.0	59.0	59.0					2																	210558811		2203	4300	6503	SO:0001819	synonymous_variant	4133	exon7			CAGCACTCTCGCA		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.1917T>C	chr2.hg19:g.210558811T>C		114.0	0.0		94.0	4.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	hg19	CCDS2384.1																																																																																			.	.		0.443	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
MAP2	4133	hgsc.bcm.edu	37	2	210570348	210570348	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:210570348A>G	ENST00000360351.4	+	11	5135	c.4629A>G	c.(4627-4629)agA>agG	p.R1543R	MAP2_ENST00000447185.1_Silent_p.R1539R|MAP2_ENST00000392194.1_Silent_p.R187R|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000361559.4_Silent_p.R187R|MAP2_ENST00000199940.6_Silent_p.R244R	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1543					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R1543R(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CTCTCCCAAGACCTTCCTCCA	0.468																																					p.R1543R	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											MAP2_ENST00000199940,caecum,carcinoma,0,3	MAP2	372	.	1	Substitution - coding silent(1)	ovary(1)	c.A4629G						.						121.0	123.0	123.0					2																	210570348		2203	4300	6503	SO:0001819	synonymous_variant	4133	exon11			CCCAAGACCTTCC		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4629A>G	chr2.hg19:g.210570348A>G		105.0	0.0		91.0	5.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	hg19	CCDS2384.1																																																																																			.	.		0.468	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
CPS1	1373	hgsc.bcm.edu	37	2	211523405	211523405	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:211523405A>G	ENST00000233072.5	+	31	3945	c.3749A>G	c.(3748-3750)gAt>gGt	p.D1250G	CPS1_ENST00000430249.2_Missense_Mutation_p.D1256G|CPS1_ENST00000451903.2_Missense_Mutation_p.D799G	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1250	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AAAGGAAATGATGTCTTGGTA	0.438																																					p.D1256G		Atlas-SNP	.											.	CPS1	485	.	0			c.A3767G						.						101.0	93.0	95.0					2																	211523405		2203	4300	6503	SO:0001583	missense	1373	exon32			GAAATGATGTCTT	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3749A>G	chr2.hg19:g.211523405A>G	ENSP00000233072:p.Asp1250Gly	121.0	0.0		91.0	4.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	hg19	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.139075	0.56936	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97303	-4.33;-4.33;-4.33	5.76	4.6	0.57074	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.145114	0.64402	D	0.000011	D	0.97077	0.9045	M	0.85945	2.785	0.43267	D	0.995213	B;B	0.33883	0.43;0.43	B;B	0.40982	0.345;0.345	D	0.96161	0.9115	10	0.87932	D	0	-14.2383	11.5602	0.50772	0.9302:0.0:0.0698:0.0	.	1260;1250	Q59HF8;P31327	.;CPSM_HUMAN	G	1256;1258;1250;799	ENSP00000402608:D1256G;ENSP00000233072:D1250G;ENSP00000406136:D799G	ENSP00000233072:D1250G	D	+	2	0	CPS1	211231650	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	8.625000	0.90965	0.995000	0.38917	0.460000	0.39030	GAT	.	.		0.438	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
PECR	55825	hgsc.bcm.edu	37	2	216904018	216904018	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:216904018T>C	ENST00000265322.7	-	8	966	c.892A>G	c.(892-894)Aag>Gag	p.K298E		NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	298					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	GCTTTCTCCTTAAAGGTCTCC	0.453																																					p.K298E		Atlas-SNP	.											.	PECR	22	.	0			c.A892G						.						151.0	148.0	149.0					2																	216904018		2203	4300	6503	SO:0001583	missense	55825	exon8			TCTCCTTAAAGGT	AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.892A>G	chr2.hg19:g.216904018T>C	ENSP00000265322:p.Lys298Glu	89.0	0.0		100.0	4.0	NM_018441	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Missense_Mutation	SNP	ENST00000265322.7	hg19	CCDS33375.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.028975	0.35797	.	.	ENSG00000115425	ENST00000265322	D	0.83755	-1.76	4.59	3.46	0.39613	.	0.592548	0.18550	N	0.137922	T	0.65709	0.2717	N	0.17082	0.46	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.10450	0.002;0.005	T	0.47275	-0.9130	10	0.18276	T	0.48	.	6.2887	0.21047	0.0:0.1097:0.0:0.8903	.	298;152	Q9BY49;Q9BY49-2	PECR_HUMAN;.	E	298	ENSP00000265322:K298E	ENSP00000265322:K298E	K	-	1	0	PECR	216612263	0.018000	0.18449	0.008000	0.14137	0.008000	0.06430	1.175000	0.31944	2.061000	0.61500	0.459000	0.35465	AAG	.	.		0.453	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1	NM_018441	
RESP18	389075	hgsc.bcm.edu	37	2	220194423	220194423	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:220194423C>A	ENST00000333527.5	-	4	400	c.401G>T	c.(400-402)aGa>aTa	p.R134I	RESP18_ENST00000392083.1_Missense_Mutation_p.R10I	NM_001007089.3	NP_001007090.3	Q5W5W9	RES18_HUMAN	regulated endocrine-specific protein 18	92					in utero embryonic development (GO:0001701)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|rough endoplasmic reticulum lumen (GO:0048237)|secretory granule (GO:0030141)				endometrium(1)|prostate(1)	2						GGGATGCAGTCTGCTGGCATG	0.522																																					p.R134I		Atlas-SNP	.											.	RESP18	13	.	0			c.G401T						.						146.0	125.0	131.0					2																	220194423		692	1591	2283	SO:0001583	missense	389075	exon4			TGCAGTCTGCTGG	AF437883	CCDS33382.2	2q35	2012-12-07	2012-12-07		ENSG00000182698	ENSG00000182698			33762	protein-coding gene	gene with protein product		612721	"""regulated endocrine-specific protein 18 homolog (rat)"""			17951542, 7988462	Standard	NM_001007089		Approved		uc002vlc.4	Q5W5W9	OTTHUMG00000150223	ENST00000333527.5:c.401G>T	chr2.hg19:g.220194423C>A	ENSP00000330269:p.Arg134Ile	150.0	0.0		145.0	44.0	NM_001007089	A8MQ49|Q38I23|Q5W5X0	Missense_Mutation	SNP	ENST00000333527.5	hg19	CCDS33382.2	.	.	.	.	.	.	.	.	.	.	C	11.65	1.700907	0.30142	.	.	ENSG00000182698	ENST00000392083;ENST00000333527	.	.	.	3.1	2.13	0.27403	.	0.192755	0.25792	N	0.028261	T	0.52933	0.1765	M	0.72894	2.215	0.26033	N	0.981717	D;D	0.67145	0.996;0.996	P;P	0.61592	0.891;0.891	T	0.42155	-0.9468	9	0.87932	D	0	.	5.3713	0.16140	0.0:0.8193:0.0:0.1807	.	134;74	Q5W5W9-2;Q5W5W9-3	.;.	I	10;134	.	ENSP00000330269:R134I	R	-	2	0	RESP18	219902667	0.032000	0.19561	0.199000	0.23439	0.321000	0.28281	0.674000	0.25218	0.751000	0.32900	0.313000	0.20887	AGA	.	.		0.522	RESP18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316885.1	NM_001007089	
SLC4A3	6508	hgsc.bcm.edu	37	2	220506390	220506390	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:220506390T>C	ENST00000358055.3	+	23	4151	c.3639T>C	c.(3637-3639)gcT>gcC	p.A1213A	SLC4A3_ENST00000273063.6_Silent_p.A1240A|SLC4A3_ENST00000373762.3_Silent_p.A1240A|SLC4A3_ENST00000373760.2_Silent_p.A1213A|SLC4A3_ENST00000317151.3_Silent_p.A1213A			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	1213	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGGAAGATGCTGAACCAAACT	0.567																																					p.A1240A		Atlas-SNP	.											.	SLC4A3	144	.	0			c.T3720C						.						178.0	130.0	146.0					2																	220506390		2203	4300	6503	SO:0001819	synonymous_variant	6508	exon23			AGATGCTGAACCA		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.3639T>C	chr2.hg19:g.220506390T>C		129.0	0.0		115.0	5.0	NM_201574	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	ENST00000358055.3	hg19	CCDS2445.1																																																																																			.	.		0.567	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
WDFY1	57590	hgsc.bcm.edu	37	2	224746759	224746759	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:224746759A>G	ENST00000233055.4	-	10	1066	c.964T>C	c.(964-966)Tgc>Cgc	p.C322R		NM_020830.3	NP_065881.1	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1	322						cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)	18		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		CACTTCCCGCAGACAGCCTGC	0.502																																					p.C322R		Atlas-SNP	.											.	WDFY1	46	.	0			c.T964C						.						184.0	188.0	187.0					2																	224746759		2203	4300	6503	SO:0001583	missense	57590	exon10			TCCCGCAGACAGC	AB037856	CCDS33387.1	2q36.2	2013-01-09	2003-03-13		ENSG00000085449	ENSG00000085449		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20451	protein-coding gene	gene with protein product			"""WD40 and FYVE domain containing 1"""			11739631	Standard	NM_020830		Approved	KIAA1435, FENS-1, WDF1, ZFYVE17	uc002vnq.3	Q8IWB7	OTTHUMG00000153370	ENST00000233055.4:c.964T>C	chr2.hg19:g.224746759A>G	ENSP00000233055:p.Cys322Arg	58.0	0.0		72.0	4.0	NM_020830	Q53S17|Q9H9D5|Q9P2B3	Missense_Mutation	SNP	ENST00000233055.4	hg19	CCDS33387.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.698483	0.88830	.	.	ENSG00000085449	ENST00000233055	D	0.93076	-3.16	5.9	5.9	0.94986	Zinc finger, RING/FYVE/PHD-type (1);WD40 repeat-like-containing domain (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.98194	0.9403	H	0.99475	4.585	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99929	1.1307	10	0.17369	T	0.5	-20.6731	16.3322	0.83039	1.0:0.0:0.0:0.0	.	322	Q8IWB7	WDFY1_HUMAN	R	322	ENSP00000233055:C322R	ENSP00000233055:C322R	C	-	1	0	WDFY1	224455003	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.958000	0.93099	2.251000	0.74343	0.528000	0.53228	TGC	.	.		0.502	WDFY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330908.1	NM_020830	
GPR55	9290	hgsc.bcm.edu	37	2	231775064	231775064	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:231775064A>G	ENST00000392040.1	-	2	806	c.614T>C	c.(613-615)aTc>aCc	p.I205T	GPR55_ENST00000392039.2_Missense_Mutation_p.I205T|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	205					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		CAGGATGTGGATGCTCCTGGA	0.602																																					p.I205T		Atlas-SNP	.											.	GPR55	46	.	0			c.T614C						.						76.0	82.0	80.0					2																	231775064		2203	4300	6503	SO:0001583	missense	9290	exon2			ATGTGGATGCTCC	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.614T>C	chr2.hg19:g.231775064A>G	ENSP00000375894:p.Ile205Thr	96.0	0.0		92.0	5.0	NM_005683	Q8N580	Missense_Mutation	SNP	ENST00000392040.1	hg19	CCDS2480.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163116	0.78226	.	.	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	T;T;T	0.40225	1.04;1.04;1.04	5.38	5.38	0.77491	GPCR, rhodopsin-like superfamily (1);	0.049335	0.85682	D	0.000000	T	0.60805	0.2297	M	0.78344	2.41	0.44635	D	0.997614	D	0.59357	0.985	P	0.60345	0.873	T	0.63225	-0.6685	10	0.44086	T	0.13	-29.4351	13.3386	0.60533	1.0:0.0:0.0:0.0	.	205	Q9Y2T6	GPR55_HUMAN	T	205	ENSP00000375894:I205T;ENSP00000375893:I205T;ENSP00000412768:I205T	ENSP00000375893:I205T	I	-	2	0	GPR55	231483308	1.000000	0.71417	0.233000	0.24025	0.955000	0.61496	7.414000	0.80117	2.025000	0.59659	0.459000	0.35465	ATC	.	.		0.602	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683	
NMUR1	10316	hgsc.bcm.edu	37	2	232392897	232392897	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:232392897A>G	ENST00000305141.4	-	2	968	c.835T>C	c.(835-837)Tcc>Ccc	p.S279P		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	279					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTGTATCTGGACCTGGCTGCT	0.637																																					p.S279P		Atlas-SNP	.											.	NMUR1	46	.	0			c.T835C						.						46.0	46.0	46.0					2																	232392897		2203	4300	6503	SO:0001583	missense	10316	exon2			ATCTGGACCTGGC	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.835T>C	chr2.hg19:g.232392897A>G	ENSP00000305877:p.Ser279Pro	86.0	0.0		74.0	5.0	NM_006056	O43664|Q7LDP6|Q8NE20	Missense_Mutation	SNP	ENST00000305141.4	hg19	CCDS2486.1	.	.	.	.	.	.	.	.	.	.	A	8.663	0.901073	0.17760	.	.	ENSG00000171596	ENST00000305141	T	0.38401	1.14	2.75	-5.33	0.02713	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.20740	0.0499	L	0.45581	1.43	0.09310	N	1	P	0.39157	0.662	B	0.33392	0.163	T	0.09465	-1.0673	9	0.30078	T	0.28	.	3.6817	0.08313	0.5167:0.2307:0.0:0.2525	.	279	Q9HB89	NMUR1_HUMAN	P	279	ENSP00000305877:S279P	ENSP00000305877:S279P	S	-	1	0	NMUR1	232101141	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-1.048000	0.03517	-1.146000	0.02854	0.374000	0.22700	TCC	.	.		0.637	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
C2orf57	165100	hgsc.bcm.edu	37	2	232458839	232458839	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:232458839A>G	ENST00000313965.2	+	1	1265	c.1177A>G	c.(1177-1179)Aac>Gac	p.N393D		NM_152614.2	NP_689827.2	Q53QW1	CB057_HUMAN	chromosome 2 open reading frame 57	393										endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	19		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		GGCTGACCCCAACTATGATTA	0.647																																					p.N393D		Atlas-SNP	.											.	C2orf57	35	.	0			c.A1177G						.						26.0	25.0	26.0					2																	232458839		2201	4299	6500	SO:0001583	missense	165100	exon1			GACCCCAACTATG	BC034405	CCDS2487.1	2q37.1	2008-02-05			ENSG00000177673	ENSG00000177673			28563	protein-coding gene	gene with protein product						12477932	Standard	NM_152614		Approved	MGC35154	uc002vrz.3	Q53QW1	OTTHUMG00000133226	ENST00000313965.2:c.1177A>G	chr2.hg19:g.232458839A>G	ENSP00000315557:p.Asn393Asp	84.0	0.0		100.0	4.0	NM_152614	Q8N4F2	Missense_Mutation	SNP	ENST00000313965.2	hg19	CCDS2487.1	.	.	.	.	.	.	.	.	.	.	A	12.56	1.975392	0.34848	.	.	ENSG00000177673	ENST00000313965	T	0.19938	2.11	4.92	-0.295	0.12828	.	.	.	.	.	T	0.12603	0.0306	L	0.29908	0.895	0.09310	N	1	B	0.31459	0.324	B	0.30179	0.112	T	0.25950	-1.0117	9	0.54805	T	0.06	.	3.5746	0.07930	0.5646:0.0:0.2752:0.1602	.	393	Q53QW1	CB057_HUMAN	D	393	ENSP00000315557:N393D	ENSP00000315557:N393D	N	+	1	0	C2orf57	232167083	0.000000	0.05858	0.001000	0.08648	0.163000	0.22366	-0.022000	0.12480	0.056000	0.16144	0.455000	0.32223	AAC	.	.		0.647	C2orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256962.1	NM_152614	
ECEL1	9427	hgsc.bcm.edu	37	2	233344956	233344956	+	Silent	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:233344956C>A	ENST00000304546.1	-	18	2445	c.2235G>T	c.(2233-2235)ctG>ctT	p.L745L	ECEL1_ENST00000409941.1_Silent_p.L743L	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	745					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		ACACACTGCCCAGCACCCTGG	0.617																																					p.L745L		Atlas-SNP	.											.	ECEL1	73	.	0			c.G2235T						.						74.0	61.0	65.0					2																	233344956		2203	4300	6503	SO:0001819	synonymous_variant	9427	exon18			ACTGCCCAGCACC	Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.2235G>T	chr2.hg19:g.233344956C>A		143.0	0.0		102.0	49.0	NM_004826	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Silent	SNP	ENST00000304546.1	hg19	CCDS2493.1																																																																																			.	.		0.617	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257039.2	NM_004826	
NEU2	4759	hgsc.bcm.edu	37	2	233898881	233898881	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:233898881A>G	ENST00000233840.3	+	2	257	c.257A>G	c.(256-258)aAc>aGc	p.N86S		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	86					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	CGGTCCATGAACCCATGCCCC	0.612																																					p.N86S		Atlas-SNP	.											.	NEU2	42	.	0			c.A257G						.						120.0	101.0	108.0					2																	233898881		2203	4300	6503	SO:0001583	missense	4759	exon2			CCATGAACCCATG	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.257A>G	chr2.hg19:g.233898881A>G	ENSP00000233840:p.Asn86Ser	119.0	0.0		107.0	5.0	NM_005383	Q3KNW4|Q6NTB4	Missense_Mutation	SNP	ENST00000233840.3	hg19	CCDS2501.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.999122	0.54147	.	.	ENSG00000115488	ENST00000233840	D	0.92397	-3.03	4.88	3.74	0.42951	Neuraminidase (2);	0.083507	0.51477	D	0.000096	D	0.93070	0.7794	L	0.55103	1.725	0.44736	D	0.997735	D	0.58970	0.984	P	0.62089	0.898	D	0.92618	0.6105	10	0.59425	D	0.04	-48.0065	9.1916	0.37202	0.9143:0.0:0.0857:0.0	.	86	Q9Y3R4	NEUR2_HUMAN	S	86	ENSP00000233840:N86S	ENSP00000233840:N86S	N	+	2	0	NEU2	233607125	1.000000	0.71417	1.000000	0.80357	0.239000	0.25481	5.054000	0.64275	1.821000	0.53095	0.459000	0.35465	AAC	.	.		0.612	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383	
HJURP	55355	hgsc.bcm.edu	37	2	234756078	234756078	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:234756078A>G	ENST00000411486.2	-	5	432	c.367T>C	c.(367-369)Tca>Cca	p.S123P	HJURP_ENST00000432087.1_Intron|HJURP_ENST00000434039.1_5'Flank|HJURP_ENST00000441687.1_Intron	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	123					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TCCTGGTCTGACGTGGCATCG	0.478																																					p.S123P		Atlas-SNP	.											.	HJURP	72	.	0			c.T367C						.						117.0	100.0	106.0					2																	234756078		2203	4300	6503	SO:0001583	missense	55355	exon5			GGTCTGACGTGGC		CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.367T>C	chr2.hg19:g.234756078A>G	ENSP00000414109:p.Ser123Pro	164.0	0.0		134.0	6.0	NM_018410	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	ENST00000411486.2	hg19	CCDS33406.1	.	.	.	.	.	.	.	.	.	.	A	5.107	0.205451	0.09704	.	.	ENSG00000123485	ENST00000411486;ENST00000454020	T;T	0.32988	3.21;1.43	3.14	-2.97	0.05530	.	5.373250	0.00166	N	0.000013	T	0.22475	0.0542	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07328	-1.0778	10	0.28530	T	0.3	5.0109	1.6263	0.02724	0.2501:0.4445:0.1342:0.1712	.	123	Q8NCD3	HJURP_HUMAN	P	123;82	ENSP00000414109:S123P;ENSP00000414051:S82P	ENSP00000414109:S123P	S	-	1	0	HJURP	234420817	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.274000	0.08537	-0.587000	0.05890	0.533000	0.62120	TCA	.	.		0.478	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	NM_018410	
BHLHE40	8553	hgsc.bcm.edu	37	3	5025019	5025019	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:5025019T>C	ENST00000256495.3	+	5	1484	c.881T>C	c.(880-882)cTt>cCt	p.L294P		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	294					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						CGGATGCAGCTTTCGGATGAT	0.547																																					p.L294P		Atlas-SNP	.											.	BHLHE40	35	.	0			c.T881C						.						103.0	97.0	99.0					3																	5025019		2203	4300	6503	SO:0001583	missense	8553	exon5			TGCAGCTTTCGGA	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.881T>C	chr3.hg19:g.5025019T>C	ENSP00000256495:p.Leu294Pro	95.0	0.0		83.0	5.0	NM_003670	Q96TD3	Missense_Mutation	SNP	ENST00000256495.3	hg19	CCDS2565.1	.	.	.	.	.	.	.	.	.	.	T	2.778	-0.254100	0.05829	.	.	ENSG00000134107	ENST00000256495	T	0.42131	0.98	5.62	3.09	0.35607	.	2.530130	0.02512	N	0.091610	T	0.31606	0.0802	N	0.22421	0.69	0.20403	N	0.99991	B	0.06786	0.001	B	0.06405	0.002	T	0.16958	-1.0385	10	0.36615	T	0.2	-10.7409	5.6528	0.17627	0.0:0.2083:0.1334:0.6584	.	294	O14503	BHE40_HUMAN	P	294	ENSP00000256495:L294P	ENSP00000256495:L294P	L	+	2	0	BHLHE40	5000019	0.511000	0.26179	0.379000	0.26080	0.163000	0.22366	2.540000	0.45727	0.354000	0.24105	0.533000	0.62120	CTT	.	.		0.547	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
SETD5	55209	hgsc.bcm.edu	37	3	9517690	9517690	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:9517690C>G	ENST00000406341.1	+	22	4434	c.4244C>G	c.(4243-4245)cCa>cGa	p.P1415R	SETD5_ENST00000407969.1_Missense_Mutation_p.P1434R|SETD5_ENST00000402198.1_Missense_Mutation_p.P1415R|SETD5_ENST00000402466.1_Missense_Mutation_p.P1317R|SETD5_ENST00000302463.6_Missense_Mutation_p.P1317R			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1415								p.P1415Q(1)|p.P1317Q(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CAGCACTACCCACACCGTGGG	0.572																																					p.P1415R		Atlas-SNP	.											.	SETD5	210	.	2	Substitution - Missense(2)	lung(2)	c.C4244G						.						44.0	43.0	44.0					3																	9517690		1970	4158	6128	SO:0001583	missense	55209	exon23			ACTACCCACACCG	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.4244C>G	chr3.hg19:g.9517690C>G	ENSP00000383939:p.Pro1415Arg	123.0	0.0		92.0	4.0	NM_001080517	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	ENST00000406341.1	hg19	CCDS46741.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319176	0.60524	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.92965	-2.81;-3.14;-2.81;-2.79;-3.14	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000002	D	0.92473	0.7610	N	0.14661	0.345	0.51482	D	0.999923	D;D;D	0.76494	0.999;0.999;0.994	D;D;P	0.83275	0.983;0.996;0.755	D	0.94247	0.7490	10	0.72032	D	0.01	-8.8772	18.5784	0.91163	0.0:1.0:0.0:0.0	.	1084;1317;1415	B3KXG4;Q9C0A6-3;Q9C0A6	.;.;SETD5_HUMAN	R	1415;1317;1415;1434;1317	ENSP00000385852:P1415R;ENSP00000384429:P1317R;ENSP00000383939:P1415R;ENSP00000384114:P1434R;ENSP00000302028:P1317R	ENSP00000302028:P1317R	P	+	2	0	SETD5	9492690	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	3.323000	0.52014	2.448000	0.82819	0.467000	0.42956	CCA	.	.		0.572	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318425.1	XM_371614	
IL17RE	132014	hgsc.bcm.edu	37	3	9944675	9944675	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:9944675T>C	ENST00000383814.3	+	1	164	c.59T>C	c.(58-60)cTc>cCc	p.L20P	IL17RE_ENST00000295980.3_Missense_Mutation_p.L20P|IL17RE_ENST00000421412.1_Missense_Mutation_p.L53P|IL17RE_ENST00000454190.2_Missense_Mutation_p.L20P	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E	20					inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		GTCATCGACCTCTCTGACTCT	0.617																																					p.L60P		Atlas-SNP	.											.	IL17RE	62	.	0			c.T179C						.						84.0	75.0	78.0					3																	9944675		2203	4300	6503	SO:0001583	missense	132014	exon2			TCGACCTCTCTGA	AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.59T>C	chr3.hg19:g.9944675T>C	ENSP00000373325:p.Leu20Pro	136.0	0.0		160.0	7.0	NM_153483	B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Missense_Mutation	SNP	ENST00000383814.3	hg19	CCDS2589.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660295	0.67586	.	.	ENSG00000163701	ENST00000421412;ENST00000295980;ENST00000383814;ENST00000454190;ENST00000454992	T;T;T;T	0.41065	1.05;1.09;1.09;1.01	5.17	5.17	0.71159	.	0.296788	0.23056	N	0.052422	T	0.57917	0.2086	L	0.59436	1.845	0.21841	N	0.999519	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.68765	0.943;0.943;0.96	T	0.53194	-0.8473	10	0.87932	D	0	-6.324	11.3942	0.49832	0.0:0.0:0.0:1.0	.	20;20;20	Q8NFR9-3;Q8NFR9-5;Q8NFR9	.;.;I17RE_HUMAN	P	53;20;20;20;20	ENSP00000404916:L53P;ENSP00000295980:L20P;ENSP00000373325:L20P;ENSP00000388086:L20P	ENSP00000295980:L20P	L	+	2	0	IL17RE	9919675	0.071000	0.21146	0.008000	0.14137	0.028000	0.11728	2.249000	0.43169	1.948000	0.56530	0.533000	0.62120	CTC	.	.		0.617	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250529.1	NM_153480	
C3orf20	84077	hgsc.bcm.edu	37	3	14724660	14724660	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:14724660A>G	ENST00000253697.3	+	3	892	c.440A>G	c.(439-441)gAg>gGg	p.E147G	C3orf20_ENST00000412910.1_Missense_Mutation_p.E25G|C3orf20_ENST00000435614.1_Missense_Mutation_p.E25G	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	147						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						CTGCTGACGGAGCTCCTCAGA	0.602																																					p.E147G		Atlas-SNP	.											.	C3orf20	109	.	0			c.A440G						.						92.0	85.0	88.0					3																	14724660		2203	4300	6503	SO:0001583	missense	84077	exon3			TGACGGAGCTCCT	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.440A>G	chr3.hg19:g.14724660A>G	ENSP00000253697:p.Glu147Gly	109.0	0.0		118.0	5.0	NM_032137	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	hg19	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.094674	0.76870	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.19669	2.43;2.13;2.13	4.93	4.93	0.64822	.	0.000000	0.44902	D	0.000408	T	0.35307	0.0927	L	0.36672	1.1	0.39811	D	0.972704	D	0.89917	1.0	D	0.87578	0.998	T	0.20042	-1.0287	10	0.87932	D	0	-33.9103	12.1238	0.53905	1.0:0.0:0.0:0.0	.	147	Q8ND61	CC020_HUMAN	G	147;25;25	ENSP00000253697:E147G;ENSP00000402933:E25G;ENSP00000396081:E25G	ENSP00000253697:E147G	E	+	2	0	C3orf20	14699664	1.000000	0.71417	0.857000	0.33713	0.913000	0.54294	4.731000	0.62022	1.858000	0.53909	0.482000	0.46254	GAG	.	.		0.602	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
FGD5	152273	hgsc.bcm.edu	37	3	14862587	14862587	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:14862587A>G	ENST00000285046.5	+	1	2119	c.2009A>G	c.(2008-2010)cAt>cGt	p.H670R	FGD5_ENST00000543601.1_Missense_Mutation_p.H429R	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	670					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AACAAATTGCATGTGGATGTG	0.512																																					p.H670R		Atlas-SNP	.											.	FGD5	248	.	0			c.A2009G						.						79.0	78.0	78.0					3																	14862587		1976	4174	6150	SO:0001583	missense	152273	exon1			AATTGCATGTGGA	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.2009A>G	chr3.hg19:g.14862587A>G	ENSP00000285046:p.His670Arg	148.0	0.0		123.0	5.0	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	hg19	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	A	4.077	0.012113	0.07912	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.76448	-1.02;-0.83	5.32	4.15	0.48705	.	0.000000	0.64402	D	0.000013	T	0.68513	0.3009	L	0.55481	1.735	0.23611	N	0.99729	P;P	0.40834	0.553;0.73	B;B	0.32533	0.109;0.147	T	0.59085	-0.7520	10	0.36615	T	0.2	-24.7629	11.6535	0.51304	0.8671:0.0:0.0:0.1329	.	429;670	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	R	670;429	ENSP00000285046:H670R;ENSP00000445949:H429R	ENSP00000285046:H670R	H	+	2	0	FGD5	14837591	0.969000	0.33509	0.054000	0.19295	0.001000	0.01503	3.642000	0.54367	0.842000	0.35045	-0.327000	0.08410	CAT	.	.		0.512	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
CNOT10	25904	hgsc.bcm.edu	37	3	32811404	32811404	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:32811404A>G	ENST00000328834.5	+	18	2346	c.2030A>G	c.(2029-2031)gAg>gGg	p.E677G	CNOT10_ENST00000331889.6_Missense_Mutation_p.E650G|CNOT10_ENST00000454516.2_Missense_Mutation_p.E737G	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	677					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						CATCCTAAAGAGGTGCCCCCT	0.453																																					p.E737G		Atlas-SNP	.											.	CNOT10	57	.	0			c.A2210G						.						126.0	127.0	127.0					3																	32811404		2203	4300	6503	SO:0001583	missense	25904	exon18			CTAAAGAGGTGCC	BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.2030A>G	chr3.hg19:g.32811404A>G	ENSP00000330060:p.Glu677Gly	93.0	0.0		82.0	4.0	NM_001256742	B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	ENST00000328834.5	hg19	CCDS2655.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.985415	0.93044	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000454516;ENST00000430408	T;T;T	0.29397	1.57;1.57;1.57	5.52	5.52	0.82312	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.48333	0.1494	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.63880	0.98;0.974;0.993;0.979	P;P;D;P	0.63033	0.718;0.736;0.91;0.628	T	0.38308	-0.9667	10	0.39692	T	0.17	-22.7079	15.6346	0.76941	1.0:0.0:0.0:0.0	.	737;650;676;677	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	G	650;677;737;212	ENSP00000329376:E650G;ENSP00000330060:E677G;ENSP00000399862:E737G	ENSP00000330060:E677G	E	+	2	0	CNOT10	32786408	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	9.339000	0.96797	2.093000	0.63338	0.460000	0.39030	GAG	.	.		0.453	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253248.2	NM_015442	
TRANK1	9881	hgsc.bcm.edu	37	3	36874860	36874860	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:36874860G>C	ENST00000429976.2	-	21	6329	c.6082C>G	c.(6082-6084)Cag>Gag	p.Q2028E	TRANK1_ENST00000301807.6_Missense_Mutation_p.Q1478E|TRANK1_ENST00000428977.2_Missense_Mutation_p.Q1478E	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2028							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GCCTCACACTGGCTGGCTGCT	0.547																																					p.Q2028E		Atlas-SNP	.											.	TRANK1	398	.	0			c.C6082G						.						27.0	27.0	27.0					3																	36874860		1941	4150	6091	SO:0001583	missense	9881	exon21			CACACTGGCTGGC	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6082C>G	chr3.hg19:g.36874860G>C	ENSP00000416168:p.Gln2028Glu	87.0	0.0		99.0	4.0	NM_014831	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	hg19	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	G	6.513	0.462928	0.12402	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.28895	1.59;2.01;1.59	4.5	4.5	0.54988	.	0.906562	0.09217	N	0.832386	T	0.17023	0.0409	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.14023	0.01	T	0.05289	-1.0894	10	0.36615	T	0.2	.	8.6352	0.33943	0.1027:0.0:0.8973:0.0	.	2028	O15050	TRNK1_HUMAN	E	1478;2028;1478	ENSP00000416826:Q1478E;ENSP00000416168:Q2028E;ENSP00000301807:Q1478E	ENSP00000301807:Q1478E	Q	-	1	0	TRANK1	36849864	0.010000	0.17322	0.549000	0.28204	0.801000	0.45260	1.711000	0.37930	2.496000	0.84212	0.555000	0.69702	CAG	.	.		0.547	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
MLH1	4292	hgsc.bcm.edu	37	3	37053518	37053518	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:37053518C>G	ENST00000231790.2	+	8	821	c.605C>G	c.(604-606)gCt>gGt	p.A202G	MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000455445.2_5'UTR|MLH1_ENST00000435176.1_Missense_Mutation_p.A104G	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	202					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						GAGACAGTAGCTGATGTTAGG	0.408		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.A202G		Atlas-SNP	.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1	226	.	1	Whole gene deletion(1)	ovary(1)	c.C605G						.						144.0	130.0	135.0					3																	37053518		2203	4300	6503	SO:0001583	missense	4292	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CAGTAGCTGATGT	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.605C>G	chr3.hg19:g.37053518C>G	ENSP00000231790:p.Ala202Gly	209.0	0.0		178.0	56.0	NM_000249	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	ENST00000231790.2	hg19	CCDS2663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.54|19.54	3.846296|3.846296	0.71603|0.71603	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937;ENST00000383761;ENST00000435176|ENST00000456676	T;T|.	0.81247|.	-1.47;-1.47|.	5.76|5.76	5.76|5.76	0.90799|0.90799	Ribosomal protein S5 domain 2-type fold (1);DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (2);|.	0.173869|.	0.49305|.	D|.	0.000145|.	T|T	0.78799|0.78799	0.4340|0.4340	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	P;B;B|.	0.38455|.	0.632;0.275;0.151|.	B;B;B|.	0.41946|.	0.371;0.24;0.185|.	T|T	0.77656|0.77656	-0.2506|-0.2506	10|5	0.25751|.	T|.	0.34|.	-7.6496|-7.6496	19.9576|19.9576	0.97228|0.97228	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	104;202;202|.	E9PCU2;Q53GX1;P40692|.	.;.;MLH1_HUMAN|.	G|V	202;168;168;66;104|194	ENSP00000231790:A202G;ENSP00000402564:A104G|.	ENSP00000231790:A202G|.	A|L	+|+	2|1	0|2	MLH1|MLH1	37028522|37028522	1.000000|1.000000	0.71417|0.71417	0.437000|0.437000	0.26809|0.26809	0.769000|0.769000	0.43574|0.43574	7.417000|7.417000	0.80156|0.80156	2.736000|2.736000	0.93811|0.93811	0.655000|0.655000	0.94253|0.94253	GCT|CTG	.	.		0.408	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
PLCD1	5333	hgsc.bcm.edu	37	3	38049787	38049787	+	Silent	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:38049787C>A	ENST00000334661.4	-	13	2196	c.1974G>T	c.(1972-1974)gtG>gtT	p.V658V	PLCD1_ENST00000479619.1_5'Flank|PLCD1_ENST00000463876.1_Silent_p.V679V	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	658	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CATGGATCTCCACTGTCACTT	0.557																																					p.V679V		Atlas-SNP	.											.	PLCD1	87	.	0			c.G2037T						.						93.0	98.0	96.0					3																	38049787		2203	4300	6503	SO:0001819	synonymous_variant	5333	exon13			GATCTCCACTGTC		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.1974G>T	chr3.hg19:g.38049787C>A		133.0	0.0		79.0	4.0	NM_001130964	B3KR14|Q86VN8	Silent	SNP	ENST00000334661.4	hg19	CCDS2671.1																																																																																			.	.		0.557	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
SCN5A	6331	hgsc.bcm.edu	37	3	38640487	38640487	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:38640487A>G	ENST00000333535.4	-	13	2094	c.1945T>C	c.(1945-1947)Tgt>Cgt	p.C649R	SCN5A_ENST00000449557.2_Missense_Mutation_p.C649R|SCN5A_ENST00000443581.1_Missense_Mutation_p.C649R|SCN5A_ENST00000414099.2_Missense_Mutation_p.C649R|SCN5A_ENST00000425664.1_Missense_Mutation_p.C649R|SCN5A_ENST00000450102.2_Missense_Mutation_p.C649R|SCN5A_ENST00000451551.2_Missense_Mutation_p.C649R|SCN5A_ENST00000413689.1_Missense_Mutation_p.C649R|SCN5A_ENST00000423572.2_Missense_Mutation_p.C649R|SCN5A_ENST00000455624.2_Missense_Mutation_p.C649R			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	649					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CCATCTACACACGGAGCCTGG	0.632																																					p.C649R		Atlas-SNP	.											.	SCN5A	634	.	0			c.T1945C						.						33.0	40.0	38.0					3																	38640487		2186	4284	6470	SO:0001583	missense	6331	exon13			CTACACACGGAGC	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.1945T>C	chr3.hg19:g.38640487A>G	ENSP00000328968:p.Cys649Arg	78.0	0.0		84.0	4.0	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	hg19	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	A	7.281	0.609018	0.14066	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.90133	-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62;-2.62	3.97	1.32	0.21799	Domain of unknown function DUF3451 (1);	0.665356	0.14237	N	0.332336	D	0.83510	0.5270	N	0.22421	0.69	0.28086	N	0.932019	B;B;B;B;B;B;B	0.33477	0.023;0.116;0.144;0.18;0.174;0.413;0.09	B;B;B;B;B;B;B	0.35073	0.079;0.113;0.146;0.079;0.175;0.195;0.048	T	0.75187	-0.3406	10	0.66056	D	0.02	.	10.1617	0.42855	0.6777:0.3223:0.0:0.0	.	649;649;649;649;649;649;649	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	R	649	ENSP00000398962:C649R;ENSP00000398266:C649R;ENSP00000410257:C649R;ENSP00000388797:C649R;ENSP00000397915:C649R;ENSP00000416634:C649R;ENSP00000328968:C649R;ENSP00000399524:C649R;ENSP00000403355:C649R;ENSP00000413996:C649R	ENSP00000328968:C649R	C	-	1	0	SCN5A	38615491	0.706000	0.27856	0.013000	0.15412	0.008000	0.06430	2.290000	0.43531	0.085000	0.17107	0.459000	0.35465	TGT	.	.		0.632	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
SCN10A	6336	hgsc.bcm.edu	37	3	38812863	38812863	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:38812863A>G	ENST00000449082.2	-	4	505	c.506T>C	c.(505-507)tTg>tCg	p.L169S		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	169					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TATCTTTATCAAGGCTTCAAA	0.453																																					p.L169S		Atlas-SNP	.											.	SCN10A	359	.	0			c.T506C						.						125.0	123.0	124.0					3																	38812863		2203	4300	6503	SO:0001583	missense	6336	exon4			TTTATCAAGGCTT	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.506T>C	chr3.hg19:g.38812863A>G	ENSP00000390600:p.Leu169Ser	103.0	0.0		90.0	5.0	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	hg19	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	A	13.19	2.163203	0.38217	.	.	ENSG00000185313	ENST00000449082	D	0.98901	-5.22	5.15	4.0	0.46444	Ion transport (1);	0.186924	0.23656	N	0.045865	D	0.97990	0.9338	M	0.87328	2.875	0.19945	N	0.999949	B	0.20368	0.044	B	0.24701	0.055	D	0.95523	0.8596	10	0.72032	D	0.01	.	10.782	0.46384	0.9249:0.0:0.0751:0.0	.	169	Q9Y5Y9	SCNAA_HUMAN	S	169	ENSP00000390600:L169S	ENSP00000390600:L169S	L	-	2	0	SCN10A	38787867	0.402000	0.25311	0.977000	0.42913	0.919000	0.55068	3.116000	0.50399	0.970000	0.38263	-0.274000	0.10170	TTG	.	.		0.453	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
USP19	10869	hgsc.bcm.edu	37	3	49149789	49149789	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:49149789T>C	ENST00000398888.2	-	18	2702	c.2384A>G	c.(2383-2385)cAg>cGg	p.Q795R	USP19_ENST00000398896.1_Missense_Mutation_p.Q603R|USP19_ENST00000417901.1_Missense_Mutation_p.Q898R|USP19_ENST00000453664.1_Missense_Mutation_p.Q886R|USP19_ENST00000434032.2_Missense_Mutation_p.Q896R|USP19_ENST00000398898.2_Missense_Mutation_p.Q835R|USP19_ENST00000398892.3_Missense_Mutation_p.Q835R	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	795	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTGCTTCCGCTGGCAGGCTGC	0.637																																					p.Q898R		Atlas-SNP	.											.	USP19	158	.	0			c.A2693G						.						48.0	55.0	53.0					3																	49149789		2062	4206	6268	SO:0001583	missense	10869	exon19			TTCCGCTGGCAGG	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.2384A>G	chr3.hg19:g.49149789T>C	ENSP00000381863:p.Gln795Arg	109.0	0.0		119.0	5.0	NM_001199161	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	hg19	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	T	18.34	3.603235	0.66445	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032	T;T;T;T;T;T;T	0.20332	2.11;2.08;2.18;2.18;2.08;2.21;2.18	5.8	5.8	0.92144	Zinc finger, MYND-type (3);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.177194	0.51477	D	0.000086	T	0.35393	0.0930	L	0.33485	1.01	0.43018	D	0.994561	D;D;D;D;D	0.76494	0.999;0.999;0.997;0.994;0.995	D;D;D;D;P	0.76575	0.967;0.967;0.95;0.988;0.874	T	0.04522	-1.0945	10	0.33141	T	0.24	-23.4359	15.8026	0.78468	0.0:0.0:0.0:1.0	.	896;886;795;835;603	E9PEG8;E7EN22;O94966;B5MEG5;E7ESU0	.;.;UBP19_HUMAN;.;.	R	603;835;898;886;835;795;896	ENSP00000381870:Q603R;ENSP00000381872:Q835R;ENSP00000395260:Q898R;ENSP00000400090:Q886R;ENSP00000381867:Q835R;ENSP00000381863:Q795R;ENSP00000401197:Q896R	ENSP00000381863:Q795R	Q	-	2	0	USP19	49124793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.585000	0.46111	2.211000	0.71520	0.459000	0.35465	CAG	.	.		0.637	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
LAMB2	3913	hgsc.bcm.edu	37	3	49169091	49169091	+	Silent	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:49169091G>A	ENST00000418109.1	-	6	689	c.525C>T	c.(523-525)taC>taT	p.Y175Y	LAMB2_ENST00000305544.4_Silent_p.Y175Y	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	175	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGAAATATCGGTACACATGCC	0.582																																					p.Y175Y		Atlas-SNP	.											.	LAMB2	156	.	0			c.C525T						.						87.0	91.0	90.0					3																	49169091		2203	4300	6503	SO:0001819	synonymous_variant	3913	exon5			ATATCGGTACACA		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.525C>T	chr3.hg19:g.49169091G>A		68.0	0.0		92.0	5.0	NM_002292	Q16321	Silent	SNP	ENST00000418109.1	hg19	CCDS2789.1																																																																																			.	.		0.582	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
IP6K1	9807	hgsc.bcm.edu	37	3	49775655	49775655	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:49775655T>C	ENST00000321599.4	-	3	725	c.424A>G	c.(424-426)Acc>Gcc	p.T142A	IP6K1_ENST00000468463.1_Missense_Mutation_p.T142A|IP6K1_ENST00000460540.1_5'UTR|IP6K1_ENST00000395238.1_5'UTR	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	142					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						CTCTCAGAGGTCTCAAGGGAC	0.577																																					p.T142A		Atlas-SNP	.											.	IP6K1	41	.	0			c.A424G						.						127.0	105.0	112.0					3																	49775655		2203	4300	6503	SO:0001583	missense	9807	exon3			CAGAGGTCTCAAG	D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.424A>G	chr3.hg19:g.49775655T>C	ENSP00000323780:p.Thr142Ala	118.0	0.0		120.0	5.0	NM_153273	A8K157|A8MUX4|Q7L3I7|Q96E38	Missense_Mutation	SNP	ENST00000321599.4	hg19	CCDS33760.1	.	.	.	.	.	.	.	.	.	.	T	5.005	0.186671	0.09547	.	.	ENSG00000176095	ENST00000321599;ENST00000468463	T;T	0.61392	0.11;0.11	5.93	0.582	0.17412	.	0.463132	0.24291	N	0.039815	T	0.32164	0.0820	L	0.29908	0.895	0.34560	D	0.712236	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18967	-1.0320	10	0.07813	T	0.8	-5.7755	1.9413	0.03347	0.1195:0.1404:0.2483:0.4917	.	142;142	C9JNA8;Q92551	.;IP6K1_HUMAN	A	142	ENSP00000323780:T142A;ENSP00000420467:T142A	ENSP00000323780:T142A	T	-	1	0	IP6K1	49750659	0.409000	0.25368	0.210000	0.23637	0.843000	0.47879	-0.020000	0.12525	-0.112000	0.11979	0.460000	0.39030	ACC	.	.		0.577	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1	NM_153273	
TUSC2	11334	hgsc.bcm.edu	37	3	50368106	50368106	+	5'Flank	SNP	C	C	G	rs142957899		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:50368106C>G	ENST00000232496.4	-	0	0				RASSF1_ENST00000357043.2_Missense_Mutation_p.R314P|RASSF1_ENST00000395126.3_Missense_Mutation_p.R159P|RASSF1_ENST00000359365.4_Missense_Mutation_p.R310P|TUSC2_ENST00000462137.1_5'Flank|RASSF1_ENST00000327761.3_Missense_Mutation_p.R240P	NM_007275.1	NP_009206.1	O75896	TUSC2_HUMAN	tumor suppressor candidate 2						cell cycle (GO:0007049)|cell maturation (GO:0048469)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|chemokine (C-C motif) ligand 5 production (GO:0071609)|inflammatory response (GO:0006954)|interleukin-15 production (GO:0032618)|natural killer cell differentiation (GO:0001779)|negative regulation of interleukin-17 production (GO:0032700)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)|phagocytosis (GO:0006909)|positive regulation of interleukin-10 production (GO:0032733)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to defense-related host reactive oxygen species production (GO:0052567)	mitochondrion (GO:0005739)				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTCCTCCTCCCGCTGCAGGAT	0.587																																					p.R314P		Atlas-SNP	.											.	RASSF1	46	.	0			c.G941C						.						103.0	92.0	95.0					3																	50368106		2203	4300	6503	SO:0001631	upstream_gene_variant	11186	exon6			TCCTCCCGCTGCA	AF055479	CCDS2819.1	3p21.3	2010-09-21	2004-01-20	2004-01-21	ENSG00000114383	ENSG00000114383			17034	protein-coding gene	gene with protein product		607052	"""PDGFA associated protein 2"""	PDAP2		8780057, 11593436	Standard	NM_007275		Approved	FUS1, PAP, C3orf11	uc003czy.1	O75896	OTTHUMG00000156877		chr3.hg19:g.50368106C>G	Exception_encountered	79.0	0.0		60.0	12.0	NM_170714	B2R4Y9	Missense_Mutation	SNP	ENST00000232496.4	hg19	CCDS2819.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613182	0.87359	.	.	ENSG00000068028	ENST00000327761;ENST00000395126;ENST00000357043;ENST00000359365	T;T;T;T	0.77750	2.65;2.18;-1.12;-1.12	5.49	5.49	0.81192	SARAH (1);	0.000000	0.85682	D	0.000000	D	0.87822	0.6274	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.995	D;D;P	0.97110	0.987;1.0;0.905	D	0.88382	0.3002	10	0.72032	D	0.01	-30.2568	18.3174	0.90226	0.0:1.0:0.0:0.0	.	310;314;240	Q9NS23-2;Q9NS23;Q5TZT2	.;RASF1_HUMAN;.	P	240;159;314;310	ENSP00000333327:R240P;ENSP00000378558:R159P;ENSP00000349547:R314P;ENSP00000352323:R310P	ENSP00000333327:R240P	R	-	2	0	RASSF1	50343110	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	3.852000	0.55934	2.735000	0.93741	0.563000	0.77884	CGG	.	C|1.000;T|0.000		0.587	TUSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346399.1	NM_007275	
DNAH1	25981	hgsc.bcm.edu	37	3	52429610	52429610	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:52429610A>G	ENST00000420323.2	+	70	11436	c.11175A>G	c.(11173-11175)aaA>aaG	p.K3725K		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3790	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGAGGGGCAAATGGGTCTTCT	0.637																																					p.K3725K		Atlas-SNP	.											.	DNAH1	534	.	0			c.A11175G						.						57.0	64.0	61.0					3																	52429610		2073	4242	6315	SO:0001819	synonymous_variant	25981	exon70			GGGCAAATGGGTC	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.11175A>G	chr3.hg19:g.52429610A>G		126.0	0.0		93.0	4.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	hg19	CCDS46842.1																																																																																			.	.		0.637	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
CACNA1D	776	hgsc.bcm.edu	37	3	53839136	53839136	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:53839136A>G	ENST00000350061.5	+	45	6223	c.5712A>G	c.(5710-5712)agA>agG	p.R1904R	CACNA1D_ENST00000422281.2_Silent_p.R1880R|CACNA1D_ENST00000544977.1_Silent_p.R283R|CACNA1D_ENST00000288139.4_Silent_p.R1924R	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1904					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATTCACGGAGATCTCCAAGGA	0.562																																					p.R1924R		Atlas-SNP	.											.	CACNA1D	324	.	0			c.A5772G						.						95.0	93.0	93.0					3																	53839136		2203	4300	6503	SO:0001819	synonymous_variant	776	exon46			ACGGAGATCTCCA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.5712A>G	chr3.hg19:g.53839136A>G		41.0	0.0		29.0	4.0	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	ENST00000350061.5	hg19	CCDS46848.1																																																																																			.	.		0.562	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
PRICKLE2	166336	hgsc.bcm.edu	37	3	64138962	64138962	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:64138962A>G	ENST00000295902.6	-	6	1268	c.683T>C	c.(682-684)gTg>gCg	p.V228A	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.V284A	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	228	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GCCGCCCAGCACTGTCTCACA	0.522																																					p.V228A		Atlas-SNP	.											.	PRICKLE2	88	.	0			c.T683C						.						172.0	151.0	158.0					3																	64138962		2203	4300	6503	SO:0001583	missense	166336	exon6			CCCAGCACTGTCT	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.683T>C	chr3.hg19:g.64138962A>G	ENSP00000295902:p.Val228Ala	73.0	0.0		98.0	4.0	NM_198859	Q0VF44	Missense_Mutation	SNP	ENST00000295902.6	hg19	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	A	15.09	2.731365	0.48939	.	.	ENSG00000163637	ENST00000295902	D	0.86865	-2.18	5.56	5.56	0.83823	Zinc finger, LIM-type (5);	0.000000	0.64402	D	0.000007	D	0.85022	0.5602	L	0.49513	1.565	0.80722	D	1	B	0.21071	0.051	B	0.26094	0.066	T	0.81215	-0.1034	10	0.38643	T	0.18	-42.7799	15.9994	0.80280	1.0:0.0:0.0:0.0	.	228	Q7Z3G6	PRIC2_HUMAN	A	228	ENSP00000295902:V228A	ENSP00000295902:V228A	V	-	2	0	PRICKLE2	64114002	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.526000	0.81920	2.241000	0.73720	0.533000	0.62120	GTG	.	.		0.522	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
VGLL3	389136	hgsc.bcm.edu	37	3	87027732	87027732	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:87027732A>G	ENST00000398399.2	-	2	710	c.347T>C	c.(346-348)cTc>cCc	p.L116P	VGLL3_ENST00000383698.3_Missense_Mutation_p.L116P	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		TTCTGGATGGAGGGTGATGGC	0.473																																					p.L116P		Atlas-SNP	.											.	VGLL3	62	.	0			c.T347C						.						124.0	121.0	122.0					3																	87027732		1973	4181	6154	SO:0001583	missense	389136	exon2			GGATGGAGGGTGA	AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.347T>C	chr3.hg19:g.87027732A>G	ENSP00000381436:p.Leu116Pro	68.0	0.0		117.0	6.0	NM_016206		Missense_Mutation	SNP	ENST00000398399.2	hg19	CCDS43110.1	.	.	.	.	.	.	.	.	.	.	A	17.27	3.347752	0.61183	.	.	ENSG00000206538	ENST00000398399;ENST00000383698	T;T	0.47528	0.84;0.84	5.41	5.41	0.78517	.	0.063714	0.64402	D	0.000010	T	0.42223	0.1193	L	0.44542	1.39	0.52099	D	0.999948	B	0.11235	0.004	B	0.11329	0.006	T	0.21586	-1.0241	10	0.32370	T	0.25	-4.1992	15.4467	0.75235	1.0:0.0:0.0:0.0	.	116	A8MV65	VGLL3_HUMAN	P	116	ENSP00000381436:L116P;ENSP00000373199:L116P	ENSP00000373199:L116P	L	-	2	0	VGLL3	87110422	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.452000	0.52971	2.048000	0.60808	0.533000	0.62120	CTC	.	.		0.473	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	NM_016206	
IFT57	55081	hgsc.bcm.edu	37	3	107940994	107940994	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:107940994T>C	ENST00000264538.3	-	1	423	c.176A>G	c.(175-177)gAg>gGg	p.E59G		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	59					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			CCGGAGGAACTCCTCCTCGTA	0.677																																					p.E59G		Atlas-SNP	.											.	IFT57	44	.	0			c.A176G						.						25.0	27.0	26.0					3																	107940994		2202	4300	6502	SO:0001583	missense	55081	exon1			AGGAACTCCTCCT	AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.176A>G	chr3.hg19:g.107940994T>C	ENSP00000264538:p.Glu59Gly	114.0	0.0		95.0	5.0	NM_018010	Q96DA9	Missense_Mutation	SNP	ENST00000264538.3	hg19	CCDS2951.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.256450	0.59321	.	.	ENSG00000114446	ENST00000264538;ENST00000492106	.	.	.	5.45	4.3	0.51218	.	0.371791	0.32518	N	0.005982	T	0.45637	0.1352	L	0.37750	1.13	0.42558	D	0.993138	B	0.11235	0.004	B	0.04013	0.001	T	0.31475	-0.9942	9	0.30078	T	0.28	.	11.2919	0.49256	0.0:0.0715:0.0:0.9285	.	59	Q9NWB7	IFT57_HUMAN	G	59	.	ENSP00000264538:E59G	E	-	2	0	IFT57	109423684	1.000000	0.71417	0.910000	0.35882	0.972000	0.66771	4.432000	0.59922	1.015000	0.39444	0.455000	0.32223	GAG	.	.		0.677	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353918.1	NM_018010	
RETNLB	84666	hgsc.bcm.edu	37	3	108475432	108475432	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:108475432T>C	ENST00000295755.6	-	2	329	c.131A>G	c.(130-132)tAc>tGc	p.Y44C	RETNLB_ENST00000482939.1_5'UTR	NM_032579.2	NP_115968.1	Q9BQ08	RETNB_HUMAN	resistin like beta	44					cell proliferation (GO:0008283)	extracellular region (GO:0005576)				endometrium(1)|kidney(3)|lung(10)|prostate(1)|skin(1)	16						AGAGGGACTGTACTCTGAGTA	0.507																																					p.Y44C		Atlas-SNP	.											.	RETNLB	38	.	0			c.A131G						.						152.0	123.0	133.0					3																	108475432		2203	4300	6503	SO:0001583	missense	84666	exon2			GGACTGTACTCTG	AF290873	CCDS2953.1	3q13.1	2008-02-05			ENSG00000163515	ENSG00000163515			20388	protein-coding gene	gene with protein product		605645				10921885, 12574343	Standard	NM_032579		Approved	HXCP2, FIZZ2, RELMb	uc003dxh.2	Q9BQ08	OTTHUMG00000159393	ENST00000295755.6:c.131A>G	chr3.hg19:g.108475432T>C	ENSP00000295755:p.Tyr44Cys	113.0	0.0		81.0	4.0	NM_032579	Q14D27	Missense_Mutation	SNP	ENST00000295755.6	hg19	CCDS2953.1	.	.	.	.	.	.	.	.	.	.	T	7.813	0.716107	0.15306	.	.	ENSG00000163515	ENST00000295755	T	0.42513	0.97	3.96	-5.23	0.02798	.	1.318770	0.05653	N	0.585484	T	0.22166	0.0534	N	0.22421	0.69	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.18808	-1.0325	10	0.39692	T	0.17	.	1.7816	0.03033	0.5548:0.1178:0.119:0.2083	.	44	Q9BQ08	RETNB_HUMAN	C	44	ENSP00000295755:Y44C	ENSP00000295755:Y44C	Y	-	2	0	RETNLB	109958122	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.130000	0.03241	-0.516000	0.06470	0.523000	0.50628	TAC	.	.		0.507	RETNLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355093.1		
DPPA2	151871	hgsc.bcm.edu	37	3	109028179	109028179	+	Splice_Site	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:109028179T>C	ENST00000478945.1	-	4	428		c.e4-2			NM_138815.3	NP_620170.3	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2						lung-associated mesenchyme development (GO:0060484)|positive regulation of stem cell proliferation (GO:2000648)|regulation of histone methylation (GO:0031060)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTAGATGACCTAAGACAAGAA	0.393																																					.		Atlas-SNP	.											.	DPPA2	52	.	0			c.182-2A>G						.						89.0	88.0	88.0					3																	109028179		2203	4300	6503	SO:0001630	splice_region_variant	151871	exon5			ATGACCTAAGACA	AY283672	CCDS2956.1	3q13.13	2010-05-04			ENSG00000163530	ENSG00000163530			19197	protein-coding gene	gene with protein product	"""cancer/testis antigen 100"""	614445				15583978	Standard	NM_138815		Approved	PESCRG1, CT100	uc003dxo.3	Q7Z7J5	OTTHUMG00000159227	ENST00000478945.1:c.182-2A>G	chr3.hg19:g.109028179T>C		210.0	0.0		124.0	5.0	NM_138815	Q8WVF0	Splice_Site	SNP	ENST00000478945.1	hg19	CCDS2956.1	.	.	.	.	.	.	.	.	.	.	T	10.81	1.455084	0.26161	.	.	ENSG00000163530	ENST00000478945	.	.	.	4.97	1.23	0.21249	.	.	.	.	.	.	.	.	.	.	.	0.29211	N	0.874552	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.9406	0.09325	0.0:0.1895:0.1832:0.6273	.	.	.	.	.	-1	.	.	.	-	.	.	DPPA2	110510869	0.003000	0.15002	0.003000	0.11579	0.379000	0.30106	-0.024000	0.12435	0.130000	0.18549	0.459000	0.35465	.	.	.		0.393	DPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353938.1	NM_138815	Intron
WDR5B	54554	hgsc.bcm.edu	37	3	122133628	122133628	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:122133628C>T	ENST00000330689.4	-	1	1254	c.748G>A	c.(748-750)Ggt>Agt	p.G250S	RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	250										kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		TTCTTATGACCAGTGTATGTT	0.373																																					p.G250S		Atlas-SNP	.											.	WDR5B	36	.	0			c.G748A						.						107.0	110.0	109.0					3																	122133628		2203	4300	6503	SO:0001583	missense	54554	exon1			TATGACCAGTGTA	AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.748G>A	chr3.hg19:g.122133628C>T	ENSP00000330381:p.Gly250Ser	169.0	0.0		114.0	5.0	NM_019069	B2RCM9|Q9NUL4	Missense_Mutation	SNP	ENST00000330689.4	hg19	CCDS3012.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152237	0.57259	.	.	ENSG00000196981	ENST00000330689	T	0.70045	-0.45	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048353	0.85682	D	0.000000	T	0.65144	0.2663	M	0.74389	2.26	0.80722	D	1	P	0.43431	0.807	B	0.39805	0.31	T	0.71334	-0.4624	10	0.72032	D	0.01	.	10.7016	0.45931	0.1903:0.8097:0.0:0.0	.	250	Q86VZ2	WDR5B_HUMAN	S	250	ENSP00000330381:G250S	ENSP00000330381:G250S	G	-	1	0	WDR5B	123616318	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	4.797000	0.62503	2.644000	0.89710	0.561000	0.74099	GGT	.	.		0.373	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355753.1	NM_019069	
PLXNA1	5361	hgsc.bcm.edu	37	3	126739124	126739124	+	Silent	SNP	G	G	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:126739124G>T	ENST00000393409.2	+	20	3975	c.3975G>T	c.(3973-3975)cgG>cgT	p.R1325R	PLXNA1_ENST00000251772.4_Silent_p.R1302R	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1325					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TTGACTACCGGACATATGCCA	0.607																																					p.R1325R		Atlas-SNP	.											.	PLXNA1	185	.	0			c.G3975T						.						102.0	83.0	89.0					3																	126739124		2203	4300	6503	SO:0001819	synonymous_variant	5361	exon20			CTACCGGACATAT	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3975G>T	chr3.hg19:g.126739124G>T		106.0	0.0		87.0	4.0	NM_032242		Silent	SNP	ENST00000393409.2	hg19	CCDS33847.2																																																																																			.	.		0.607	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
COL6A6	131873	hgsc.bcm.edu	37	3	130285737	130285737	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:130285737A>G	ENST00000358511.6	+	4	1505	c.1474A>G	c.(1474-1476)Aaa>Gaa	p.K492E	COL6A6_ENST00000453409.2_Missense_Mutation_p.K492E	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	492	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TGAGATCAATAAATACTCCAA	0.488																																					p.K492E		Atlas-SNP	.											.	COL6A6	497	.	0			c.A1474G						.						114.0	116.0	115.0					3																	130285737		1909	4116	6025	SO:0001583	missense	131873	exon4			ATCAATAAATACT	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1474A>G	chr3.hg19:g.130285737A>G	ENSP00000351310:p.Lys492Glu	148.0	0.0		123.0	5.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	A	3.309	-0.141255	0.06669	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.77098	-1.07;-1.07	5.18	4.0	0.46444	von Willebrand factor, type A (3);	0.185922	0.37955	N	0.001874	T	0.54127	0.1839	N	0.16066	0.365	0.09310	N	1	B	0.22909	0.077	B	0.24848	0.056	T	0.44267	-0.9339	10	0.02654	T	1	.	6.5047	0.22188	0.6208:0.3012:0.0781:0.0	.	492	A6NMZ7	CO6A6_HUMAN	E	492	ENSP00000351310:K492E;ENSP00000399236:K492E	ENSP00000351310:K492E	K	+	1	0	COL6A6	131768427	0.000000	0.05858	0.073000	0.20177	0.867000	0.49689	0.386000	0.20702	0.794000	0.33899	0.459000	0.35465	AAA	.	.		0.488	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
PIK3R4	30849	hgsc.bcm.edu	37	3	130435261	130435261	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:130435261A>G	ENST00000356763.3	-	9	2867	c.2310T>C	c.(2308-2310)ctT>ctC	p.L770L		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	770					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L770L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						ACTTCTTCAGAAGCTGTGCTA	0.398																																					p.L770L		Atlas-SNP	.											PIK3R4,NS,carcinoma,0,1	PIK3R4	145	.	1	Substitution - coding silent(1)	lung(1)	c.T2310C						.						90.0	95.0	93.0					3																	130435261		2203	4300	6503	SO:0001819	synonymous_variant	30849	exon9			CTTCAGAAGCTGT	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2310T>C	chr3.hg19:g.130435261A>G		134.0	0.0		113.0	6.0	NM_014602	Q2TBF4	Silent	SNP	ENST00000356763.3	hg19	CCDS3067.1																																																																																			.	.		0.398	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
RAB6B	51560	hgsc.bcm.edu	37	3	133560224	133560224	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:133560224T>C	ENST00000285208.4	-	4	543	c.194A>G	c.(193-195)cAg>cGg	p.Q65R	RAB6B_ENST00000469959.1_Intron|RAB6B_ENST00000486858.1_Missense_Mutation_p.Q52R|RAB6B_ENST00000543906.1_Missense_Mutation_p.Q65R	NM_016577.3	NP_057661.3	Q9NRW1	RAB6B_HUMAN	RAB6B, member RAS oncogene family	65					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	11						GTCCCAGAGCTGCAGTCGCAC	0.652																																					p.Q65R		Atlas-SNP	.											.	RAB6B	36	.	0			c.A194G						.						89.0	77.0	81.0					3																	133560224		2203	4300	6503	SO:0001583	missense	51560	exon4			CAGAGCTGCAGTC	AF166492	CCDS3082.1	3q22.1	2008-05-15			ENSG00000154917	ENSG00000154917		"""RAB, member RAS oncogene"""	14902	protein-coding gene	gene with protein product		615852					Standard	NM_016577		Approved		uc003epy.3	Q9NRW1	OTTHUMG00000159749	ENST00000285208.4:c.194A>G	chr3.hg19:g.133560224T>C	ENSP00000285208:p.Gln65Arg	83.0	0.0		84.0	4.0	NM_016577	B2R5Z9|B7Z337|D3DND3|Q92929	Missense_Mutation	SNP	ENST00000285208.4	hg19	CCDS3082.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.543305	0.65198	.	.	ENSG00000154917	ENST00000285208;ENST00000543906;ENST00000486858;ENST00000477759;ENST00000460865;ENST00000488969	T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	4.7	4.7	0.59300	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.88220	0.6378	M	0.84156	2.68	0.80722	D	1	P;P	0.36048	0.534;0.491	B;P	0.58577	0.417;0.841	D	0.88946	0.3383	10	0.59425	D	0.04	-5.2834	13.444	0.61129	0.0:0.0:0.0:1.0	.	52;65	B7Z337;Q9NRW1	.;RAB6B_HUMAN	R	65;65;52;32;11;32	ENSP00000285208:Q65R;ENSP00000437797:Q65R;ENSP00000419381:Q52R;ENSP00000419941:Q32R;ENSP00000419526:Q11R;ENSP00000417433:Q32R	ENSP00000285208:Q65R	Q	-	2	0	RAB6B	135042914	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.339000	0.79282	1.868000	0.54150	0.379000	0.24179	CAG	.	.		0.652	RAB6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357152.1		
PPP2R3A	5523	hgsc.bcm.edu	37	3	135721457	135721457	+	Missense_Mutation	SNP	T	T	C	rs148236440		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:135721457T>C	ENST00000264977.3	+	2	1734	c.1117T>C	c.(1117-1119)Tcc>Ccc	p.S373P	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	373					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TCCAAACAACTCCACAAATTC	0.373																																					p.S373P		Atlas-SNP	.											.	PPP2R3A	114	.	0			c.T1117C						.						63.0	64.0	63.0					3																	135721457		2203	4298	6501	SO:0001583	missense	5523	exon2			AACAACTCCACAA	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.1117T>C	chr3.hg19:g.135721457T>C	ENSP00000264977:p.Ser373Pro	135.0	0.0		119.0	5.0	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	ENST00000264977.3	hg19	CCDS3087.1	.	.	.	.	.	.	.	.	.	.	T	5.003	0.186191	0.09495	.	.	ENSG00000073711	ENST00000264977	T	0.06068	3.35	4.95	1.25	0.21368	.	0.275476	0.35615	N	0.003083	T	0.03263	0.0095	L	0.31664	0.95	0.35027	D	0.758389	P	0.37864	0.61	B	0.29440	0.102	T	0.50065	-0.8871	10	0.28530	T	0.3	.	4.2532	0.10705	0.1628:0.1525:0.0:0.6847	.	373	Q06190	P2R3A_HUMAN	P	373	ENSP00000264977:S373P	ENSP00000264977:S373P	S	+	1	0	PPP2R3A	137204147	0.650000	0.27331	0.129000	0.21949	0.584000	0.36387	1.367000	0.34204	0.681000	0.31386	0.533000	0.62120	TCC	.	T|1.000;G|0.000		0.373	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
DBR1	51163	hgsc.bcm.edu	37	3	137880850	137880850	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:137880850T>A	ENST00000260803.4	-	8	1669	c.1516A>T	c.(1516-1518)Acc>Tcc	p.T506S	DBR1_ENST00000505015.2_Missense_Mutation_p.T272S	NM_016216.3	NP_057300.2	Q9UK59	DBR1_HUMAN	debranching RNA lariats 1	506					mRNA splicing, via spliceosome (GO:0000398)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA lariat debranching enzyme activity (GO:0008419)			NS(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						GGCACCTTGGTTAAGTCCTCT	0.448																																					p.T506S		Atlas-SNP	.											.	DBR1	45	.	0			c.A1516T						.						208.0	195.0	200.0					3																	137880850		2203	4300	6503	SO:0001583	missense	51163	exon8			CCTTGGTTAAGTC	AF180919	CCDS33863.1	3q22.3	2013-05-01	2013-05-01		ENSG00000138231	ENSG00000138231			15594	protein-coding gene	gene with protein product		607024	"""debranching enzyme (S. Cerevisiae) homolog 1"", ""debranching enzyme homolog 1 (S. cerevisiae)"""			10982890	Standard	NM_016216		Approved		uc003erv.3	Q9UK59	OTTHUMG00000159824	ENST00000260803.4:c.1516A>T	chr3.hg19:g.137880850T>A	ENSP00000260803:p.Thr506Ser	602.0	0.0		540.0	194.0	NM_016216	Q96GH0|Q9NXQ6	Missense_Mutation	SNP	ENST00000260803.4	hg19	CCDS33863.1	.	.	.	.	.	.	.	.	.	.	T	1.206	-0.631146	0.03584	.	.	ENSG00000138231	ENST00000260803;ENST00000505015	T	0.42513	0.97	5.59	1.79	0.24919	.	1.023440	0.07748	N	0.948007	T	0.23611	0.0571	N	0.25647	0.755	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.28235	-1.0050	10	0.08381	T	0.77	-8.8053	2.2824	0.04118	0.148:0.084:0.3067:0.4612	.	506;274	Q9UK59;Q9UK59-2	DBR1_HUMAN;.	S	506;272	ENSP00000260803:T506S	ENSP00000260803:T506S	T	-	1	0	DBR1	139363540	0.000000	0.05858	0.009000	0.14445	0.497000	0.33675	0.240000	0.18042	0.063000	0.16370	0.533000	0.62120	ACC	.	.		0.448	DBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357585.1		
PLOD2	5352	hgsc.bcm.edu	37	3	145795696	145795696	+	Intron	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:145795696T>C	ENST00000360060.3	-	14	1678				PLOD2_ENST00000461497.1_Missense_Mutation_p.K166E|RP11-274H2.2_ENST00000480247.1_RNA|PLOD2_ENST00000494950.1_Missense_Mutation_p.K451E|PLOD2_ENST00000282903.5_Missense_Mutation_p.K506E	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2						cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	GGGGAGTCTTTTTCCCTTTGT	0.343																																					p.K506E		Atlas-SNP	.											.	PLOD2	81	.	0			c.A1516G						.						105.0	118.0	113.0					3																	145795696		2203	4299	6502	SO:0001627	intron_variant	5352	exon14			AGTCTTTTTCCCT	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1501-1014A>G	chr3.hg19:g.145795696T>C		41.0	0.0		57.0	4.0	NM_182943	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	hg19	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	t	14.42	2.529067	0.44969	.	.	ENSG00000152952	ENST00000461497;ENST00000282903;ENST00000494950	D;T;T	0.90504	-2.68;-0.06;-0.05	6.0	6.0	0.97389	.	0.185560	0.38058	N	0.001838	D	0.84575	0.5502	N	0.14661	0.345	0.37782	D	0.927046	P;D;P	0.55605	0.877;0.972;0.877	B;P;B	0.47162	0.339;0.54;0.265	D	0.83788	0.0229	10	0.09843	T	0.71	-32.0152	16.537	0.84375	0.0:0.0:0.0:1.0	.	451;506;166	E7ETU9;O00469-2;B3KWS3	.;.;.	E	166;506;451	ENSP00000419354:K166E;ENSP00000282903:K506E;ENSP00000420094:K451E	ENSP00000282903:K506E	K	-	1	0	PLOD2	147278386	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.590000	0.82653	2.296000	0.77279	0.524000	0.50904	AAA	.	.		0.343	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
MED12L	116931	hgsc.bcm.edu	37	3	150874118	150874118	+	Splice_Site	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:150874118G>A	ENST00000474524.1	+	5	764		c.e5+1		MED12L_ENST00000273432.4_Splice_Site|MED12L_ENST00000422248.2_Splice_Site|MED12L_ENST00000309237.4_Splice_Site	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like							mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.?(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CATGTTCCAGGTAACCTTTTG	0.453																																					.		Atlas-SNP	.											MED12L,NS,carcinoma,0,1	MED12L	271	.	1	Unknown(1)	kidney(1)	c.726+1G>A						.						128.0	118.0	121.0					3																	150874118		2203	4300	6503	SO:0001630	splice_region_variant	116931	exon5			TTCCAGGTAACCT	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.726+1G>A	chr3.hg19:g.150874118G>A		99.0	0.0		71.0	3.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Splice_Site	SNP	ENST00000474524.1	hg19	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663821	0.88251	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4315	0.90627	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MED12L	152356808	1.000000	0.71417	0.992000	0.48379	0.971000	0.66376	9.250000	0.95477	2.515000	0.84797	0.557000	0.71058	.	.	.		0.453	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	Intron
IGSF10	285313	hgsc.bcm.edu	37	3	151154684	151154684	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:151154684A>G	ENST00000282466.3	-	6	7664	c.7665T>C	c.(7663-7665)gtT>gtC	p.V2555V	IGSF10_ENST00000495443.1_5'UTR|MED12L_ENST00000474524.1_3'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2555	Ig-like C2-type 12.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTGGCTTGGGAACTCCCAAGG	0.522																																					p.V2555V		Atlas-SNP	.											.	IGSF10	279	.	0			c.T7665C						.						72.0	66.0	68.0					3																	151154684		2203	4300	6503	SO:0001819	synonymous_variant	285313	exon6			CTTGGGAACTCCC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7665T>C	chr3.hg19:g.151154684A>G		170.0	0.0		144.0	6.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	hg19	CCDS3160.1																																																																																			.	.		0.522	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
LEKR1	389170	hgsc.bcm.edu	37	3	156763334	156763334	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:156763334T>C	ENST00000470811.1	+	14	2297	c.962T>C	c.(961-963)cTg>cCg	p.L321P	LEKR1_ENST00000356539.4_Missense_Mutation_p.L625P			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	321										breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CTTGCAAGACTGAACTCTGAA	0.522																																					p.L625P		Atlas-SNP	.											.	LEKR1	66	.	0			c.T1874C						.						84.0	90.0	88.0					3																	156763334		2203	4300	6503	SO:0001583	missense	389170	exon13			CAAGACTGAACTC	AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.962T>C	chr3.hg19:g.156763334T>C	ENSP00000418214:p.Leu321Pro	103.0	0.0		92.0	4.0	NM_001004316		Missense_Mutation	SNP	ENST00000470811.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.90	1.777115	0.31411	.	.	ENSG00000178110	ENST00000470811;ENST00000356539	T;T	0.50277	0.75;0.75	4.94	-0.8	0.10897	.	1.367640	0.04888	N	0.448914	T	0.32675	0.0837	L	0.31294	0.92	0.09310	N	0.999999	B	0.09022	0.002	B	0.08055	0.003	T	0.15435	-1.0437	10	0.27082	T	0.32	0.9376	4.9006	0.13773	0.1453:0.3366:0.0:0.5181	.	321	Q6ZMV7	LEKR1_HUMAN	P	321;625	ENSP00000418214:L321P;ENSP00000348936:L625P	ENSP00000348936:L625P	L	+	2	0	LEKR1	158246028	0.000000	0.05858	0.001000	0.08648	0.586000	0.36452	-0.777000	0.04669	-0.043000	0.13513	0.533000	0.62120	CTG	.	.		0.522	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	protein_coding	OTTHUMT00000351625.3	NM_001004316	
FNDC3B	64778	hgsc.bcm.edu	37	3	171965470	171965470	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:171965470C>T	ENST00000336824.4	+	5	511	c.412C>T	c.(412-414)Cac>Tac	p.H138Y	FNDC3B_ENST00000415807.2_Missense_Mutation_p.H138Y|FNDC3B_ENST00000416957.1_Missense_Mutation_p.H138Y	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	138					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.H138Y(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TCATAACTCACACACGGCTTA	0.502																																					p.H138Y		Atlas-SNP	.											FNDC3B,NS,carcinoma,0,1	FNDC3B	118	.	1	Substitution - Missense(1)	lung(1)	c.C412T						.						248.0	212.0	224.0					3																	171965470		2203	4300	6503	SO:0001583	missense	64778	exon5			AACTCACACACGG	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.412C>T	chr3.hg19:g.171965470C>T	ENSP00000338523:p.His138Tyr	289.0	0.0		263.0	101.0	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	hg19	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	C	31	5.082043	0.94050	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957;ENST00000443501	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.58	5.58	0.84498	.	0.046445	0.85682	D	0.000000	T	0.53514	0.1801	L	0.57536	1.79	0.80722	D	1	D;B	0.67145	0.996;0.409	D;B	0.78314	0.991;0.119	T	0.41466	-0.9507	10	0.34782	T	0.22	-16.8634	19.5677	0.95401	0.0:1.0:0.0:0.0	.	138;138	Q53EP0-2;Q53EP0	.;FND3B_HUMAN	Y	138;138;138;111	ENSP00000411242:H138Y;ENSP00000338523:H138Y;ENSP00000389094:H138Y;ENSP00000389064:H111Y	ENSP00000338523:H138Y	H	+	1	0	FNDC3B	173448164	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.339000	0.65953	2.617000	0.88574	0.655000	0.94253	CAC	.	.		0.502	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
GHSR	2693	hgsc.bcm.edu	37	3	172163000	172163000	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:172163000A>G	ENST00000241256.2	-	2	1094	c.1052T>C	c.(1051-1053)cTg>cCg	p.L351P		NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	351					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			TTCATCTTTCAGAGTGGAGAG	0.463																																					p.L351P	Esophageal Squamous(93;641 1401 20883 29581 34638)	Atlas-SNP	.											.	GHSR	104	.	0			c.T1052C						.						87.0	98.0	94.0					3																	172163000		2203	4300	6503	SO:0001583	missense	2693	exon2			TCTTTCAGAGTGG	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.1052T>C	chr3.hg19:g.172163000A>G	ENSP00000241256:p.Leu351Pro	84.0	0.0		78.0	4.0	NM_198407	Q14D12|Q6ISR8|Q92848|Q96RJ7	Missense_Mutation	SNP	ENST00000241256.2	hg19	CCDS3218.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.989569	0.35131	.	.	ENSG00000121853	ENST00000241256	T	0.69175	-0.38	5.91	5.91	0.95273	.	0.515542	0.19252	N	0.118895	T	0.48205	0.1487	N	0.22421	0.69	0.80722	D	1	B	0.31193	0.312	B	0.31290	0.127	T	0.49652	-0.8917	10	0.34782	T	0.22	-8.276	4.4458	0.11597	0.6547:0.1727:0.1726:0.0	.	351	Q92847	GHSR_HUMAN	P	351	ENSP00000241256:L351P	ENSP00000241256:L351P	L	-	2	0	GHSR	173645694	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	3.789000	0.55454	2.252000	0.74401	0.528000	0.53228	CTG	.	.		0.463	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346728.1	NM_004122	
DCUN1D1	54165	hgsc.bcm.edu	37	3	182665120	182665120	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:182665120T>C	ENST00000292782.4	-	6	759	c.606A>G	c.(604-606)gaA>gaG	p.E202E	DCUN1D1_ENST00000469954.1_Silent_p.E187E	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	202	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					ubiquitin ligase complex (GO:0000151)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			GTTTATGATGTTCCTATTTAA	0.294																																					p.E202E		Atlas-SNP	.											.	DCUN1D1	27	.	0			c.A606G						.						114.0	109.0	111.0					3																	182665120		2200	4298	6498	SO:0001819	synonymous_variant	54165	exon6			ATGATGTTCCTAT	AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.606A>G	chr3.hg19:g.182665120T>C		107.0	0.0		90.0	4.0	NM_020640	B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Silent	SNP	ENST00000292782.4	hg19	CCDS3240.1																																																																																			.	.		0.294	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350658.1	NM_020640	
EIF4G1	1981	hgsc.bcm.edu	37	3	184049876	184049876	+	Splice_Site	SNP	T	T	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:184049876T>A	ENST00000346169.2	+	32	4889		c.e32+2		EIF4G1_ENST00000427845.1_Splice_Site|EIF4G1_ENST00000434061.2_Splice_Site|EIF4G1_ENST00000414031.1_Splice_Site|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000392537.2_Splice_Site|EIF4G1_ENST00000441154.1_Splice_Site|EIF4G1_ENST00000411531.1_Splice_Site|EIF4G1_ENST00000350481.5_Splice_Site|EIF4G1_ENST00000424196.1_Splice_Site|EIF4G1_ENST00000435046.2_Splice_Site|EIF4G1_ENST00000342981.4_Splice_Site|EIF4G1_ENST00000382330.3_Splice_Site|EIF4G1_ENST00000319274.6_Splice_Site|EIF4G1_ENST00000352767.3_Splice_Site	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1						cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGCCTCCCAGTAAGAGCCAGG	0.572																																					.		Atlas-SNP	.											.	EIF4G1	151	.	0			c.4639+2T>A						.						39.0	39.0	39.0					3																	184049876		2203	4300	6503	SO:0001630	splice_region_variant	1981	exon33			TCCCAGTAAGAGC	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.4618+2T>A	chr3.hg19:g.184049876T>A		88.0	0.0		65.0	4.0	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Splice_Site	SNP	ENST00000346169.2	hg19	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.941711	0.73557	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	.	.	.	4.35	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2405	0.59994	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	EIF4G1	185532570	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.502000	0.81614	1.588000	0.49971	0.369000	0.22263	.	.	.		0.572	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	Intron
MAP3K13	9175	hgsc.bcm.edu	37	3	185191353	185191353	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr3:185191353T>C	ENST00000265026.3	+	11	2568	c.2234T>C	c.(2233-2235)aTa>aCa	p.I745T	MAP3K13_ENST00000535426.1_Missense_Mutation_p.I601T|MAP3K13_ENST00000446828.1_Missense_Mutation_p.I538T|MAP3K13_ENST00000443863.1_Missense_Mutation_p.I601T|MAP3K13_ENST00000424227.1_Missense_Mutation_p.I745T	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.P746fs*4(1)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TCCTTAGACATACCCTCTGCT	0.562																																					p.I745T		Atlas-SNP	.											.,1	MAP3K13	209	.	1	Insertion - Frameshift(1)	breast(1)	c.T2234C						.						90.0	93.0	92.0					3																	185191353		2203	4300	6503	SO:0001583	missense	9175	exon11			TAGACATACCCTC	BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.2234T>C	chr3.hg19:g.185191353T>C	ENSP00000265026:p.Ile745Thr	60.0	0.0		54.0	3.0	NM_004721		Missense_Mutation	SNP	ENST00000265026.3	hg19	CCDS3270.1	.	.	.	.	.	.	.	.	.	.	T	7.644	0.681444	0.14907	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026	T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54	6.08	-12.2	0.00006	.	2.989660	0.00855	N	0.001866	T	0.03695	0.0105	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31447	-0.9943	10	0.13108	T	0.6	.	2.3442	0.04267	0.1543:0.3369:0.2354:0.2734	.	601;538;745	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	T	538;745;601;601;745	ENSP00000411483:I538T;ENSP00000399910:I745T;ENSP00000409325:I601T;ENSP00000439257:I601T;ENSP00000265026:I745T	ENSP00000265026:I745T	I	+	2	0	MAP3K13	186674047	0.000000	0.05858	0.000000	0.03702	0.593000	0.36681	-0.563000	0.05943	-1.687000	0.01437	-0.290000	0.09829	ATA	.	.		0.562	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
FGFR3	2261	hgsc.bcm.edu	37	4	1805419	1805419	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:1805419A>G	ENST00000260795.2	+	7	1033	c.931A>G	c.(931-933)Acg>Gcg	p.T311A	FGFR3_ENST00000352904.1_Intron|FGFR3_ENST00000481110.2_Splice_Site_p.T311A|FGFR3_ENST00000340107.4_Intron|FGFR3_ENST00000440486.2_Splice_Site_p.T311A|FGFR3_ENST00000412135.2_Intron			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	311	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CTCTTTGTAGACGGCGGGCGC	0.632		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.T311A		Atlas-SNP	.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3	3320	.	0			c.A931G						.						54.0	52.0	52.0					4																	1805419		2200	4300	6500	SO:0001630	splice_region_variant	2261	exon8	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	TTGTAGACGGCGG	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.931-1A>G	chr4.hg19:g.1805419A>G		127.0	0.0		68.0	5.0	NM_000142	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	ENST00000260795.2	hg19	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	a	14.77	2.633238	0.47049	.	.	ENSG00000068078	ENST00000481110;ENST00000440486;ENST00000260795;ENST00000507588	T;T;T;T	0.78246	-0.19;-0.19;-0.19;-1.16	4.29	4.29	0.51040	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.320176	0.32444	N	0.006093	T	0.66426	0.2788	L	0.33753	1.03	0.80722	D	1	B;B;B;B	0.25772	0.134;0.068;0.005;0.002	B;B;B;B	0.30029	0.11;0.107;0.021;0.011	T	0.60865	-0.7178	9	.	.	.	.	9.9822	0.41819	0.8297:0.1703:0.0:0.0	.	274;311;311;311	Q8NI15;P22607-4;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	A	311;311;311;97	ENSP00000420533:T311A;ENSP00000414914:T311A;ENSP00000260795:T311A;ENSP00000427289:T97A	.	T	+	1	0	FGFR3	1775217	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.079000	0.76829	1.690000	0.51089	0.459000	0.35465	ACG	.	.		0.632	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	Missense_Mutation
LETM1	3954	hgsc.bcm.edu	37	4	1843301	1843301	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:1843301A>G	ENST00000302787.2	-	3	663	c.367T>C	c.(367-369)Tcc>Ccc	p.S123P		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	123					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			GACTTGAGGGACTTCTCTACT	0.607																																					p.S123P		Atlas-SNP	.											LETM1,caecum,carcinoma,0,1	LETM1	48	.	0			c.T367C						.						70.0	72.0	72.0					4																	1843301		2203	4300	6503	SO:0001583	missense	3954	exon3			TGAGGGACTTCTC	AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.367T>C	chr4.hg19:g.1843301A>G	ENSP00000305653:p.Ser123Pro	73.0	0.0		52.0	4.0	NM_012318	B4DED2|Q9UF65	Missense_Mutation	SNP	ENST00000302787.2	hg19	CCDS3355.1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.382222	0.61845	.	.	ENSG00000168924	ENST00000302787;ENST00000417150	.	.	.	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.77525	0.4143	M	0.70275	2.135	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	T	0.80527	-0.1343	9	0.72032	D	0.01	-24.0072	14.4179	0.67163	1.0:0.0:0.0:0.0	.	123;123	O95202-3;O95202	.;LETM1_HUMAN	P	123;83	.	ENSP00000305653:S123P	S	-	1	0	LETM1	1813099	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	8.353000	0.90077	2.004000	0.58718	0.460000	0.39030	TCC	.	.		0.607	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241634.1		
POLN	353497	hgsc.bcm.edu	37	4	2210196	2210196	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:2210196T>C	ENST00000511885.2	-	5	585	c.232A>G	c.(232-234)Agt>Ggt	p.S78G	POLN_ENST00000515357.1_5'UTR|POLN_ENST00000382865.1_Missense_Mutation_p.S78G			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	78					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			GATGTCTGACTTCTTAAAGAT	0.378								DNA polymerases (catalytic subunits)																													p.S78G		Atlas-SNP	.											.	POLN	82	.	0			c.A232G						.						45.0	47.0	46.0					4																	2210196		2202	4300	6502	SO:0001583	missense	353497	exon3			TCTGACTTCTTAA	AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.232A>G	chr4.hg19:g.2210196T>C	ENSP00000435506:p.Ser78Gly	78.0	0.0		59.0	4.0	NM_181808	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	ENST00000511885.2	hg19	CCDS3360.1	.	.	.	.	.	.	.	.	.	.	T	8.282	0.815687	0.16607	.	.	ENSG00000130997	ENST00000511885;ENST00000382865	T;T	0.46819	0.86;0.86	5.26	1.56	0.23342	.	3.085710	0.00575	N	0.000310	T	0.33381	0.0861	L	0.29908	0.895	0.09310	N	1	P;B	0.39782	0.688;0.435	B;B	0.28849	0.095;0.057	T	0.32851	-0.9891	10	0.62326	D	0.03	-3.4331	5.763	0.18211	0.0:0.4072:0.0:0.5928	.	78;78	E7ERY2;Q7Z5Q5	.;DPOLN_HUMAN	G	78	ENSP00000435506:S78G;ENSP00000372316:S78G	ENSP00000372316:S78G	S	-	1	0	POLN	2179994	0.000000	0.05858	0.068000	0.19968	0.175000	0.22909	0.385000	0.20685	0.326000	0.23384	0.454000	0.30748	AGT	.	.		0.378	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000205684.2	NM_181808	
SH3BP2	6452	hgsc.bcm.edu	37	4	2824742	2824742	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:2824742T>C	ENST00000356331.5	+	3	478	c.217T>C	c.(217-219)Ttc>Ctc	p.F73L	SH3BP2_ENST00000389838.2_Missense_Mutation_p.F73L|SH3BP2_ENST00000435136.2_Missense_Mutation_p.F73L|SH3BP2_ENST00000503393.2_Missense_Mutation_p.F130L|SH3BP2_ENST00000511747.1_Missense_Mutation_p.F73L|SH3BP2_ENST00000442312.2_Missense_Mutation_p.F101L|SH3BP2_ENST00000452765.2_Missense_Mutation_p.F73L	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2	73	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		GCAGGGCGCCTTCTCCCTGAG	0.657									Cherubism																												p.F130L		Atlas-SNP	.											.	SH3BP2	43	.	0			c.T388C						.						58.0	53.0	54.0					4																	2824742		2203	4300	6503	SO:0001583	missense	6452	exon3	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	GGCGCCTTCTCCC	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.217T>C	chr4.hg19:g.2824742T>C	ENSP00000348685:p.Phe73Leu	128.0	0.0		95.0	4.0	NM_001145856	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Missense_Mutation	SNP	ENST00000356331.5	hg19	CCDS33944.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962250	0.53400	.	.	ENSG00000087266	ENST00000452765;ENST00000389838;ENST00000503219;ENST00000504294;ENST00000508385;ENST00000512014;ENST00000513095;ENST00000442312;ENST00000502260;ENST00000435136;ENST00000511747;ENST00000503393;ENST00000356331	T;T;T;T;T;T;T;T;T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85;-0.85	4.18	2.95	0.34219	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.74465	0.3720	L	0.49778	1.585	0.46654	D	0.999144	P;D;B;P	0.53619	0.722;0.961;0.435;0.625	B;P;B;B	0.53224	0.338;0.721;0.084;0.266	T	0.75482	-0.3302	10	0.56958	D	0.05	-8.6345	9.4275	0.38590	0.0:0.0905:0.0:0.9095	.	101;101;130;73	B4DT04;B7Z9B6;D6R919;P78314	.;.;.;3BP2_HUMAN	L	73;73;73;73;73;73;73;101;73;73;73;130;73	ENSP00000409746:F73L;ENSP00000374488:F73L;ENSP00000422796:F73L;ENSP00000423275:F73L;ENSP00000424917:F73L;ENSP00000424105:F73L;ENSP00000423823:F73L;ENSP00000388152:F101L;ENSP00000425537:F73L;ENSP00000403231:F73L;ENSP00000424846:F73L;ENSP00000422168:F130L;ENSP00000348685:F73L	ENSP00000348685:F73L	F	+	1	0	SH3BP2	2794540	1.000000	0.71417	1.000000	0.80357	0.622000	0.37654	5.228000	0.65310	1.538000	0.49270	0.402000	0.26972	TTC	.	.		0.657	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362406.2	NM_003023	
LAP3	51056	hgsc.bcm.edu	37	4	17586728	17586728	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:17586728A>G	ENST00000226299.4	+	6	947	c.673A>G	c.(673-675)Agt>Ggt	p.S225G	AC006160.5_ENST00000511010.1_RNA|LAP3_ENST00000606142.1_Missense_Mutation_p.S194G	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	225					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						GAATCTCAAAAGTGCTAGTAG	0.453																																					p.S225G		Atlas-SNP	.											.	LAP3	50	.	0			c.A673G						.						98.0	99.0	99.0					4																	17586728		2203	4300	6503	SO:0001583	missense	51056	exon6			CTCAAAAGTGCTA	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.673A>G	chr4.hg19:g.17586728A>G	ENSP00000226299:p.Ser225Gly	110.0	0.0		99.0	4.0	NM_015907	B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	SNP	ENST00000226299.4	hg19	CCDS3422.1	.	.	.	.	.	.	.	.	.	.	A	8.928	0.962686	0.18583	.	.	ENSG00000002549	ENST00000226299;ENST00000513105	T;T	0.44881	0.91;0.99	5.14	1.31	0.21738	Peptidase M17, leucyl aminopeptidase, C-terminal (1);	0.713801	0.15548	N	0.256569	T	0.17534	0.0421	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20538	-1.0272	10	0.30854	T	0.27	-0.4062	8.5401	0.33388	0.7614:0.0:0.2386:0.0	.	225	P28838	AMPL_HUMAN	G	225;59	ENSP00000226299:S225G;ENSP00000424724:S59G	ENSP00000226299:S225G	S	+	1	0	LAP3	17195826	0.000000	0.05858	0.002000	0.10522	0.946000	0.59487	0.039000	0.13884	0.061000	0.16311	0.459000	0.35465	AGT	.	.		0.453	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1		
FAM184B	27146	hgsc.bcm.edu	37	4	17641002	17641002	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:17641002T>C	ENST00000265018.3	-	14	2749	c.2537A>G	c.(2536-2538)cAg>cGg	p.Q846R		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	846										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						CTGGGCTTGCTGAGTCTCCTC	0.622																																					p.Q846R		Atlas-SNP	.											.	FAM184B	38	.	0			c.A2537G						.						29.0	31.0	30.0					4																	17641002		692	1591	2283	SO:0001583	missense	27146	exon14			GCTTGCTGAGTCT		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2537A>G	chr4.hg19:g.17641002T>C	ENSP00000265018:p.Gln846Arg	105.0	0.0		85.0	4.0	NM_015688		Missense_Mutation	SNP	ENST00000265018.3	hg19	CCDS47033.1	.	.	.	.	.	.	.	.	.	.	T	4.863	0.160419	0.09287	.	.	ENSG00000047662	ENST00000265018	T	0.30714	1.52	5.02	3.78	0.43462	.	0.301359	0.32093	N	0.006581	T	0.27967	0.0689	L	0.29908	0.895	0.26459	N	0.975473	D	0.57257	0.979	P	0.54140	0.743	T	0.06588	-1.0818	10	0.19590	T	0.45	-28.5006	6.9356	0.24464	0.3188:0.0:0.0:0.6812	.	846	Q9ULE4	F184B_HUMAN	R	846	ENSP00000265018:Q846R	ENSP00000265018:Q846R	Q	-	2	0	FAM184B	17250100	0.997000	0.39634	0.995000	0.50966	0.248000	0.25809	0.969000	0.29370	1.897000	0.54924	0.402000	0.26972	CAG	.	.		0.622	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
TLR6	10333	hgsc.bcm.edu	37	4	38830367	38830367	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:38830367G>A	ENST00000381950.1	-	1	793	c.728C>T	c.(727-729)tCa>tTa	p.S243L	TLR6_ENST00000436693.2_Missense_Mutation_p.S243L			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	243					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGTGAGTTCTGATAAAAATTT	0.353																																					p.S243L		Atlas-SNP	.											.	TLR6	67	.	0			c.C728T						.						49.0	54.0	52.0					4																	38830367		2203	4300	6503	SO:0001583	missense	10333	exon2			AGTTCTGATAAAA		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.728C>T	chr4.hg19:g.38830367G>A	ENSP00000371376:p.Ser243Leu	132.0	0.0		86.0	4.0	NM_006068	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	ENST00000381950.1	hg19	CCDS3446.1	.	.	.	.	.	.	.	.	.	.	G	0.708	-0.788184	0.02884	.	.	ENSG00000174130	ENST00000436693;ENST00000381950;ENST00000508542	T;T	0.25579	1.79;1.79	5.56	1.98	0.26296	.	0.333724	0.25383	N	0.031061	T	0.11707	0.0285	N	0.12182	0.205	0.18873	N	0.999982	B	0.02656	0.0	B	0.08055	0.003	T	0.35649	-0.9780	10	0.08837	T	0.75	.	10.1964	0.43056	0.323:0.0:0.677:0.0	.	243	Q9Y2C9	TLR6_HUMAN	L	243	ENSP00000389600:S243L;ENSP00000371376:S243L	ENSP00000371376:S243L	S	-	2	0	TLR6	38506762	0.000000	0.05858	0.929000	0.37066	0.044000	0.14063	-0.709000	0.05030	0.050000	0.15949	-0.663000	0.03849	TCA	.	.		0.353	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1		
PHOX2B	8929	hgsc.bcm.edu	37	4	41750513	41750513	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:41750513C>T	ENST00000226382.2	-	1	474	c.115G>A	c.(115-117)Gcc>Acc	p.A39T	RP11-227F19.1_ENST00000508038.1_RNA|RP11-227F19.2_ENST00000510602.1_lincRNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	39					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						AAGCCACTGGCCTGGCTGCAG	0.587			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.A39T		Atlas-SNP	.	yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	.	PHOX2B	53	.	0			c.G115A						.						35.0	36.0	36.0					4																	41750513		2203	4300	6503	SO:0001583	missense	8929	exon1	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CACTGGCCTGGCT	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.115G>A	chr4.hg19:g.41750513C>T	ENSP00000226382:p.Ala39Thr	66.0	0.0		70.0	4.0	NM_003924	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	hg19	CCDS3463.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839351	0.51057	.	.	ENSG00000109132	ENST00000226382	D	0.90732	-2.72	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81365	0.4807	N	0.03608	-0.345	0.80722	D	1	B	0.26483	0.15	B	0.23419	0.046	T	0.77675	-0.2499	10	0.42905	T	0.14	.	19.4899	0.95046	0.0:1.0:0.0:0.0	.	39	Q99453	PHX2B_HUMAN	T	39	ENSP00000226382:A39T	ENSP00000226382:A39T	A	-	1	0	PHOX2B	41445270	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.582000	0.67477	2.611000	0.88343	0.555000	0.69702	GCC	.	.		0.587	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2		
ART3	419	hgsc.bcm.edu	37	4	77018798	77018798	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:77018798A>G	ENST00000355810.4	+	4	902	c.783A>G	c.(781-783)ggA>ggG	p.G261G	ART3_ENST00000341029.5_Splice_Site_p.G261G|ART3_ENST00000349321.3_Splice_Site_p.G261G|AC112719.1_ENST00000582318.1_RNA|ART3_ENST00000513494.1_3'UTR	NM_001130016.2	NP_001123488.1	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3	261					protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|stomach(1)	16			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GTGTTTCAGGACTAAAAACCG	0.323																																					p.G261G		Atlas-SNP	.											.	ART3	34	.	0			c.A783G						.						89.0	101.0	97.0					4																	77018798		2203	4299	6502	SO:0001630	splice_region_variant	419	exon4			TTCAGGACTAAAA	X95827	CCDS3575.1, CCDS47079.1, CCDS47080.1	4q21.1	2008-05-15			ENSG00000156219	ENSG00000156219			725	protein-coding gene	gene with protein product		603086				9119374	Standard	NM_001130017		Approved		uc003hjo.3	Q13508	OTTHUMG00000130110	ENST00000355810.4:c.782-1A>G	chr4.hg19:g.77018798A>G		139.0	0.0		97.0	4.0	NM_001130017	Q53XW3|Q6FHT7|Q8WVJ7|Q93069|Q96HL1	Silent	SNP	ENST00000355810.4	hg19	CCDS47079.1																																																																																			.	.		0.323	ART3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252416.2	NM_001179	Silent
AFF1	4299	hgsc.bcm.edu	37	4	88035706	88035706	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:88035706C>A	ENST00000307808.6	+	11	2120	c.1700C>A	c.(1699-1701)tCc>tAc	p.S567Y	AFF1_ENST00000544085.1_Missense_Mutation_p.S205Y|AFF1_ENST00000395146.4_Missense_Mutation_p.S574Y	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	567					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CCTAAAAGCTCCAGCAAAGCC	0.632																																					p.S574Y		Atlas-SNP	.											.	AFF1	102	.	0			c.C1721A						.						9.0	13.0	12.0					4																	88035706		2182	4278	6460	SO:0001583	missense	4299	exon12			AAAGCTCCAGCAA	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1700C>A	chr4.hg19:g.88035706C>A	ENSP00000305689:p.Ser567Tyr	76.0	0.0		62.0	17.0	NM_001166693	B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	hg19	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983544	0.35036	.	.	ENSG00000172493	ENST00000395146;ENST00000541943;ENST00000307808;ENST00000544085	T;T;T	0.66995	-0.24;-0.24;-0.24	6.04	5.18	0.71444	.	0.319347	0.31636	N	0.007315	T	0.77177	0.4092	M	0.66939	2.045	0.43583	D	0.995929	D;D;D	0.58970	0.984;0.984;0.984	P;P;P	0.62184	0.899;0.865;0.899	T	0.79369	-0.1832	10	0.72032	D	0.01	-8.2015	11.7338	0.51752	0.1392:0.727:0.1338:0.0	.	574;567;567	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	Y	574;226;567;205	ENSP00000378578:S574Y;ENSP00000305689:S567Y;ENSP00000440843:S205Y	ENSP00000305689:S567Y	S	+	2	0	AFF1	88254730	0.343000	0.24818	0.986000	0.45419	0.133000	0.20885	1.907000	0.39897	1.528000	0.49103	0.561000	0.74099	TCC	.	.		0.632	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
GRID2	2895	hgsc.bcm.edu	37	4	94006348	94006348	+	Silent	SNP	T	T	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:94006348T>G	ENST00000282020.4	+	3	705	c.447T>G	c.(445-447)ccT>ccG	p.P149P	GRID2_ENST00000510992.1_Intron|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	149					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TTCGCCCACCTGTCTACTTGC	0.458																																					p.P149P		Atlas-SNP	.											.	GRID2	233	.	0			c.T447G						.						107.0	103.0	105.0					4																	94006348		2203	4300	6503	SO:0001819	synonymous_variant	2895	exon3			CCCACCTGTCTAC	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.447T>G	chr4.hg19:g.94006348T>G		193.0	0.0		136.0	53.0	NM_001510	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	ENST00000282020.4	hg19	CCDS3637.1																																																																																			.	.		0.458	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
PDHA2	5161	hgsc.bcm.edu	37	4	96761829	96761829	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:96761829T>C	ENST00000295266.4	+	1	591	c.528T>C	c.(526-528)gcT>gcC	p.A176A		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	176					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		CTGGCATTGCTCTGGCCTGTA	0.502																																					p.A176A		Atlas-SNP	.											.	PDHA2	118	.	0			c.T528C						.						62.0	66.0	65.0					4																	96761829		2203	4300	6503	SO:0001819	synonymous_variant	5161	exon1			CATTGCTCTGGCC		CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.528T>C	chr4.hg19:g.96761829T>C		72.0	0.0		75.0	4.0	NM_005390	B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Silent	SNP	ENST00000295266.4	hg19	CCDS3644.1																																																																																			.	.		0.502	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253608.1		
CENPE	1062	hgsc.bcm.edu	37	4	104053878	104053878	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:104053878A>T	ENST00000265148.3	-	42	6985	c.6896T>A	c.(6895-6897)gTg>gAg	p.V2299E	CENPE_ENST00000380026.3_Missense_Mutation_p.V2178E	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2299	Kinetochore-binding domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GAAGTTATTCACTTGACAAAT	0.289																																					p.V2299E		Atlas-SNP	.											.	CENPE	253	.	0			c.T6896A						.						71.0	75.0	74.0					4																	104053878		2201	4295	6496	SO:0001583	missense	1062	exon42			TTATTCACTTGAC	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6896T>A	chr4.hg19:g.104053878A>T	ENSP00000265148:p.Val2299Glu	348.0	0.0		236.0	92.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	hg19	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016421	0.75161	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.76578	-1.03;-0.98	5.36	5.36	0.76844	.	.	.	.	.	D	0.85340	0.5674	L	0.56769	1.78	0.23537	N	0.997464	D;D	0.89917	1.0;0.998	D;P	0.87578	0.998;0.905	T	0.77086	-0.2718	9	0.66056	D	0.02	.	12.0565	0.53538	1.0:0.0:0.0:0.0	.	2178;2299	Q02224-3;Q02224	.;CENPE_HUMAN	E	2299;2263;2178	ENSP00000265148:V2299E;ENSP00000369365:V2178E	ENSP00000265148:V2299E	V	-	2	0	CENPE	104273327	1.000000	0.71417	0.995000	0.50966	0.925000	0.55904	4.702000	0.61817	2.158000	0.67659	0.523000	0.50628	GTG	.	.		0.289	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ANK2	287	hgsc.bcm.edu	37	4	114274414	114274414	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:114274414A>G	ENST00000357077.4	+	38	4693	c.4640A>G	c.(4639-4641)gAg>gGg	p.E1547G	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.E1514G|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1547					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GAGCCAGGAGAGCCTTTTGAA	0.448																																					p.E1547G		Atlas-SNP	.											.	ANK2	576	.	0			c.A4640G						.						55.0	57.0	56.0					4																	114274414		2203	4300	6503	SO:0001583	missense	287	exon38			CAGGAGAGCCTTT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4640A>G	chr4.hg19:g.114274414A>G	ENSP00000349588:p.Glu1547Gly	121.0	0.0		106.0	5.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	17.45	3.392949	0.62066	.	.	ENSG00000145362	ENST00000503423;ENST00000504454;ENST00000357077;ENST00000264366	T;T;T;T	0.77750	-0.57;-0.74;-1.12;-1.03	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000036	D	0.87366	0.6159	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	D	0.87899	0.2689	10	0.49607	T	0.09	.	15.3528	0.74402	1.0:0.0:0.0:0.0	.	1514;1547	Q01484;Q01484-4	ANK2_HUMAN;.	G	1460;1562;1547;1514	ENSP00000421011:E1460G;ENSP00000424722:E1562G;ENSP00000349588:E1547G;ENSP00000264366:E1514G	ENSP00000264366:E1514G	E	+	2	0	ANK2	114493863	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.157000	0.94714	2.024000	0.59613	0.528000	0.53228	GAG	.	.		0.448	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
PDE5A	8654	hgsc.bcm.edu	37	4	120549709	120549709	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:120549709A>G	ENST00000354960.3	-	1	437	c.118T>C	c.(118-120)Ttt>Ctt	p.F40L	PDE5A_ENST00000264805.5_5'Flank|PDE5A_ENST00000394439.1_5'Flank	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	40					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	GAGAAGGTAAAGTCCCAGTGA	0.562											OREG0016307	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F40L		Atlas-SNP	.											.	PDE5A	83	.	0			c.T118C						.						111.0	98.0	103.0					4																	120549709		2203	4300	6503	SO:0001583	missense	8654	exon1			AGGTAAAGTCCCA	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.118T>C	chr4.hg19:g.120549709A>G	ENSP00000347046:p.Phe40Leu	76.0	0.0	1504	75.0	5.0	NM_001083	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	hg19	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.097894	0.76870	.	.	ENSG00000138735	ENST00000354960	T	0.71341	-0.56	5.98	5.98	0.97165	.	0.408709	0.28641	N	0.014626	T	0.60843	0.2300	L	0.38692	1.165	0.80722	D	1	B	0.13594	0.008	B	0.06405	0.002	T	0.56080	-0.8038	10	0.16896	T	0.51	.	15.4404	0.75178	1.0:0.0:0.0:0.0	.	40	O76074	PDE5A_HUMAN	L	40	ENSP00000347046:F40L	ENSP00000347046:F40L	F	-	1	0	PDE5A	120769157	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.149000	0.64863	2.288000	0.76882	0.482000	0.46254	TTT	.	.		0.562	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	
LARP1B	55132	hgsc.bcm.edu	37	4	129127685	129127685	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:129127685C>A	ENST00000326639.6	+	18	2623	c.2412C>A	c.(2410-2412)taC>taA	p.Y804*	LARP1B_ENST00000264584.5_Nonsense_Mutation_p.Y745*|LARP1B_ENST00000354456.3_Nonsense_Mutation_p.Y223*|LARP1B_ENST00000441387.1_Intron|LARP1B_ENST00000506199.1_3'UTR	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	804						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						AAAAAGACTACGAATCTGGTA	0.333																																					p.Y804X		Atlas-SNP	.											.	LARP1B	120	.	0			c.C2412A						.						42.0	48.0	46.0					4																	129127685		2202	4296	6498	SO:0001587	stop_gained	55132	exon18			AGACTACGAATCT		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.2412C>A	chr4.hg19:g.129127685C>A	ENSP00000321997:p.Tyr804*	103.0	0.0		76.0	4.0	NM_018078	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Nonsense_Mutation	SNP	ENST00000326639.6	hg19	CCDS3738.1	.	.	.	.	.	.	.	.	.	.	C	38	6.689746	0.97764	.	.	ENSG00000138709	ENST00000326639;ENST00000264584;ENST00000354456	.	.	.	4.97	-1.63	0.08345	.	0.062930	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3942	0.49832	0.0:0.3263:0.0:0.6737	.	.	.	.	X	804;745;223	.	ENSP00000264584:Y745X	Y	+	3	2	LARP1B	129347135	0.949000	0.32298	0.992000	0.48379	0.981000	0.71138	0.012000	0.13287	-0.252000	0.09528	-0.367000	0.07326	TAC	.	.		0.333	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
GAB1	2549	hgsc.bcm.edu	37	4	144378870	144378870	+	Intron	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:144378870T>C	ENST00000262994.4	+	7	1887				GAB1_ENST00000262995.4_Silent_p.G541G|GAB1_ENST00000505913.1_Intron	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1						activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					AACCCCATGGTTTAGAGCGAA	0.348																																					p.G541G		Atlas-SNP	.											.	GAB1	80	.	0			c.T1623C						.						53.0	48.0	50.0					4																	144378870		2203	4300	6503	SO:0001627	intron_variant	2549	exon7			CCATGGTTTAGAG	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1586-1668T>C	chr4.hg19:g.144378870T>C		107.0	0.0		94.0	5.0	NM_207123	A8K152|Q4W5G2|Q6P1W2	Silent	SNP	ENST00000262994.4	hg19	CCDS3759.1																																																																																			.	.		0.348	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
PRMT9	90826	hgsc.bcm.edu	37	4	148563937	148563937	+	Splice_Site	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:148563937C>T	ENST00000322396.6	-	10	2442		c.e10+1		PRMT10_ENST00000541232.1_Splice_Site|TMEM184C_ENST00000508208.1_Intron	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN								cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						TAGACACTTACCTGAAACTGG	0.408																																					.		Atlas-SNP	.											.	PRMT10	68	.	0			c.2199+1G>A						.						97.0	98.0	98.0					4																	148563937		2203	4300	6503	SO:0001630	splice_region_variant	90826	exon11			CACTTACCTGAAA																												ENST00000322396.6:c.2199+1G>A	chr4.hg19:g.148563937C>T		128.0	0.0		78.0	4.0	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Splice_Site	SNP	ENST00000322396.6	hg19	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.911053	0.92178	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1731	0.98165	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRMT10	148783387	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	6.817000	0.75252	2.768000	0.95171	0.655000	0.94253	.	.	.		0.408	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		Intron
NR3C2	4306	hgsc.bcm.edu	37	4	149073680	149073680	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:149073680C>A	ENST00000358102.3	-	6	2812	c.2450G>T	c.(2449-2451)aGa>aTa	p.R817I	NR3C2_ENST00000511528.1_Missense_Mutation_p.R821I|NR3C2_ENST00000355292.3_Missense_Mutation_p.R821I|NR3C2_ENST00000503313.1_5'UTR|RP11-76G10.1_ENST00000514843.1_RNA|NR3C2_ENST00000512865.1_Missense_Mutation_p.R700I|NR3C2_ENST00000344721.4_Missense_Mutation_p.R817I	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	817	Steroid-binding.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TTTGTACGATCTCCAGCTCAA	0.363																																					p.R817I	Melanoma(27;428 957 40335 51025 51111)	Atlas-SNP	.											.	NR3C2	94	.	0			c.G2450T						.						133.0	131.0	132.0					4																	149073680		2203	4300	6503	SO:0001583	missense	4306	exon6			TACGATCTCCAGC	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2450G>T	chr4.hg19:g.149073680C>A	ENSP00000350815:p.Arg817Ile	308.0	0.0		234.0	78.0	NM_000901	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	hg19	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	C	31	5.080490	0.94050	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000511528	D;D;D;D;D	0.96334	-3.98;-3.98;-3.98;-3.98;-3.98	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.98717	0.9569	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.99293	1.0899	9	.	.	.	.	19.7686	0.96352	0.0:1.0:0.0:0.0	.	700;817	B0ZBF5;B0ZBF6	.;.	I	817;821;817;700;821	ENSP00000341390:R817I;ENSP00000347441:R821I;ENSP00000350815:R817I;ENSP00000423510:R700I;ENSP00000421481:R821I	.	R	-	2	0	NR3C2	149293130	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.665000	0.90641	0.591000	0.81541	AGA	.	.		0.363	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
RBM46	166863	hgsc.bcm.edu	37	4	155719149	155719149	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:155719149A>G	ENST00000281722.3	+	3	573	c.338A>G	c.(337-339)gAa>gGa	p.E113G	RBM46_ENST00000514866.1_Missense_Mutation_p.E113G|RBM46_ENST00000510397.1_Missense_Mutation_p.E113G	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	113	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				ACAAAAGAAGAAGCCCAATTA	0.338																																					p.E113G		Atlas-SNP	.											.	RBM46	76	.	0			c.A338G						.						100.0	107.0	105.0					4																	155719149		2203	4300	6503	SO:0001583	missense	166863	exon3			AAGAAGAAGCCCA	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.338A>G	chr4.hg19:g.155719149A>G	ENSP00000281722:p.Glu113Gly	159.0	0.0		100.0	4.0	NM_144979	B3KWU8|B4DZ27	Missense_Mutation	SNP	ENST00000281722.3	hg19	CCDS3790.1	.	.	.	.	.	.	.	.	.	.	A	11.87	1.766891	0.31320	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397;ENST00000512640	T;T;T;T	0.46819	2.33;0.86;2.33;0.86	5.9	4.65	0.58169	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.202982	0.51477	D	0.000088	T	0.37183	0.0994	L	0.31065	0.9	0.42403	D	0.992578	B;B;B	0.14805	0.011;0.001;0.007	B;B;B	0.19666	0.026;0.016;0.026	T	0.24657	-1.0154	10	0.49607	T	0.09	-21.5981	12.8283	0.57733	0.8639:0.1361:0.0:0.0	.	113;113;113	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	G	113	ENSP00000424500:E113G;ENSP00000281722:E113G;ENSP00000422813:E113G;ENSP00000426672:E113G	ENSP00000281722:E113G	E	+	2	0	RBM46	155938599	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.341000	0.52151	2.254000	0.74563	0.460000	0.39030	GAA	.	.		0.338	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979	
GALNTL6	442117	hgsc.bcm.edu	37	4	173730521	173730521	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:173730521A>G	ENST00000506823.1	+	6	1220	c.563A>G	c.(562-564)aAg>aGg	p.K188R	GALNTL6_ENST00000508122.1_Missense_Mutation_p.K171R	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	188	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						GAACACCTGAAGGATAAATTG	0.433																																					p.K188R		Atlas-SNP	.											.	GALNTL6	102	.	0			c.A563G						.						92.0	90.0	91.0					4																	173730521		2203	4300	6503	SO:0001583	missense	442117	exon6			ACCTGAAGGATAA		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.563A>G	chr4.hg19:g.173730521A>G	ENSP00000423313:p.Lys188Arg	171.0	0.0		97.0	4.0	NM_001034845	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	hg19	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	A	10.47	1.359869	0.24598	.	.	ENSG00000174473	ENST00000506823;ENST00000404275;ENST00000508122	T;T	0.61859	0.07;0.07	5.45	5.45	0.79879	Glycosyl transferase, family 2 (1);	0.160836	0.42294	N	0.000734	T	0.53642	0.1809	M	0.64080	1.96	0.53688	D	0.999972	B	0.12013	0.005	B	0.12156	0.007	T	0.54234	-0.8324	10	0.52906	T	0.07	.	10.2026	0.43094	0.9255:0.0:0.0745:0.0	.	188	Q49A17	GLTL6_HUMAN	R	188;188;171	ENSP00000423313:K188R;ENSP00000423827:K171R	ENSP00000385382:K188R	K	+	2	0	GALNTL6	173967096	1.000000	0.71417	0.997000	0.53966	0.138000	0.21146	6.279000	0.72620	2.196000	0.70406	0.402000	0.26972	AAG	.	.		0.433	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	
NEIL3	55247	hgsc.bcm.edu	37	4	178257425	178257425	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:178257425A>G	ENST00000264596.3	+	4	695	c.577A>G	c.(577-579)Atc>Gtc	p.I193V		NM_018248.2	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3 (E. coli)	193					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		AGTAGGGAACATCATCAAAAA	0.373								Base excision repair (BER), DNA glycosylases																													p.I193V		Atlas-SNP	.											.	NEIL3	89	.	0			c.A577G						.						146.0	148.0	147.0					4																	178257425		2203	4300	6503	SO:0001583	missense	55247	exon4			GGGAACATCATCA	AB079071	CCDS3828.1	4q34	2014-02-18			ENSG00000109674	ENSG00000109674			24573	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 3"""	608934				12713815, 12509226	Standard	NM_018248		Approved	FLJ10858, hFPG2, FPG2, hNEI3, ZGRF3	uc003iut.2	Q8TAT5	OTTHUMG00000160722	ENST00000264596.3:c.577A>G	chr4.hg19:g.178257425A>G	ENSP00000264596:p.Ile193Val	174.0	0.0		94.0	4.0	NM_018248	Q2PPJ3|Q8NG51|Q9NV95	Missense_Mutation	SNP	ENST00000264596.3	hg19	CCDS3828.1	.	.	.	.	.	.	.	.	.	.	A	18.59	3.657674	0.67586	.	.	ENSG00000109674	ENST00000264596	T	0.20200	2.09	4.93	4.93	0.64822	DNA glycosylase/AP lyase, H2TH DNA-binding (1);Ribosomal protein S13-like, H2TH (1);	0.000000	0.85682	D	0.000000	T	0.41166	0.1147	L	0.52823	1.66	0.58432	D	0.999997	D	0.89917	1.0	D	0.81914	0.995	T	0.21586	-1.0241	10	0.59425	D	0.04	-19.4282	14.22	0.65820	1.0:0.0:0.0:0.0	.	193	Q8TAT5	NEIL3_HUMAN	V	193	ENSP00000264596:I193V	ENSP00000264596:I193V	I	+	1	0	NEIL3	178494419	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.484000	0.90445	2.191000	0.70037	0.533000	0.62120	ATC	.	.		0.373	NEIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361914.1	NM_018248	
WWC2	80014	hgsc.bcm.edu	37	4	184169911	184169911	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:184169911T>C	ENST00000403733.3	+	7	976	c.777T>C	c.(775-777)atT>atC	p.I259I	WWC2_ENST00000448232.2_Silent_p.I259I|WWC2_ENST00000504005.1_Intron|WWC2_ENST00000378925.3_Silent_p.I161I|WWC2_ENST00000513834.1_Silent_p.I259I	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	259					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		ATCAGAACATTGGCAGATCTG	0.433																																					p.I259I		Atlas-SNP	.											.	WWC2	78	.	0			c.T777C						.						91.0	86.0	87.0					4																	184169911		2203	4300	6503	SO:0001819	synonymous_variant	80014	exon7			GAACATTGGCAGA	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.777T>C	chr4.hg19:g.184169911T>C		116.0	0.0		97.0	5.0	NM_024949	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Silent	SNP	ENST00000403733.3	hg19	CCDS34109.2																																																																																			.	.		0.433	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
UFSP2	55325	hgsc.bcm.edu	37	4	186336995	186336995	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:186336995C>T	ENST00000264689.6	-	5	476	c.360G>A	c.(358-360)atG>atA	p.M120I	Y_RNA_ENST00000384502.1_RNA|UFSP2_ENST00000502282.1_Intron	NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	120						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		ACATTTCCAGCATAAGATCTA	0.348																																					p.M120I		Atlas-SNP	.											.	UFSP2	33	.	0			c.G360A						.						76.0	69.0	71.0					4																	186336995		2203	4300	6503	SO:0001583	missense	55325	exon5			TTCCAGCATAAGA	AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.360G>A	chr4.hg19:g.186336995C>T	ENSP00000264689:p.Met120Ile	126.0	0.0		79.0	4.0	NM_018359	Q6IA77|Q96FS3	Missense_Mutation	SNP	ENST00000264689.6	hg19	CCDS3842.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.76|16.76	3.211299|3.211299	0.58343|0.58343	.|.	.|.	ENSG00000109775|ENSG00000109775	ENST00000511485|ENST00000264689;ENST00000505357	.|T;T	.|0.52754	.|1.56;0.65	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	.|0.043790	.|0.85682	.|D	.|0.000000	T|T	0.41581|0.41581	0.1165|0.1165	L|L	0.59436|0.59436	1.845|1.845	0.39946|0.39946	D|D	0.974478|0.974478	.|P;B	.|0.35844	.|0.524;0.162	.|B;B	.|0.27887	.|0.084;0.03	T|T	0.50013|0.50013	-0.8877|-0.8877	5|10	.|0.66056	.|D	.|0.02	-17.3221|-17.3221	12.4411|12.4411	0.55625|0.55625	0.0:0.9219:0.0:0.0781|0.0:0.9219:0.0:0.0781	.|.	.|120;20	.|Q9NUQ7;B3KRI4	.|UFSP2_HUMAN;.	T|I	34|120;114	.|ENSP00000264689:M120I;ENSP00000423108:M114I	.|ENSP00000264689:M120I	A|M	-|-	1|3	0|0	UFSP2|UFSP2	186573989|186573989	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.729000|3.729000	0.54999|0.54999	2.665000|2.665000	0.90641|0.90641	0.655000|0.655000	0.94253|0.94253	GCT|ATG	.	.		0.348	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360589.2	NM_018359	
FAT1	2195	hgsc.bcm.edu	37	4	187541014	187541014	+	Silent	SNP	C	C	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:187541014C>T	ENST00000441802.2	-	10	6935	c.6726G>A	c.(6724-6726)ctG>ctA	p.L2242L		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2242	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CCTCAAAGTCCAGAGGAGCTA	0.488										HNSCC(5;0.00058)																											p.L2242L	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.G6726A						.						145.0	151.0	149.0					4																	187541014		2037	4215	6252	SO:0001819	synonymous_variant	2195	exon10			AAAGTCCAGAGGA	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6726G>A	chr4.hg19:g.187541014C>T		168.0	0.0		76.0	4.0	NM_005245		Silent	SNP	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.		0.488	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
SLC9A3	6550	hgsc.bcm.edu	37	5	488453	488453	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:488453A>G	ENST00000264938.3	-	3	662	c.653T>C	c.(652-654)cTg>cCg	p.L218P	SLC9A3_ENST00000514375.1_Missense_Mutation_p.L218P	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	218					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GTCGTTCAGCAGCGACTCCCC	0.672																																					p.L218P		Atlas-SNP	.											.	SLC9A3	89	.	0			c.T653C						.						69.0	63.0	65.0					5																	488453		2202	4300	6502	SO:0001583	missense	6550	exon3			TTCAGCAGCGACT		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.653T>C	chr5.hg19:g.488453A>G	ENSP00000264938:p.Leu218Pro	84.0	0.0		89.0	4.0	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	hg19	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.706543	0.89018	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.19669	2.13;2.13	4.64	4.64	0.57946	Cation/H+ exchanger (1);	0.000000	0.64402	D	0.000001	T	0.55065	0.1897	M	0.93016	3.37	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.79784	0.993;0.955	T	0.67757	-0.5588	10	0.87932	D	0	.	14.0411	0.64676	1.0:0.0:0.0:0.0	.	218;218	E9PF67;P48764	.;SL9A3_HUMAN	P	218	ENSP00000264938:L218P;ENSP00000422983:L218P	ENSP00000264938:L218P	L	-	2	0	SLC9A3	541453	1.000000	0.71417	0.970000	0.41538	0.869000	0.49853	8.952000	0.93031	1.851000	0.53745	0.459000	0.35465	CTG	.	.		0.672	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
SEMA5A	9037	hgsc.bcm.edu	37	5	9119234	9119234	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:9119234A>G	ENST00000382496.5	-	15	2466	c.1801T>C	c.(1801-1803)Tgg>Cgg	p.W601R		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	601	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CACGAGGTCCAGGGAGTCCAG	0.647																																					p.W601R		Atlas-SNP	.											.	SEMA5A	236	.	0			c.T1801C						.						54.0	49.0	51.0					5																	9119234		2203	4300	6503	SO:0001583	missense	9037	exon15			AGGTCCAGGGAGT	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1801T>C	chr5.hg19:g.9119234A>G	ENSP00000371936:p.Trp601Arg	122.0	0.0		140.0	7.0	NM_003966	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	hg19	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.649576	0.67358	.	.	ENSG00000112902	ENST00000382496	T	0.64085	-0.08	5.35	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.85483	0.5707	H	0.98426	4.23	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.87282	0.2293	10	0.87932	D	0	.	9.4575	0.38764	0.9152:0.0:0.0848:0.0	.	601	Q13591	SEM5A_HUMAN	R	601	ENSP00000371936:W601R	ENSP00000371936:W601R	W	-	1	0	SEMA5A	9172234	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	8.969000	0.93411	0.868000	0.35678	0.455000	0.32223	TGG	.	.		0.647	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
TRIO	7204	hgsc.bcm.edu	37	5	14474101	14474101	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:14474101A>G	ENST00000344204.4	+	40	6003		c.e40-1		TRIO_ENST00000537187.1_Splice_Site	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor						apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTTTAATTGTAGGGCTACATG	0.383																																					.		Atlas-SNP	.											.	TRIO	305	.	0			c.5980-2A>G						.						136.0	116.0	123.0					5																	14474101		2203	4300	6503	SO:0001630	splice_region_variant	7204	exon40			AATTGTAGGGCTA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.5980-1A>G	chr5.hg19:g.14474101A>G		110.0	0.0		92.0	4.0	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Splice_Site	SNP	ENST00000344204.4	hg19	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.491429	0.64074	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000541447	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4933	0.75629	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIO	14527101	1.000000	0.71417	0.911000	0.35937	0.885000	0.51271	9.221000	0.95188	2.064000	0.61679	0.460000	0.39030	.	.	.		0.383	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	Intron
TRIO	7204	hgsc.bcm.edu	37	5	14502746	14502746	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:14502746T>C	ENST00000344204.4	+	54	8415	c.8391T>C	c.(8389-8391)agT>agC	p.S2797S	TRIO_ENST00000537187.1_Silent_p.S2621S|TRIO_ENST00000344135.5_Silent_p.S296S	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2797	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CCTTCTACAGTGAAGTGGCTG	0.522																																					p.S2797S		Atlas-SNP	.											.	TRIO	305	.	0			c.T8391C						.						141.0	112.0	122.0					5																	14502746		2203	4300	6503	SO:0001819	synonymous_variant	7204	exon54			CTACAGTGAAGTG	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8391T>C	chr5.hg19:g.14502746T>C		60.0	0.0		69.0	5.0	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	hg19	CCDS3883.1																																																																																			.	.		0.522	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
TRIO	7204	hgsc.bcm.edu	37	5	14508302	14508302	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:14508302A>G	ENST00000344204.4	+	57	9089	c.9065A>G	c.(9064-9066)aAg>aGg	p.K3022R	TRIO_ENST00000537187.1_Missense_Mutation_p.K2846R|TRIO_ENST00000344135.5_Missense_Mutation_p.K521R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	3022	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTGAGCCAGAAGGCCAAGGAG	0.602																																					p.K3022R		Atlas-SNP	.											.	TRIO	305	.	0			c.A9065G						.						88.0	95.0	92.0					5																	14508302		2203	4300	6503	SO:0001583	missense	7204	exon57			GCCAGAAGGCCAA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.9065A>G	chr5.hg19:g.14508302A>G	ENSP00000339299:p.Lys3022Arg	90.0	0.0		64.0	4.0	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	hg19	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	11.54	1.668093	0.29604	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000344135	T;T;T	0.65549	-0.16;-0.16;-0.16	5.72	1.93	0.25924	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.184175	0.48286	N	0.000198	T	0.42607	0.1210	N	0.17312	0.475	0.20307	N	0.999912	B	0.30236	0.274	B	0.37304	0.246	T	0.30822	-0.9965	10	0.16896	T	0.51	.	6.4663	0.21983	0.7261:0.1315:0.1424:0.0	.	3022	O75962	TRIO_HUMAN	R	3022;2846;521	ENSP00000339299:K3022R;ENSP00000446348:K2846R;ENSP00000339291:K521R	ENSP00000339291:K521R	K	+	2	0	TRIO	14561302	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	1.885000	0.39678	0.085000	0.17107	-0.256000	0.11100	AAG	.	.		0.602	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
ZFR	51663	hgsc.bcm.edu	37	5	32444759	32444759	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:32444759A>C	ENST00000265069.8	-	1	108	c.6T>G	c.(4-6)atT>atG	p.I2M		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	2					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		GGCATATGGGAATCATGGGCT	0.672																																					p.I2M		Atlas-SNP	.											.	ZFR	98	.	0			c.T6G						.						79.0	79.0	79.0					5																	32444759		2195	4290	6485	SO:0001583	missense	51663	exon1			TATGGGAATCATG	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.6T>G	chr5.hg19:g.32444759A>C	ENSP00000265069:p.Ile2Met	223.0	0.0		326.0	36.0	NM_016107	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	hg19	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.397754	0.62177	.	.	ENSG00000056097	ENST00000265069;ENST00000416900	T	0.07021	3.23	4.59	4.59	0.56863	.	0.064020	0.64402	D	0.000009	T	0.08537	0.0212	N	0.22421	0.69	0.52099	D	0.999945	P;B	0.38565	0.637;0.232	B;B	0.41813	0.367;0.147	T	0.19031	-1.0318	10	0.87932	D	0	.	12.5026	0.55964	1.0:0.0:0.0:0.0	.	2;2	B2RNR6;Q96KR1	.;ZFR_HUMAN	M	2	ENSP00000265069:I2M	ENSP00000265069:I2M	I	-	3	3	ZFR	32480516	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.867000	0.75511	1.822000	0.53115	0.454000	0.30748	ATT	.	.		0.672	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
RICTOR	253260	hgsc.bcm.edu	37	5	38978735	38978735	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:38978735A>T	ENST00000357387.3	-	9	801	c.771T>A	c.(769-771)taT>taA	p.Y257*	RICTOR_ENST00000296782.5_Nonsense_Mutation_p.Y257*	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					GAAAATCAGTATAGGGTGCTA	0.289																																					p.Y257X		Atlas-SNP	.											.	RICTOR	182	.	0			c.T771A						.						52.0	56.0	54.0					5																	38978735		2203	4296	6499	SO:0001587	stop_gained	253260	exon9			ATCAGTATAGGGT		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.771T>A	chr5.hg19:g.38978735A>T	ENSP00000349959:p.Tyr257*	92.0	0.0		99.0	4.0	NM_152756		Nonsense_Mutation	SNP	ENST00000357387.3	hg19	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	A	34	5.338480	0.95783	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	.	.	.	5.69	3.25	0.37280	.	0.055706	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.8045	7.6001	0.28071	0.6406:0.0:0.3594:0.0	.	.	.	.	X	257	.	ENSP00000296782:Y257X	Y	-	3	2	RICTOR	39014492	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.739000	0.47409	0.410000	0.25675	0.377000	0.23210	TAT	.	.		0.289	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
SKIV2L2	23517	hgsc.bcm.edu	37	5	54674959	54674959	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:54674959A>G	ENST00000230640.5	+	18	2242	c.1988A>G	c.(1987-1989)aAg>aGg	p.K663R	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.K562R	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	663					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTTTAGGTAAAGAATGAAGGA	0.313																																					p.K663R	Melanoma(2;92 134 23744 29976 33782)	Atlas-SNP	.											.	SKIV2L2	104	.	0			c.A1988G						.						45.0	50.0	48.0					5																	54674959		2203	4298	6501	SO:0001583	missense	23517	exon18			AGGTAAAGAATGA	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1988A>G	chr5.hg19:g.54674959A>G	ENSP00000230640:p.Lys663Arg	32.0	0.0		36.0	4.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	hg19	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.082615	0.36758	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.30448	1.53;1.53	5.61	5.61	0.85477	.	0.048228	0.85682	D	0.000000	T	0.20495	0.0493	N	0.16833	0.445	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.004	T	0.07385	-1.0775	10	0.17369	T	0.5	-17.457	15.4537	0.75297	1.0:0.0:0.0:0.0	.	562;663	F5H7E2;P42285	.;SK2L2_HUMAN	R	663;562	ENSP00000230640:K663R;ENSP00000442583:K562R	ENSP00000230640:K663R	K	+	2	0	SKIV2L2	54710716	1.000000	0.71417	0.992000	0.48379	0.916000	0.54674	8.015000	0.88690	2.134000	0.65973	0.528000	0.53228	AAG	.	.		0.313	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
RGS7BP	401190	hgsc.bcm.edu	37	5	63802520	63802520	+	Silent	SNP	C	C	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:63802520C>A	ENST00000334025.2	+	1	395	c.69C>A	c.(67-69)atC>atA	p.I23I	RGS7BP_ENST00000508162.1_3'UTR	NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein	23					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		TCTTCCAGATCAGCAAGCCCC	0.637																																					p.I23I		Atlas-SNP	.											.	RGS7BP	32	.	0			c.C69A						.						29.0	39.0	35.0					5																	63802520		2203	4300	6503	SO:0001819	synonymous_variant	401190	exon1			CCAGATCAGCAAG	BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.69C>A	chr5.hg19:g.63802520C>A		84.0	0.0		115.0	5.0	NM_001029875	B7Z3X1	Silent	SNP	ENST00000334025.2	hg19	CCDS34170.1																																																																																			.	.		0.637	RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368464.1	NM_001029875	
ADAMTS6	11174	hgsc.bcm.edu	37	5	64558682	64558682	+	IGR	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:64558682T>C								ADAMTS6 (64090 upstream) : ADAMTS6 (34352 downstream)																							AGGAGACGCCTCCCCCGCAGG	0.537																																					p.G576G		Atlas-SNP	.											.	ADAMTS6	174	.	0			c.A1728G						.						49.0	42.0	44.0					5																	64558682		2203	4300	6503	SO:0001628	intergenic_variant	11174	exon13			GACGCCTCCCCCG																													chr5.hg19:g.64558682T>C		53.0	0.0		88.0	4.0	NM_197941		Silent	SNP		hg19																																																																																				.	.	0	0.537								
CCNB1	891	hgsc.bcm.edu	37	5	68467214	68467214	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:68467214G>A	ENST00000256442.5	+	4	734	c.481G>A	c.(481-483)Gga>Aga	p.G161R		NM_031966.3	NP_114172.1	P14635	CCNB1_HUMAN	cyclin B1	161					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to iron(III) ion (GO:0071283)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle checkpoint (GO:0071174)|mitotic spindle stabilization (GO:0043148)|negative regulation of gene expression (GO:0010629)|negative regulation of protein phosphorylation (GO:0001933)|oocyte maturation (GO:0001556)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of chromosome condensation (GO:0060623)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to DDT (GO:0046680)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|spermatogenesis (GO:0007283)|tissue regeneration (GO:0042246)|ventricular cardiac muscle cell development (GO:0055015)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase activity (GO:0016301)|patched binding (GO:0005113)|protein kinase binding (GO:0019901)			large_intestine(2)|lung(5)|skin(1)	8		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGCAGAAGATGGAGCTGATCC	0.388																																					p.G161R		Atlas-SNP	.											.	CCNB1	36	.	0			c.G481A						.						145.0	143.0	143.0					5																	68467214		2203	4300	6503	SO:0001583	missense	891	exon4			GAAGATGGAGCTG	U22364	CCDS3997.1	5q12	2008-07-18			ENSG00000134057	ENSG00000134057			1579	protein-coding gene	gene with protein product	"""G2/mitotic-specific cyclin B1"""	123836		CCNB		1386342	Standard	NM_031966		Approved		uc003jvm.3	P14635	OTTHUMG00000097817	ENST00000256442.5:c.481G>A	chr5.hg19:g.68467214G>A	ENSP00000256442:p.Gly161Arg	237.0	0.0		286.0	88.0	NM_031966	A8K066|Q5TZP9	Missense_Mutation	SNP	ENST00000256442.5	hg19	CCDS3997.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601127	0.28534	.	.	ENSG00000134057	ENST00000256442;ENST00000506572;ENST00000508407;ENST00000505500	T;T;T;T	0.31510	2.78;2.78;1.49;2.56	5.62	4.56	0.56223	Cyclin-like (1);	0.330907	0.32301	N	0.006291	T	0.29256	0.0728	L	0.56769	1.78	0.32326	N	0.56171	P;B;B	0.41475	0.751;0.01;0.001	B;B;B	0.41723	0.365;0.007;0.007	T	0.28427	-1.0044	10	0.24483	T	0.36	.	9.1402	0.36899	0.0875:0.0:0.7618:0.1507	.	161;161;161	E9PC90;Q5TZP9;P14635	.;.;CCNB1_HUMAN	R	161	ENSP00000256442:G161R;ENSP00000423387:G161R;ENSP00000426092:G161R;ENSP00000424588:G161R	ENSP00000256442:G161R	G	+	1	0	CCNB1	68502970	0.140000	0.22579	1.000000	0.80357	0.892000	0.51952	1.519000	0.35888	2.640000	0.89533	0.591000	0.81541	GGA	.	.		0.388	CCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215084.1	NM_031966	
VCAN	1462	hgsc.bcm.edu	37	5	82807955	82807955	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:82807955T>C	ENST00000265077.3	+	6	1347	c.782T>C	c.(781-783)tTc>tCc	p.F261S	VCAN_ENST00000512590.2_Missense_Mutation_p.F213S|VCAN_ENST00000342785.4_Missense_Mutation_p.F261S|VCAN_ENST00000513984.1_Missense_Mutation_p.F261S|VCAN_ENST00000343200.5_Missense_Mutation_p.F261S|VCAN_ENST00000502527.2_Missense_Mutation_p.F261S	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	261	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CCCAGTAAATTCACCTTCGAG	0.473																																					p.F261S		Atlas-SNP	.											.	VCAN	498	.	0			c.T782C						.						57.0	55.0	55.0					5																	82807955		2203	4300	6503	SO:0001583	missense	1462	exon6			GTAAATTCACCTT	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.782T>C	chr5.hg19:g.82807955T>C	ENSP00000265077:p.Phe261Ser	59.0	0.0		65.0	5.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	hg19	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470943	0.63625	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000513960;ENST00000513984;ENST00000502527	T;T;T;T;T;T;T	0.09163	3.01;3.01;3.01;3.01;3.01;3.01;3.01	5.49	5.49	0.81192	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.189449	0.31697	N	0.007216	T	0.31857	0.0810	M	0.67569	2.06	0.42692	D	0.993584	D;B;D;D;P	0.76494	0.995;0.145;0.999;0.993;0.7	D;B;D;D;P	0.75020	0.942;0.164;0.943;0.985;0.532	T	0.03898	-1.0994	10	0.87932	D	0	.	15.5685	0.76313	0.0:0.0:0.0:1.0	.	261;261;261;261;261	P13611-3;P13611-4;P13611-2;P13611;Q86W61	.;.;.;CSPG2_HUMAN;.	S	261;261;261;213;261;261;261	ENSP00000265077:F261S;ENSP00000340062:F261S;ENSP00000342768:F261S;ENSP00000425959:F213S;ENSP00000426251:F261S;ENSP00000426715:F261S;ENSP00000421362:F261S	ENSP00000265077:F261S	F	+	2	0	VCAN	82843711	0.999000	0.42202	0.976000	0.42696	0.035000	0.12851	7.992000	0.88273	2.078000	0.62432	0.460000	0.39030	TTC	.	.		0.473	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
MCTP1	79772	hgsc.bcm.edu	37	5	94224673	94224673	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:94224673G>A	ENST00000515393.1	-	12	1843	c.1844C>T	c.(1843-1845)cCa>cTa	p.P615L	MCTP1_ENST00000429576.2_Missense_Mutation_p.P348L|MCTP1_ENST00000312216.8_Missense_Mutation_p.P394L|MCTP1_ENST00000505208.1_Missense_Mutation_p.P394L|MCTP1_ENST00000505078.1_Missense_Mutation_p.P131L	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	615	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		TATCCTCAATGGGCTCTGAAA	0.428																																					p.P615L		Atlas-SNP	.											.	MCTP1	110	.	0			c.C1844T						.						75.0	78.0	77.0					5																	94224673		2203	4300	6503	SO:0001583	missense	79772	exon12			CTCAATGGGCTCT		CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1844C>T	chr5.hg19:g.94224673G>A	ENSP00000424126:p.Pro615Leu	91.0	0.0		108.0	5.0	NM_024717	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	ENST00000515393.1	hg19	CCDS34203.1	.	.	.	.	.	.	.	.	.	.	G	6.028	0.373600	0.11409	.	.	ENSG00000175471	ENST00000515393;ENST00000429576;ENST00000505078;ENST00000312216;ENST00000508509;ENST00000512425;ENST00000505208;ENST00000506568	T;T;T;T;T;T;T;T	0.78126	-1.15;-0.85;-0.13;-1.02;-0.84;-0.96;-1.13;-0.76	5.65	5.65	0.86999	.	0.064498	0.64402	D	0.000008	T	0.41880	0.1178	N	0.00642	-1.3	0.48040	D	0.999578	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.09377	0.003;0.004;0.001	T	0.53005	-0.8499	10	0.07030	T	0.85	-10.2496	8.0979	0.30840	0.1905:0.0:0.8095:0.0	.	615;348;394	Q6DN14;Q6DN14-3;Q6DN14-2	MCTP1_HUMAN;.;.	L	615;348;131;394;335;276;394;216	ENSP00000424126:P615L;ENSP00000391639:P348L;ENSP00000426417:P131L;ENSP00000308957:P394L;ENSP00000423410:P335L;ENSP00000431075:P276L;ENSP00000426438:P394L;ENSP00000426294:P216L	ENSP00000308957:P394L	P	-	2	0	MCTP1	94250429	1.000000	0.71417	0.987000	0.45799	0.933000	0.57130	4.022000	0.57203	2.824000	0.97209	0.655000	0.94253	CCA	.	.		0.428	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
FTMT	94033	hgsc.bcm.edu	37	5	121187671	121187671	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:121187671T>C	ENST00000321339.1	+	1	22	c.13T>C	c.(13-15)Ttc>Ctc	p.F5L		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	5					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GCTGTCCTGCTTCAGGCTCCT	0.692																																					p.F5L		Atlas-SNP	.											.	FTMT	71	.	0			c.T13C						.						31.0	35.0	34.0					5																	121187671		2201	4297	6498	SO:0001583	missense	94033	exon1			TCCTGCTTCAGGC	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.13T>C	chr5.hg19:g.121187671T>C	ENSP00000313691:p.Phe5Leu	60.0	0.0		76.0	4.0	NM_177478		Missense_Mutation	SNP	ENST00000321339.1	hg19	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	T	13.59	2.282230	0.40394	.	.	ENSG00000181867	ENST00000321339	T	0.67865	-0.29	3.1	1.94	0.25998	.	.	.	.	.	T	0.46889	0.1416	L	0.27053	0.805	0.09310	N	1	B	0.29037	0.231	B	0.19391	0.025	T	0.32771	-0.9894	9	0.44086	T	0.13	.	4.7468	0.13042	0.0:0.1469:0.0:0.8531	.	5	Q8N4E7	FTMT_HUMAN	L	5	ENSP00000313691:F5L	ENSP00000313691:F5L	F	+	1	0	FTMT	121215570	0.001000	0.12720	0.017000	0.16124	0.113000	0.19764	0.358000	0.20216	0.577000	0.29470	0.528000	0.53228	TTC	.	.		0.692	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
CTNNA1	1495	hgsc.bcm.edu	37	5	138260967	138260967	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:138260967A>G	ENST00000302763.7	+	13	1860	c.1770A>G	c.(1768-1770)caA>caG	p.Q590Q	CTNNA1_ENST00000518825.1_Silent_p.Q590Q|CTNNA1_ENST00000540387.1_Silent_p.Q220Q|CTNNA1_ENST00000355078.5_Silent_p.Q487Q	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	590					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTACTGAGCAAGTAGAAGCAG	0.557																																					p.Q590Q		Atlas-SNP	.											.	CTNNA1	114	.	0			c.A1770G						.						79.0	71.0	74.0					5																	138260967		2203	4300	6503	SO:0001819	synonymous_variant	1495	exon13			TGAGCAAGTAGAA	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1770A>G	chr5.hg19:g.138260967A>G		75.0	0.0		97.0	5.0	NM_001903	Q12795|Q8N1C0	Silent	SNP	ENST00000302763.7	hg19	CCDS34243.1																																																																																			.	.		0.557	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
DND1	373863	hgsc.bcm.edu	37	5	140052972	140052972	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:140052972A>G	ENST00000542735.1	-	2	69	c.26T>C	c.(25-27)cTg>cCg	p.L9P	HARS_ENST00000504156.1_3'UTR	NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	9					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCACACCACAGCTGAGAGGG	0.647																																					p.L9P		Atlas-SNP	.											.	DND1	15	.	0			c.T26C						.						53.0	53.0	53.0					5																	140052972		2203	4300	6503	SO:0001630	splice_region_variant	373863	exon2			CACCACAGCTGAG	AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.25-1T>C	chr5.hg19:g.140052972A>G		97.0	0.0		122.0	6.0	NM_194249		Missense_Mutation	SNP	ENST00000542735.1	hg19	CCDS4236.1	.	.	.	.	.	.	.	.	.	.	A	12.15	1.852215	0.32699	.	.	ENSG00000256453	ENST00000542735	T	0.33865	1.39	4.7	3.52	0.40303	.	0.299359	0.22494	N	0.059325	T	0.16300	0.0392	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.05750	-1.0866	10	0.30854	T	0.27	-2.1486	5.2348	0.15441	0.4857:0.125:0.0:0.3893	.	9	Q8IYX4	DND1_HUMAN	P	9	ENSP00000445366:L9P	ENSP00000445366:L9P	L	-	2	0	DND1	140033156	0.193000	0.23313	0.998000	0.56505	0.705000	0.40729	1.105000	0.31086	0.790000	0.33803	0.379000	0.24179	CTG	.	.		0.647	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251669.2	NM_194249	Missense_Mutation
PCDHB5	26167	hgsc.bcm.edu	37	5	140515856	140515856	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:140515856T>C	ENST00000231134.5	+	1	1057	c.840T>C	c.(838-840)gcT>gcC	p.A280A		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	280	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAGCCTATGCTCTATTCCAAG	0.463																																					p.A280A		Atlas-SNP	.											.	PCDHB5	184	.	0			c.T840C						.						119.0	121.0	120.0					5																	140515856		2203	4300	6503	SO:0001819	synonymous_variant	26167	exon1			CTATGCTCTATTC	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.840T>C	chr5.hg19:g.140515856T>C		100.0	0.0		99.0	4.0	NM_015669	Q549F4|Q9UFU9	Silent	SNP	ENST00000231134.5	hg19	CCDS4247.1																																																																																			.	.		0.463	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHB6	56130	hgsc.bcm.edu	37	5	140530199	140530199	+	Nonsense_Mutation	SNP	C	C	T	rs144886449		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:140530199C>T	ENST00000231136.1	+	1	361	c.361C>T	c.(361-363)Cga>Tga	p.R121*	PCDHB6_ENST00000543635.1_5'UTR	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	121	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCTTCCTTGCGAGTCAGAGA	0.468																																					p.R121X		Atlas-SNP	.											.	PCDHB6	161	.	0			c.C361T						.						53.0	58.0	56.0					5																	140530199		2203	4300	6503	SO:0001587	stop_gained	56130	exon1			TCCTTGCGAGTCA	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.361C>T	chr5.hg19:g.140530199C>T	ENSP00000231136:p.Arg121*	89.0	0.0		93.0	4.0	NM_018939	B2R8R9	Nonsense_Mutation	SNP	ENST00000231136.1	hg19	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.621023	0.46736	.	.	ENSG00000113211	ENST00000231136	.	.	.	4.97	-6.87	0.01671	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	2.4032	0.04407	0.4866:0.1269:0.2371:0.1494	.	.	.	.	X	121	.	ENSP00000231136:R121X	R	+	1	2	PCDHB6	140510383	0.000000	0.05858	0.000000	0.03702	0.953000	0.61014	-4.537000	0.00219	-0.893000	0.03930	-0.224000	0.12420	CGA	.	C|1.000;A|0.000		0.468	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140856091	140856091	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:140856091T>C	ENST00000308177.3	+	1	512	c.408T>C	c.(406-408)ccT>ccC	p.P136P	PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	136	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTTTCCCTACCCAGGAAA	0.557																																					p.P136P		Atlas-SNP	.											.	PCDHGC3	173	.	0			c.T408C						.						75.0	76.0	75.0					5																	140856091		2203	4300	6503	SO:0001819	synonymous_variant	5098	exon1			TTTCCCTACCCAG	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.408T>C	chr5.hg19:g.140856091T>C		120.0	0.0		119.0	5.0	NM_032402	O60622|Q08192|Q9Y5C4	Silent	SNP	ENST00000308177.3	hg19	CCDS4261.1																																																																																			.	.		0.557	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
SH3TC2	79628	hgsc.bcm.edu	37	5	148407517	148407517	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:148407517T>C	ENST00000515425.1	-	11	1879	c.1778A>G	c.(1777-1779)gAa>gGa	p.E593G	SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000538184.1_Missense_Mutation_p.E140G|SH3TC2_ENST00000394358.2_Missense_Mutation_p.E478G|SH3TC2_ENST00000512049.1_Missense_Mutation_p.E586G	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	593					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTGCCTTTTCCAACAGGGC	0.572																																					p.E593G		Atlas-SNP	.											.	SH3TC2	178	.	0			c.A1778G						.						64.0	62.0	63.0					5																	148407517		2203	4300	6503	SO:0001583	missense	79628	exon11			GCCTTTTCCAACA	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1778A>G	chr5.hg19:g.148407517T>C	ENSP00000423660:p.Glu593Gly	81.0	0.0		81.0	4.0	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	hg19	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	T	8.646	0.897215	0.17686	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049;ENST00000394358	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	6.04	4.9	0.64082	Tetratricopeptide-like helical (1);	0.059425	0.64402	D	0.000004	T	0.53546	0.1803	L	0.41632	1.29	0.50313	D	0.999869	B;B;B;B	0.18013	0.025;0.008;0.008;0.008	B;B;B;B	0.18561	0.022;0.009;0.015;0.009	T	0.51687	-0.8674	10	0.35671	T	0.21	.	7.3318	0.26586	0.0:0.1557:0.0:0.8443	.	478;586;593;593	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	G	140;593;586;478	ENSP00000441427:E140G;ENSP00000423660:E593G;ENSP00000421860:E586G;ENSP00000377886:E478G	ENSP00000377886:E478G	E	-	2	0	SH3TC2	148387710	1.000000	0.71417	0.998000	0.56505	0.370000	0.29829	4.899000	0.63245	2.317000	0.78254	0.460000	0.39030	GAA	.	.		0.572	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
ARHGEF37	389337	hgsc.bcm.edu	37	5	148980772	148980772	+	Silent	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:148980772A>G	ENST00000333677.6	+	3	451	c.288A>G	c.(286-288)gaA>gaG	p.E96E		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	96	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						CCTCCAAGGAAGAGGAACAAG	0.463																																					p.E96E		Atlas-SNP	.											.	ARHGEF37	45	.	0			c.A288G						.						81.0	83.0	83.0					5																	148980772		1988	4174	6162	SO:0001819	synonymous_variant	389337	exon3			CAAGGAAGAGGAA	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.288A>G	chr5.hg19:g.148980772A>G		86.0	0.0		100.0	4.0	NM_001001669	Q6ZW51	Silent	SNP	ENST00000333677.6	hg19	CCDS43385.1																																																																																			.	.		0.463	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373763.1	NM_001001669	
TNIP1	10318	hgsc.bcm.edu	37	5	150436496	150436496	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:150436496T>C	ENST00000389378.2	-	6	1046	c.458A>G	c.(457-459)gAg>gGg	p.E153G	TNIP1_ENST00000522226.1_Missense_Mutation_p.E153G|TNIP1_ENST00000518977.1_Missense_Mutation_p.E153G|TNIP1_ENST00000315050.7_Missense_Mutation_p.E153G|TNIP1_ENST00000524280.1_Missense_Mutation_p.E153G|TNIP1_ENST00000521591.1_Missense_Mutation_p.E153G|TNIP1_ENST00000523338.1_Missense_Mutation_p.E153G|TNIP1_ENST00000520931.1_Missense_Mutation_p.E100G|TNIP1_ENST00000523200.1_Missense_Mutation_p.E153G	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	153	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTGCCGTCCTCACGGGGCAG	0.682																																					p.E153G		Atlas-SNP	.											.	TNIP1	51	.	0			c.A458G						.						24.0	25.0	25.0					5																	150436496		2203	4298	6501	SO:0001583	missense	10318	exon6			CCGTCCTCACGGG	AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.458A>G	chr5.hg19:g.150436496T>C	ENSP00000374029:p.Glu153Gly	38.0	0.0		61.0	5.0	NM_001252385	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	hg19	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	T	14.30	2.494990	0.44352	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840;ENST00000522100	T;T;T;T;T;T;T;T;T;T	0.25749	1.96;2.03;2.03;2.04;2.03;2.03;2.04;2.08;2.08;1.78	5.03	3.87	0.44632	.	0.052153	0.85682	D	0.000000	T	0.33818	0.0876	M	0.77103	2.36	0.51482	D	0.999926	B;B;B;B;B;B;B	0.27192	0.011;0.068;0.02;0.068;0.068;0.171;0.171	B;B;B;B;B;B;B	0.33521	0.016;0.059;0.016;0.059;0.064;0.165;0.165	T	0.19582	-1.0301	10	0.87932	D	0	-17.8083	10.6611	0.45702	0.0:0.076:0.0:0.924	.	153;107;107;153;153;153;153	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	G	100;153;153;153;110;110;115;153;153;153;153;153;110;100	ENSP00000429891:E100G;ENSP00000374029:E153G;ENSP00000317891:E153G;ENSP00000428243:E153G;ENSP00000428187:E153G;ENSP00000430760:E153G;ENSP00000430971:E153G;ENSP00000429912:E153G;ENSP00000431105:E153G;ENSP00000428487:E100G	ENSP00000317891:E153G	E	-	2	0	TNIP1	150416689	1.000000	0.71417	0.952000	0.39060	0.412000	0.31113	5.169000	0.64984	0.872000	0.35775	0.533000	0.62120	GAG	.	.		0.682	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058	
ATP10B	23120	hgsc.bcm.edu	37	5	160063301	160063301	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:160063301T>C	ENST00000327245.5	-	11	1862	c.1016A>G	c.(1015-1017)aAt>aGt	p.N339S	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	339					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAAGGTCCCATTCCAGATGCT	0.498																																					p.N339S		Atlas-SNP	.											.	ATP10B	201	.	0			c.A1016G						.						91.0	90.0	90.0					5																	160063301		1957	4154	6111	SO:0001583	missense	23120	exon11			GTCCCATTCCAGA	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1016A>G	chr5.hg19:g.160063301T>C	ENSP00000313600:p.Asn339Ser	65.0	0.0		85.0	4.0	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	hg19	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	T	11.78	1.740137	0.30865	.	.	ENSG00000118322	ENST00000327245	D	0.88354	-2.37	5.18	4.02	0.46733	ATPase, P-type, ATPase-associated domain (1);	0.391334	0.28510	N	0.015087	T	0.75459	0.3852	N	0.10945	0.07	0.26882	N	0.967521	B;B;B;B	0.22683	0.073;0.002;0.008;0.023	B;B;B;B	0.25987	0.065;0.022;0.006;0.033	T	0.61530	-0.7044	9	.	.	.	.	6.6745	0.23085	0.0:0.0824:0.2552:0.6624	.	383;339;311;339	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	S	339	ENSP00000313600:N339S	.	N	-	2	0	ATP10B	159995879	0.997000	0.39634	0.791000	0.31998	0.864000	0.49448	2.903000	0.48711	0.920000	0.36970	-0.389000	0.06534	AAT	.	.		0.498	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
GABRG2	2566	hgsc.bcm.edu	37	5	161580269	161580269	+	Silent	SNP	G	G	A			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:161580269G>A	ENST00000361925.4	+	9	1519	c.1299G>A	c.(1297-1299)agG>agA	p.R433R	GABRG2_ENST00000393933.4_Silent_p.R338R|GABRG2_ENST00000356592.3_Silent_p.R441R|GABRG2_ENST00000414552.2_Silent_p.R481R			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	433	Interaction with GABARAP. {ECO:0000255}.				adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GACATGGGAGGATACATATCC	0.488																																					p.R481R		Atlas-SNP	.											.	GABRG2	142	.	0			c.G1443A						.						252.0	246.0	248.0					5																	161580269		2203	4300	6503	SO:0001819	synonymous_variant	2566	exon11			TGGGAGGATACAT		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1299G>A	chr5.hg19:g.161580269G>A		589.0	0.0		716.0	200.0	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	hg19	CCDS4358.1																																																																																			.	.		0.488	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
FAM193B	54540	hgsc.bcm.edu	37	5	176951436	176951436	+	Silent	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:176951436T>C	ENST00000514747.1	-	6	2094	c.2046A>G	c.(2044-2046)aaA>aaG	p.K682K	FAM193B_ENST00000329540.5_Silent_p.K308K|FAM193B_ENST00000508298.1_5'Flank|FAM193B_ENST00000443375.2_Silent_p.K649K	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	762						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						AGCTGCCTACTTTGGGAAGCT	0.677																																					p.K682K		Atlas-SNP	.											.	FAM193B	28	.	0			c.A2046G						.						13.0	14.0	14.0					5																	176951436		1872	4088	5960	SO:0001819	synonymous_variant	54540	exon6			GCCTACTTTGGGA		CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.2046A>G	chr5.hg19:g.176951436T>C		129.0	0.0		99.0	5.0	NM_001190946	E9PET5|Q9NW00	Silent	SNP	ENST00000514747.1	hg19	CCDS54954.1	.	.	.	.	.	.	.	.	.	.	T	6.885	0.532741	0.13127	.	.	ENSG00000146067	ENST00000524677	.	.	.	4.98	-3.55	0.04639	.	.	.	.	.	T	0.28764	0.0713	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.35822	-0.9773	4	.	.	.	-1.2745	7.7099	0.28671	0.0:0.4714:0.1289:0.3997	.	.	.	.	G	368	.	.	S	-	1	0	FAM193B	176884042	0.084000	0.21492	0.015000	0.15790	0.935000	0.57460	0.155000	0.16362	-0.458000	0.07023	0.454000	0.30748	AGT	.	.		0.677	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373121.1	NM_019057	
TBC1D9B	23061	hgsc.bcm.edu	37	5	179320450	179320450	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:179320450A>G	ENST00000356834.3	-	5	632	c.595T>C	c.(595-597)Tgg>Cgg	p.W199R	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.W199R	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	199	GRAM 1.					integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGTCCACCCACTGCACCACG	0.607																																					p.W199R		Atlas-SNP	.											.	TBC1D9B	157	.	0			c.T595C						.						92.0	75.0	81.0					5																	179320450		2203	4300	6503	SO:0001583	missense	23061	exon5			CCACCCACTGCAC	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.595T>C	chr5.hg19:g.179320450A>G	ENSP00000349291:p.Trp199Arg	64.0	0.0		72.0	4.0	NM_198868	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	SNP	ENST00000356834.3	hg19	CCDS43408.1	.	.	.	.	.	.	.	.	.	.	A	18.76	3.693004	0.68271	.	.	ENSG00000197226	ENST00000356834;ENST00000355235	D;D	0.87029	-2.2;-2.2	4.36	4.36	0.52297	GRAM (2);	0.000000	0.85682	D	0.000000	D	0.94584	0.8255	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95692	0.8741	10	0.87932	D	0	-11.1939	13.7011	0.62608	1.0:0.0:0.0:0.0	.	199;199;199	A1L3A9;Q66K14-2;Q66K14	.;.;TBC9B_HUMAN	R	199	ENSP00000349291:W199R;ENSP00000347375:W199R	ENSP00000347375:W199R	W	-	1	0	TBC1D9B	179253056	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	9.047000	0.93823	1.841000	0.53522	0.260000	0.18958	TGG	.	.		0.607	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
MGAT1	4245	hgsc.bcm.edu	37	5	180218962	180218962	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:180218962T>C	ENST00000446023.2	-	3	1760	c.1010A>G	c.(1009-1011)cAg>cGg	p.Q337R	MGAT1_ENST00000393340.3_Missense_Mutation_p.Q337R|MGAT1_ENST00000333055.3_Missense_Mutation_p.Q337R|MGAT1_ENST00000427865.2_Missense_Mutation_p.Q337R|MGAT1_ENST00000307826.4_Missense_Mutation_p.Q337R	NM_001114617.1|NM_001114618.1	NP_001108089.1|NP_001108090.1	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	337					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine catabolic process (GO:0006049)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	acetylglucosaminyltransferase activity (GO:0008375)|alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0003827)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	13	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGCACAAACTGCTGGTTCAG	0.572																																					p.Q337R		Atlas-SNP	.											.	MGAT1	48	.	0			c.A1010G						.																																			SO:0001583	missense	4245	exon3			ACAAACTGCTGGT	M61829	CCDS4458.1	5q35.3	2013-02-25			ENSG00000131446	ENSG00000131446	2.4.1.101	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7044	protein-coding gene	gene with protein product		160995		MGAT, GLYT1		1827260	Standard	NM_002406		Approved	GNT-1, GLCNAC-TI	uc003mmg.4	P26572	OTTHUMG00000130937	ENST00000446023.2:c.1010A>G	chr5.hg19:g.180218962T>C	ENSP00000404718:p.Gln337Arg	88.0	0.0		89.0	4.0	NM_001114617	A8K404|B3KRU8|D3DWR1|Q6IBE3	Missense_Mutation	SNP	ENST00000446023.2	hg19	CCDS4458.1	.	.	.	.	.	.	.	.	.	.	T	9.329	1.060068	0.19987	.	.	ENSG00000131446	ENST00000333055;ENST00000307826;ENST00000446023;ENST00000393340;ENST00000452920;ENST00000427865	D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82	4.52	3.38	0.38709	.	0.470122	0.21631	N	0.071499	T	0.72293	0.3442	N	0.20986	0.625	0.28281	N	0.923964	B	0.02656	0.0	B	0.04013	0.001	T	0.60326	-0.7285	10	0.28530	T	0.3	-8.6443	8.1092	0.30905	0.0:0.0994:0.0:0.9006	.	337	P26572	MGAT1_HUMAN	R	337;337;337;337;194;337	ENSP00000332073:Q337R;ENSP00000311888:Q337R;ENSP00000404718:Q337R;ENSP00000377010:Q337R;ENSP00000402838:Q337R	ENSP00000311888:Q337R	Q	-	2	0	MGAT1	180151568	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.002000	0.57053	2.030000	0.59900	0.533000	0.62120	CAG	.	.		0.572	MGAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368189.1	NM_001114618	
SLC22A23	63027	hgsc.bcm.edu	37	6	3290023	3290023	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr6:3290023T>C	ENST00000406686.3	-	6	1287	c.1288A>G	c.(1288-1290)Aac>Gac	p.N430D	SLC22A23_ENST00000380302.4_Missense_Mutation_p.N149D|SLC22A23_ENST00000436008.2_Missense_Mutation_p.N430D|SLC22A23_ENST00000490273.1_Missense_Mutation_p.N149D|PSMG4_ENST00000451246.2_Intron	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	430					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				ACCACAATGTTCTTCCACAGG	0.582																																					p.N430D		Atlas-SNP	.											.	SLC22A23	89	.	0			c.A1288G						.						165.0	125.0	138.0					6																	3290023		2203	4300	6503	SO:0001583	missense	63027	exon6			CAATGTTCTTCCA	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1288A>G	chr6.hg19:g.3290023T>C	ENSP00000385028:p.Asn430Asp	88.0	0.0		84.0	4.0	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	hg19	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.613979	0.87359	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000380302;ENST00000490273;ENST00000485307;ENST00000467177	T;T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8;-0.8	4.33	4.33	0.51752	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.045545	0.85682	D	0.000000	T	0.71467	0.3343	L	0.43923	1.385	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.60286	0.872;0.872	T	0.71224	-0.4656	10	0.34782	T	0.22	-35.1252	13.9461	0.64086	0.0:0.0:0.0:1.0	.	430;430	C9J4Z0;A1A5C7	.;S22AN_HUMAN	D	430;430;149;149;258;256	ENSP00000410245:N430D;ENSP00000385028:N430D;ENSP00000369657:N149D;ENSP00000419463:N149D;ENSP00000418134:N258D;ENSP00000418985:N256D	ENSP00000369657:N149D	N	-	1	0	SLC22A23	3235022	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.353000	0.79414	1.942000	0.56320	0.459000	0.35465	AAC	.	.		0.582	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
TMPRSS11B	132724	hgsc.bcm.edu	37	4	69097023	69097023	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr4:69097023delG	ENST00000332644.5	-	7	745	c.584delC	c.(583-585)gcafs	p.A195fs		NM_182502.3	NP_872308.2	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	195	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.A195E(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)	27						CCATGGCCATGCCCCCTCCAG	0.493																																					p.A195fs		Atlas-Indel,Pindel	.											.	TMPRSS11B	66	.	1	Substitution - Missense(1)	skin(1)	c.585delA						.						81.0	81.0	81.0					4																	69097023		2203	4300	6503	SO:0001589	frameshift_variant	132724	exon7			.	BX537945	CCDS3521.1	4q13.2	2010-04-13			ENSG00000185873	ENSG00000185873		"""Serine peptidases / Transmembrane"""	25398	protein-coding gene	gene with protein product							Standard	NM_182502		Approved		uc003hdw.4	Q86T26	OTTHUMG00000129301	ENST00000332644.5:c.584delC	chr4.hg19:g.69097023delG	ENSP00000330475:p.Ala195fs	187.0	0.0		241.0	76.0	NM_182502	A8K4D9	Frame_Shift_Del	DEL	ENST00000332644.5	hg19	CCDS3521.1																																																																																			.	.		0.493	TMPRSS11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251431.2	NM_182502	
WDR33	55339	hgsc.bcm.edu	37	2	128522284	128522336	+	Intron	DEL	GTGCAGAAAGTTTCCCAGAAACTGACAGAGCCCATGCATCTCTGCACCCAGAA	GTGCAGAAAGTTTCCCAGAAACTGACAGAGCCCATGCATCTCTGCACCCAGAA	-	rs200736326|rs369619546	byFrequency	TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	GTGCAGAAAGTTTCCCAGAAACTGACAGAGCCCATGCATCTCTGCACCCAGAA	GTGCAGAAAGTTTCCCAGAAACTGACAGAGCCCATGCATCTCTGCACCCAGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr2:128522284_128522336delGTGCAGAAAGTTTCCCAGAAACTGACAGAGCCCATGCATCTCTGCACCCAGAA	ENST00000322313.4	-	6	785				WDR33_ENST00000409658.3_Frame_Shift_Del_p.ILGAEMHGLCQFLGNFLH231fs|WDR33_ENST00000393006.1_Intron	NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33						mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TGTTTATAGGGTGCAGAAAGTTTCCCAGAAACTGACAGAGCCCATGCATCTCTGCACCCAGAATACACTTAGA	0.403																																					p.231_249del		Atlas-Indel,Pindel	.											.	WDR33	136	.	0			c.693_745del						.																																			SO:0001627	intron_variant	55339	exon6			.		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.626+65TTCTGGGTGCAGAGATGCATGGGCTCTGTCAGTTTCTGGGAAACTTTCTGCAC>-	chr2.hg19:g.128522284_128522336delGTGCAGAAAGTTTCCCAGAAACTGACAGAGCCCATGCATCTCTGCACCCAGAA		271.0	0.0		155.0	16.0	NM_001006622	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Frame_Shift_Del	DEL	ENST00000322313.4	hg19	CCDS2150.1																																																																																			.	.		0.403	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
GABRG2	2566	hgsc.bcm.edu	37	5	161576259	161576259	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:161576259delG	ENST00000361925.4	+	8	1288	c.1068delG	c.(1066-1068)ttgfs	p.L356fs	GABRG2_ENST00000393933.4_Frame_Shift_Del_p.L261fs|GABRG2_ENST00000356592.3_Frame_Shift_Del_p.L356fs|GABRG2_ENST00000414552.2_Frame_Shift_Del_p.L396fs			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	356					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGGCACCTTGCATTATTTTG	0.408																																					p.L396fs		Atlas-Indel,Pindel	.											.	GABRG2	142	.	0			c.1187delT						.						192.0	162.0	172.0					5																	161576259		2203	4300	6503	SO:0001589	frameshift_variant	2566	exon9			.		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1068delG	chr5.hg19:g.161576259delG	ENSP00000354651:p.Leu356fs	807.0	0.0		915.0	222.0	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Frame_Shift_Del	DEL	ENST00000361925.4	hg19	CCDS4358.1																																																																																			.	.		0.408	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
LEAP2	116842	hgsc.bcm.edu	37	5	132209684	132209685	+	Frame_Shift_Ins	INS	-	-	G	rs377649330		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr5:132209684_132209685insG	ENST00000296877.2	+	2	1473_1474	c.100_101insG	c.(100-102)aggfs	p.R34fs	LEAP2_ENST00000485457.1_3'UTR	NM_052971.2	NP_443203.1	Q969E1	LEAP2_HUMAN	liver expressed antimicrobial peptide 2	34					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				NS(1)|endometrium(1)	2		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGCAAAGAGAAGGCCACGGAGA	0.51																																					p.R34fs		Atlas-Indel,Pindel	.											.	LEAP2	6	.	0			c.100_101insG						.																																			SO:0001589	frameshift_variant	116842	exon2			.	AJ409065, BX443829	CCDS4163.1	5q31.1	2008-02-05			ENSG00000164406	ENSG00000164406			29571	protein-coding gene	gene with protein product		611373				12493837	Standard	NM_052971		Approved	LEAP-2	uc003kyc.3	Q969E1	OTTHUMG00000059837	ENST00000296877.2:c.102dupG	chr5.hg19:g.132209686_132209686dupG	ENSP00000296877:p.Arg34fs	137.0	0.0		136.0	64.0	NM_052971	D3DQ91	Frame_Shift_Ins	INS	ENST00000296877.2	hg19	CCDS4163.1																																																																																			.	.		0.510	LEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133046.1	NM_052971	
UBQLN4	56893	hgsc.bcm.edu	37	1	156011369	156011371	+	In_Frame_Del	DEL	CGT	CGT	-	rs371953742		TCGA-BC-A10W-01A-11D-A12Z-10	TCGA-BC-A10W-11A-11D-A12Z-10	CGT	CGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9681d501-d5be-4b4d-8587-69b0a4f9eb3a	16c0da05-13b9-4c80-947f-2532f2cbf61a	g.chr1:156011369_156011371delCGT	ENST00000368309.3	-	10	1650_1652	c.1558_1560delACG	c.(1558-1560)acgdel	p.T520del		NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	520					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					ATGTGGCTGGCGTGGCTGGTGAG	0.606																																					p.520_521del		Atlas-INDEL	.											.	UBQLN4	47	.	0			c.1559_1561del						.																																			SO:0001651	inframe_deletion	56893	exon10			.	BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.1558_1560delACG	chr1.hg19:g.156011369_156011371delCGT	ENSP00000357292:p.Thr520del	152.0	0.0		403.0	45.0	NM_020131	A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	In_Frame_Del	DEL	ENST00000368309.3	hg19	CCDS1127.1																																																																																			.	.		0.606	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046193.1	NM_020131	
