#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAMTA1	23261	hgsc.bcm.edu	37	1	7151365	7151365	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:7151365A>G	ENST00000303635.7	+	4	443	c.236A>G	c.(235-237)gAa>gGa	p.E79G	CAMTA1_ENST00000439411.2_Splice_Site_p.E79G	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	79					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTGTTTCAGGAAATTGCAGCT	0.363			T	WWTR1	epitheliod hemangioendothelioma																																p.E79G		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.A236G						.						100.0	96.0	97.0					1																	7151365		2203	4300	6503	SO:0001630	splice_region_variant	23261	exon4			TTCAGGAAATTGC	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.235-1A>G	chr1.hg19:g.7151365A>G		78.0	0.0		96.0	4.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	hg19	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220641	0.79464	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.38560	1.13;1.14	5.35	5.35	0.76521	CG-1 (2);	0.092388	0.42172	D	0.000755	T	0.69024	0.3065	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.75587	-0.3266	10	0.87932	D	0	-12.2974	14.812	0.70003	1.0:0.0:0.0:0.0	.	79	Q9Y6Y1	CMTA1_HUMAN	G	79	ENSP00000306522:E79G;ENSP00000402561:E79G	ENSP00000306522:E79G	E	+	2	0	CAMTA1	7073952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.239000	0.89811	2.149000	0.67028	0.533000	0.62120	GAA	.	.		0.363	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	Missense_Mutation
PER3	8863	hgsc.bcm.edu	37	1	7887204	7887204	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:7887204T>C	ENST00000361923.2	+	17	2366	c.2191T>C	c.(2191-2193)Tcg>Ccg	p.S731P	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.S739P	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	731	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGACGCGGTCGGCCGGCTG	0.552																																					p.S731P		Atlas-SNP	.											.	PER3	95	.	0			c.T2191C						.						14.0	18.0	17.0					1																	7887204		2081	4140	6221	SO:0001583	missense	8863	exon17			ACGCGGTCGGCCG	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2191T>C	chr1.hg19:g.7887204T>C	ENSP00000355031:p.Ser731Pro	60.0	0.0		95.0	4.0	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	hg19	CCDS89.1	.	.	.	.	.	.	.	.	.	.	T	10.43	1.348940	0.24426	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.10960	2.84;2.82	4.52	2.22	0.28083	.	71.754500	0.00166	N	0.000000	T	0.22859	0.0552	L	0.49126	1.545	0.09310	N	1	D;B;B;D	0.71674	0.998;0.152;0.236;0.998	P;B;B;P	0.59115	0.852;0.032;0.07;0.852	T	0.07102	-1.0790	10	0.30854	T	0.27	.	5.9575	0.19281	0.0:0.3271:0.0:0.6729	.	731;739;739;731	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	P	739;731	ENSP00000366755:S739P;ENSP00000355031:S731P	ENSP00000355031:S731P	S	+	1	0	PER3	7809791	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.421000	0.07053	0.284000	0.22305	0.459000	0.35465	TCG	.	.		0.552	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
SPEN	23013	hgsc.bcm.edu	37	1	16174601	16174601	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:16174601A>G	ENST00000375759.3	+	1	243	c.39A>G	c.(37-39)ttA>ttG	p.L13L	RP11-169K16.9_ENST00000317122.1_RNA	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	13	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGGGCAACTTACCCGAGAACG	0.692																																					p.L13L		Atlas-SNP	.											.	SPEN	374	.	0			c.A39G						.						35.0	32.0	33.0					1																	16174601		2195	4291	6486	SO:0001819	synonymous_variant	23013	exon1			CAACTTACCCGAG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.39A>G	chr1.hg19:g.16174601A>G		100.0	0.0		97.0	4.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	hg19	CCDS164.1																																																																																			.	.		0.692	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SERINC2	347735	hgsc.bcm.edu	37	1	31905905	31905906	+	Missense_Mutation	DNP	GT	GT	CA	rs375057852		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G|T	G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:31905905_31905906GT>CA	ENST00000373709.3	+	9	1255_1256	c.1105_1106GT>CA	c.(1105-1107)GTg>CAg	p.V369Q	SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000536384.1_Missense_Mutation_p.V373Q|SERINC2_ENST00000536859.1_Missense_Mutation_p.V373Q|SERINC2_ENST00000373710.1_Missense_Mutation_p.V378Q	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	369					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		GCAGCAGCAGGTGGCAGCCTGT	0.634																																					p.V378L|p.V378E		Atlas-SNP	.											.	SERINC2	44	.	0			c.G1132C|c.T1133A						.																																			SO:0001583	missense	347735	exon10			CAGCAGGTGGCAG|AGCAGGTGGCAGC	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	Exception_encountered	chr1.hg19:g.31905905_31905906delinsCA	ENSP00000362813:p.Val369Gln	82.0	0.0		117.0	7.0|6.0	NM_001199038	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Missense_Mutation	SNP	ENST00000373709.3	hg19	CCDS30662.1																																																																																			.	.		0.634	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010680.1	NM_018565	
TRIM62	55223	hgsc.bcm.edu	37	1	33646996	33646996	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:33646996A>G	ENST00000291416.5	-	1	271	c.38T>C	c.(37-39)aTc>aCc	p.I13T	TRIM62_ENST00000485148.1_5'UTR	NM_018207.2	NP_060677.2	Q9BVG3	TRI62_HUMAN	tripartite motif containing 62	13					innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)				GCTCAGGCAGATGGAGCACAG	0.711																																					p.I13T		Atlas-SNP	.											.	TRIM62	26	.	0			c.T38C						.						7.0	9.0	9.0					1																	33646996		2075	4114	6189	SO:0001583	missense	55223	exon1			AGGCAGATGGAGC	BC007999	CCDS376.1	1p35.1	2013-10-11	2011-01-25		ENSG00000116525	ENSG00000116525		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	25574	protein-coding gene	gene with protein product	"""ductal epithelium-associated RING Chromosome 1"""		"""tripartite motif-containing 62"""			19536326	Standard	NM_018207		Approved	FLJ10759, DEAR1	uc001bxb.3	Q9BVG3	OTTHUMG00000004132	ENST00000291416.5:c.38T>C	chr1.hg19:g.33646996A>G	ENSP00000291416:p.Ile13Thr	24.0	0.0		43.0	4.0	NM_018207	B3KVH5|B4DTE4|D3DPR1|Q9NVG0	Missense_Mutation	SNP	ENST00000291416.5	hg19	CCDS376.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.197937	0.58126	.	.	ENSG00000116525	ENST00000291416;ENST00000373432;ENST00000373430	D	0.89270	-2.49	4.74	4.74	0.60224	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.96100	0.8729	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96914	0.9669	10	0.87932	D	0	.	12.1608	0.54103	1.0:0.0:0.0:0.0	.	13	Q9BVG3	TRI62_HUMAN	T	13	ENSP00000291416:I13T	ENSP00000291416:I13T	I	-	2	0	TRIM62	33419583	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	9.080000	0.94040	1.740000	0.51718	0.402000	0.26972	ATC	.	.		0.711	TRIM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011890.1	NM_018207	
GRIK3	2899	hgsc.bcm.edu	37	1	37282833	37282833	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:37282833C>A	ENST00000373091.3	-	13	1935	c.1919G>T	c.(1918-1920)gGc>gTc	p.G640V	GRIK3_ENST00000373093.4_Missense_Mutation_p.G640V	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	640					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CCACCAGATGCCACCAATGAT	0.552																																					p.G640V		Atlas-SNP	.											.	GRIK3	195	.	0			c.G1919T						.						164.0	143.0	150.0					1																	37282833		2203	4300	6503	SO:0001583	missense	2899	exon13			CAGATGCCACCAA	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1919G>T	chr1.hg19:g.37282833C>A	ENSP00000362183:p.Gly640Val	127.0	0.0		188.0	72.0	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	hg19	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029633	0.93518	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	D;D	0.96913	-4.17;-4.17	5.74	5.74	0.90152	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	D	0.98143	0.9387	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98686	1.0694	10	0.87932	D	0	.	19.9326	0.97124	0.0:1.0:0.0:0.0	.	640;640	A9Z1Z8;Q13003	.;GRIK3_HUMAN	V	640	ENSP00000362183:G640V;ENSP00000362185:G640V	ENSP00000362183:G640V	G	-	2	0	GRIK3	37055420	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.720000	0.93068	0.650000	0.86243	GGC	.	.		0.552	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
NRD1	4898	hgsc.bcm.edu	37	1	52306057	52306057	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:52306057A>T	ENST00000354831.7	-	2	660	c.471T>A	c.(469-471)gaT>gaA	p.D157E	NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000352171.7_Missense_Mutation_p.D157E|NRD1_ENST00000544028.1_Missense_Mutation_p.D25E|NRD1_ENST00000539524.1_Missense_Mutation_p.D25E	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CAGAAtcttcatcatcatctt	0.373																																					p.D157E		Atlas-SNP	.											.	NRD1	89	.	0			c.T471A						.						195.0	158.0	171.0					1																	52306057		2203	4300	6503	SO:0001583	missense	4898	exon2			ATCTTCATCATCA	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.471T>A	chr1.hg19:g.52306057A>T	ENSP00000346890:p.Asp157Glu	220.0	0.0		263.0	11.0	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	A	8.848	0.943971	0.18281	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.52754	1.49;3.25;0.65;1.57	5.22	2.89	0.33648	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.397003	0.22061	N	0.065179	T	0.22475	0.0542	.	.	.	0.26633	N	0.972435	B;B;B	0.13145	0.007;0.004;0.004	B;B;B	0.12156	0.007;0.003;0.003	T	0.25813	-1.0121	9	0.02654	T	1	-2.3898	11.1792	0.48618	0.9192:0.0:0.0808:0.0	.	157;156;157	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	E	157;157;25;157;25	ENSP00000262679:D157E;ENSP00000346890:D157E;ENSP00000444416:D25E;ENSP00000442262:D25E	ENSP00000262679:D157E	D	-	3	2	NRD1	52078645	0.996000	0.38824	1.000000	0.80357	0.777000	0.43975	1.218000	0.32467	0.313000	0.23062	-1.236000	0.01555	GAT	.	.		0.373	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
NRD1	4898	hgsc.bcm.edu	37	1	52306079	52306079	+	Missense_Mutation	SNP	T	T	A	rs62648104		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:52306079T>A	ENST00000354831.7	-	2	638	c.449A>T	c.(448-450)gAg>gTg	p.E150V	NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000352171.7_Missense_Mutation_p.E150V|NRD1_ENST00000544028.1_Missense_Mutation_p.E18V|NRD1_ENST00000539524.1_Missense_Mutation_p.E18V	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	0	Asp/Glu-rich (highly acidic).|Poly-Glu.				cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						ttcttcttcctccacctcctc	0.378																																					p.E150V		Atlas-SNP	.											.	NRD1	89	.	0			c.A449T						.						163.0	138.0	146.0					1																	52306079		2203	4300	6503	SO:0001583	missense	4898	exon2			TCTTCCTCCACCT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.449A>T	chr1.hg19:g.52306079T>A	ENSP00000346890:p.Glu150Val	164.0	0.0		177.0	14.0	NM_001101662	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	3.056	-0.194350	0.06259	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.38240	1.31;3.15;1.15;1.22	5.25	2.92	0.33932	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.525899	0.19688	N	0.108344	T	0.18341	0.0440	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23650	0.062;0.089;0.01	B;B;B	0.17098	0.017;0.007;0.007	T	0.14755	-1.0461	10	0.38643	T	0.18	-0.0317	5.1939	0.15225	0.0:0.1704:0.2022:0.6274	rs62648104	150;150;150	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	V	150;150;18;150;18	ENSP00000262679:E150V;ENSP00000346890:E150V;ENSP00000444416:E18V;ENSP00000442262:E18V	ENSP00000262679:E150V	E	-	2	0	NRD1	52078667	0.129000	0.22400	0.012000	0.15200	0.145000	0.21501	0.870000	0.28010	0.317000	0.23160	0.454000	0.30748	GAG	.	T|0.024;A|0.976		0.378	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
DAB1	1600	hgsc.bcm.edu	37	1	57480890	57480890	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:57480890T>C	ENST00000371231.1	-	13	1243	c.1209A>G	c.(1207-1209)caA>caG	p.Q403Q	DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371236.2_Silent_p.Q370Q|DAB1_ENST00000439789.2_Silent_p.Q284Q|DAB1_ENST00000414851.2_Silent_p.Q352Q|DAB1_ENST00000420954.2_Silent_p.Q368Q|DAB1_ENST00000371234.4_Silent_p.Q370Q			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	403					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GCATAACAGTTTGTGTGGGCA	0.637																																					p.Q370Q		Atlas-SNP	.											.	DAB1	129	.	0			c.A1110G						.						86.0	74.0	78.0					1																	57480890		2203	4300	6503	SO:0001819	synonymous_variant	1600	exon14			AACAGTTTGTGTG	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1209A>G	chr1.hg19:g.57480890T>C		41.0	0.0		64.0	5.0	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	hg19																																																																																				.	.		0.637	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
INADL	10207	hgsc.bcm.edu	37	1	62593700	62593700	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:62593700A>G	ENST00000371158.2	+	40	5214	c.5100A>G	c.(5098-5100)ggA>ggG	p.G1700G	INADL_ENST00000472512.1_3'UTR	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1700	PDZ 10. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GTCCCTTAGGAGATATCCCCG	0.413																																					p.G1700G		Atlas-SNP	.											.	INADL	179	.	0			c.A5100G						.						96.0	92.0	93.0					1																	62593700		1894	4125	6019	SO:0001819	synonymous_variant	10207	exon40			CTTAGGAGATATC	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.5100A>G	chr1.hg19:g.62593700A>G		62.0	0.0		86.0	4.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Silent	SNP	ENST00000371158.2	hg19	CCDS617.2																																																																																			.	.		0.413	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
RAVER2	55225	hgsc.bcm.edu	37	1	65255125	65255125	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:65255125A>G	ENST00000294428.3	+	5	1111	c.1033A>G	c.(1033-1035)Aaa>Gaa	p.K345E	RAVER2_ENST00000430964.2_Missense_Mutation_p.K51E|RAVER2_ENST00000371072.4_Missense_Mutation_p.K345E			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	345						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						ACAAATTATGAAAAGTTTAAA	0.373																																					p.K345E		Atlas-SNP	.											.	RAVER2	56	.	0			c.A1033G						.						99.0	91.0	94.0					1																	65255125		1849	4092	5941	SO:0001583	missense	55225	exon5			ATTATGAAAAGTT	AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.1033A>G	chr1.hg19:g.65255125A>G	ENSP00000294428:p.Lys345Glu	82.0	0.0		80.0	27.0	NM_018211	Q6P141|Q9NPV7	Missense_Mutation	SNP	ENST00000294428.3	hg19		.	.	.	.	.	.	.	.	.	.	A	16.29	3.081993	0.55861	.	.	ENSG00000162437	ENST00000371072;ENST00000294428;ENST00000430964	T;T	0.32753	1.44;1.45	4.9	4.9	0.64082	.	0.204244	0.50627	D	0.000116	T	0.13713	0.0332	L	0.46157	1.445	0.27606	N	0.94882	P;P	0.50943	0.9;0.94	B;B	0.43754	0.248;0.43	T	0.06232	-1.0838	10	0.23302	T	0.38	-33.0872	10.399	0.44218	0.8359:0.1641:0.0:0.0	.	345;345	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	E	345;345;51	ENSP00000360112:K345E;ENSP00000294428:K345E	ENSP00000294428:K345E	K	+	1	0	RAVER2	65027713	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	5.683000	0.68189	1.835000	0.53391	0.482000	0.46254	AAA	.	.		0.373	RAVER2-201	KNOWN	basic	protein_coding	protein_coding		NM_018211	
FAM73A	374986	hgsc.bcm.edu	37	1	78245387	78245387	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:78245387T>C	ENST00000370791.3	+	1	79	c.47T>C	c.(46-48)gTg>gCg	p.V16A	RNA5SP21_ENST00000410917.1_RNA|FAM73A_ENST00000443751.2_Missense_Mutation_p.V16A	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	16						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		GAAGCTGGCGTGGGCAGGCCA	0.672																																					p.V16A		Atlas-SNP	.											.	FAM73A	56	.	0			c.T47C						.						7.0	7.0	7.0					1																	78245387		2175	4250	6425	SO:0001583	missense	374986	exon1			CTGGCGTGGGCAG		CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.47T>C	chr1.hg19:g.78245387T>C	ENSP00000359827:p.Val16Ala	49.0	0.0		90.0	4.0	NM_001270384	Q6MZG0	Missense_Mutation	SNP	ENST00000370791.3	hg19	CCDS681.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.345644	0.41498	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.31769	1.96;1.48	4.33	-2.21	0.06973	.	1.377560	0.05336	N	0.529266	T	0.04272	0.0118	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.35624	-0.9781	10	0.87932	D	0	-8.5736	0.8207	0.01111	0.1575:0.2444:0.1618:0.4362	.	16;16;16	F8W7S1;B7ZLZ8;Q8NAN2	.;.;FA73A_HUMAN	A	16	ENSP00000359827:V16A;ENSP00000393675:V16A	ENSP00000359827:V16A	V	+	2	0	FAM73A	78017975	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	-1.357000	0.02607	-0.363000	0.08101	-0.321000	0.08615	GTG	.	.		0.672	FAM73A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026931.1	NM_198549	
CLCA4	22802	hgsc.bcm.edu	37	1	87025972	87025972	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:87025972A>G	ENST00000370563.3	+	3	421	c.379A>G	c.(379-381)Aaa>Gaa	p.K127E	CLCA4_ENST00000263723.5_5'UTR	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	127	Metalloprotease domain. {ECO:0000250|UniProtKB:A8K7I4}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		ATGTGGAGAGAAAGGCGAATA	0.388																																					p.K127E		Atlas-SNP	.											.	CLCA4	131	.	0			c.A379G						.						141.0	123.0	128.0					1																	87025972		1886	4128	6014	SO:0001583	missense	22802	exon3			GGAGAGAAAGGCG	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.379A>G	chr1.hg19:g.87025972A>G	ENSP00000359594:p.Lys127Glu	52.0	0.0		91.0	4.0	NM_012128	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	ENST00000370563.3	hg19	CCDS41355.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.175595	0.57692	.	.	ENSG00000016602	ENST00000370563	T	0.12672	2.66	5.75	3.25	0.37280	Chloride channel calcium-activated (1);	0.388829	0.28257	N	0.016019	T	0.12646	0.0307	L	0.53617	1.68	0.80722	D	1	P	0.42649	0.786	P	0.51945	0.685	T	0.03068	-1.1076	10	0.28530	T	0.3	-22.0051	12.9577	0.58441	0.5335:0.4665:0.0:0.0	.	127	Q14CN2	CLCA4_HUMAN	E	127	ENSP00000359594:K127E	ENSP00000359594:K127E	K	+	1	0	CLCA4	86798560	0.356000	0.24930	0.890000	0.34922	0.995000	0.86356	0.995000	0.29706	0.961000	0.38030	0.533000	0.62120	AAA	.	.		0.388	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
CLCA4	22802	hgsc.bcm.edu	37	1	87038340	87038340	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:87038340C>T	ENST00000370563.3	+	9	1446	c.1404C>T	c.(1402-1404)ggC>ggT	p.G468G	CLCA4_ENST00000496322.1_3'UTR|CLCA4_ENST00000263723.5_Silent_p.G181G|RP4-651E10.4_ENST00000456587.1_RNA	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	468	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		AGAACAATGGCCTCATTGATG	0.363																																					p.G468G		Atlas-SNP	.											.	CLCA4	131	.	0			c.C1404T						.						106.0	110.0	109.0					1																	87038340		2184	4296	6480	SO:0001819	synonymous_variant	22802	exon9			CAATGGCCTCATT	AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.1404C>T	chr1.hg19:g.87038340C>T		109.0	0.0		98.0	4.0	NM_012128	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Silent	SNP	ENST00000370563.3	hg19	CCDS41355.1																																																																																			.	.		0.363	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028292.1	NM_012128	
PKN2	5586	hgsc.bcm.edu	37	1	89299097	89299097	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:89299097T>C	ENST00000370521.3	+	22	3280	c.2921T>C	c.(2920-2922)tTc>tCc	p.F974S	PKN2_ENST00000370513.5_Missense_Mutation_p.F926S|PKN2_ENST00000495119.1_3'UTR|PKN2_ENST00000370505.3_Missense_Mutation_p.F817S|PKN2_ENST00000544045.1_Missense_Mutation_p.F648S	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	974	AGC-kinase C-terminal.|Necessary for the catalytic activity.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		CAGGAAATGTTCAGAGATTTT	0.403																																					p.F974S		Atlas-SNP	.											.	PKN2	109	.	0			c.T2921C						.						84.0	84.0	84.0					1																	89299097		1985	4158	6143	SO:0001583	missense	5586	exon22			AAATGTTCAGAGA	U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.2921T>C	chr1.hg19:g.89299097T>C	ENSP00000359552:p.Phe974Ser	69.0	0.0		70.0	4.0	NM_006256	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	hg19	CCDS714.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.553933	0.86231	.	.	ENSG00000065243	ENST00000370521;ENST00000370505;ENST00000370513;ENST00000544045	D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87	5.84	5.84	0.93424	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.47455	U	0.000226	D	0.97473	0.9173	H	0.99299	4.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99338	1.0911	10	0.87932	D	0	.	16.2055	0.82126	0.0:0.0:0.0:1.0	.	958;926;974	B4DTP5;E7ESL7;Q16513	.;.;PKN2_HUMAN	S	974;817;926;648	ENSP00000359552:F974S;ENSP00000359536:F817S;ENSP00000359544:F926S;ENSP00000439643:F648S	ENSP00000359536:F817S	F	+	2	0	PKN2	89071685	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.698000	0.84413	2.226000	0.72624	0.482000	0.46254	TTC	.	.		0.403	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3	NM_006256	
COL11A1	1301	hgsc.bcm.edu	37	1	103481268	103481268	+	Missense_Mutation	SNP	C	C	A	rs150428394		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:103481268C>A	ENST00000370096.3	-	12	1756	c.1444G>T	c.(1444-1446)Gct>Tct	p.A482S	COL11A1_ENST00000358392.2_Missense_Mutation_p.A494S|COL11A1_ENST00000512756.1_Missense_Mutation_p.A366S|COL11A1_ENST00000353414.4_Missense_Mutation_p.A443S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	482	Collagen-like 1.|Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGACCATCAGCCCCTGGTAAG	0.353																																					p.A494S		Atlas-SNP	.											.	COL11A1	972	.	0			c.G1480T						.						37.0	36.0	36.0					1																	103481268		2203	4299	6502	SO:0001583	missense	1301	exon12			CATCAGCCCCTGG	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1444G>T	chr1.hg19:g.103481268C>A	ENSP00000359114:p.Ala482Ser	134.0	0.0		129.0	45.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531033	0.45073	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.42	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.91157	0.7215	L	0.40543	1.245	0.80722	D	1	P;P;P;P	0.45348	0.77;0.827;0.827;0.856	B;B;P;P	0.48454	0.376;0.442;0.52;0.578	D	0.89616	0.3845	10	0.16896	T	0.51	.	18.675	0.91525	0.0:1.0:0.0:0.0	.	366;443;494;482	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	S	482;494;443;366;494	ENSP00000359114:A482S;ENSP00000351163:A494S;ENSP00000302551:A443S;ENSP00000426533:A366S;ENSP00000408640:A494S	ENSP00000302551:A443S	A	-	1	0	COL11A1	103253856	1.000000	0.71417	0.997000	0.53966	0.907000	0.53573	5.552000	0.67281	2.510000	0.84645	0.585000	0.79938	GCT	.	C|1.000;T|0.000		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
GPSM2	29899	hgsc.bcm.edu	37	1	109465168	109465168	+	Missense_Mutation	SNP	T	T	A	rs374875864|rs35029887|rs201481482	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:109465168T>A	ENST00000406462.2	+	14	2343	c.1570T>A	c.(1570-1572)Tct>Act	p.S524T	GPSM2_ENST00000264126.3_Missense_Mutation_p.S524T|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	524					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		AACAACAACTTCTTCCACTCC	0.373																																					p.S524T		Atlas-SNP	.											.	GPSM2	56	.	0			c.T1570A						.						79.0	117.0	104.0					1																	109465168		2190	4293	6483	SO:0001583	missense	29899	exon13			ACAACTTCTTCCA	AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.1570T>A	chr1.hg19:g.109465168T>A	ENSP00000385510:p.Ser524Thr	53.0	0.0		80.0	5.0	NM_013296	Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	ENST00000406462.2	hg19	CCDS792.2	.	.	.	.	.	.	.	.	.	.	T	7.387	0.629929	0.14257	.	.	ENSG00000121957	ENST00000406462;ENST00000264126	D;D	0.93712	-3.27;-3.27	6.17	-6.6	0.01824	.	0.546439	0.21807	N	0.068824	T	0.62563	0.2438	N	0.08118	0	0.09310	N	0.999996	B	0.11235	0.004	B	0.06405	0.002	T	0.64601	-0.6369	10	0.15499	T	0.54	-3.6969	9.2309	0.37437	0.0:0.2789:0.4599:0.2613	.	524	P81274	GPSM2_HUMAN	T	524	ENSP00000385510:S524T;ENSP00000264126:S524T	ENSP00000264126:S524T	S	+	1	0	GPSM2	109266691	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-1.555000	0.01697	-0.250000	0.11733	TCT	.	.		0.373	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032400.3	NM_013296	
HIPK1	204851	hgsc.bcm.edu	37	1	114500750	114500750	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:114500750T>C	ENST00000369558.1	+	8	2050	c.1818T>C	c.(1816-1818)gaT>gaC	p.D606D	HIPK1_ENST00000369553.1_Silent_p.D212D|HIPK1_ENST00000406344.1_Silent_p.D212D|HIPK1_ENST00000369554.2_Silent_p.D606D|HIPK1_ENST00000340480.4_Silent_p.D232D|HIPK1_ENST00000369555.2_Silent_p.D606D|HIPK1_ENST00000426820.2_Silent_p.D606D|HIPK1_ENST00000369559.4_Silent_p.D606D|HIPK1_ENST00000369561.4_Silent_p.D572D			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	606					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTAATTCAGATGTCTCACTAC	0.458																																					p.D606D		Atlas-SNP	.											.	HIPK1	195	.	0			c.T1818C						.						134.0	132.0	133.0					1																	114500750		2203	4300	6503	SO:0001819	synonymous_variant	204851	exon8			TTCAGATGTCTCA	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.1818T>C	chr1.hg19:g.114500750T>C		112.0	0.0		136.0	50.0	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Silent	SNP	ENST00000369558.1	hg19	CCDS867.1																																																																																			.	.		0.458	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
DENND4B	9909	hgsc.bcm.edu	37	1	153907287	153907287	+	Missense_Mutation	SNP	G	G	C	rs3835302|rs199597671		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:153907287G>C	ENST00000361217.4	-	18	3140	c.2722C>G	c.(2722-2724)Cag>Gag	p.Q908E	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	908	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			tcctgctgctgctgctgctgc	0.632																																					p.Q908E		Atlas-SNP	.											.	DENND4B	210	.	0			c.C2722G						.						23.0	27.0	26.0					1																	153907287		2184	4281	6465	SO:0001583	missense	9909	exon18			GCTGCTGCTGCTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2722C>G	chr1.hg19:g.153907287G>C	ENSP00000354597:p.Gln908Glu	46.0	0.0		80.0	9.0	NM_014856	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	hg19	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	G	1.785	-0.481073	0.04383	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06294	3.33;3.32	2.67	0.673	0.17941	.	5.053470	0.00166	N	0.000001	T	0.00815	0.0027	N	0.14661	0.345	0.19300	N	0.999977	B	0.02656	0.0	B	0.04013	0.001	T	0.26573	-1.0099	10	0.02654	T	1	-2.4288	3.3651	0.07201	0.1454:0.0:0.5849:0.2697	.	908	O75064	DEN4B_HUMAN	E	908;919	ENSP00000354597:Q908E;ENSP00000357635:Q919E	ENSP00000354597:Q908E	Q	-	1	0	DENND4B	152173911	0.943000	0.32029	0.986000	0.45419	0.760000	0.43138	0.537000	0.23144	0.194000	0.20326	0.271000	0.19318	CAG	.	.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
HAX1	10456	hgsc.bcm.edu	37	1	154247645	154247645	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:154247645T>C	ENST00000328703.7	+	5	785	c.572T>C	c.(571-573)gTt>gCt	p.V191A	HAX1_ENST00000457918.2_Missense_Mutation_p.V143A|HAX1_ENST00000532105.1_Missense_Mutation_p.V63A|HAX1_ENST00000483970.2_Missense_Mutation_p.V199A	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	191	Involved in CASP9 binding.|Involved in GNA13 binding.|Involved in HCLS1 binding.|Involved in PKD2 binding.|Required for localization in sarcoplasmic reticulum. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GATTCCCAGGTTTCCCAGGAG	0.483									Kostmann syndrome																												p.V191A		Atlas-SNP	.											.	HAX1	25	.	0			c.T572C						.						62.0	63.0	63.0					1																	154247645		2203	4300	6503	SO:0001583	missense	10456	exon5	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	CCCAGGTTTCCCA	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.572T>C	chr1.hg19:g.154247645T>C	ENSP00000329002:p.Val191Ala	93.0	0.0		91.0	4.0	NM_006118	A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Missense_Mutation	SNP	ENST00000328703.7	hg19	CCDS1064.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.040682	0.75732	.	.	ENSG00000143575	ENST00000328703;ENST00000457918;ENST00000483970;ENST00000435087;ENST00000532105	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.81697	0.4877	M	0.82630	2.6	0.58432	D	0.999992	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.87578	0.993;0.995;0.998;0.995	D	0.85121	0.0969	10	0.87932	D	0	-16.2253	13.3471	0.60580	0.0:0.0:0.0:1.0	.	199;165;143;191	O00165-2;O00165-3;O00165-5;O00165	.;.;.;HAX1_HUMAN	A	191;143;199;195;63	ENSP00000329002:V191A;ENSP00000411448:V143A;ENSP00000435088:V199A;ENSP00000394920:V195A;ENSP00000433951:V63A	ENSP00000329002:V191A	V	+	2	0	HAX1	152514269	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	5.600000	0.67599	2.168000	0.68352	0.460000	0.39030	GTT	.	.		0.483	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087650.1	NM_006118	
EFNA3	1944	hgsc.bcm.edu	37	1	155057654	155057654	+	Silent	SNP	C	C	A	rs199552063	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:155057654C>A	ENST00000368408.3	+	2	286	c.216C>A	c.(214-216)ggC>ggA	p.G72G	EFNA3_ENST00000505139.1_Silent_p.G67G|EFNA3_ENST00000418360.2_Silent_p.G72G|EFNA3_ENST00000556931.1_Silent_p.G67G	NM_004952.4	NP_004943.1	P52797	EFNA3_HUMAN	ephrin-A3	72	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.			Missing (in Ref. 2; AAA52368). {ECO:0000305}.	axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		all cancers(21;5.67e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000284)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGGGGGTgggccccggggcgg	0.662																																					p.G72G		Atlas-SNP	.											.	EFNA3	15	.	0			c.C216A						.						21.0	26.0	24.0					1																	155057654		2181	4259	6440	SO:0001819	synonymous_variant	1944	exon2			GGTGGGCCCCGGG	BC017722	CCDS1090.1	1q21-q22	2011-03-09			ENSG00000143590	ENSG00000143590		"""Ephrins"""	3223	protein-coding gene	gene with protein product		601381		EPLG3		8660976	Standard	NM_004952		Approved	LERK3, Ehk1-L	uc001fhf.3	P52797	OTTHUMG00000035313	ENST00000368408.3:c.216C>A	chr1.hg19:g.155057654C>A		30.0	0.0		68.0	10.0	NM_004952	B7ZAD3|D3DV85|Q0VGC9|Q5SR70	Silent	SNP	ENST00000368408.3	hg19	CCDS1090.1																																																																																			.	.		0.662	EFNA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085429.1	NM_004952	
EFNA3	1944	hgsc.bcm.edu	37	1	155057657	155057657	+	Silent	SNP	C	C	G	rs199552063	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:155057657C>G	ENST00000368408.3	+	2	289	c.219C>G	c.(217-219)ccC>ccG	p.P73P	EFNA3_ENST00000505139.1_Silent_p.P68P|EFNA3_ENST00000418360.2_Silent_p.P73P|EFNA3_ENST00000556931.1_Silent_p.P68P	NM_004952.4	NP_004943.1	P52797	EFNA3_HUMAN	ephrin-A3	73	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.			Missing (in Ref. 2; AAA52368). {ECO:0000305}.	axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		all cancers(21;5.67e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000284)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGTgggccccggggcgggac	0.662																																					p.P73P		Atlas-SNP	.											.	EFNA3	15	.	0			c.C219G						.						19.0	25.0	23.0					1																	155057657		2168	4252	6420	SO:0001819	synonymous_variant	1944	exon2			GGGCCCCGGGGCG	BC017722	CCDS1090.1	1q21-q22	2011-03-09			ENSG00000143590	ENSG00000143590		"""Ephrins"""	3223	protein-coding gene	gene with protein product		601381		EPLG3		8660976	Standard	NM_004952		Approved	LERK3, Ehk1-L	uc001fhf.3	P52797	OTTHUMG00000035313	ENST00000368408.3:c.219C>G	chr1.hg19:g.155057657C>G		30.0	0.0		72.0	10.0	NM_004952	B7ZAD3|D3DV85|Q0VGC9|Q5SR70	Silent	SNP	ENST00000368408.3	hg19	CCDS1090.1																																																																																			.	.		0.662	EFNA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085429.1	NM_004952	
MTX1	4580	hgsc.bcm.edu	37	1	155180142	155180142	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:155180142T>C	ENST00000368376.3	+	2	640	c.534T>C	c.(532-534)taT>taC	p.Y178Y	MTX1_ENST00000609421.1_Silent_p.Y29Y|THBS3_ENST00000541990.1_5'Flank|THBS3_ENST00000457183.2_5'Flank|THBS3_ENST00000368378.3_5'Flank|THBS3_ENST00000486260.1_5'Flank|MTX1_ENST00000316721.4_Silent_p.Y178Y|RP11-263K19.6_ENST00000455788.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1	178					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGCAGACCTATGCCAGATTTA	0.502																																					p.Y178Y		Atlas-SNP	.											.	MTX1	17	.	0			c.T534C						.						121.0	111.0	115.0					1																	155180142		2203	4300	6503	SO:0001819	synonymous_variant	4580	exon2			GACCTATGCCAGA		CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708	ENST00000368376.3:c.534T>C	chr1.hg19:g.155180142T>C		106.0	0.0		119.0	51.0	NM_198883	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	Silent	SNP	ENST00000368376.3	hg19	CCDS1100.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759243	0.31137	.	.	ENSG00000173171	ENST00000424959	.	.	.	5.87	3.58	0.41010	.	.	.	.	.	T	0.41949	0.1181	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38908	-0.9639	4	.	.	.	-29.5015	6.5199	0.22269	0.0:0.2489:0.0:0.7511	.	.	.	.	T	34	.	.	M	+	2	0	MTX1	153446766	0.994000	0.37717	1.000000	0.80357	0.927000	0.56198	0.182000	0.16900	1.166000	0.42689	0.533000	0.62120	ATG	.	.		0.502	MTX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086844.1	NM_198883	
BCAN	63827	hgsc.bcm.edu	37	1	156622302	156622302	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:156622302A>G	ENST00000329117.5	+	8	1896	c.1560A>G	c.(1558-1560)tcA>tcG	p.S520S	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Silent_p.S520S	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	520	O-glycosylated at two sites.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTGGTGCATCACCACTTCCTG	0.642																																					p.S520S		Atlas-SNP	.											.	BCAN	174	.	0			c.A1560G						.						24.0	23.0	23.0					1																	156622302		2203	4299	6502	SO:0001819	synonymous_variant	63827	exon8			TGCATCACCACTT	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1560A>G	chr1.hg19:g.156622302A>G		48.0	0.0		78.0	4.0	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	ENST00000329117.5	hg19	CCDS1149.1																																																																																			.	.		0.642	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
CD48	962	hgsc.bcm.edu	37	1	160648863	160648863	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:160648863A>G	ENST00000368046.3	-	4	798	c.711T>C	c.(709-711)atT>atC	p.I237I	RP11-404F10.2_ENST00000443928.2_RNA|RP11-404F10.2_ENST00000588034.1_RNA|RP11-404F10.2_ENST00000598917.2_RNA	NM_001778.3	NP_001769.2	P09326	CD48_HUMAN	CD48 molecule	237					blood coagulation (GO:0007596)|defense response (GO:0006952)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|stomach(1)	10	all_cancers(52;2.18e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ACAGGCCAAGAATGGTGGGCA	0.473																																					p.I237I		Atlas-SNP	.											.	CD48	31	.	0			c.T711C						.						117.0	109.0	112.0					1																	160648863		2203	4300	6503	SO:0001819	synonymous_variant	962	exon4			GCCAAGAATGGTG	BC016182	CCDS1208.1, CCDS72955.1	1q21.3-q22	2013-01-29	2006-03-31		ENSG00000117091	ENSG00000117091		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1683	protein-coding gene	gene with protein product		109530	"""CD48 antigen (B-cell membrane protein)"", ""CD48 molecule """	BCM1		2828034	Standard	NM_001256030		Approved	BLAST, mCD48, hCD48, SLAMF2	uc001fwo.2	P09326	OTTHUMG00000024009	ENST00000368046.3:c.711T>C	chr1.hg19:g.160648863A>G		63.0	0.0		85.0	4.0	NM_001778	Q5U055|Q8MGR0	Silent	SNP	ENST00000368046.3	hg19	CCDS1208.1																																																																																			.	.		0.473	CD48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060471.1	NM_001778	
FMO3	2328	hgsc.bcm.edu	37	1	171061807	171061807	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:171061807A>G	ENST00000367755.4	+	2	119	c.8A>G	c.(7-9)aAg>aGg	p.K3R	FMO3_ENST00000392085.2_Missense_Mutation_p.K3R|FMO3_ENST00000542847.1_5'UTR|FMO3_ENST00000534514.1_3'UTR|FMO3_ENST00000538429.1_Missense_Mutation_p.K3R	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	3					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	ACCATGGGGAAGAAAGTGGCC	0.458																																					p.K3R		Atlas-SNP	.											.	FMO3	73	.	0			c.A8G						.						91.0	89.0	90.0					1																	171061807		2203	4300	6503	SO:0001583	missense	2328	exon2			TGGGGAAGAAAGT	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.8A>G	chr1.hg19:g.171061807A>G	ENSP00000356729:p.Lys3Arg	87.0	0.0		98.0	4.0	NM_006894	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	ENST00000367755.4	hg19	CCDS1292.1	.	.	.	.	.	.	.	.	.	.	A	12.41	1.930519	0.34096	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000538429	T;T;T	0.61392	0.11;0.11;0.22	4.56	2.15	0.27550	.	0.441677	0.21716	N	0.070196	T	0.31638	0.0803	L	0.46741	1.465	0.20196	N	0.999922	B;B	0.24368	0.022;0.102	B;B	0.34385	0.018;0.181	T	0.36065	-0.9763	10	0.46703	T	0.11	-7.0076	8.3035	0.32027	0.8307:0.0:0.1693:0.0	.	3;3	F5H261;P31513	.;FMO3_HUMAN	R	3	ENSP00000356729:K3R;ENSP00000375935:K3R;ENSP00000439500:K3R	ENSP00000356729:K3R	K	+	2	0	FMO3	169328431	0.042000	0.20092	0.258000	0.24420	0.981000	0.71138	1.404000	0.34623	0.122000	0.18314	0.460000	0.39030	AAG	.	.		0.458	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
PRG4	10216	hgsc.bcm.edu	37	1	186276411	186276411	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:186276411G>A	ENST00000445192.2	+	7	1605	c.1560G>A	c.(1558-1560)aaG>aaA	p.K520K	PRG4_ENST00000367483.4_Silent_p.K479K|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.K477K|PRG4_ENST00000367485.4_Silent_p.K427K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	520	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CCACTCCCAAGGAGCCTGCAC	0.632																																					p.K520K		Atlas-SNP	.											PRG4,NS,malignant_melanoma,0,1	PRG4	259	.	0			c.G1560A						.						129.0	118.0	122.0					1																	186276411		2203	4299	6502	SO:0001819	synonymous_variant	10216	exon7			TCCCAAGGAGCCT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1560G>A	chr1.hg19:g.186276411G>A		79.0	2.0		91.0	4.0	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	hg19	CCDS1369.1																																																																																			.	.		0.632	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
KCNT2	343450	hgsc.bcm.edu	37	1	196451495	196451495	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:196451495C>G	ENST00000294725.9	-	4	1205	c.290G>C	c.(289-291)tGg>tCg	p.W97S	KCNT2_ENST00000609185.1_Missense_Mutation_p.W97S|KCNT2_ENST00000367431.4_Missense_Mutation_p.W97S|KCNT2_ENST00000367433.5_Missense_Mutation_p.W97S|KCNT2_ENST00000451324.2_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	97					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCTGTTCACCCAAAAGATATG	0.274																																					p.W97S		Atlas-SNP	.											.	KCNT2	243	.	0			c.G290C						.						50.0	47.0	48.0					1																	196451495		2202	4299	6501	SO:0001583	missense	343450	exon4			TTCACCCAAAAGA	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.290G>C	chr1.hg19:g.196451495C>G	ENSP00000294725:p.Trp97Ser	59.0	0.0		52.0	19.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	hg19	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.105261	0.77096	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.19532	2.14;2.19;2.38	5.44	5.44	0.79542	.	0.000000	0.56097	D	0.000028	T	0.54287	0.1849	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.993;0.999;0.999;0.993	T	0.60712	-0.7209	10	0.72032	D	0.01	-10.332	18.4088	0.90543	0.0:1.0:0.0:0.0	.	97;97;97;97	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	S	97	ENSP00000356403:W97S;ENSP00000356401:W97S;ENSP00000294725:W97S	ENSP00000294725:W97S	W	-	2	0	KCNT2	194718118	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.374000	0.73132	2.703000	0.92315	0.655000	0.94253	TGG	.	.		0.274	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
SOX13	9580	hgsc.bcm.edu	37	1	204092852	204092852	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:204092852T>C	ENST00000367204.1	+	12	1404	c.1295T>C	c.(1294-1296)aTg>aCg	p.M432T		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	432					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			AACGCCTTCATGGTGTGGGCC	0.597											OREG0014126	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M432T		Atlas-SNP	.											.	SOX13	38	.	0			c.T1295C						.						58.0	62.0	61.0					1																	204092852		2194	4299	6493	SO:0001583	missense	9580	exon12			CCTTCATGGTGTG		CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1295T>C	chr1.hg19:g.204092852T>C	ENSP00000356172:p.Met432Thr	44.0	0.0	2142	74.0	4.0	NM_005686	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	hg19	CCDS44299.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.742257	0.89573	.	.	ENSG00000143842	ENST00000367204	D	0.98249	-4.82	5.69	5.69	0.88448	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	D	0.000000	D	0.99260	0.9742	H	0.95745	3.715	0.80722	D	1	D;D;D	0.64830	0.994;0.994;0.994	D;D;D	0.75020	0.985;0.985;0.985	D	0.98914	1.0781	10	0.87932	D	0	.	15.6035	0.76642	0.0:0.0:0.0:1.0	.	299;299;432	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	T	432	ENSP00000356172:M432T	ENSP00000356172:M432T	M	+	2	0	SOX13	202359475	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.162000	0.67917	0.533000	0.62120	ATG	.	.		0.597	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087881.2	NM_005686	
IARS2	55699	hgsc.bcm.edu	37	1	220276069	220276069	+	Silent	SNP	A	A	G	rs112842443		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:220276069A>G	ENST00000302637.5	+	7	1004	c.900A>G	c.(898-900)caA>caG	p.Q300Q	IARS2_ENST00000366922.1_Silent_p.Q228Q	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	300					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GGACCACACAACCTTGGACGA	0.343																																					p.Q300Q		Atlas-SNP	.											.	IARS2	106	.	0			c.A900G						.						111.0	107.0	108.0					1																	220276069		2203	4300	6503	SO:0001819	synonymous_variant	55699	exon7			CACACAACCTTGG	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.900A>G	chr1.hg19:g.220276069A>G		65.0	0.0		76.0	4.0	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Silent	SNP	ENST00000302637.5	hg19	CCDS1523.1																																																																																			.	A|0.500;G|0.500		0.343	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
EPHX1	2052	hgsc.bcm.edu	37	1	226016567	226016567	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:226016567A>G	ENST00000366837.4	+	2	333	c.137A>G	c.(136-138)gAc>gGc	p.D46G	EPHX1_ENST00000467015.1_3'UTR|EPHX1_ENST00000272167.5_Missense_Mutation_p.D46G	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	46					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					AGGGAGGACGACAGCATCCGC	0.602																																					p.D46G		Atlas-SNP	.											.	EPHX1	57	.	0			c.A137G						.						43.0	38.0	40.0					1																	226016567		2203	4300	6503	SO:0001583	missense	2052	exon2			AGGACGACAGCAT	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.137A>G	chr1.hg19:g.226016567A>G	ENSP00000355802:p.Asp46Gly	84.0	0.0		99.0	5.0	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	hg19	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	A	8.638	0.895363	0.17613	.	.	ENSG00000143819	ENST00000445856;ENST00000272167;ENST00000448202;ENST00000366837	T;T;T;T	0.03831	3.79;3.79;3.79;3.79	5.0	3.85	0.44370	.	0.319521	0.30949	N	0.008543	T	0.04003	0.0112	N	0.19112	0.55	0.23232	N	0.998072	B	0.18013	0.025	B	0.20184	0.028	T	0.39292	-0.9621	10	0.33940	T	0.23	0.0749	11.7659	0.51930	0.6484:0.3516:0.0:0.0	.	46	P07099	HYEP_HUMAN	G	46	ENSP00000398491:D46G;ENSP00000272167:D46G;ENSP00000408469:D46G;ENSP00000355802:D46G	ENSP00000272167:D46G	D	+	2	0	EPHX1	224083190	0.856000	0.29760	0.988000	0.46212	0.303000	0.27691	1.829000	0.39121	0.726000	0.32339	0.379000	0.24179	GAC	.	.		0.602	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
LIN9	286826	hgsc.bcm.edu	37	1	226420805	226420805	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:226420805A>G	ENST00000328205.5	-	14	2108	c.1563T>C	c.(1561-1563)tcT>tcC	p.S521S	LIN9_ENST00000481685.1_Silent_p.S486S|LIN9_ENST00000366801.1_Silent_p.S470S	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	505					DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)				breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		ACCTGATATTAGAAGCGTCTA	0.323																																					p.S521S	Ovarian(197;1696 2974 11248 14117)	Atlas-SNP	.											.	LIN9	57	.	0			c.T1563C						.						68.0	75.0	73.0					1																	226420805		2203	4291	6494	SO:0001819	synonymous_variant	286826	exon14			GATATTAGAAGCG	AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.1563T>C	chr1.hg19:g.226420805A>G		59.0	0.0		90.0	4.0	NM_173083	Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Silent	SNP	ENST00000328205.5	hg19	CCDS1553.1																																																																																			.	.		0.323	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091523.2	NM_173083	
ADSS	159	hgsc.bcm.edu	37	1	244574699	244574699	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:244574699T>C	ENST00000366535.3	-	12	1524	c.1208A>G	c.(1207-1209)aAg>aGg	p.K403R	RP11-518L10.5_ENST00000417765.1_RNA	NM_001126.3	NP_001117.2			adenylosuccinate synthase											endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)			TGGGAGAGTCTTATATTGAAC	0.343																																					p.K403R		Atlas-SNP	.											.	ADSS	49	.	0			c.A1208G						.						130.0	129.0	130.0					1																	244574699		2203	4300	6503	SO:0001583	missense	159	exon12			AGAGTCTTATATT	BC012356	CCDS1624.1	1q44	2008-02-05			ENSG00000035687	ENSG00000035687	6.3.4.4		292	protein-coding gene	gene with protein product		103060				2004783, 1592113	Standard	NM_001126		Approved		uc001iaj.3	P30520	OTTHUMG00000040102	ENST00000366535.3:c.1208A>G	chr1.hg19:g.244574699T>C	ENSP00000355493:p.Lys403Arg	78.0	0.0		89.0	4.0	NM_001126		Missense_Mutation	SNP	ENST00000366535.3	hg19	CCDS1624.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.345552	0.61073	.	.	ENSG00000035687	ENST00000366535;ENST00000449326	T	0.45668	0.89	5.81	4.68	0.58851	.	0.088135	0.85682	D	0.000000	T	0.31199	0.0789	L	0.27975	0.815	0.41124	D	0.985835	B	0.06786	0.001	B	0.06405	0.002	T	0.07233	-1.0783	10	0.59425	D	0.04	-11.5745	11.9233	0.52803	0.0:0.068:0.0:0.932	.	403	P30520	PURA2_HUMAN	R	403;382	ENSP00000355493:K403R	ENSP00000355493:K403R	K	-	2	0	ADSS	242641322	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.999000	0.70665	1.014000	0.39417	0.528000	0.53228	AAG	.	.		0.343	ADSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096697.1	NM_001126	
CNST	163882	hgsc.bcm.edu	37	1	246754974	246754974	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:246754974A>T	ENST00000366513.4	+	2	379	c.110A>T	c.(109-111)gAt>gTt	p.D37V	CNST_ENST00000366512.3_Missense_Mutation_p.D37V|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	37					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						TCTGCATCAGATGAAAATGAA	0.493																																					p.D37V		Atlas-SNP	.											.	CNST	73	.	0			c.A110T						.						144.0	127.0	133.0					1																	246754974		2203	4300	6503	SO:0001583	missense	163882	exon2			CATCAGATGAAAA	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.110A>T	chr1.hg19:g.246754974A>T	ENSP00000355470:p.Asp37Val	119.0	0.0		143.0	45.0	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	hg19	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443183	0.83993	.	.	ENSG00000162852	ENST00000366513;ENST00000366512;ENST00000366511	T;T;T	0.26223	1.75;1.75;1.75	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	M	0.76002	2.32	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.55010	-0.8207	10	0.87932	D	0	-10.1254	14.5632	0.68156	1.0:0.0:0.0:0.0	.	37;37	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	V	37	ENSP00000355470:D37V;ENSP00000355469:D37V;ENSP00000355468:D37V	ENSP00000355468:D37V	D	+	2	0	CNST	244821597	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.987000	0.70571	2.371000	0.80710	0.533000	0.62120	GAT	.	.		0.493	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
WDR35	57539	hgsc.bcm.edu	37	2	20169327	20169327	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:20169327C>T	ENST00000345530.3	-	9	1037	c.922G>A	c.(922-924)Gca>Aca	p.A308T	WDR35_ENST00000281405.4_Missense_Mutation_p.A308T|WDR35_ENST00000416055.2_5'UTR	NM_001006657.1	NP_001006658.1	Q9P2L0	WDR35_HUMAN	WD repeat domain 35	308					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)		p.A308T(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(8)|lung(16)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAGATAGTGCAGATATTTCC	0.323																																					p.A308T		Atlas-SNP	.											WDR35,rectum,carcinoma,0,1	WDR35	92	.	1	Substitution - Missense(1)	large_intestine(1)	c.G922A						.						78.0	80.0	79.0					2																	20169327		2203	4300	6503	SO:0001583	missense	57539	exon9			ATAGTGCAGATAT	AB037757	CCDS1695.1, CCDS33152.1	2p24.3	2014-02-21			ENSG00000118965	ENSG00000118965		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	29250	protein-coding gene	gene with protein product		613602				10718198	Standard	NM_001006657		Approved	MGC33196, KIAA1336, IFT121, IFTA1	uc002rdi.3	Q9P2L0	OTTHUMG00000090737	ENST00000345530.3:c.922G>A	chr2.hg19:g.20169327C>T	ENSP00000314444:p.Ala308Thr	46.0	0.0		47.0	2.0	NM_020779	B3KVI5|Q4ZG01|Q8NE11	Missense_Mutation	SNP	ENST00000345530.3	hg19	CCDS33152.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100893	0.56183	.	.	ENSG00000118965	ENST00000345530;ENST00000281405	T;T	0.63096	-0.02;-0.02	4.58	3.67	0.42095	.	0.116795	0.56097	D	0.000027	T	0.59418	0.2192	M	0.69823	2.125	0.80722	D	1	B;B	0.26483	0.15;0.034	B;B	0.34779	0.189;0.081	T	0.51466	-0.8702	10	0.06494	T	0.89	-8.2294	12.0686	0.53603	0.3201:0.6799:0.0:0.0	.	308;308	Q9P2L0-2;Q9P2L0	.;WDR35_HUMAN	T	308	ENSP00000314444:A308T;ENSP00000281405:A308T	ENSP00000281405:A308T	A	-	1	0	WDR35	20032808	1.000000	0.71417	0.963000	0.40424	0.976000	0.68499	4.954000	0.63631	0.846000	0.35142	0.460000	0.39030	GCA	.	.		0.323	WDR35-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207472.2	NM_020779	
NRBP1	29959	hgsc.bcm.edu	37	2	27656637	27656637	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:27656637A>G	ENST00000233557.3	+	4	1140	c.308A>G	c.(307-309)gAa>gGa	p.E103G	NRBP1_ENST00000379852.3_Missense_Mutation_p.E103G|NRBP1_ENST00000379863.3_Missense_Mutation_p.E103G			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	103	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					CAGTTCTCTGAACGCAAGAAC	0.483																																					p.E103G		Atlas-SNP	.											.	NRBP1	40	.	0			c.A308G						.						116.0	113.0	114.0					2																	27656637		2203	4300	6503	SO:0001583	missense	29959	exon3			TCTCTGAACGCAA	AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.308A>G	chr2.hg19:g.27656637A>G	ENSP00000233557:p.Glu103Gly	74.0	0.0		81.0	4.0	NM_013392	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	hg19	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.029826	0.93575	.	.	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863;ENST00000419281	T;T;T	0.67171	-0.25;-0.25;-0.25	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77955	0.4208	M	0.64080	1.96	0.80722	D	1	D;D	0.60575	0.984;0.988	D;D	0.66716	0.91;0.946	T	0.78677	-0.2111	10	0.48119	T	0.1	-12.8784	13.9748	0.64265	1.0:0.0:0.0:0.0	.	103;103	F8W6G1;Q9UHY1	.;NRBP_HUMAN	G	103;83;103;103;103	ENSP00000233557:E103G;ENSP00000369181:E103G;ENSP00000369192:E103G	ENSP00000233557:E103G	E	+	2	0	NRBP1	27510141	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.847000	0.92166	1.988000	0.58038	0.459000	0.35465	GAA	.	.		0.483	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
FAM98A	25940	hgsc.bcm.edu	37	2	33811687	33811687	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:33811687A>G	ENST00000238823.8	-	6	802	c.662T>C	c.(661-663)cTg>cCg	p.L221P	FAM98A_ENST00000403368.1_Missense_Mutation_p.L221P|FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000441530.2_Missense_Mutation_p.L26P			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	222							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TTTTATTAGCAGCTTTCTCCG	0.348																																					p.L221P		Atlas-SNP	.											.	FAM98A	42	.	0			c.T662C						.						144.0	140.0	141.0					2																	33811687		2203	4300	6503	SO:0001583	missense	25940	exon6			ATTAGCAGCTTTC		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.662T>C	chr2.hg19:g.33811687A>G	ENSP00000238823:p.Leu221Pro	84.0	0.0		87.0	4.0	NM_015475	B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	ENST00000238823.8	hg19	CCDS33179.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252846	0.80135	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000403368;ENST00000441530	T;T;T	0.48836	0.8;0.8;0.8	5.76	4.59	0.56863	.	0.061993	0.64402	D	0.000014	T	0.63058	0.2479	L	0.52905	1.665	0.80722	D	1	D;D;P	0.71674	0.995;0.998;0.936	P;D;B	0.75484	0.879;0.986;0.367	T	0.65615	-0.6125	10	0.87932	D	0	-5.4484	13.2866	0.60247	0.8677:0.1323:0.0:0.0	.	222;52;221	Q8NCA5;B4DY25;Q8NCA5-2	FA98A_HUMAN;.;.	P	221;222;221;26	ENSP00000238823:L221P;ENSP00000384711:L221P;ENSP00000408716:L26P	ENSP00000238823:L221P	L	-	2	0	FAM98A	33665191	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.415000	0.80131	1.090000	0.41315	0.528000	0.53228	CTG	.	.		0.348	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
RMDN2	151393	hgsc.bcm.edu	37	2	38218373	38218373	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:38218373A>G	ENST00000406384.1	+	7	1072	c.878A>G	c.(877-879)gAt>gGt	p.D293G	RMDN2_ENST00000417700.2_Missense_Mutation_p.D148G|RMDN2_ENST00000234195.3_Missense_Mutation_p.D471G|RMDN2_ENST00000354545.2_Missense_Mutation_p.D293G|RMDN2_ENST00000407257.1_Missense_Mutation_p.D471G|RMDN2-AS1_ENST00000414365.2_RNA	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	293						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											GAACATCTAGATATAGCAATC	0.343																																					p.D471G		Atlas-SNP	.											.	.	.	.	0			c.A1412G						.						90.0	92.0	91.0					2																	38218373		2203	4300	6503	SO:0001583	missense	151393	exon7			ATCTAGATATAGC	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.878A>G	chr2.hg19:g.38218373A>G	ENSP00000386004:p.Asp293Gly	47.0	0.0		64.0	4.0	NM_144713	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	ENST00000406384.1	hg19	CCDS54351.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.758402	0.49468	.	.	ENSG00000115841	ENST00000354545;ENST00000406384;ENST00000407257;ENST00000417700;ENST00000234195;ENST00000442857	T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59	5.63	4.4	0.53042	Tetratricopeptide-like helical (1);	0.347273	0.30455	N	0.009598	T	0.64057	0.2564	M	0.84082	2.675	0.44985	D	0.998004	B;P;P;P	0.50943	0.39;0.94;0.94;0.894	B;P;P;P	0.51742	0.341;0.678;0.678;0.678	T	0.69946	-0.5007	10	0.72032	D	0.01	.	10.0512	0.42216	0.8492:0.0:0.0:0.1508	.	471;148;293;148	Q96LZ7-2;Q96LZ7-4;Q96LZ7;Q96LZ7-3	.;.;RMD2_HUMAN;.	G	293;293;471;148;471;148	ENSP00000346549:D293G;ENSP00000386004:D293G;ENSP00000385049:D471G;ENSP00000392977:D148G;ENSP00000234195:D471G;ENSP00000416367:D148G	ENSP00000234195:D471G	D	+	2	0	FAM82A1	38071877	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.193000	0.58385	2.271000	0.75665	0.533000	0.62120	GAT	.	.		0.343	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
DYNC2LI1	51626	hgsc.bcm.edu	37	2	44032355	44032355	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:44032355A>G	ENST00000260605.8	+	12	1063	c.963A>G	c.(961-963)gaA>gaG	p.E321E	DYNC2LI1_ENST00000605786.1_Silent_p.E322E|DYNC2LI1_ENST00000443170.3_Silent_p.E195E	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	321					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGAAAATGAAGTCGATGAGA	0.373																																					p.E322E		Atlas-SNP	.											.	DYNC2LI1	46	.	0			c.A966G						.						88.0	93.0	91.0					2																	44032355		2203	4300	6503	SO:0001819	synonymous_variant	51626	exon12			AAATGAAGTCGAT		CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.963A>G	chr2.hg19:g.44032355A>G		99.0	0.0		119.0	6.0	NM_001193464	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Silent	SNP	ENST00000260605.8	hg19	CCDS1813.1	.	.	.	.	.	.	.	.	.	.	A	7.232	0.599551	0.13939	.	.	ENSG00000138036	ENST00000378587	.	.	.	4.88	3.68	0.42216	.	.	.	.	.	T	0.62575	0.2439	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60094	-0.7330	4	.	.	.	-29.5592	11.8498	0.52405	0.8534:0.1466:0.0:0.0	.	.	.	.	R	305	.	.	K	+	2	0	DYNC2LI1	43885859	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	1.350000	0.34010	0.948000	0.37687	0.533000	0.62120	AAG	.	.		0.373	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250536.2	NM_016008	
RTN4	57142	hgsc.bcm.edu	37	2	55254181	55254181	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:55254181T>C	ENST00000337526.6	-	3	1297	c.1054A>G	c.(1054-1056)Aaa>Gaa	p.K352E	RTN4_ENST00000357732.4_Intron|RTN4_ENST00000404909.1_Missense_Mutation_p.K146E|RTN4_ENST00000354474.6_Missense_Mutation_p.K120E|RTN4_ENST00000394611.2_Missense_Mutation_p.K146E|RTN4_ENST00000405240.1_Missense_Mutation_p.K146E|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Missense_Mutation_p.K146E	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	352					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TTAACCAATTTAGTAAGAGCT	0.348																																					p.K352E		Atlas-SNP	.											.	RTN4	189	.	0			c.A1054G						.						109.0	111.0	110.0					2																	55254181		2203	4298	6501	SO:0001583	missense	57142	exon3			CCAATTTAGTAAG	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1054A>G	chr2.hg19:g.55254181T>C	ENSP00000337838:p.Lys352Glu	84.0	0.0		66.0	30.0	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	hg19	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	T	0.033	-1.319899	0.01320	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.18810	2.19;2.19;2.29;2.19;2.19;2.2	5.83	-6.08	0.02151	.	7739.210000	0.00166	N	0.000000	T	0.10165	0.0249	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.16600	-1.0397	10	0.18276	T	0.48	0.2994	3.1864	0.06602	0.0972:0.3614:0.193:0.3484	.	352	Q9NQC3	RTN4_HUMAN	E	146;146;352;146;146;120	ENSP00000384471:K146E;ENSP00000349944:K146E;ENSP00000337838:K352E;ENSP00000378109:K146E;ENSP00000385650:K146E;ENSP00000346465:K120E	ENSP00000337838:K352E	K	-	1	0	RTN4	55107685	0.000000	0.05858	0.000000	0.03702	0.183000	0.23260	-0.582000	0.05814	-1.296000	0.02353	0.528000	0.53228	AAA	.	.		0.348	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
CCDC88A	55704	hgsc.bcm.edu	37	2	55562103	55562103	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:55562103T>C	ENST00000436346.1	-	15	2695	c.1854A>G	c.(1852-1854)gaA>gaG	p.E618E	AC012358.8_ENST00000608103.1_RNA|AC012358.8_ENST00000599475.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000594078.1_RNA|CCDC88A_ENST00000336838.6_Silent_p.E618E|CCDC88A_ENST00000413716.2_Silent_p.E618E|CCDC88A_ENST00000263630.8_Silent_p.E618E	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	618					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CTTTATAATGTTCCAATTCTT	0.244																																					p.E618E		Atlas-SNP	.											.	CCDC88A	336	.	0			c.A1854G						.						28.0	27.0	27.0					2																	55562103		2199	4294	6493	SO:0001819	synonymous_variant	55704	exon15			ATAATGTTCCAAT	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.1854A>G	chr2.hg19:g.55562103T>C		83.0	0.0		99.0	4.0	NM_018084	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Silent	SNP	ENST00000436346.1	hg19																																																																																				.	.		0.244	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
ALMS1	7840	hgsc.bcm.edu	37	2	73799567	73799567	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:73799567A>G	ENST00000264448.6	+	16	10671	c.10560A>G	c.(10558-10560)aaA>aaG	p.K3520K	ALMS1_ENST00000409009.1_Silent_p.K3478K	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3520					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ATCCAGACAAACATAGAGAAC	0.373																																					p.K3520K		Atlas-SNP	.											.	ALMS1	384	.	0			c.A10560G						.						86.0	79.0	81.0					2																	73799567		1879	4118	5997	SO:0001819	synonymous_variant	7840	exon16			AGACAAACATAGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.10560A>G	chr2.hg19:g.73799567A>G		83.0	0.0		96.0	4.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.373	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
EIF2AK3	9451	hgsc.bcm.edu	37	2	88879055	88879055	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:88879055T>C	ENST00000303236.3	-	11	2168	c.1867A>G	c.(1867-1869)Agg>Ggg	p.R623G	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.R472G	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	623	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						AGACGGATCCTCTTGATAGCA	0.403																																					p.R623G	GBM(138;671 1851 16235 39058 45249)	Atlas-SNP	.											.	EIF2AK3	160	.	0			c.A1867G						.						167.0	160.0	162.0					2																	88879055		2203	4300	6503	SO:0001583	missense	9451	exon11			GGATCCTCTTGAT	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.1867A>G	chr2.hg19:g.88879055T>C	ENSP00000307235:p.Arg623Gly	107.0	0.0		90.0	5.0	NM_004836	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	ENST00000303236.3	hg19	CCDS33241.1	.	.	.	.	.	.	.	.	.	.	T	16.26	3.072809	0.55646	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.21361	2.01;2.01;2.01	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043020	0.85682	D	0.000000	T	0.32852	0.0843	M	0.84219	2.685	0.80722	D	1	B	0.25235	0.121	B	0.26416	0.069	T	0.12785	-1.0534	10	0.87932	D	0	-24.0879	15.1804	0.72952	0.0:0.0:0.0:1.0	.	623	Q9NZJ5	E2AK3_HUMAN	G	472;623;472;502	ENSP00000408325:R472G;ENSP00000307235:R623G;ENSP00000412076:R502G	ENSP00000307235:R623G	R	-	1	2	EIF2AK3	88660170	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.170000	0.71920	2.324000	0.78689	0.533000	0.62120	AGG	.	.		0.403	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836	
PSD4	23550	hgsc.bcm.edu	37	2	113950141	113950141	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:113950141G>A	ENST00000245796.6	+	6	2008	c.1813G>A	c.(1813-1815)Gaa>Aaa	p.E605K	PSD4_ENST00000441564.3_Missense_Mutation_p.E577K	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	605	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCGGAAGTCTGAAGTGGCTGC	0.597																																					p.E605K		Atlas-SNP	.											.	PSD4	74	.	0			c.G1813A						.						71.0	74.0	73.0					2																	113950141		2203	4300	6503	SO:0001583	missense	23550	exon6			AAGTCTGAAGTGG	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1813G>A	chr2.hg19:g.113950141G>A	ENSP00000245796:p.Glu605Lys	47.0	0.0		33.0	20.0	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	hg19	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	g	26.9	4.781639	0.90282	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.51817	0.69;0.69	5.68	5.68	0.88126	SEC7-like (4);	0.161385	0.53938	D	0.000043	T	0.42921	0.1224	N	0.20483	0.58	0.80722	D	1	P;P;B	0.49783	0.766;0.928;0.333	P;P;P	0.49708	0.561;0.62;0.536	T	0.42932	-0.9422	10	0.87932	D	0	.	12.9495	0.58391	0.0:0.1627:0.8373:0.0	.	263;577;605	Q59HG0;Q8NDX1-2;Q8NDX1	.;.;PSD4_HUMAN	K	605;577	ENSP00000245796:E605K;ENSP00000413997:E577K	ENSP00000245796:E605K	E	+	1	0	PSD4	113666612	1.000000	0.71417	0.988000	0.46212	0.996000	0.88848	3.299000	0.51826	2.692000	0.91855	0.651000	0.88453	GAA	.	.		0.597	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
NMI	9111	hgsc.bcm.edu	37	2	152127280	152127280	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:152127280T>C	ENST00000243346.5	-	8	1321	c.851A>G	c.(850-852)aAg>aGg	p.K284R		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	284					inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		ACCTCCATTCTTTGCCCGTTG	0.393																																					p.K284R		Atlas-SNP	.											.	NMI	21	.	0			c.A851G						.						182.0	171.0	175.0					2																	152127280		2203	4300	6503	SO:0001583	missense	9111	exon8			CCATTCTTTGCCC	U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.851A>G	chr2.hg19:g.152127280T>C	ENSP00000243346:p.Lys284Arg	102.0	0.0		94.0	4.0	NM_004688	B5BU69|Q53TI8|Q9BVE5	Missense_Mutation	SNP	ENST00000243346.5	hg19	CCDS2192.1	.	.	.	.	.	.	.	.	.	.	T	9.898	1.206042	0.22205	.	.	ENSG00000123609	ENST00000243346	T	0.38240	1.15	5.26	1.42	0.22433	Nmi/IFP 35 (1);	0.373716	0.30126	N	0.010349	T	0.17492	0.0420	N	0.17312	0.475	0.09310	N	1	B	0.18741	0.03	B	0.20184	0.028	T	0.14755	-1.0461	10	0.20519	T	0.43	-11.8808	5.2342	0.15437	0.0:0.1:0.3929:0.5072	.	284	Q13287	NMI_HUMAN	R	284	ENSP00000243346:K284R	ENSP00000243346:K284R	K	-	2	0	NMI	151835526	0.163000	0.22920	0.951000	0.38953	0.907000	0.53573	0.194000	0.17135	0.818000	0.34468	0.482000	0.46254	AAG	.	.		0.393	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254817.2	NM_004688	
NMI	9111	hgsc.bcm.edu	37	2	152128184	152128184	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:152128184C>A	ENST00000243346.5	-	7	1167	c.697G>T	c.(697-699)Gtt>Ttt	p.V233F		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	233					inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		GAAACAGTAACTCTATGGCAG	0.343																																					p.V233F		Atlas-SNP	.											.	NMI	21	.	0			c.G697T						.						148.0	161.0	156.0					2																	152128184		2203	4300	6503	SO:0001583	missense	9111	exon7			CAGTAACTCTATG	U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.697G>T	chr2.hg19:g.152128184C>A	ENSP00000243346:p.Val233Phe	60.0	0.0		22.0	14.0	NM_004688	B5BU69|Q53TI8|Q9BVE5	Missense_Mutation	SNP	ENST00000243346.5	hg19	CCDS2192.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041873	0.55003	.	.	ENSG00000123609	ENST00000243346	T	0.59906	0.23	5.92	5.92	0.95590	Nmi/IFP 35 (1);	0.114299	0.64402	D	0.000013	T	0.78654	0.4317	M	0.85542	2.76	0.38913	D	0.957577	D	0.89917	1.0	D	0.79784	0.993	T	0.82287	-0.0532	10	0.72032	D	0.01	-21.175	15.8301	0.78743	0.0:1.0:0.0:0.0	.	233	Q13287	NMI_HUMAN	F	233	ENSP00000243346:V233F	ENSP00000243346:V233F	V	-	1	0	NMI	151836430	0.883000	0.30277	0.199000	0.23439	0.361000	0.29550	2.276000	0.43408	2.810000	0.96702	0.585000	0.79938	GTT	.	.		0.343	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254817.2	NM_004688	
ACVR1C	130399	hgsc.bcm.edu	37	2	158390463	158390463	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:158390463A>G	ENST00000243349.8	-	9	1809	c.1449T>C	c.(1447-1449)tcT>tcC	p.S483S	ACVR1C_ENST00000409680.3_Silent_p.S433S|ACVR1C_ENST00000335450.7_Silent_p.S403S|ACVR1C_ENST00000348328.5_Silent_p.S326S	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						CACAAAGTTGAGATATAGTCT	0.403																																					p.S483S		Atlas-SNP	.											ACVR1C,right_upper_lobe,carcinoma,0,1	ACVR1C	85	.	0			c.T1449C						.						96.0	105.0	102.0					2																	158390463		2203	4300	6503	SO:0001819	synonymous_variant	130399	exon9			AAGTTGAGATATA	BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1449T>C	chr2.hg19:g.158390463A>G		47.0	0.0		37.0	2.0	NM_145259		Silent	SNP	ENST00000243349.8	hg19	CCDS2205.1																																																																																			.	.		0.403	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254924.2	NM_145259	
PLA2R1	22925	hgsc.bcm.edu	37	2	160879270	160879270	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:160879270A>G	ENST00000283243.7	-	7	1406	c.1200T>C	c.(1198-1200)caT>caC	p.H400H	PLA2R1_ENST00000392771.1_Silent_p.H400H	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	400	C-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GCAGAGCCTCATGCCAGGTCT	0.438																																					p.H400H		Atlas-SNP	.											.	PLA2R1	153	.	0			c.T1200C						.						150.0	141.0	144.0					2																	160879270		2203	4300	6503	SO:0001819	synonymous_variant	22925	exon7			AGCCTCATGCCAG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.1200T>C	chr2.hg19:g.160879270A>G		133.0	0.0		81.0	4.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	hg19	CCDS33309.1																																																																																			.	.		0.438	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
TTC21B	79809	hgsc.bcm.edu	37	2	166788360	166788360	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:166788360T>C	ENST00000243344.7	-	8	939	c.802A>G	c.(802-804)Acc>Gcc	p.T268A	AC010127.5_ENST00000443032.1_RNA|AC010127.5_ENST00000440322.1_RNA	NM_024753.4	NP_079029.3	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	268					forebrain dorsal/ventral pattern formation (GO:0021798)|intraciliary retrograde transport (GO:0035721)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|protein localization to cilium (GO:0061512)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|nuclear chromatin (GO:0000790)		p.T268S(1)		breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(9)|lung(28)|ovary(2)|pancreas(2)|skin(2)|urinary_tract(1)	58						TCCAGCTTGGTGGAAGCCTAA	0.368																																					p.T268A		Atlas-SNP	.											TTC21B,NS,carcinoma,0,1	TTC21B	130	.	1	Substitution - Missense(1)	lung(1)	c.A802G						.						115.0	105.0	108.0					2																	166788360		2203	4300	6503	SO:0001583	missense	79809	exon8			GCTTGGTGGAAGC	AB082523	CCDS33315.1	2q24.3	2014-09-04			ENSG00000123607	ENSG00000123607		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	25660	protein-coding gene	gene with protein product		612014				12056414, 21258341	Standard	NM_024753		Approved	FLJ11457, JBTS11, NPHP12, IFT139, THM1	uc002udk.3	Q7Z4L5	OTTHUMG00000154083	ENST00000243344.7:c.802A>G	chr2.hg19:g.166788360T>C	ENSP00000243344:p.Thr268Ala	59.0	0.0		55.0	3.0	NM_024753	A8MUZ3|Q3LIE4|Q53T84|Q6P4A1|Q6PIF5|Q8NCN3|Q96MA4|Q9HAK8	Missense_Mutation	SNP	ENST00000243344.7	hg19	CCDS33315.1	.	.	.	.	.	.	.	.	.	.	T	1.929	-0.446471	0.04604	.	.	ENSG00000123607	ENST00000243344	T	0.49139	0.79	5.48	-2.46	0.06461	Tetratricopeptide-like helical (1);	0.808960	0.11771	N	0.531104	T	0.19167	0.0460	N	0.11201	0.11	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.26883	-1.0090	10	0.07990	T	0.79	-0.3644	4.5639	0.12173	0.2916:0.3352:0.0:0.3732	.	268;268	Q7Z4L5-2;Q7Z4L5	.;TT21B_HUMAN	A	268	ENSP00000243344:T268A	ENSP00000243344:T268A	T	-	1	0	TTC21B	166496606	0.028000	0.19301	0.088000	0.20740	0.085000	0.17905	-0.318000	0.08050	-0.405000	0.07599	-0.256000	0.11100	ACC	.	.		0.368	TTC21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333770.1	NM_024753	
SCN9A	6335	hgsc.bcm.edu	37	2	167142891	167142891	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:167142891T>C	ENST00000409435.1	-	10	1556	c.1557A>G	c.(1555-1557)gaA>gaG	p.E519E	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Silent_p.E520E|SCN9A_ENST00000409672.1_Silent_p.E519E|SCN9A_ENST00000375387.4_Silent_p.E520E			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	519			E -> K (in dbSNP:rs187453572). {ECO:0000269|PubMed:19763161}.		behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCCTATGCCCTTCGACACCAA	0.458																																					p.E519E		Atlas-SNP	.											.	SCN9A	296	.	0			c.A1557G						.						255.0	239.0	244.0					2																	167142891		1930	4137	6067	SO:0001819	synonymous_variant	6335	exon11			ATGCCCTTCGACA	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1557A>G	chr2.hg19:g.167142891T>C		127.0	0.0		92.0	4.0	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	ENST00000409435.1	hg19	CCDS46441.1																																																																																			.	.		0.458	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
SCN7A	6332	hgsc.bcm.edu	37	2	167297978	167297978	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:167297978G>A	ENST00000409855.1	-	14	2211	c.2085C>T	c.(2083-2085)gaC>gaT	p.D695D		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	695					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCTCCATACAGTCCCACAAGG	0.433																																					p.D695D		Atlas-SNP	.											.	SCN7A	410	.	0			c.C2085T						.						66.0	69.0	68.0					2																	167297978		2203	4300	6503	SO:0001819	synonymous_variant	6332	exon14			CATACAGTCCCAC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2085C>T	chr2.hg19:g.167297978G>A		146.0	0.0		82.0	57.0	NM_002976		Silent	SNP	ENST00000409855.1	hg19	CCDS46442.1																																																																																			.	.		0.433	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
CERS6	253782	hgsc.bcm.edu	37	2	169626076	169626076	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:169626076A>G	ENST00000305747.6	+	10	1646	c.1059A>G	c.(1057-1059)gaA>gaG	p.E353E	CERS6_ENST00000392687.4_Silent_p.E361E|CERS6-AS1_ENST00000425636.2_RNA	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	353					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AGGACTCAGAACCTCCGGGAA	0.498																																					p.E361E		Atlas-SNP	.											.	.	.	.	0			c.A1083G						.						109.0	104.0	106.0					2																	169626076		2203	4300	6503	SO:0001819	synonymous_variant	253782	exon11			CTCAGAACCTCCG	BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.1059A>G	chr2.hg19:g.169626076A>G		59.0	0.0		86.0	4.0	NM_001256126	Q32M63|Q8N617	Silent	SNP	ENST00000305747.6	hg19	CCDS2228.1																																																																																			.	.		0.498	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255235.2	NM_203463	
LRP2	4036	hgsc.bcm.edu	37	2	170048456	170048456	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:170048456T>C	ENST00000263816.3	-	48	9203	c.8918A>G	c.(8917-8919)gAt>gGt	p.D2973G		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2973	LDL-receptor class A 22. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACATCGCCATCACAGACCCA	0.478																																					p.D2973G		Atlas-SNP	.											.	LRP2	751	.	0			c.A8918G						.						98.0	91.0	93.0					2																	170048456		2203	4300	6503	SO:0001583	missense	4036	exon48			TCGCCATCACAGA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8918A>G	chr2.hg19:g.170048456T>C	ENSP00000263816:p.Asp2973Gly	78.0	0.0		69.0	4.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.740147	0.89573	.	.	ENSG00000081479	ENST00000263816	D	0.98732	-5.1	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.99527	0.9831	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97869	1.0285	10	0.87932	D	0	.	16.0014	0.80294	0.0:0.0:0.0:1.0	.	2973	P98164	LRP2_HUMAN	G	2973	ENSP00000263816:D2973G	ENSP00000263816:D2973G	D	-	2	0	LRP2	169756702	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	7.841000	0.86834	2.181000	0.69327	0.528000	0.53228	GAT	.	.		0.478	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
CHN1	1123	hgsc.bcm.edu	37	2	175673733	175673733	+	Silent	SNP	T	T	C	rs376051698		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:175673733T>C	ENST00000409900.3	-	11	1315	c.1002A>G	c.(1000-1002)gaA>gaG	p.E334E	CHN1_ENST00000409597.1_Silent_p.E150E|CHN1_ENST00000488080.1_5'UTR|CHN1_ENST00000409156.3_Silent_p.E308E|CHN1_ENST00000295497.7_Silent_p.E209E	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	334	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			TGTTGATATCTTCATACATGT	0.343			T	TAF15	extraskeletal myxoid chondrosarcoma																																p.E334E		Atlas-SNP	.		Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	.	CHN1	67	.	0			c.A1002G						.	T	,,	1,3743		0,1,1871	181.0	174.0	176.0		924,627,1002	3.7	1.0	2		176	3,8215		0,3,4106	no	coding-synonymous,coding-synonymous,coding-synonymous	CHN1	NM_001025201.3,NM_001206602.1,NM_001822.5	,,	0,4,5977	CC,CT,TT		0.0365,0.0267,0.0334	,,	308/434,209/335,334/460	175673733	4,11958	1872	4109	5981	SO:0001819	synonymous_variant	1123	exon11			GATATCTTCATAC		CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.1002A>G	chr2.hg19:g.175673733T>C		129.0	0.0		93.0	4.0	NM_001822	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Silent	SNP	ENST00000409900.3	hg19	CCDS46455.1																																																																																			.	.		0.343	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334453.1	NM_001822	
TTN	7273	hgsc.bcm.edu	37	2	179577610	179577610	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:179577610A>T	ENST00000591111.1	-	92	26415	c.26191T>A	c.(26191-26193)Ttc>Atc	p.F8731I	TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.F9048I|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.F7804I|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12884	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTAACACTGAAAGGAGGTGTT	0.428																																					p.F9048I		Atlas-SNP	.											.	TTN	18412	.	0			c.T27142A						.						59.0	55.0	56.0					2																	179577610		1929	4130	6059	SO:0001583	missense	7273	exon94			CACTGAAAGGAGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26191T>A	chr2.hg19:g.179577610A>T	ENSP00000465570:p.Phe8731Ile	78.0	0.0		95.0	35.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	13.09	2.132850	0.37630	.	.	ENSG00000155657	ENST00000342992	T	0.65916	-0.18	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50548	0.1622	L	0.31065	0.9	0.80722	D	1	B	0.21071	0.051	B	0.17433	0.018	T	0.51482	-0.8700	9	0.87932	D	0	.	11.7623	0.51910	0.9291:0.0:0.0709:0.0	.	8731	Q8WZ42	TITIN_HUMAN	I	7804	ENSP00000343764:F7804I	ENSP00000343764:F7804I	F	-	1	0	TTN	179285855	0.816000	0.29132	0.998000	0.56505	0.996000	0.88848	1.358000	0.34102	2.198000	0.70561	0.533000	0.62120	TTC	.	.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC150	284992	hgsc.bcm.edu	37	2	197540964	197540964	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:197540964A>G	ENST00000389175.4	+	11	1370	c.1235A>G	c.(1234-1236)aAt>aGt	p.N412S	CCDC150_ENST00000423093.2_Missense_Mutation_p.N80S|CCDC150_ENST00000272831.7_Missense_Mutation_p.N80S|CCDC150_ENST00000472405.2_3'UTR	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	412										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						ACTGTTCAGAATGAGAAAACC	0.403																																					p.N412S		Atlas-SNP	.											.	CCDC150	96	.	0			c.A1235G						.						170.0	169.0	169.0					2																	197540964		1905	4124	6029	SO:0001583	missense	284992	exon11			TTCAGAATGAGAA		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.1235A>G	chr2.hg19:g.197540964A>G	ENSP00000373827:p.Asn412Ser	120.0	0.0		100.0	4.0	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	ENST00000389175.4	hg19	CCDS46478.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.026094	0.35701	.	.	ENSG00000144395	ENST00000272831;ENST00000389175;ENST00000423093	T	0.53857	0.6	5.26	4.08	0.47627	.	0.275149	0.28290	N	0.015898	T	0.48059	0.1479	L	0.60455	1.87	0.23712	N	0.997048	P;P	0.44139	0.728;0.827	B;B	0.41510	0.197;0.359	T	0.38650	-0.9651	10	0.36615	T	0.2	.	10.1163	0.42593	0.8317:0.1683:0.0:0.0	.	80;412	B4DZ03;Q8NCX0	.;CC150_HUMAN	S	80;412;80	ENSP00000373827:N412S	ENSP00000272831:N80S	N	+	2	0	CCDC150	197249209	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	3.635000	0.54309	0.973000	0.38340	0.455000	0.32223	AAT	.	.		0.403	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
CARF	79800	hgsc.bcm.edu	37	2	203834662	203834662	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:203834662A>G	ENST00000402905.3	+	10	1295	c.974A>G	c.(973-975)cAg>cGg	p.Q325R	CARF_ENST00000414439.1_Missense_Mutation_p.Q223R|CARF_ENST00000545262.1_Missense_Mutation_p.Q249R|CARF_ENST00000320443.8_Missense_Mutation_p.Q325R|CARF_ENST00000428585.1_Missense_Mutation_p.Q249R|WDR12_ENST00000477723.1_Intron|CARF_ENST00000545253.1_Missense_Mutation_p.Q237R|CARF_ENST00000456821.2_3'UTR|CARF_ENST00000438828.2_Missense_Mutation_p.Q325R	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	325					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AAAAAGGTACAGAAGTTTCCT	0.299																																					p.Q325R		Atlas-SNP	.											.	ALS2CR8	56	.	0			c.A974G						.						59.0	53.0	54.0					2																	203834662		1786	4059	5845	SO:0001583	missense	79800	exon11			AGGTACAGAAGTT	AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.974A>G	chr2.hg19:g.203834662A>G	ENSP00000384006:p.Gln325Arg	112.0	0.0		72.0	4.0	NM_024744	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	ENST00000402905.3	hg19	CCDS42801.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.884843	0.33255	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	5.12	5.12	0.69794	.	0.078378	0.53938	D	0.000054	T	0.27134	0.0665	N	0.08118	0	0.33720	D	0.616834	B;B;B	0.30455	0.118;0.118;0.28	B;B;B	0.31442	0.13;0.09;0.09	T	0.33828	-0.9853	9	0.10636	T	0.68	-5.8278	14.0921	0.64998	1.0:0.0:0.0:0.0	.	237;249;325	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	R	325;223;249;237;249;325;325	.	ENSP00000316224:Q325R	Q	+	2	0	ALS2CR8	203542907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.588000	0.60999	1.915000	0.55452	0.528000	0.53228	CAG	.	.		0.299	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
ZDBF2	57683	hgsc.bcm.edu	37	2	207174473	207174473	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:207174473T>C	ENST00000374423.3	+	5	5607	c.5221T>C	c.(5221-5223)Tgt>Cgt	p.C1741R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1741							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGAAGTGAGCTGTGAACCGGA	0.433																																					p.C1741R		Atlas-SNP	.											.	ZDBF2	531	.	0			c.T5221C						.						71.0	71.0	71.0					2																	207174473		1867	4099	5966	SO:0001583	missense	57683	exon5			GTGAGCTGTGAAC	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5221T>C	chr2.hg19:g.207174473T>C	ENSP00000363545:p.Cys1741Arg	91.0	0.0		72.0	4.0	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	hg19	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	T	5.271	0.235353	0.10023	.	.	ENSG00000204186	ENST00000374423	T	0.49720	0.77	4.11	-2.77	0.05877	.	.	.	.	.	T	0.22704	0.0548	N	0.16478	0.41	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.15492	-1.0435	9	0.29301	T	0.29	.	0.8665	0.01205	0.1567:0.1963:0.322:0.325	.	1741	Q9HCK1	ZDBF2_HUMAN	R	1741	ENSP00000363545:C1741R	ENSP00000363545:C1741R	C	+	1	0	ZDBF2	206882718	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.076000	0.14712	-0.486000	0.06744	-0.280000	0.10049	TGT	.	.		0.433	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
FN1	2335	hgsc.bcm.edu	37	2	216264012	216264012	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:216264012T>C	ENST00000359671.1	-	21	3581	c.3316A>G	c.(3316-3318)Aca>Gca	p.T1106A	FN1_ENST00000354785.4_Missense_Mutation_p.T1106A|FN1_ENST00000323926.6_Missense_Mutation_p.T1106A|FN1_ENST00000432072.2_Missense_Mutation_p.T1106A|FN1_ENST00000336916.4_Missense_Mutation_p.T1106A|FN1_ENST00000346544.3_Missense_Mutation_p.T1106A|FN1_ENST00000357009.2_Missense_Mutation_p.T1106A|FN1_ENST00000421182.1_Missense_Mutation_p.T1106A|FN1_ENST00000345488.5_Missense_Mutation_p.T1106A|FN1_ENST00000446046.1_Missense_Mutation_p.T1106A|FN1_ENST00000357867.4_Missense_Mutation_p.T1106A|FN1_ENST00000443816.1_Missense_Mutation_p.T1106A|FN1_ENST00000356005.4_Missense_Mutation_p.T1106A			P02751	FINC_HUMAN	fibronectin 1	1106	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GGCGTCCATGTGATCACAATG	0.468																																					p.T1106A		Atlas-SNP	.											.	FN1	521	.	0			c.A3316G						.						172.0	164.0	166.0					2																	216264012		2203	4300	6503	SO:0001583	missense	2335	exon21			TCCATGTGATCAC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3316A>G	chr2.hg19:g.216264012T>C	ENSP00000352696:p.Thr1106Ala	78.0	0.0		84.0	4.0	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	T	22.9	4.348521	0.82132	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000001	T	0.67306	0.2879	L	0.47716	1.5	0.54753	D	0.999989	D;D;D;D;D;P;D;D;D;D	0.71674	0.994;0.987;0.957;0.994;0.99;0.863;0.998;0.988;0.994;0.987	D;P;D;D;D;P;D;D;D;D	0.85130	0.992;0.891;0.936;0.992;0.996;0.729;0.997;0.992;0.992;0.992	T	0.69401	-0.5155	10	0.66056	D	0.02	.	16.0707	0.80928	0.0:0.0:0.0:1.0	.	1106;1106;1106;1106;1106;1106;1106;1106;1106;1106	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	A	1106	ENSP00000394423:T1106A;ENSP00000323534:T1106A;ENSP00000338200:T1106A;ENSP00000350534:T1106A;ENSP00000346839:T1106A;ENSP00000352696:T1106A;ENSP00000265312:T1106A;ENSP00000273049:T1106A;ENSP00000349509:T1106A;ENSP00000410422:T1106A;ENSP00000415018:T1106A;ENSP00000399538:T1106A;ENSP00000348285:T1106A	ENSP00000265313:T1106A	T	-	1	0	FN1	215972257	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.912000	0.56386	2.194000	0.70268	0.533000	0.62120	ACA	.	.		0.468	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
CTDSP1	58190	hgsc.bcm.edu	37	2	219266306	219266306	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:219266306T>C	ENST00000273062.2	+	2	423	c.87T>C	c.(85-87)gcT>gcC	p.A29A	MIR26B_ENST00000362251.2_RNA|RP11-378A13.2_ENST00000608367.1_RNA|CTDSP1_ENST00000488627.1_3'UTR|CTDSP1_ENST00000443891.1_Silent_p.A29A	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1	29					negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGTCAGCAGCTTCCCAGAAGC	0.637																																					p.A29A		Atlas-SNP	.											.	CTDSP1	19	.	0			c.T87C						.						59.0	64.0	62.0					2																	219266306		2203	4300	6503	SO:0001819	synonymous_variant	58190	exon2			AGCAGCTTCCCAG	AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.87T>C	chr2.hg19:g.219266306T>C		125.0	0.0		87.0	4.0	NM_001206878	C9IYG0|Q7Z5Q3|Q7Z5Q4	Silent	SNP	ENST00000273062.2	hg19	CCDS2416.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.573427	0.28092	.	.	ENSG00000144579	ENST00000452977;ENST00000428361;ENST00000431127	.	.	.	5.08	1.42	0.22433	.	.	.	.	.	T	0.55909	0.1950	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47799	-0.9089	4	.	.	.	-5.8045	8.5109	0.33217	0.0:0.2295:0.0:0.7705	.	.	.	.	P	15;31;99	.	.	L	+	2	0	CTDSP1	218974550	1.000000	0.71417	0.993000	0.49108	0.897000	0.52465	1.831000	0.39141	0.277000	0.22141	-0.290000	0.09829	CTT	.	.		0.637	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256774.1	NM_182642, NM_021198	
MOGAT1	116255	hgsc.bcm.edu	37	2	223559205	223559205	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:223559205T>C	ENST00000446656.3	+	4	603	c.603T>C	c.(601-603)acT>acC	p.T201T		NM_058165.2	NP_477513.2	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	201					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|cervix(1)|endometrium(1)|lung(5)|urinary_tract(1)	9		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		GAAAGTTCACTCTGTTCATCC	0.443																																					p.T201T	Ovarian(93;205 1446 2385 11581 25911)	Atlas-SNP	.											.	MOGAT1	47	.	0			c.T603C						.						86.0	86.0	86.0					2																	223559205		1898	4123	6021	SO:0001819	synonymous_variant	116255	exon4			GTTCACTCTGTTC	AF384163	CCDS46524.1	2q36.2	2006-10-06	2004-05-28	2004-05-28	ENSG00000124003	ENSG00000124003			18210	protein-coding gene	gene with protein product		610268	"""diacylglycerol O-acyltransferase 2 like 1"""	DGAT2L1		14970677	Standard	NM_058165		Approved	DGAT2L, MGAT1	uc010fws.1	Q96PD6	OTTHUMG00000153394	ENST00000446656.3:c.603T>C	chr2.hg19:g.223559205T>C		93.0	0.0		57.0	4.0	NM_058165	Q6IEE5	Silent	SNP	ENST00000446656.3	hg19	CCDS46524.1																																																																																			.	.		0.443	MOGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331010.3	NM_058165	
LMCD1	29995	hgsc.bcm.edu	37	3	8607167	8607167	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:8607167A>T	ENST00000157600.3	+	5	1005	c.773A>T	c.(772-774)tAc>tTc	p.Y258F	LMCD1-AS1_ENST00000439407.1_RNA|LMCD1_ENST00000454244.1_Missense_Mutation_p.Y185F|LMCD1_ENST00000397386.3_Missense_Mutation_p.Y146F	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	258	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		CCCGTGGTCTACTCGGACAGG	0.602																																					p.Y258F		Atlas-SNP	.											.	LMCD1	38	.	0			c.A773T						.						99.0	107.0	104.0					3																	8607167		2203	4300	6503	SO:0001583	missense	29995	exon5			TGGTCTACTCGGA	AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.773A>T	chr3.hg19:g.8607167A>T	ENSP00000157600:p.Tyr258Phe	90.0	0.0		125.0	51.0	NM_014583	B4DG80	Missense_Mutation	SNP	ENST00000157600.3	hg19	CCDS33688.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.173647	0.78452	.	.	ENSG00000071282	ENST00000157600;ENST00000454244;ENST00000397386	T;T;T	0.49720	0.8;0.8;0.77	5.27	5.27	0.74061	Zinc finger, LIM-type (4);	0.000000	0.64402	D	0.000020	T	0.34513	0.0900	N	0.10629	0.01	0.54753	D	0.999984	P;P	0.49090	0.84;0.919	B;P	0.51974	0.405;0.686	T	0.22243	-1.0222	10	0.02654	T	1	-28.9704	14.0186	0.64539	1.0:0.0:0.0:0.0	.	146;258	B4DEY6;Q9NZU5	.;LMCD1_HUMAN	F	258;185;146	ENSP00000157600:Y258F;ENSP00000396515:Y185F;ENSP00000380542:Y146F	ENSP00000157600:Y258F	Y	+	2	0	LMCD1	8582167	1.000000	0.71417	0.960000	0.40013	0.967000	0.64934	7.111000	0.77077	1.996000	0.58369	0.482000	0.46254	TAC	.	.		0.602	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337854.1	NM_014583	
IQSEC1	9922	hgsc.bcm.edu	37	3	12942853	12942853	+	Intron	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:12942853A>G	ENST00000273221.4	-	13	3064					NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1						actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGGGGTGGCCAGGGCTGGGGC	0.692																																					p.L992P		Atlas-SNP	.											.	IQSEC1	88	.	0			c.T2975C						.						2.0	2.0	2.0					3																	12942853		587	1389	1976	SO:0001627	intron_variant	9922	exon14			GTGGCCAGGGCTG	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2847+1419T>C	chr3.hg19:g.12942853A>G		25.0	0.0		42.0	5.0	NM_001134382	O94863|Q96D85	Missense_Mutation	SNP	ENST00000273221.4	hg19	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	a	0.309	-0.968904	0.02232	.	.	ENSG00000144711	ENST00000435445;ENST00000429247	T	0.50277	0.75	3.83	-3.76	0.04359	.	.	.	.	.	T	0.17662	0.0424	.	.	.	0.21579	N	0.999639	B	0.02656	0.0	B	0.01281	0.0	T	0.26360	-1.0105	8	0.07644	T	0.81	.	3.0466	0.06155	0.1077:0.1748:0.4542:0.2633	.	992	E9PG60	.	P	992	ENSP00000402299:L992P	ENSP00000402299:L992P	L	-	2	0	IQSEC1	12917853	0.803000	0.28956	0.000000	0.03702	0.044000	0.14063	0.719000	0.25881	-0.633000	0.05545	-0.246000	0.11932	CTG	.	.		0.692	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
WNT7A	7476	hgsc.bcm.edu	37	3	13896149	13896149	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:13896149A>G	ENST00000285018.4	-	3	754	c.450T>C	c.(448-450)ggT>ggC	p.G150G		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	150					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						CAGAGCAGCCACCCCACTTCC	0.607																																					p.G150G		Atlas-SNP	.											.	WNT7A	70	.	0			c.T450C						.						115.0	109.0	111.0					3																	13896149		2203	4300	6503	SO:0001819	synonymous_variant	7476	exon3			GCAGCCACCCCAC	D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.450T>C	chr3.hg19:g.13896149A>G		49.0	0.0		63.0	5.0	NM_004625	Q96H90|Q9Y560	Silent	SNP	ENST00000285018.4	hg19	CCDS2616.1																																																																																			.	.		0.607	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625	
METTL6	131965	hgsc.bcm.edu	37	3	15467900	15467900	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:15467900T>C	ENST00000443029.1	-	2	359	c.119A>G	c.(118-120)gAg>gGg	p.E40G	METTL6_ENST00000383790.3_Missense_Mutation_p.E40G|METTL6_ENST00000450816.2_Missense_Mutation_p.E40G|METTL6_ENST00000383789.5_Missense_Mutation_p.E40G|EAF1_ENST00000396842.2_5'Flank|EAF1_ENST00000432764.2_5'Flank			Q8TCB7	METL6_HUMAN	methyltransferase like 6	40							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(9)|lung(3)|prostate(1)	15						TTTCTGAGCCTCTTGTTCCAA	0.398																																					p.E40G		Atlas-SNP	.											.	METTL6	27	.	0			c.A119G						.						127.0	118.0	121.0					3																	15467900		1824	4075	5899	SO:0001583	missense	131965	exon2			TGAGCCTCTTGTT	AK057791	CCDS43056.1	3p25.1	2005-11-02			ENSG00000206562	ENSG00000206562			28343	protein-coding gene	gene with protein product						12477932	Standard	NM_152396		Approved	MGC24132	uc003bzs.1	Q8TCB7	OTTHUMG00000156431	ENST00000443029.1:c.119A>G	chr3.hg19:g.15467900T>C	ENSP00000407613:p.Glu40Gly	84.0	0.0		113.0	5.0	NM_152396	Q96LU4	Missense_Mutation	SNP	ENST00000443029.1	hg19	CCDS43056.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083044	0.55861	.	.	ENSG00000206562	ENST00000383790;ENST00000450816;ENST00000383789	T;T;T	0.69306	-0.39;-0.39;-0.39	5.68	5.68	0.88126	.	0.092095	0.85682	D	0.000000	T	0.73590	0.3606	M	0.73598	2.24	0.58432	D	0.999999	P;P;B	0.38535	0.635;0.503;0.204	P;B;B	0.44811	0.461;0.43;0.126	T	0.77040	-0.2735	10	0.72032	D	0.01	-13.8455	15.6013	0.76628	0.0:0.0:0.0:1.0	.	40;40;40	B4DDX3;Q8TCB7-2;Q8TCB7	.;.;METL6_HUMAN	G	40	ENSP00000373300:E40G;ENSP00000410726:E40G;ENSP00000373299:E40G	ENSP00000373299:E40G	E	-	2	0	METTL6	15442904	1.000000	0.71417	1.000000	0.80357	0.427000	0.31564	8.040000	0.89188	2.164000	0.68074	0.528000	0.53228	GAG	.	.		0.398	METTL6-007	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346373.1	NM_152396	
TOP2B	7155	hgsc.bcm.edu	37	3	25670532	25670532	+	Silent	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:25670532A>T	ENST00000264331.4	-	14	1793	c.1794T>A	c.(1792-1794)atT>atA	p.I598I	TOP2B_ENST00000435706.2_Silent_p.I593I	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	598					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GTACCTTTACAATAGGAGTAA	0.294																																					p.I593I		Atlas-SNP	.											.	TOP2B	98	.	0			c.T1779A						.						95.0	90.0	92.0					3																	25670532		1796	4060	5856	SO:0001819	synonymous_variant	7155	exon14			CTTTACAATAGGA	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1794T>A	chr3.hg19:g.25670532A>T		40.0	0.0		46.0	23.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Silent	SNP	ENST00000264331.4	hg19																																																																																				.	.		0.294	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
MYRIP	25924	hgsc.bcm.edu	37	3	40211580	40211580	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:40211580T>C	ENST00000302541.6	+	8	1211	c.869T>C	c.(868-870)cTc>cCc	p.L290P	MYRIP_ENST00000396217.3_Missense_Mutation_p.L201P|MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000444716.1_Missense_Mutation_p.L290P|MYRIP_ENST00000425621.1_Missense_Mutation_p.L290P|MYRIP_ENST00000539167.1_Missense_Mutation_p.L103P	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	290	Myosin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CCCGCTGCCCTCTGGGTGAGT	0.607																																					p.L290P		Atlas-SNP	.											.	MYRIP	98	.	0			c.T869C						.						70.0	63.0	66.0					3																	40211580		2203	4300	6503	SO:0001583	missense	25924	exon8			CTGCCCTCTGGGT	AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.869T>C	chr3.hg19:g.40211580T>C	ENSP00000301972:p.Leu290Pro	58.0	0.0		96.0	4.0	NM_015460	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	hg19	CCDS2689.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.111257	0.37242	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	4.71	2.23	0.28157	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.278895	0.29126	N	0.013067	T	0.50222	0.1603	L	0.52573	1.65	0.49299	D	0.99977	D;D;D	0.89917	1.0;0.997;0.998	D;D;D	0.79784	0.993;0.944;0.967	T	0.41197	-0.9522	9	.	.	.	.	4.9851	0.14185	0.0:0.0988:0.1855:0.7156	.	201;290;290	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	P	290;290;290;201;103	ENSP00000398665:L290P;ENSP00000301972:L290P;ENSP00000389323:L290P;ENSP00000379519:L201P;ENSP00000438297:L103P	.	L	+	2	0	MYRIP	40186584	0.686000	0.27661	0.684000	0.30055	0.317000	0.28152	1.423000	0.34837	0.246000	0.21394	0.459000	0.35465	CTC	.	.		0.607	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460	
SNRK	54861	hgsc.bcm.edu	37	3	43388906	43388906	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:43388906G>A	ENST00000296088.7	+	7	1459	c.1155G>A	c.(1153-1155)gcG>gcA	p.A385A	RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000454177.1_Silent_p.A385A|SNRK_ENST00000429705.2_Silent_p.A385A|SNRK_ENST00000437827.1_Silent_p.A179A|SNRK-AS1_ENST00000422681.1_RNA	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TGTCCCACGCGACTGTCCCTC	0.547																																					p.A385A		Atlas-SNP	.											.	SNRK	118	.	0			c.G1155A						.						70.0	75.0	74.0					3																	43388906		2039	4193	6232	SO:0001819	synonymous_variant	54861	exon7			CCACGCGACTGTC	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1155G>A	chr3.hg19:g.43388906G>A		22.0	0.0		47.0	19.0	NM_017719		Silent	SNP	ENST00000296088.7	hg19	CCDS43075.1																																																																																			.	.		0.547	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
KIF15	56992	hgsc.bcm.edu	37	3	44816758	44816758	+	Silent	SNP	T	T	C	rs34893204		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:44816758T>C	ENST00000326047.4	+	3	224	c.75T>C	c.(73-75)gaT>gaC	p.D25D		NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	25					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		ATGAAGGTGATGCCATCAAAG	0.388																																					p.D25D		Atlas-SNP	.											.	KIF15	103	.	0			c.T75C						.						142.0	130.0	134.0					3																	44816758		2203	4300	6503	SO:0001819	synonymous_variant	56992	exon3			AGGTGATGCCATC	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.75T>C	chr3.hg19:g.44816758T>C		83.0	0.0		98.0	4.0	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Silent	SNP	ENST00000326047.4	hg19	CCDS33744.1																																																																																			.	T|0.987;A|0.013		0.388	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
CDHR4	389118	hgsc.bcm.edu	37	3	49832387	49832387	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:49832387A>G	ENST00000412678.2	-	9	1186	c.1178T>C	c.(1177-1179)gTc>gCc	p.V393A	CDHR4_ENST00000462108.1_5'Flank	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	393	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						CACCTCAAGGACTCTGTCATA	0.622																																					p.V393A		Atlas-SNP	.											.	CDHR4	37	.	0			c.T1178C						.						47.0	53.0	51.0					3																	49832387		692	1591	2283	SO:0001583	missense	389118	exon9			TCAAGGACTCTGT		CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.1178T>C	chr3.hg19:g.49832387A>G	ENSP00000391409:p.Val393Ala	60.0	0.0		73.0	5.0	NM_001007540	Q6UXT0	Missense_Mutation	SNP	ENST00000412678.2	hg19	CCDS46829.1	.	.	.	.	.	.	.	.	.	.	A	9.067	0.996049	0.19043	.	.	ENSG00000187492	ENST00000412678	T	0.68624	-0.34	4.75	-4.5	0.03493	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.34890	0.0913	N	0.08118	0	0.25389	N	0.988542	B	0.02656	0.0	B	0.04013	0.001	T	0.31223	-0.9951	9	0.08179	T	0.78	.	5.9065	0.19004	0.4414:0.0:0.4237:0.1349	.	393	A6H8M9	CDHR4_HUMAN	A	393	ENSP00000391409:V393A	ENSP00000391409:V393A	V	-	2	0	CDHR4	49807391	0.000000	0.05858	0.029000	0.17559	0.537000	0.34900	-1.076000	0.03420	-0.906000	0.03866	-0.421000	0.06004	GTC	.	.		0.622	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350387.1	NM_001007540	
NT5DC2	64943	hgsc.bcm.edu	37	3	52558487	52558487	+	Nonstop_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:52558487C>A	ENST00000307076.4	-	14	1962	c.1562G>T	c.(1561-1563)tGa>tTa	p.*521L	NT5DC2_ENST00000307092.4_Nonstop_Mutation_p.*462L|NT5DC2_ENST00000422318.2_Nonstop_Mutation_p.*558L|NT5DC2_ENST00000459839.1_Nonstop_Mutation_p.*533L|STAB1_ENST00000321725.6_3'UTR	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	0							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		AAGGTGCCCTCAGCGGATGTG	0.612																																					p.X558L		Atlas-SNP	.											NT5DC2,bladder,carcinoma,0,1	NT5DC2	35	.	0			c.G1673T						.						82.0	93.0	89.0					3																	52558487		2203	4299	6502	SO:0001578	stop_lost	64943	exon14			TGCCCTCAGCGGA	AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.1562G>T	chr3.hg19:g.52558487C>A		47.0	0.0		55.0	3.0	NM_001134231	C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	ENST00000307076.4	hg19	CCDS2858.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321470	0.81580	.	.	ENSG00000168268	ENST00000307092;ENST00000463947;ENST00000307076;ENST00000422318;ENST00000459839	.	.	.	5.76	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8637	0.52480	0.0:0.8599:0.0:0.1401	.	.	.	.	L	462;195;521;558;533	.	.	X	-	2	2	NT5DC2	52533527	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	1.449000	0.35123	1.453000	0.47775	-0.140000	0.14226	TGA	.	.		0.612	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000351509.1	NM_022908	
RPP14	11102	hgsc.bcm.edu	37	3	58302307	58302307	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:58302307A>G	ENST00000445193.3	+	4	639	c.228A>G	c.(226-228)agA>agG	p.R76R	RPP14_ENST00000528153.1_5'Flank|RPP14_ENST00000477305.1_3'UTR|RPP14_ENST00000466547.1_Silent_p.R76R|RPP14_ENST00000295959.5_Silent_p.R76R	NM_001098783.2	NP_001092253.1	O95059	RPP14_HUMAN	ribonuclease P/MRP 14kDa subunit	76					tRNA processing (GO:0008033)	nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)|RNA binding (GO:0003723)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.000187)|KIRC - Kidney renal clear cell carcinoma(10;0.0102)|Kidney(10;0.0118)|OV - Ovarian serous cystadenocarcinoma(275;0.191)		CCATCTTGAGAATATGTAGCA	0.413																																					p.R76R		Atlas-SNP	.											.	RPP14	6	.	0			c.A228G						.						148.0	139.0	142.0					3																	58302307		2203	4300	6503	SO:0001819	synonymous_variant	11102	exon4			CTTGAGAATATGT	AF001175	CCDS2888.1	3p21.2	2012-05-21	2007-06-26		ENSG00000163684	ENSG00000163684			30327	protein-coding gene	gene with protein product		606112	"""ribonuclease P 14kDa subunit"""			10024167, 11929972	Standard	NM_001098783		Approved	P14	uc031sah.1	O95059	OTTHUMG00000159152	ENST00000445193.3:c.228A>G	chr3.hg19:g.58302307A>G		83.0	0.0		103.0	5.0	NM_007042	Q53X97	Silent	SNP	ENST00000445193.3	hg19	CCDS2888.1																																																																																			.	.		0.413	RPP14-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353527.2	NM_007042	
CADPS	8618	hgsc.bcm.edu	37	3	62385129	62385129	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:62385129C>T	ENST00000383710.4	-	30	4363	c.4014G>A	c.(4012-4014)caG>caA	p.Q1338Q	CADPS_ENST00000357948.3_Silent_p.Q1259Q|CADPS_ENST00000283269.9_Silent_p.Q1299Q	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1338	Mediates targeting and association with DCVs. {ECO:0000250}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TGCTGATGCCCTGCAGTCCCC	0.522																																					p.Q1338Q		Atlas-SNP	.											.	CADPS	387	.	0			c.G4014A						.						217.0	189.0	198.0					3																	62385129		2203	4300	6503	SO:0001819	synonymous_variant	8618	exon30			GATGCCCTGCAGT	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.4014G>A	chr3.hg19:g.62385129C>T		132.0	0.0		119.0	45.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	ENST00000383710.4	hg19	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	4.156	0.027463	0.08054	.	.	ENSG00000163618	ENST00000473635	.	.	.	5.86	3.1	0.35709	.	.	.	.	.	T	0.59622	0.2207	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55263	-0.8168	4	.	.	.	.	10.0739	0.42349	0.0:0.7833:0.0:0.2167	.	.	.	.	K	330	.	.	R	-	2	0	CADPS	62360169	0.996000	0.38824	1.000000	0.80357	0.902000	0.53008	0.512000	0.22755	0.809000	0.34255	-0.140000	0.14226	AGG	.	.		0.522	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64617541	64617541	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:64617541C>G	ENST00000498707.1	-	15	2578	c.2236G>C	c.(2236-2238)Ggt>Cgt	p.G746R	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.G718R	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	746	Cys-rich.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTATCGCCACCACAAACCCCA	0.358																																					p.G746R		Atlas-SNP	.											.	ADAMTS9	206	.	0			c.G2236C						.						119.0	118.0	118.0					3																	64617541		2202	4300	6502	SO:0001583	missense	56999	exon15			CGCCACCACAAAC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2236G>C	chr3.hg19:g.64617541C>G	ENSP00000418735:p.Gly746Arg	104.0	0.0		122.0	46.0	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	hg19	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265563	0.95399	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.68025	-0.3;-0.3	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	M	0.63169	1.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;P	0.97110	0.997;1.0;1.0;0.882	T	0.80567	-0.1325	10	0.59425	D	0.04	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	718;746;746;746	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	R	718;746	ENSP00000295903:G718R;ENSP00000418735:G746R	ENSP00000295903:G718R	G	-	1	0	ADAMTS9	64592581	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	GGT	.	.		0.358	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
EBLN2	55096	hgsc.bcm.edu	37	3	73111481	73111481	+	Missense_Mutation	SNP	C	C	A	rs3832186|rs201649088	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:73111481C>A	ENST00000533473.1	+	1	672	c.249C>A	c.(247-249)aaC>aaA	p.N83K	PPP4R2_ENST00000394284.3_Intron|PPP4R2_ENST00000295862.9_Intron|PPP4R2_ENST00000356692.5_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	83										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						CTGGGAAAAACAGACAGTATC	0.478																																					p.N83K		Atlas-SNP	.											.	EBLN2	18	.	0			c.C249A						.						34.0	34.0	34.0					3																	73111481		1942	4138	6080	SO:0001583	missense	55096	exon1			GAAAAACAGACAG		CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.249C>A	chr3.hg19:g.73111481C>A	ENSP00000432104:p.Asn83Lys	64.0	0.0		76.0	5.0	NM_018029	Q8WWH3|Q9NW89	Missense_Mutation	SNP	ENST00000533473.1	hg19	CCDS54608.1	.	.	.	.	.	.	.	.	.	.	C	4.916	0.170168	0.09339	.	.	ENSG00000255423	ENST00000533473	.	.	.	0.458	0.458	0.16670	P40 nucleoprotein, subdomain 1, Borna disease virus (1);	.	.	.	.	T	0.16854	0.0405	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.13407	0.009	T	0.23368	-1.0190	7	0.31617	T	0.26	.	.	.	.	.	83	Q6P2I7	EBLN2_HUMAN	K	83	.	ENSP00000432104:N83K	N	+	3	2	EBLN2	73194171	0.047000	0.20315	0.005000	0.12908	0.005000	0.04900	0.305000	0.19254	0.482000	0.27582	0.484000	0.47621	AAC	.	.		0.478	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386932.1	NM_018029	
PDZRN3	23024	hgsc.bcm.edu	37	3	73434932	73434932	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:73434932T>C	ENST00000263666.4	-	9	1637	c.1523A>G	c.(1522-1524)gAt>gGt	p.D508G	PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000462146.2_Missense_Mutation_p.D165G|PDZRN3_ENST00000535920.1_Missense_Mutation_p.D230G|PDZRN3_ENST00000466780.1_Missense_Mutation_p.D165G|PDZRN3_ENST00000479530.1_Missense_Mutation_p.D225G	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	508					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CCAGCCCTCATCCAGCTGCAG	0.463																																					p.D508G		Atlas-SNP	.											.	PDZRN3	196	.	0			c.A1523G						.						163.0	132.0	143.0					3																	73434932		2203	4300	6503	SO:0001583	missense	23024	exon9			CCCTCATCCAGCT	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1523A>G	chr3.hg19:g.73434932T>C	ENSP00000263666:p.Asp508Gly	43.0	0.0		78.0	5.0	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	hg19	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.5|24.5	4.537290|4.537290	0.85812|0.85812	.|.	.|.	ENSG00000121440|ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909|ENST00000494559	T;T;T;T;T;T|.	0.11063|.	2.81;3.51;3.41;3.41;3.52;3.52|.	5.44|5.44	5.44|5.44	0.79542|0.79542	PDZ/DHR/GLGF (1);|.	0.097121|.	0.64402|.	N|.	0.000002|.	T|T	0.72260|0.72260	0.3438|0.3438	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	B;D;D;D|.	0.89917|.	0.006;1.0;0.972;0.991|.	B;D;D;D|.	0.91635|.	0.122;0.999;0.938;0.996|.	T|T	0.72020|0.72020	-0.4416|-0.4416	10|5	0.49607|.	T|.	0.09|.	.|.	15.1433|15.1433	0.72626|0.72626	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	230;225;225;508|.	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7|.	.;.;.;PZRN3_HUMAN|.	G|V	508;230;165;165;225;508;206|105	ENSP00000263666:D508G;ENSP00000442026:D230G;ENSP00000418168:D165G;ENSP00000418484:D165G;ENSP00000418624:D225G;ENSP00000419250:D206G|.	ENSP00000263666:D508G|.	D|M	-|-	2|1	0|0	PDZRN3|PDZRN3	73517622|73517622	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	7.852000|7.852000	0.86927|0.86927	2.053000|2.053000	0.61076|0.61076	0.533000|0.533000	0.62120|0.62120	GAT|ATG	.	.		0.463	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
SLC35A5	55032	hgsc.bcm.edu	37	3	112299917	112299917	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:112299917T>C	ENST00000492406.1	+	6	1236	c.953T>C	c.(952-954)cTt>cCt	p.L318P	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	318					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						TTCCAGGGCCTTTCAGTGGCT	0.428																																					p.L318P		Atlas-SNP	.											.	SLC35A5	40	.	0			c.T953C						.						78.0	75.0	76.0					3																	112299917		2203	4299	6502	SO:0001583	missense	55032	exon6			AGGGCCTTTCAGT	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.953T>C	chr3.hg19:g.112299917T>C	ENSP00000417654:p.Leu318Pro	69.0	0.0		90.0	4.0	NM_017945	D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	ENST00000492406.1	hg19	CCDS2967.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.169361	0.78339	.	.	ENSG00000138459	ENST00000492406	T	0.61040	0.14	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85399	0.1130	9	.	.	.	-19.211	16.2076	0.82138	0.0:0.0:0.0:1.0	.	318	Q9BS91	S35A5_HUMAN	P	318	ENSP00000417654:L318P	.	L	+	2	0	SLC35A5	113782607	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.554000	0.82212	2.285000	0.76669	0.477000	0.44152	CTT	.	.		0.428	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1	NM_017945	
GRAMD1C	54762	hgsc.bcm.edu	37	3	113601662	113601662	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:113601662A>G	ENST00000358160.4	+	6	1015	c.523A>G	c.(523-525)Aat>Gat	p.N175D	GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000452134.2_5'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	175						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						GTTGTGGCAGAATGTATTATT	0.348																																					p.N175D		Atlas-SNP	.											.	GRAMD1C	71	.	0			c.A523G						.						165.0	167.0	167.0					3																	113601662		2203	4300	6503	SO:0001583	missense	54762	exon6			TGGCAGAATGTAT		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.523A>G	chr3.hg19:g.113601662A>G	ENSP00000350881:p.Asn175Asp	92.0	0.0		87.0	4.0	NM_017577	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	hg19	CCDS33826.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.360984	0.82353	.	.	ENSG00000178075	ENST00000358160	T	0.36699	1.24	5.2	5.2	0.72013	.	0.481200	0.24260	N	0.040096	T	0.62466	0.2430	M	0.85197	2.74	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.65635	-0.6120	10	0.42905	T	0.14	.	13.0454	0.58922	1.0:0.0:0.0:0.0	.	175	Q8IYS0	GRM1C_HUMAN	D	175	ENSP00000350881:N175D	ENSP00000350881:N175D	N	+	1	0	GRAMD1C	115084352	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.682000	0.91232	1.955000	0.56771	0.523000	0.50628	AAT	.	.		0.348	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577	
POLQ	10721	hgsc.bcm.edu	37	3	121158914	121158914	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:121158914T>C	ENST00000264233.5	-	27	7442	c.7314A>G	c.(7312-7314)ggA>ggG	p.G2438G		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2438					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TCTGAACAAATCCGTCTCTTT	0.338								DNA polymerases (catalytic subunits)																													p.G2438G	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.A7314G						.						117.0	115.0	116.0					3																	121158914		2201	4300	6501	SO:0001819	synonymous_variant	10721	exon27			AACAAATCCGTCT	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7314A>G	chr3.hg19:g.121158914T>C		18.0	0.0		30.0	4.0	NM_199420	O95160|Q6VMB5	Silent	SNP	ENST00000264233.5	hg19	CCDS33833.1																																																																																			.	.		0.338	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
MBD4	8930	hgsc.bcm.edu	37	3	129151369	129151369	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:129151369A>G	ENST00000249910.1	-	7	1817	c.1642T>C	c.(1642-1644)Ttt>Ctt	p.F548L	MBD4_ENST00000429544.2_Missense_Mutation_p.F542L|MBD4_ENST00000503197.1_Intron|MBD4_ENST00000509587.1_5'Flank|MBD4_ENST00000393278.2_Missense_Mutation_p.F230L|MBD4_ENST00000507208.1_Missense_Mutation_p.F548L	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	548					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						TTGACACAAAAAATTCGGTAA	0.413								Base excision repair (BER), DNA glycosylases																													p.F548L		Atlas-SNP	.											.	MBD4	53	.	0			c.T1642C						.						184.0	170.0	175.0					3																	129151369		2203	4300	6503	SO:0001583	missense	8930	exon7			CACAAAAAATTCG	AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1642T>C	chr3.hg19:g.129151369A>G	ENSP00000249910:p.Phe548Leu	111.0	0.0		94.0	4.0	NM_003925	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	hg19	CCDS3058.1	.	.	.	.	.	.	.	.	.	.	A	35	5.437390	0.96168	.	.	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000393278;ENST00000507208	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.84	5.84	0.93424	DNA glycosylase (2);	0.051405	0.85682	D	0.000000	T	0.69878	0.3160	M	0.87827	2.91	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.75912	-0.3150	10	0.87932	D	0	-23.3192	15.9385	0.79736	1.0:0.0:0.0:0.0	.	548;230;542;548	E9PEE4;Q2MD36;O95243-2;O95243	.;.;.;MBD4_HUMAN	L	542;548;230;548	ENSP00000394080:F542L;ENSP00000249910:F548L;ENSP00000376959:F230L;ENSP00000422327:F548L	ENSP00000249910:F548L	F	-	1	0	MBD4	130634059	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.720000	0.91442	2.241000	0.73720	0.529000	0.55759	TTT	.	.		0.413	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	NM_003925	
STAG1	10274	hgsc.bcm.edu	37	3	136085882	136085882	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:136085882T>C	ENST00000383202.2	-	25	2844	c.2588A>G	c.(2587-2589)cAt>cGt	p.H863R	STAG1_ENST00000536929.1_Missense_Mutation_p.H447R|STAG1_ENST00000236698.5_Missense_Mutation_p.H863R|STAG1_ENST00000434713.2_Missense_Mutation_p.H637R	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	863					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CCTTCTTTTATGTAAGGCCTC	0.353																																					p.H863R		Atlas-SNP	.											.	STAG1	135	.	0			c.A2588G						.						213.0	203.0	206.0					3																	136085882		2202	4299	6501	SO:0001583	missense	10274	exon25			CTTTTATGTAAGG	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.2588A>G	chr3.hg19:g.136085882T>C	ENSP00000372689:p.His863Arg	121.0	0.0		149.0	61.0	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	hg19	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517726	0.85495	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.36340	1.69;1.7;1.83;1.26	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.67088	0.2856	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.85130	0.997;0.957	T	0.74051	-0.3789	10	0.72032	D	0.01	.	16.1354	0.81481	0.0:0.0:0.0:1.0	.	863;863	Q6P275;Q8WVM7	.;STAG1_HUMAN	R	863;863;637;447	ENSP00000372689:H863R;ENSP00000236698:H863R;ENSP00000404396:H637R;ENSP00000445787:H447R	ENSP00000236698:H863R	H	-	2	0	STAG1	137568572	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	2.207000	0.71202	0.533000	0.62120	CAT	.	.		0.353	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
ARMC8	25852	hgsc.bcm.edu	37	3	137960687	137960687	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:137960687A>G	ENST00000469044.1	+	11	1171	c.900A>G	c.(898-900)ggA>ggG	p.G300G	ARMC8_ENST00000485396.1_Silent_p.G227G|ARMC8_ENST00000491704.1_Silent_p.G258G|ARMC8_ENST00000471453.1_Silent_p.G286G|ARMC8_ENST00000538260.1_Silent_p.G269G|ARMC8_ENST00000489213.1_Silent_p.G258G|ARMC8_ENST00000481646.1_Silent_p.G286G|ARMC8_ENST00000358441.2_Silent_p.G286G|ARMC8_ENST00000393058.3_Silent_p.G290G|ARMC8_ENST00000461822.1_Intron|ARMC8_ENST00000470821.1_Silent_p.G300G	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	300										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						GAGTTGAAGGAGCTGAGACAC	0.398																																					p.G286G		Atlas-SNP	.											.	ARMC8	79	.	0			c.A858G						.						155.0	139.0	144.0					3																	137960687		2203	4300	6503	SO:0001819	synonymous_variant	25852	exon12			TGAAGGAGCTGAG		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.900A>G	chr3.hg19:g.137960687A>G		76.0	0.0		93.0	4.0	NM_213654	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Silent	SNP	ENST00000469044.1	hg19																																																																																				.	.		0.398	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	
SLC9A9	285195	hgsc.bcm.edu	37	3	143550901	143550901	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:143550901T>C	ENST00000316549.6	-	2	546	c.338A>G	c.(337-339)cAc>cGc	p.H113R		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	113					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						ATTGATGTTGTGCTGACTTAT	0.303																																					p.H113R		Atlas-SNP	.											.	SLC9A9	117	.	0			c.A338G						.						148.0	140.0	143.0					3																	143550901		2203	4299	6502	SO:0001583	missense	285195	exon2			ATGTTGTGCTGAC	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.338A>G	chr3.hg19:g.143550901T>C	ENSP00000320246:p.His113Arg	46.0	0.0		68.0	4.0	NM_173653	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	hg19	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	T	10.76	1.441778	0.25900	.	.	ENSG00000181804	ENST00000316549;ENST00000474151	T;T	0.21932	1.98;1.98	5.14	5.14	0.70334	Cation/H+ exchanger (1);	0.144593	0.49305	D	0.000159	T	0.10680	0.0261	N	0.01048	-1.04	0.44899	D	0.997915	P	0.37914	0.611	P	0.48598	0.583	T	0.41592	-0.9500	10	0.16420	T	0.52	.	9.851	0.41057	0.0:0.0762:0.0:0.9238	.	113	Q8IVB4	SL9A9_HUMAN	R	113	ENSP00000320246:H113R;ENSP00000418627:H113R	ENSP00000320246:H113R	H	-	2	0	SLC9A9	145033591	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.570000	0.53834	2.285000	0.76669	0.533000	0.62120	CAC	.	.		0.303	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653	
ZIC1	7545	hgsc.bcm.edu	37	3	147128660	147128660	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:147128660C>A	ENST00000282928.4	+	1	1490	c.761C>A	c.(760-762)aCg>aAg	p.T254K		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	254					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GAGCTAGTTACGCACGTCACC	0.557																																					p.T254K		Atlas-SNP	.											.	ZIC1	141	.	0			c.C761A						.						103.0	95.0	98.0					3																	147128660		2203	4300	6503	SO:0001583	missense	7545	exon1			TAGTTACGCACGT	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.761C>A	chr3.hg19:g.147128660C>A	ENSP00000282928:p.Thr254Lys	103.0	0.0		181.0	69.0	NM_003412	Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	hg19	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253887	0.80135	.	.	ENSG00000152977	ENST00000282928	D	0.91124	-2.79	4.01	4.01	0.46588	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	D	0.95076	0.8405	M	0.81179	2.53	0.80722	D	1	D	0.65815	0.995	D	0.71184	0.972	D	0.95992	0.8986	10	0.87932	D	0	.	16.467	0.84081	0.0:1.0:0.0:0.0	.	254	Q15915	ZIC1_HUMAN	K	254	ENSP00000282928:T254K	ENSP00000282928:T254K	T	+	2	0	ZIC1	148611350	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.870000	0.69620	1.930000	0.55929	0.561000	0.74099	ACG	.	.		0.557	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
IL12A	3592	hgsc.bcm.edu	37	3	159711260	159711260	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:159711260G>C	ENST00000305579.2	+	4	708	c.401G>C	c.(400-402)aGa>aCa	p.R134T	IL12A-AS1_ENST00000497452.1_RNA|IL12A_ENST00000466512.1_Intron|IL12A_ENST00000480787.1_Missense_Mutation_p.R96T	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	100					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTAAATTCCAGAGAGACCTCT	0.308																																					p.R134T		Atlas-SNP	.											.	IL12A	23	.	0			c.G401C						.						59.0	60.0	59.0					3																	159711260		2203	4300	6503	SO:0001583	missense	3592	exon4			ATTCCAGAGAGAC	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.401G>C	chr3.hg19:g.159711260G>C	ENSP00000303231:p.Arg134Thr	115.0	0.0		112.0	45.0	NM_000882	Q96QZ1	Missense_Mutation	SNP	ENST00000305579.2	hg19	CCDS3187.1	.	.	.	.	.	.	.	.	.	.	G	1.493	-0.554082	0.03996	.	.	ENSG00000168811	ENST00000305579;ENST00000480787	.	.	.	3.8	0.996	0.19844	.	0.851921	0.10463	N	0.671752	T	0.48589	0.1508	L	0.55103	1.725	0.58432	D	0.999991	P	0.43231	0.801	B	0.43990	0.438	T	0.44205	-0.9343	9	0.51188	T	0.08	-0.4938	6.1096	0.20094	0.3345:0.0:0.6655:0.0	.	134	O60595	.	T	134;96	.	ENSP00000303231:R134T	R	+	2	0	IL12A	161193954	0.178000	0.23122	0.868000	0.34077	0.150000	0.21749	0.030000	0.13688	0.207000	0.20607	-0.142000	0.14014	AGA	.	.		0.308	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882	
SI	6476	hgsc.bcm.edu	37	3	164764772	164764772	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:164764772T>C	ENST00000264382.3	-	16	1806	c.1744A>G	c.(1744-1746)Aga>Gga	p.R582G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	582	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATGAAGCTTCTCTTATTAGGA	0.313										HNSCC(35;0.089)																											p.R582G		Atlas-SNP	.											.	SI	500	.	0			c.A1744G						.						53.0	52.0	52.0					3																	164764772		2203	4300	6503	SO:0001583	missense	6476	exon16			AGCTTCTCTTATT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1744A>G	chr3.hg19:g.164764772T>C	ENSP00000264382:p.Arg582Gly	126.0	0.0		142.0	6.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	hg19	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	T	16.86	3.238316	0.58886	.	.	ENSG00000090402	ENST00000264382	D	0.94330	-3.4	5.36	4.18	0.49190	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	H	0.99011	4.4	0.48511	D	0.999663	D	0.89917	1.0	D	0.97110	1.0	D	0.97757	1.0218	10	0.87932	D	0	.	11.6805	0.51455	0.0:0.0:0.1485:0.8515	.	582	P14410	SUIS_HUMAN	G	582	ENSP00000264382:R582G	ENSP00000264382:R582G	R	-	1	2	SI	166247466	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	1.665000	0.37449	0.856000	0.35383	0.383000	0.25322	AGA	.	.		0.313	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
PLD1	5337	hgsc.bcm.edu	37	3	171406587	171406587	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:171406587G>A	ENST00000351298.4	-	14	1544	c.1418C>T	c.(1417-1419)tCg>tTg	p.S473L	PLD1_ENST00000342215.6_Missense_Mutation_p.S473L|PLD1_ENST00000356327.5_Missense_Mutation_p.S473L|PLD1_ENST00000340989.4_Missense_Mutation_p.S473L	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	473	Catalytic.|PLD phosphodiesterase 1. {ECO:0000255|PROSITE-ProRule:PRU00153}.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	AAAGGCCACCGATTGGTCAAT	0.532																																					p.S473L	NSCLC(149;2174 3517 34058)	Atlas-SNP	.											.	PLD1	134	.	0			c.C1418T						.						121.0	99.0	107.0					3																	171406587		2203	4300	6503	SO:0001583	missense	5337	exon14			GCCACCGATTGGT	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1418C>T	chr3.hg19:g.171406587G>A	ENSP00000342793:p.Ser473Leu	83.0	0.0		98.0	4.0	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	hg19	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177091	0.57692	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.32515	3.35;3.34;1.45;3.2	5.3	4.42	0.53409	Phospholipase D/Transphosphatidylase (3);	0.078156	0.64402	D	0.000007	T	0.23727	0.0574	L	0.31157	0.91	0.80722	D	1	B;B	0.29481	0.245;0.065	B;B	0.28232	0.087;0.036	T	0.03503	-1.1030	10	0.31617	T	0.26	-11.1924	14.3925	0.66989	0.0717:0.0:0.9283:0.0	.	496;473	Q59EA4;Q13393	.;PLD1_HUMAN	L	473	ENSP00000348681:S473L;ENSP00000342793:S473L;ENSP00000339936:S473L;ENSP00000340326:S473L	ENSP00000340326:S473L	S	-	2	0	PLD1	172889281	1.000000	0.71417	0.824000	0.32777	0.355000	0.29361	9.781000	0.99029	1.364000	0.46038	0.655000	0.94253	TCG	.	.		0.532	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
FNDC3B	64778	hgsc.bcm.edu	37	3	172013157	172013157	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:172013157C>T	ENST00000336824.4	+	8	953	c.854C>T	c.(853-855)tCt>tTt	p.S285F	FNDC3B_ENST00000416957.1_Missense_Mutation_p.S285F|FNDC3B_ENST00000415807.2_Missense_Mutation_p.S285F	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	285	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.S285Y(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CCTCAGGTTTCTAATATTCAG	0.433																																					p.S285F		Atlas-SNP	.											FNDC3B,rectum,carcinoma,0,1	FNDC3B	118	.	1	Substitution - Missense(1)	large_intestine(1)	c.C854T						.						173.0	171.0	171.0					3																	172013157		2203	4300	6503	SO:0001583	missense	64778	exon8			AGGTTTCTAATAT	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.854C>T	chr3.hg19:g.172013157C>T	ENSP00000338523:p.Ser285Phe	107.0	1.0		107.0	5.0	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	hg19	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.076572	0.76415	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.60424	0.19;0.19;0.19	5.98	5.98	0.97165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.152355	0.64402	D	0.000012	T	0.77890	0.4198	M	0.79011	2.435	0.80722	D	1	P;D	0.57257	0.705;0.979	P;D	0.69824	0.595;0.966	T	0.78929	-0.2010	10	0.87932	D	0	-22.3578	19.2296	0.93833	0.0:1.0:0.0:0.0	.	285;285	Q53EP0-2;Q53EP0	.;FND3B_HUMAN	F	285	ENSP00000411242:S285F;ENSP00000338523:S285F;ENSP00000389094:S285F	ENSP00000338523:S285F	S	+	2	0	FNDC3B	173495851	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.715000	0.61909	2.835000	0.97688	0.650000	0.86243	TCT	.	.		0.433	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
MCF2L2	23101	hgsc.bcm.edu	37	3	183028819	183028819	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:183028819T>C	ENST00000328913.3	-	9	1176		c.e9-2		MCF2L2_ENST00000414362.2_Splice_Site|MCF2L2_ENST00000473233.1_Splice_Site|MCF2L2_ENST00000447025.2_Splice_Site	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2								Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			ACTAATAACCTTTCAAGAAAG	0.408																																					.		Atlas-SNP	.											.	MCF2L2	164	.	0			c.879-2A>G						.						76.0	76.0	76.0					3																	183028819		2203	4300	6503	SO:0001630	splice_region_variant	23101	exon10			ATAACCTTTCAAG	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.879-2A>G	chr3.hg19:g.183028819T>C		66.0	0.0		73.0	5.0	NM_015078	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Splice_Site	SNP	ENST00000328913.3	hg19	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.722125	0.48728	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4612	0.67450	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MCF2L2	184511513	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	6.829000	0.75314	2.092000	0.63282	0.533000	0.62120	.	.	.		0.408	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	Intron
VPS8	23355	hgsc.bcm.edu	37	3	184646287	184646287	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:184646287A>G	ENST00000437079.3	+	32	2851	c.2680A>G	c.(2680-2682)Agt>Ggt	p.S894G	VPS8_ENST00000446204.2_Missense_Mutation_p.S802G|VPS8_ENST00000287546.4_Missense_Mutation_p.S894G|VPS8_ENST00000436792.2_Missense_Mutation_p.S892G|VPS8_ENST00000463687.1_3'UTR	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	894							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			ATTTGAAGAGAGTCGACTCAT	0.333																																					p.S894G		Atlas-SNP	.											.	VPS8	109	.	0			c.A2680G						.						124.0	117.0	119.0					3																	184646287		1837	4101	5938	SO:0001583	missense	23355	exon31			GAAGAGAGTCGAC	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2680A>G	chr3.hg19:g.184646287A>G	ENSP00000397879:p.Ser894Gly	61.0	0.0		92.0	4.0	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	hg19	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	A	12.07	1.828382	0.32329	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.79	5.79	0.91817	Quinonprotein alcohol dehydrogenase-like (1);	0.394966	0.33916	N	0.004421	T	0.11665	0.0284	N	0.12182	0.205	0.34986	D	0.754568	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.15870	0.001;0.014;0.002	T	0.15780	-1.0425	10	0.32370	T	0.25	-8.2684	15.8033	0.78473	1.0:0.0:0.0:0.0	.	894;802;892	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	G	894;894;892;802	ENSP00000287546:S894G;ENSP00000397879:S894G;ENSP00000404704:S892G;ENSP00000405483:S802G	ENSP00000287546:S894G	S	+	1	0	VPS8	186128981	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.496000	0.73670	2.213000	0.71641	0.455000	0.32223	AGT	.	.		0.333	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
SEPSECS	51091	hgsc.bcm.edu	37	4	25160704	25160704	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:25160704T>C	ENST00000382103.2	-	2	212	c.140A>G	c.(139-141)gAt>gGt	p.D47G	PI4K2B_ENST00000512921.1_5'Flank|SEPSECS_ENST00000302922.3_Intron	NM_016955.3	NP_058651.3	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase	47					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	pyridoxal phosphate binding (GO:0030170)|transferase activity, transferring selenium-containing groups (GO:0016785)|tRNA binding (GO:0000049)	p.D47G(2)		endometrium(1)|large_intestine(4)|lung(2)|stomach(1)	8		Breast(46;0.173)				TGTACTTTCATCCCAGCCATT	0.363																																					p.D47G		Atlas-SNP	.											SEPSECS_ENST00000382103,NS,carcinoma,0,2	SEPSECS	55	.	2	Substitution - Missense(2)	prostate(1)|kidney(1)	c.A140G						.						118.0	108.0	111.0					4																	25160704		1865	4098	5963	SO:0001583	missense	51091	exon2			CTTTCATCCCAGC	AJ238617	CCDS3432.1, CCDS3432.2	4p15.2	2008-10-27			ENSG00000109618	ENSG00000109618			30605	protein-coding gene	gene with protein product	"""soluble liver antigen/liver pancreas antigen"""	613009				16230358, 10931155, 17142313, 17194211	Standard	NM_016955		Approved	SLA/LP, SLA	uc003grg.3	Q9HD40	OTTHUMG00000128563	ENST00000382103.2:c.140A>G	chr4.hg19:g.25160704T>C	ENSP00000371535:p.Asp47Gly	57.0	1.0		84.0	6.0	NM_016955	A8K8W1|Q0D2P3|Q17RT1|Q9NXZ5|Q9UGM9|Q9Y353	Missense_Mutation	SNP	ENST00000382103.2	hg19	CCDS3432.2	.	.	.	.	.	.	.	.	.	.	T	13.10	2.137631	0.37728	.	.	ENSG00000109618	ENST00000382103;ENST00000513285	D;D	0.81908	-1.55;-1.55	5.71	5.71	0.89125	Pyridoxal phosphate-dependent transferase, major domain (1);	0.188853	0.56097	D	0.000029	D	0.84257	0.5432	M	0.72894	2.215	0.80722	D	1	B;B	0.25904	0.137;0.028	B;B	0.32533	0.147;0.008	T	0.82750	-0.0303	10	0.56958	D	0.05	-2.1426	15.9715	0.80025	0.0:0.0:0.0:1.0	.	46;47	Q9HD40-3;Q9HD40	.;SPCS_HUMAN	G	47;132	ENSP00000371535:D47G;ENSP00000423361:D132G	ENSP00000371535:D47G	D	-	2	0	SEPSECS	24769802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.862000	0.48388	2.165000	0.68154	0.528000	0.53228	GAT	.	.		0.363	SEPSECS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250414.2	NM_016955	
RFC1	5981	hgsc.bcm.edu	37	4	39352986	39352986	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:39352986T>C	ENST00000381897.1	-	2	247	c.114A>G	c.(112-114)aaA>aaG	p.K38K	RFC1_ENST00000349703.2_Silent_p.K38K|RFC1_ENST00000418436.1_5'UTR	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	38					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CCTTTATTCCTTTCTTTGCTT	0.259																																					p.K38K	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	Atlas-SNP	.											.	RFC1	114	.	0			c.A114G						.						100.0	99.0	99.0					4																	39352986		2201	4298	6499	SO:0001819	synonymous_variant	5981	exon2			TATTCCTTTCTTT	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.114A>G	chr4.hg19:g.39352986T>C		73.0	0.0		70.0	4.0	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Silent	SNP	ENST00000381897.1	hg19	CCDS56329.1																																																																																			.	.		0.259	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
GNPDA2	132789	hgsc.bcm.edu	37	4	44709828	44709828	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:44709828A>G	ENST00000295448.3	-	6	866	c.710T>C	c.(709-711)tTt>tCt	p.F237S	GNPDA2_ENST00000511187.1_5'UTR|GNPDA2_ENST00000507917.1_Missense_Mutation_p.F203S|GNPDA2_ENST00000509756.1_Missense_Mutation_p.F237S|GNPDA2_ENST00000507534.1_Missense_Mutation_p.F167S|RP11-700J17.2_ENST00000610267.1_RNA	NM_138335.2	NP_612208.1	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	237					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(1)|lung(7)|ovary(1)	11						ATCGCATACAAAAATAGTCCG	0.413																																					p.F237S	Colon(54;743 1010 7604 16453 19544)	Atlas-SNP	.											.	GNPDA2	28	.	0			c.T710C						.						92.0	84.0	87.0					4																	44709828		2203	4300	6503	SO:0001583	missense	132789	exon6			CATACAAAAATAG	AF247786	CCDS3469.1, CCDS59472.1, CCDS59473.1	4p13	2006-04-12			ENSG00000163281	ENSG00000163281	3.5.99.6		21526	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate isomerase"""	613222				12965206	Standard	NM_001270880		Approved	SB52	uc003gwy.4	Q8TDQ7	OTTHUMG00000099415	ENST00000295448.3:c.710T>C	chr4.hg19:g.44709828A>G	ENSP00000295448:p.Phe237Ser	74.0	0.0		89.0	4.0	NM_138335	B4DJF3|Q2VYF1|Q59EA7|Q8NCZ8|Q96BJ4|Q96NC6	Missense_Mutation	SNP	ENST00000295448.3	hg19	CCDS3469.1	.	.	.	.	.	.	.	.	.	.	A	19.36	3.812079	0.70797	.	.	ENSG00000163281	ENST00000507917;ENST00000295448;ENST00000507534;ENST00000509756	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.62925	0.2468	M	0.72479	2.2	0.80722	D	1	P;D;D	0.89917	0.954;1.0;1.0	B;D;D	0.77004	0.439;0.989;0.966	T	0.67348	-0.5693	10	0.87932	D	0	-16.869	14.125	0.65215	1.0:0.0:0.0:0.0	.	203;237;237	Q2VYF1;Q8TDQ7-3;Q8TDQ7	.;.;GNPI2_HUMAN	S	203;237;167;237	ENSP00000425868:F203S;ENSP00000295448:F237S;ENSP00000427423:F167S;ENSP00000424061:F237S	ENSP00000295448:F237S	F	-	2	0	GNPDA2	44404585	1.000000	0.71417	1.000000	0.80357	0.551000	0.35334	8.761000	0.91691	2.180000	0.69256	0.533000	0.62120	TTT	.	.		0.413	GNPDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216874.3	NM_138335	
PROL1	58503	hgsc.bcm.edu	37	4	71275489	71275489	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:71275489C>T	ENST00000399575.2	+	3	618	c.444C>T	c.(442-444)acC>acT	p.T148T	PROL1_ENST00000514338.1_3'UTR	NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	148	Thr-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)	p.T148T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				ACATCACCACCGCAGATACAA	0.448																																					p.T148T		Atlas-SNP	.											PROL1,NS,carcinoma,0,1	PROL1	46	.	1	Substitution - coding silent(1)	kidney(1)	c.C444T						.						189.0	211.0	204.0					4																	71275489		1975	4164	6139	SO:0001819	synonymous_variant	58503	exon3			CACCACCGCAGAT	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.444C>T	chr4.hg19:g.71275489C>T		174.0	0.0		134.0	91.0	NM_021225	A8MZ07|P85047	Silent	SNP	ENST00000399575.2	hg19	CCDS43235.1																																																																																			.	.		0.448	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1	NM_021225	
RUFY3	22902	hgsc.bcm.edu	37	4	71588361	71588361	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:71588361A>G	ENST00000226328.4	+	1	634	c.71A>G	c.(70-72)gAg>gGg	p.E24G	RUFY3_ENST00000381006.3_Missense_Mutation_p.E24G|RUFY3_ENST00000417478.2_Intron|RUFY3_ENST00000536664.1_5'Flank	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	24					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			GCTGCCATGGAGACCATCTAC	0.547																																					p.E24G		Atlas-SNP	.											.	RUFY3	61	.	0			c.A71G						.						216.0	177.0	191.0					4																	71588361		2203	4300	6503	SO:0001583	missense	22902	exon1			CCATGGAGACCAT	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.71A>G	chr4.hg19:g.71588361A>G	ENSP00000226328:p.Glu24Gly	86.0	0.0		98.0	4.0	NM_001037442	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	ENST00000226328.4	hg19	CCDS3547.1	.	.	.	.	.	.	.	.	.	.	A	27.8	4.866401	0.91511	.	.	ENSG00000018189	ENST00000381006;ENST00000226328	T;T	0.14266	2.9;2.52	5.64	5.64	0.86602	.	0.054650	0.64402	D	0.000001	T	0.28101	0.0693	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.981	D;D	0.78314	0.991;0.932	T	0.01776	-1.1276	10	0.72032	D	0.01	-6.7551	15.8666	0.79069	1.0:0.0:0.0:0.0	.	24;24	Q7L099-3;Q7L099	.;RUFY3_HUMAN	G	24	ENSP00000370394:E24G;ENSP00000226328:E24G	ENSP00000226328:E24G	E	+	2	0	RUFY3	71807225	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.148000	0.66965	0.528000	0.53228	GAG	.	.		0.547	RUFY3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252161.2	NM_014961	
SLC4A4	8671	hgsc.bcm.edu	37	4	72306489	72306489	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:72306489A>G	ENST00000264485.5	+	8	1081	c.964A>G	c.(964-966)Agg>Ggg	p.R322G	SLC4A4_ENST00000425175.1_Splice_Site_p.R322G|SLC4A4_ENST00000512686.1_Splice_Site_p.R278G|SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000340595.3_Splice_Site_p.R278G|SLC4A4_ENST00000351898.6_Splice_Site_p.R322G	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	322					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TGTGCCCACAAGGTAAGCTGC	0.473																																					p.R322G		Atlas-SNP	.											.	SLC4A4	269	.	0			c.A964G						.						198.0	167.0	177.0					4																	72306489		2203	4300	6503	SO:0001630	splice_region_variant	8671	exon8			CCCACAAGGTAAG	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.965+1A>G	chr4.hg19:g.72306489A>G		133.0	0.0		99.0	4.0	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	hg19	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.951071	0.73787	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000512686;ENST00000340595	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	5.15	2.48	0.30137	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	D	0.89283	0.6671	M	0.92367	3.3	0.80722	D	1	D;D;P;D;D;D	0.76494	0.985;0.999;0.949;0.992;0.998;0.976	D;D;P;D;D;D	0.73708	0.924;0.979;0.875;0.94;0.981;0.948	D	0.90894	0.4763	10	0.87932	D	0	.	12.3566	0.55178	0.6088:0.3912:0.0:0.0	.	322;322;278;278;302;322	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1-3;Q9Y6R3;Q9Y6R1	.;.;.;.;.;S4A4_HUMAN	G	322;322;322;278;278	ENSP00000264485:R322G;ENSP00000393557:R322G;ENSP00000307349:R322G;ENSP00000422400:R278G;ENSP00000344272:R278G	ENSP00000264485:R322G	R	+	1	2	SLC4A4	72525353	0.974000	0.33945	0.903000	0.35520	0.972000	0.66771	2.525000	0.45598	0.883000	0.36040	0.533000	0.62120	AGG	.	.		0.473	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	Missense_Mutation
CCDC158	339965	hgsc.bcm.edu	37	4	77247091	77247091	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:77247091T>C	ENST00000388914.3	-	22	3228	c.3076A>G	c.(3076-3078)Act>Gct	p.T1026A		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	1026	Ser-rich.									breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						ACTGAACTAGTTAGGAGTGAG	0.373																																					p.T1026A		Atlas-SNP	.											.	CCDC158	114	.	0			c.A3076G						.						170.0	165.0	166.0					4																	77247091		1863	4109	5972	SO:0001583	missense	339965	exon22			AACTAGTTAGGAG	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.3076A>G	chr4.hg19:g.77247091T>C	ENSP00000373566:p.Thr1026Ala	60.0	0.0		80.0	4.0	NM_001042784	Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	hg19	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616427	0.46736	.	.	ENSG00000163749	ENST00000388914;ENST00000318586	T	0.35421	1.31	4.83	3.57	0.40892	.	0.135985	0.34245	N	0.004136	T	0.19248	0.0462	N	0.24115	0.695	0.41628	D	0.989001	P	0.36990	0.577	B	0.38264	0.269	T	0.08207	-1.0733	10	0.05833	T	0.94	.	7.3456	0.26662	0.1946:0.0:0.0:0.8054	.	1026	Q5M9N0	CD158_HUMAN	A	1026;446	ENSP00000373566:T1026A	ENSP00000316815:T446A	T	-	1	0	CCDC158	77466115	0.976000	0.34144	0.743000	0.31040	0.279000	0.26890	2.034000	0.41145	2.169000	0.68431	0.374000	0.22700	ACT	.	.		0.373	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	
CCDC158	339965	hgsc.bcm.edu	37	4	77324342	77324342	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:77324342C>T	ENST00000388914.3	-	2	171	c.19G>A	c.(19-21)Gaa>Aaa	p.E7K	SNORD50_ENST00000362987.1_RNA|CCDC158_ENST00000434846.2_Missense_Mutation_p.E7K|CCDC158_ENST00000504868.1_5'UTR	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	7										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TTATTTGATTCCCAAGCTTTT	0.323																																					p.E7K		Atlas-SNP	.											CCDC158,NS,carcinoma,0,1	CCDC158	114	.	0			c.G19A						.						133.0	124.0	126.0					4																	77324342		1806	4063	5869	SO:0001583	missense	339965	exon2			TTGATTCCCAAGC	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.19G>A	chr4.hg19:g.77324342C>T	ENSP00000373566:p.Glu7Lys	55.0	0.0		44.0	2.0	NM_001042784	Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	hg19	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217333	0.58560	.	.	ENSG00000163749	ENST00000388914;ENST00000318586;ENST00000434846	T;T	0.46819	0.99;0.86	4.06	4.06	0.47325	.	0.000000	0.43260	D	0.000586	T	0.29783	0.0744	N	0.14661	0.345	0.29528	N	0.853008	P;B	0.37330	0.59;0.447	B;B	0.34652	0.187;0.051	T	0.36456	-0.9747	10	0.66056	D	0.02	.	12.0512	0.53507	0.0:1.0:0.0:0.0	.	7;7	Q5M9N0-3;Q5M9N0	.;CD158_HUMAN	K	7	ENSP00000373566:E7K;ENSP00000401742:E7K	ENSP00000316815:E7K	E	-	1	0	CCDC158	77543366	0.994000	0.37717	0.968000	0.41197	0.512000	0.34134	1.999000	0.40806	2.550000	0.86006	0.655000	0.94253	GAA	.	.		0.323	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	
SPARCL1	8404	hgsc.bcm.edu	37	4	88411956	88411956	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:88411956A>G	ENST00000282470.6	-	6	1836	c.1366T>C	c.(1366-1368)Tgc>Cgc	p.C456R	SPARCL1_ENST00000418378.1_Missense_Mutation_p.C456R|SPARCL1_ENST00000503414.1_Missense_Mutation_p.C331R	NM_004684.4	NP_004675.3	Q14515	SPRL1_HUMAN	SPARC-like 1 (hevin)	456	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(2)	21				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		GGATCCTGGCAGACACAGTGA	0.438																																					p.C456R		Atlas-SNP	.											.	SPARCL1	59	.	0			c.T1366C						.						133.0	132.0	133.0					4																	88411956		2203	4300	6503	SO:0001583	missense	8404	exon6			CCTGGCAGACACA	X86693	CCDS3622.1	4q22-q25	2013-01-10	2008-08-29		ENSG00000152583	ENSG00000152583		"""EF-hand domain containing"""	11220	protein-coding gene	gene with protein product		606041	"""SPARC-like 1 (mast9, hevin)"""			8488563, 7600298, 16844696	Standard	NM_001128310		Approved	MAST9	uc003hqs.4	Q14515	OTTHUMG00000130605	ENST00000282470.6:c.1366T>C	chr4.hg19:g.88411956A>G	ENSP00000282470:p.Cys456Arg	155.0	0.0		98.0	4.0	NM_004684	B4E2Z0|E7ESU2|Q14800	Missense_Mutation	SNP	ENST00000282470.6	hg19	CCDS3622.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981429	0.74474	.	.	ENSG00000152583	ENST00000282470;ENST00000418378;ENST00000438050;ENST00000503414	D;D;D	0.90900	-2.75;-2.75;-2.75	5.17	5.17	0.71159	Proteinase inhibitor I1, Kazal (2);Osteonectin-like, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95487	0.8534	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96078	0.9051	10	0.87932	D	0	-8.5084	14.5292	0.67912	1.0:0.0:0.0:0.0	.	456	Q14515	SPRL1_HUMAN	R	456;456;331;331	ENSP00000282470:C456R;ENSP00000414856:C456R;ENSP00000422903:C331R	ENSP00000282470:C456R	C	-	1	0	SPARCL1	88630980	1.000000	0.71417	0.991000	0.47740	0.827000	0.46813	7.866000	0.87056	2.260000	0.74910	0.528000	0.53228	TGC	.	.		0.438	SPARCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253059.2		
DSPP	1834	hgsc.bcm.edu	37	4	88535745	88535745	+	Missense_Mutation	SNP	A	A	G	rs200924212		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:88535745A>G	ENST00000282478.7	+	4	1964	c.1931A>G	c.(1930-1932)gAc>gGc	p.D644G	DSPP_ENST00000399271.1_Missense_Mutation_p.D644G|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	644	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcagtgacagcaacagc	0.483																																					p.D644G		Atlas-SNP	.											.	DSPP	174	.	0			c.A1931G						.						122.0	140.0	134.0					4																	88535745		1797	3285	5082	SO:0001583	missense	1834	exon5			GCAGTGACAGCAA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1931A>G	chr4.hg19:g.88535745A>G	ENSP00000282478:p.Asp644Gly	159.0	0.0		110.0	6.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.716185	0.00706	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87729	-2.29;-2.29	0.737	0.737	0.18314	.	.	.	.	.	T	0.78084	0.4228	L	0.36672	1.1	0.09310	N	1	B	0.27625	0.183	B	0.15870	0.014	T	0.67229	-0.5723	8	0.56958	D	0.05	.	.	.	.	.	644	Q9NZW4	DSPP_HUMAN	G	644	ENSP00000382213:D644G;ENSP00000282478:D644G	ENSP00000282478:D644G	D	+	2	0	DSPP	88754769	0.001000	0.12720	0.155000	0.22561	0.002000	0.02628	0.867000	0.27968	0.539000	0.28788	0.147000	0.16070	GAC	.	.		0.483	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
EMCN	51705	hgsc.bcm.edu	37	4	101396223	101396223	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:101396223T>C	ENST00000296420.4	-	3	409	c.231A>G	c.(229-231)acA>acG	p.T77T	EMCN_ENST00000502327.1_5'UTR|EMCN_ENST00000305864.3_Silent_p.T77T|EMCN_ENST00000511970.1_Silent_p.T77T	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	77	Thr-rich.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		AAAAAGTAGCTGTTGACATCA	0.239																																					p.T77T		Atlas-SNP	.											.	EMCN	37	.	0			c.A231G						.						49.0	54.0	53.0					4																	101396223		2184	4274	6458	SO:0001819	synonymous_variant	51705	exon3			AGTAGCTGTTGAC	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.231A>G	chr4.hg19:g.101396223T>C		56.0	0.0		38.0	4.0	NM_001159694	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Silent	SNP	ENST00000296420.4	hg19	CCDS3655.1																																																																																			.	.		0.239	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242	
NFKB1	4790	hgsc.bcm.edu	37	4	103531782	103531782	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:103531782T>C	ENST00000505458.1	+	20	2552	c.2275T>C	c.(2275-2277)Tct>Cct	p.S759P	NFKB1_ENST00000394820.4_Missense_Mutation_p.S759P|NFKB1_ENST00000226574.4_Missense_Mutation_p.S760P|NFKB1_ENST00000600343.1_Missense_Mutation_p.S579P			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	759	Interaction with CFLAR.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	CCTGGATGACTCTTGGGAAAA	0.512																																					p.S760P		Atlas-SNP	.											.	NFKB1	78	.	0			c.T2278C						.						134.0	130.0	132.0					4																	103531782		2203	4300	6503	SO:0001583	missense	4790	exon20			GATGACTCTTGGG	M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.2275T>C	chr4.hg19:g.103531782T>C	ENSP00000424790:p.Ser759Pro	77.0	0.0		46.0	4.0	NM_003998	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	ENST00000505458.1	hg19	CCDS54783.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.926826	0.52759	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458	T;T;T	0.36878	1.23;1.23;1.23	4.62	3.44	0.39384	Ankyrin repeat-containing domain (2);	0.686712	0.13698	N	0.369051	T	0.24661	0.0598	L	0.34521	1.04	0.37283	D	0.907912	P;P;P	0.43633	0.536;0.722;0.813	B;B;B	0.41299	0.203;0.189;0.353	T	0.07731	-1.0757	10	0.24483	T	0.36	.	5.4659	0.16642	0.1337:0.0:0.2903:0.576	.	579;759;760	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	P	760;759;759	ENSP00000226574:S760P;ENSP00000378297:S759P;ENSP00000424790:S759P	ENSP00000226574:S760P	S	+	1	0	NFKB1	103750820	0.879000	0.30193	0.999000	0.59377	0.964000	0.63967	1.046000	0.30354	1.935000	0.56089	0.533000	0.62120	TCT	.	.		0.512	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363411.1		
BDH2	56898	hgsc.bcm.edu	37	4	104013835	104013835	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:104013835A>G	ENST00000296424.4	-	4	290	c.170T>C	c.(169-171)cTt>cCt	p.L57P		NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	57					epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		TGTGACATCAAGGACACGAGT	0.338																																					p.L57P		Atlas-SNP	.											.	BDH2	18	.	0			c.T170C						.						76.0	77.0	77.0					4																	104013835		2203	4300	6503	SO:0001583	missense	56898	exon4			ACATCAAGGACAC	AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.170T>C	chr4.hg19:g.104013835A>G	ENSP00000296424:p.Leu57Pro	199.0	0.0		135.0	6.0	NM_020139	A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Missense_Mutation	SNP	ENST00000296424.4	hg19	CCDS3663.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.831689	0.50845	.	.	ENSG00000164039	ENST00000296424;ENST00000504285;ENST00000509245	T;D;D	0.88354	1.77;-2.37;-2.37	4.83	4.83	0.62350	NAD(P)-binding domain (1);	0.128387	0.48286	D	0.000183	D	0.93913	0.8052	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94619	0.7811	10	0.87932	D	0	.	13.7077	0.62651	1.0:0.0:0.0:0.0	.	57	Q9BUT1	BDH2_HUMAN	P	57	ENSP00000296424:L57P;ENSP00000427442:L57P;ENSP00000422891:L57P	ENSP00000296424:L57P	L	-	2	0	BDH2	104233284	1.000000	0.71417	0.199000	0.23439	0.395000	0.30598	7.419000	0.80179	1.942000	0.56320	0.459000	0.35465	CTT	.	.		0.338	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157159.2	NM_020139	
GAR1	54433	hgsc.bcm.edu	37	4	110739158	110739158	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:110739158A>G	ENST00000226796.6	+	3	545	c.281A>G	c.(280-282)aAg>aGg	p.K94R	RP11-602N24.3_ENST00000609440.1_lincRNA|GAR1_ENST00000394631.3_Missense_Mutation_p.K94R	NM_018983.3	NP_061856.1	Q9NY12	GAR1_HUMAN	GAR1 ribonucleoprotein	94					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA snoRNP complex (GO:0031429)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cation channel activity (GO:0005261)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	9						GATGAAAATAAGGTGCCTTAT	0.333																																					p.K94R		Atlas-SNP	.											.	GAR1	16	.	0			c.A281G						.						126.0	123.0	124.0					4																	110739158		2203	4300	6503	SO:0001583	missense	54433	exon3			AAAATAAGGTGCC	AJ276003	CCDS34050.1	4q	2013-07-31	2013-07-31	2008-10-13	ENSG00000109534	ENSG00000109534			14264	protein-coding gene	gene with protein product		606468	"""nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs)"", ""GAR1 ribonucleoprotein homolog (yeast)"""	NOLA1		10757788	Standard	XM_005263069		Approved		uc003hzu.3	Q9NY12	OTTHUMG00000161108	ENST00000226796.6:c.281A>G	chr4.hg19:g.110739158A>G	ENSP00000226796:p.Lys94Arg	71.0	0.0		49.0	4.0	NM_018983	Q5MJQ2	Missense_Mutation	SNP	ENST00000226796.6	hg19	CCDS34050.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.050995	0.55218	.	.	ENSG00000109534	ENST00000394631;ENST00000226796	.	.	.	4.94	4.94	0.65067	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.047654	0.85682	D	0.000000	T	0.35219	0.0924	N	0.16478	0.41	0.43617	D	0.995991	B;B	0.27416	0.148;0.178	B;B	0.27380	0.048;0.079	T	0.23762	-1.0179	9	0.45353	T	0.12	.	9.4458	0.38697	0.9202:0.0:0.0798:0.0	.	94;94	Q9NY12-2;Q9NY12	.;GAR1_HUMAN	R	94	.	ENSP00000226796:K94R	K	+	2	0	GAR1	110958607	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.087000	0.57671	1.975000	0.57531	0.533000	0.62120	AAG	.	.		0.333	GAR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363810.2		
AP1AR	55435	hgsc.bcm.edu	37	4	113187842	113187842	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:113187842T>C	ENST00000274000.5	+	9	968	c.613T>C	c.(613-615)Tcc>Ccc	p.S205P	AP1AR_ENST00000309703.6_Missense_Mutation_p.S172P	NM_018569.4	NP_061039.3	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated regulatory protein	205	Sufficient for association with the Arp2/3 complex.				cellular protein localization (GO:0034613)|negative regulation of cell motility (GO:2000146)|negative regulation of receptor recycling (GO:0001920)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|transport vesicle (GO:0030133)	AP-1 adaptor complex binding (GO:0035650)|kinesin binding (GO:0019894)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	9						CGACAGCACATCCTTAGATCT	0.333																																					p.S205P		Atlas-SNP	.											.	AP1AR	25	.	0			c.T613C						.						126.0	125.0	125.0					4																	113187842		2203	4300	6503	SO:0001583	missense	55435	exon9			AGCACATCCTTAG	AL136628	CCDS3696.1, CCDS47125.1	4q25	2009-09-28	2009-09-25	2009-09-25	ENSG00000138660	ENSG00000138660			28808	protein-coding gene	gene with protein product	"""gamma1-adaptin brefeldin A resistance"""	610851	"""chromosome 4 open reading frame 16"""	C4orf16		15775984	Standard	NM_018569		Approved	PRO0971, 2C18, gamma-BAR	uc003iaj.4	Q63HQ0	OTTHUMG00000132849	ENST00000274000.5:c.613T>C	chr4.hg19:g.113187842T>C	ENSP00000274000:p.Ser205Pro	125.0	0.0		92.0	4.0	NM_018569	B2RCV7|Q96GG6|Q9H0V0|Q9P1L4	Missense_Mutation	SNP	ENST00000274000.5	hg19	CCDS3696.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.592478	0.86953	.	.	ENSG00000138660	ENST00000274000;ENST00000309703	T;T	0.59224	0.28;0.37	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.73289	0.3568	M	0.62723	1.935	0.58432	D	0.99999	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.76342	-0.2994	10	0.72032	D	0.01	-16.0643	15.3104	0.74026	0.0:0.0:0.0:1.0	.	172;205	Q63HQ0-2;Q63HQ0	.;AP1AR_HUMAN	P	205;172	ENSP00000274000:S205P;ENSP00000309023:S172P	ENSP00000274000:S205P	S	+	1	0	AP1AR	113407291	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.170000	0.77587	2.025000	0.59659	0.533000	0.62120	TCC	.	.		0.333	AP1AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256323.2	NM_018569	
MYOZ2	51778	hgsc.bcm.edu	37	4	120079180	120079180	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:120079180A>G	ENST00000307128.5	+	4	463	c.250A>G	c.(250-252)Agt>Ggt	p.S84G		NM_016599.4	NP_057683.1			myozenin 2											endometrium(1)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						AATACAGCACAGTATTGCTAT	0.398																																					p.S84G		Atlas-SNP	.											MYOZ2,NS,carcinoma,0,1	MYOZ2	34	.	0			c.A250G						.						109.0	109.0	109.0					4																	120079180		2203	4300	6503	SO:0001583	missense	51778	exon4			CAGCACAGTATTG	AF249873	CCDS3711.1	4q26-q27	2014-09-17	2002-01-07	2002-01-11	ENSG00000172399	ENSG00000172399			1330	protein-coding gene	gene with protein product		605602	"""chromosome 4 open reading frame 5"""	C4orf5		8619474, 9110174	Standard	NM_016599		Approved	CS-1	uc003icp.4	Q9NPC6	OTTHUMG00000132968	ENST00000307128.5:c.250A>G	chr4.hg19:g.120079180A>G	ENSP00000306997:p.Ser84Gly	59.0	1.0		38.0	2.0	NM_016599		Missense_Mutation	SNP	ENST00000307128.5	hg19	CCDS3711.1	.	.	.	.	.	.	.	.	.	.	A	8.500	0.863935	0.17250	.	.	ENSG00000172399	ENST00000307128	T	0.64438	-0.1	5.7	4.52	0.55395	.	1.230050	0.05045	N	0.477128	T	0.35451	0.0932	N	0.02158	-0.66	0.22787	N	0.998736	B	0.02656	0.0	B	0.08055	0.003	T	0.32241	-0.9914	10	0.11794	T	0.64	-0.1179	7.7009	0.28621	0.7692:0.1529:0.0779:0.0	.	84	Q9NPC6	MYOZ2_HUMAN	G	84	ENSP00000306997:S84G	ENSP00000306997:S84G	S	+	1	0	MYOZ2	120298628	0.983000	0.35010	0.761000	0.31378	0.873000	0.50193	2.962000	0.49176	0.974000	0.38366	-0.331000	0.08364	AGT	.	.		0.398	MYOZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256526.2		
JADE1	79960	hgsc.bcm.edu	37	4	129792723	129792723	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:129792723T>C	ENST00000226319.6	+	11	2115	c.1835T>C	c.(1834-1836)cTg>cCg	p.L612P	PHF17_ENST00000452328.2_Missense_Mutation_p.L600P|PHF17_ENST00000512960.1_Missense_Mutation_p.L612P	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AAAACCCTGCTGAAGCAGCCA	0.483																																					p.L612P		Atlas-SNP	.											.	PHF17	63	.	0			c.T1835C						.						60.0	65.0	63.0					4																	129792723		2203	4300	6503	SO:0001583	missense	79960	exon11			CCCTGCTGAAGCA																												ENST00000226319.6:c.1835T>C	chr4.hg19:g.129792723T>C	ENSP00000226319:p.Leu612Pro	81.0	0.0		73.0	4.0	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	hg19	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	T	2.301	-0.360169	0.05103	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.41065	1.01;1.01;1.01	4.45	-4.95	0.03048	.	2.083190	0.01822	N	0.034131	T	0.21227	0.0511	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.08680	-1.0710	9	.	.	.	.	4.7514	0.13063	0.2325:0.3486:0.0:0.4189	.	600;612	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	P	612;600;612;612	ENSP00000226319:L612P;ENSP00000388015:L600P;ENSP00000425730:L612P	.	L	+	2	0	PHF17	130012173	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	0.133000	0.15912	-0.987000	0.03494	-0.250000	0.11733	CTG	.	.		0.483	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
INPP4B	8821	hgsc.bcm.edu	37	4	143067030	143067030	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:143067030T>C	ENST00000513000.1	-	19	2116	c.1683A>G	c.(1681-1683)gaA>gaG	p.E561E	INPP4B_ENST00000509777.1_Silent_p.E561E|INPP4B_ENST00000308502.4_Silent_p.E561E|INPP4B_ENST00000262992.4_Silent_p.E561E|INPP4B_ENST00000508116.1_Silent_p.E561E	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	561					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					TTAATGAAGGTTCCTTTTCTC	0.408																																					p.E561E		Atlas-SNP	.											.	INPP4B	132	.	0			c.A1683G						.						190.0	164.0	173.0					4																	143067030		2203	4300	6503	SO:0001819	synonymous_variant	8821	exon19			TGAAGGTTCCTTT	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1683A>G	chr4.hg19:g.143067030T>C		107.0	0.0		91.0	4.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Silent	SNP	ENST00000513000.1	hg19	CCDS3757.1																																																																																			.	.		0.408	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
PRMT9	90826	hgsc.bcm.edu	37	4	148559746	148559746	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:148559746T>C	ENST00000322396.6	-	12	2717	c.2475A>G	c.(2473-2475)ggA>ggG	p.G825G	TMEM184C_ENST00000508208.1_Intron|PRMT10_ENST00000541232.1_Silent_p.G712G	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		825	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.					cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)	p.G825G(2)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						CAAGTTCCTCTCCCATTTCAA	0.408																																					p.G825G		Atlas-SNP	.											PRMT10,NS,carcinoma,0,1	PRMT10	68	.	2	Substitution - coding silent(2)	lung(2)	c.A2475G						.						205.0	183.0	190.0					4																	148559746		2203	4300	6503	SO:0001819	synonymous_variant	90826	exon12			TTCCTCTCCCATT																												ENST00000322396.6:c.2475A>G	chr4.hg19:g.148559746T>C		129.0	0.0		100.0	4.0	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Silent	SNP	ENST00000322396.6	hg19	CCDS3771.1																																																																																			.	.		0.408	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
RXFP1	59350	hgsc.bcm.edu	37	4	159526291	159526291	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:159526291T>C	ENST00000307765.5	+	5	715	c.464T>C	c.(463-465)cTg>cCg	p.L155P	RXFP1_ENST00000343542.5_Splice_Site_p.L155P|RXFP1_ENST00000423548.1_Splice_Site_p.L155P|RXFP1_ENST00000460056.2_Splice_Site_p.L74P|RXFP1_ENST00000448688.2_Splice_Site_p.L74P|RXFP1_ENST00000470033.1_Splice_Site_p.L122P	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	155					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CTTCAGAAGCTGTAAGAAAAT	0.338																																					p.L182P		Atlas-SNP	.											.	RXFP1	98	.	0			c.T545C						.						38.0	37.0	38.0					4																	159526291		1824	4065	5889	SO:0001630	splice_region_variant	59350	exon5			AGAAGCTGTAAGA	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.464+1T>C	chr4.hg19:g.159526291T>C		133.0	0.0		89.0	5.0	NM_001253727	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	hg19	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	T	17.15	3.314905	0.60524	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000423548;ENST00000448688;ENST00000343542;ENST00000470033	D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	5.75	5.75	0.90469	.	0.071887	0.56097	D	0.000022	D	0.93609	0.7959	H	0.99555	4.625	0.80722	D	1	P;P;P;P;P;P	0.46912	0.886;0.738;0.886;0.862;0.862;0.886	P;P;P;P;P;P	0.51806	0.68;0.464;0.68;0.551;0.551;0.68	D	0.95862	0.8884	10	0.87932	D	0	.	15.0485	0.71846	0.0:0.0:0.0:1.0	.	166;182;74;155;122;155	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;Q9HBX9	.;.;.;.;.;RXFP1_HUMAN	P	74;155;155;74;155;122	ENSP00000423306:L74P;ENSP00000303248:L155P;ENSP00000405841:L155P;ENSP00000414885:L74P;ENSP00000345889:L155P;ENSP00000420712:L122P	ENSP00000303248:L155P	L	+	2	0	RXFP1	159745741	1.000000	0.71417	0.990000	0.47175	0.433000	0.31745	5.735000	0.68587	2.196000	0.70406	0.455000	0.32223	CTG	.	.		0.338	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	Missense_Mutation
CPE	1363	hgsc.bcm.edu	37	4	166418679	166418679	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:166418679G>A	ENST00000402744.4	+	9	1628	c.1348G>A	c.(1348-1350)Gag>Aag	p.E450K		NM_001873.2	NP_001864.1	P16870	CBPE_HUMAN	carboxypeptidase E	450					cardiac left ventricle morphogenesis (GO:0003214)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|insulin processing (GO:0030070)|metabolic process (GO:0008152)|neuropeptide signaling pathway (GO:0007218)|protein localization to membrane (GO:0072657)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)	carboxypeptidase activity (GO:0004180)|cell adhesion molecule binding (GO:0050839)|metallocarboxypeptidase activity (GO:0004181)|neurexin family protein binding (GO:0042043)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	26	all_hematologic(180;0.221)	Prostate(90;0.0962)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.137)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTTTGAACTGGAGTCATTTTC	0.289																																					p.E450K		Atlas-SNP	.											CPE,NS,carcinoma,0,1	CPE	65	.	0			c.G1348A						.						86.0	91.0	89.0					4																	166418679		2202	4291	6493	SO:0001583	missense	1363	exon9			GAACTGGAGTCAT	X51405	CCDS3810.1	4q32.3	2012-02-10			ENSG00000109472	ENSG00000109472	3.4.17.10		2303	protein-coding gene	gene with protein product	"""carboxypeptidase H"", ""enkephalin convertase"", ""insulin granule-associated carboxypeptidase"", ""cobalt-stimulated chromaffin granule carboxypeptidase"""	114855				2334405	Standard	NM_001873		Approved		uc003irg.4	P16870	OTTHUMG00000150252	ENST00000402744.4:c.1348G>A	chr4.hg19:g.166418679G>A	ENSP00000386104:p.Glu450Lys	47.0	0.0		28.0	2.0	NM_001873	A8K4N1|B3KR42|B4DFN4|D3DP33|Q9UIU9	Missense_Mutation	SNP	ENST00000402744.4	hg19	CCDS3810.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.758016	0.49468	.	.	ENSG00000109472	ENST00000402744	T	0.44083	0.93	6.08	6.08	0.98989	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.120251	0.56097	D	0.000027	T	0.41789	0.1174	N	0.04148	-0.265	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.28808	-1.0032	10	0.07030	T	0.85	-12.1631	20.6647	0.99678	0.0:0.0:1.0:0.0	.	450	P16870	CBPE_HUMAN	K	450	ENSP00000386104:E450K	ENSP00000386104:E450K	E	+	1	0	CPE	166638129	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.698000	0.91311	2.890000	0.99128	0.655000	0.94253	GAG	.	.		0.289	CPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317094.2	NM_001873	
FAM105A	54491	hgsc.bcm.edu	37	5	14609107	14609107	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:14609107A>G	ENST00000274217.3	+	7	998	c.878A>G	c.(877-879)gAc>gGc	p.D293G		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	293	OTU.									large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					TCTGTAGGCGACACATGTGGA	0.453																																					p.D293G		Atlas-SNP	.											FAM105A,caecum,carcinoma,0,1	FAM105A	32	.	0			c.A878G						.						157.0	161.0	160.0					5																	14609107		2203	4300	6503	SO:0001583	missense	54491	exon7			TAGGCGACACATG		CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.878A>G	chr5.hg19:g.14609107A>G	ENSP00000274217:p.Asp293Gly	88.0	0.0		87.0	4.0	NM_019018	Q53H50|Q9H037	Missense_Mutation	SNP	ENST00000274217.3	hg19	CCDS3884.1	.	.	.	.	.	.	.	.	.	.	A	9.861	1.196316	0.22037	.	.	ENSG00000145569	ENST00000274217	T	0.16743	2.32	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000001	T	0.39462	0.1079	M	0.65975	2.015	0.39940	D	0.974401	D	0.89917	1.0	D	0.87578	0.998	T	0.21348	-1.0248	10	0.35671	T	0.21	-25.1344	14.7769	0.69736	1.0:0.0:0.0:0.0	.	293	Q9NUU6	F105A_HUMAN	G	293	ENSP00000274217:D293G	ENSP00000274217:D293G	D	+	2	0	FAM105A	14662107	1.000000	0.71417	0.958000	0.39756	0.026000	0.11368	5.410000	0.66381	1.885000	0.54596	0.528000	0.53228	GAC	.	.		0.453	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253710.1	NM_019018	
SPEF2	79925	hgsc.bcm.edu	37	5	35628606	35628606	+	Nonsense_Mutation	SNP	G	G	T	rs78964548		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:35628606G>T	ENST00000356031.3	+	2	257	c.103G>T	c.(103-105)Gga>Tga	p.G35*	SPEF2_ENST00000440995.2_Nonsense_Mutation_p.G35*|SPEF2_ENST00000509059.1_Nonsense_Mutation_p.G35*|SPEF2_ENST00000282469.6_Nonsense_Mutation_p.G35*	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	35	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTATCTACTTGGAGAAGTTCT	0.353																																					p.G35X		Atlas-SNP	.											.	SPEF2	324	.	0			c.G103T						.						138.0	137.0	137.0					5																	35628606		2203	4300	6503	SO:0001587	stop_gained	79925	exon2			CTACTTGGAGAAG	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.103G>T	chr5.hg19:g.35628606G>T	ENSP00000348314:p.Gly35*	94.0	0.0		92.0	4.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Nonsense_Mutation	SNP	ENST00000356031.3	hg19	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	34	5.325836	0.95708	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000510777;ENST00000440995	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.4177	0.83748	0.0:0.0:1.0:0.0	.	.	.	.	X	35	.	ENSP00000282469:G35X	G	+	1	0	SPEF2	35664363	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.625000	0.67770	2.658000	0.90341	0.655000	0.94253	GGA	.	.		0.353	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
SPEF2	79925	hgsc.bcm.edu	37	5	35792503	35792503	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:35792503C>T	ENST00000356031.3	+	31	4663	c.4509C>T	c.(4507-4509)ggC>ggT	p.G1503G	SPEF2_ENST00000440995.2_Silent_p.G1498G|SPEF2_ENST00000303129.4_Silent_p.G300G|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1503					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGAACCTTGGCACAAACAACT	0.343																																					p.G1503G		Atlas-SNP	.											.	SPEF2	324	.	0			c.C4509T						.						125.0	117.0	120.0					5																	35792503		1876	4113	5989	SO:0001819	synonymous_variant	79925	exon31			CCTTGGCACAAAC	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4509C>T	chr5.hg19:g.35792503C>T		70.0	0.0		89.0	4.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	ENST00000356031.3	hg19	CCDS43309.1																																																																																			.	.		0.343	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
NADK2	133686	hgsc.bcm.edu	37	5	36219720	36219720	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:36219720T>C	ENST00000381937.4	-	5	621	c.622A>G	c.(622-624)Aag>Gag	p.K208E	NADK2_ENST00000282512.3_Missense_Mutation_p.K45E|NADK2_ENST00000506945.1_Missense_Mutation_p.K45E|NADK2_ENST00000514504.1_Missense_Mutation_p.K208E|NADK2-AS1_ENST00000501794.2_RNA|NADK2_ENST00000397338.1_Missense_Mutation_p.K45E	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	208					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)	p.K45*(1)|p.K45delK(1)									CGATAGAACTTCTGTAAGGCT	0.353																																					p.K208E		Atlas-SNP	.											NADKD1,NS,carcinoma,0,1	NADKD1	47	.	2	Substitution - Nonsense(1)|Deletion - In frame(1)	ovary(2)	c.A622G						.						114.0	110.0	112.0					5																	36219720		2203	4300	6503	SO:0001583	missense	133686	exon5			AGAACTTCTGTAA	BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.622A>G	chr5.hg19:g.36219720T>C	ENSP00000371362:p.Lys208Glu	32.0	0.0		50.0	2.0	NM_001085411	B5MC93|Q6UTX5|Q96NM0	Missense_Mutation	SNP	ENST00000381937.4	hg19	CCDS47197.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.030185	0.93575	.	.	ENSG00000152620	ENST00000397338;ENST00000282512;ENST00000381937;ENST00000506945;ENST00000514504;ENST00000511088	T;T;T;T;T;T	0.42900	0.98;0.98;0.96;0.98;0.96;0.98	5.77	5.77	0.91146	ATP-NAD kinase, PpnK-type, alpha/beta (1);ATP-NAD kinase, PpnK-type (1);	0.133059	0.64402	D	0.000003	T	0.51193	0.1660	M	0.69358	2.11	0.58432	D	0.999996	P;P;P	0.45044	0.849;0.669;0.611	P;B;B	0.47251	0.542;0.304;0.324	T	0.55341	-0.8156	10	0.62326	D	0.03	-14.6788	15.0723	0.72046	0.0:0.0:0.0:1.0	.	45;208;208	B7Z8V7;Q4G0N4-2;Q4G0N4	.;.;NAKD1_HUMAN	E	45;45;208;45;208;45	ENSP00000380499:K45E;ENSP00000282512:K45E;ENSP00000371362:K208E;ENSP00000422250:K45E;ENSP00000421029:K208E;ENSP00000426084:K45E	ENSP00000282512:K45E	K	-	1	0	NADKD1	36255477	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.018000	0.64054	2.187000	0.69744	0.528000	0.53228	AAG	.	.		0.353	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367541.1	NM_153013	
NIPBL	25836	hgsc.bcm.edu	37	5	36984922	36984922	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:36984922A>G	ENST00000282516.8	+	10	2139	c.1640A>G	c.(1639-1641)cAg>cGg	p.Q547R	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.Q547R	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	547					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GATCTTCATCAGGCAGGAAGA	0.458																																					p.Q547R		Atlas-SNP	.											.	NIPBL	513	.	0			c.A1640G						.						167.0	174.0	171.0					5																	36984922		2203	4300	6503	SO:0001583	missense	25836	exon10			TTCATCAGGCAGG	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1640A>G	chr5.hg19:g.36984922A>G	ENSP00000282516:p.Gln547Arg	57.0	0.0		100.0	4.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	hg19	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614287	0.46631	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.95272	-3.64;-3.66	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.91331	0.7266	L	0.29908	0.895	0.46954	D	0.999266	P;P	0.42584	0.678;0.784	B;B	0.42555	0.219;0.391	D	0.90855	0.4734	10	0.34782	T	0.22	.	15.9259	0.79615	1.0:0.0:0.0:0.0	.	547;547	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	R	547	ENSP00000282516:Q547R;ENSP00000406266:Q547R	ENSP00000282516:Q547R	Q	+	2	0	NIPBL	37020679	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.593000	0.74100	2.164000	0.68074	0.528000	0.53228	CAG	.	.		0.458	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
HCN1	348980	hgsc.bcm.edu	37	5	45303811	45303811	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:45303811A>G	ENST00000303230.4	-	6	1565	c.1508T>C	c.(1507-1509)aTa>aCa	p.I503T		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	503					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TCCTTCTCGTATGATATAATC	0.408																																					p.I503T		Atlas-SNP	.											.	HCN1	298	.	0			c.T1508C						.						113.0	113.0	113.0					5																	45303811		2203	4300	6503	SO:0001583	missense	348980	exon6			TCTCGTATGATAT	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1508T>C	chr5.hg19:g.45303811A>G	ENSP00000307342:p.Ile503Thr	114.0	0.0		131.0	55.0	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	hg19	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.537042	0.85812	.	.	ENSG00000164588	ENST00000303230	D	0.94092	-3.35	5.62	5.62	0.85841	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000001	D	0.97636	0.9225	H	0.94698	3.57	0.80722	D	1	D	0.69078	0.997	D	0.77557	0.99	D	0.98779	1.0731	10	0.87932	D	0	.	16.1172	0.81314	1.0:0.0:0.0:0.0	.	503	O60741	HCN1_HUMAN	T	503	ENSP00000307342:I503T	ENSP00000307342:I503T	I	-	2	0	HCN1	45339568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.266000	0.75297	0.533000	0.62120	ATA	.	.		0.408	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
MAP3K1	4214	hgsc.bcm.edu	37	5	56178549	56178549	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:56178549T>C	ENST00000399503.3	+	14	3522	c.3522T>C	c.(3520-3522)aaT>aaC	p.N1174N		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1174					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGAATCATAATCAAAAGTGCA	0.418																																					p.N1174N		Atlas-SNP	.											.	MAP3K1	355	.	0			c.T3522C						.						77.0	76.0	76.0					5																	56178549		2037	4221	6258	SO:0001819	synonymous_variant	4214	exon14			TCATAATCAAAAG	U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3522T>C	chr5.hg19:g.56178549T>C		98.0	0.0		94.0	4.0	NM_005921		Silent	SNP	ENST00000399503.3	hg19	CCDS43318.1																																																																																			.	.		0.418	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000132309.2	XM_042066	
KIF2A	3796	hgsc.bcm.edu	37	5	61669513	61669513	+	Splice_Site	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:61669513G>A	ENST00000401507.3	+	17	1957		c.e17-1		KIF2A_ENST00000509663.2_Intron|KIF2A_ENST00000407818.3_Splice_Site|KIF2A_ENST00000506857.1_Splice_Site|KIF2A_ENST00000381103.2_Splice_Site	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		TGTATTTATAGGGTCAAAGAA	0.388																																					.		Atlas-SNP	.											.	KIF2A	69	.	0			c.1761-1G>A						.						94.0	87.0	89.0					5																	61669513		2203	4300	6503	SO:0001630	splice_region_variant	3796	exon18			TTTATAGGGTCAA	BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1647-1G>A	chr5.hg19:g.61669513G>A		63.0	0.0		85.0	40.0	NM_001098511	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Splice_Site	SNP	ENST00000401507.3	hg19	CCDS3980.2	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648587	0.29336	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000407818;ENST00000506857;ENST00000512006	.	.	.	6.17	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3488	0.60589	0.1269:0.0:0.8731:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIF2A	61705270	1.000000	0.71417	0.980000	0.43619	0.071000	0.16799	9.439000	0.97543	0.941000	0.37499	0.655000	0.94253	.	.	.		0.388	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520	Intron
AP3B1	8546	hgsc.bcm.edu	37	5	77471657	77471657	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:77471657A>G	ENST00000255194.6	-	10	1221	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	AP3B1_ENST00000519295.1_Missense_Mutation_p.V300A	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	349					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		AATATACTGCACCTCCCTAGA	0.308									Hermansky-Pudlak syndrome																												p.V349A		Atlas-SNP	.											.	AP3B1	94	.	0			c.T1046C						.						134.0	142.0	139.0					5																	77471657		2202	4296	6498	SO:0001583	missense	8546	exon10	Familial Cancer Database	HPS, HPS1-8	TACTGCACCTCCC	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1046T>C	chr5.hg19:g.77471657A>G	ENSP00000255194:p.Val349Ala	60.0	0.0		85.0	4.0	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	hg19	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.489424	0.64074	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.18810	2.19;2.19	4.82	4.82	0.62117	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.120339	0.56097	D	0.000034	T	0.24736	0.0600	L	0.58925	1.835	0.58432	D	0.999999	P	0.37370	0.592	B	0.37091	0.241	T	0.05115	-1.0905	10	0.62326	D	0.03	-13.7065	14.3773	0.66886	1.0:0.0:0.0:0.0	.	349	O00203	AP3B1_HUMAN	A	349;300;349;253	ENSP00000255194:V349A;ENSP00000430597:V300A	ENSP00000255194:V349A	V	-	2	0	AP3B1	77507413	1.000000	0.71417	0.986000	0.45419	0.988000	0.76386	8.962000	0.93254	1.797000	0.52628	0.383000	0.25322	GTG	.	.		0.308	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
RASA1	5921	hgsc.bcm.edu	37	5	86682657	86682657	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:86682657A>G	ENST00000274376.6	+	23	3426	c.2862A>G	c.(2860-2862)gaA>gaG	p.E954E	RASA1_ENST00000456692.2_Silent_p.E777E|RASA1_ENST00000512763.1_Silent_p.E787E|RASA1_ENST00000506290.1_Silent_p.E788E	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	954					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)	p.E777E(1)|p.E954E(1)		NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CCTACATGGAAGGTGTCAATC	0.333																																					p.E954E		Atlas-SNP	.											RASA1_ENST00000456692,NS,carcinoma,0,2	RASA1	213	.	2	Substitution - coding silent(2)	kidney(2)	c.A2862G						.						153.0	151.0	152.0					5																	86682657		2203	4300	6503	SO:0001819	synonymous_variant	5921	exon23			CATGGAAGGTGTC		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2862A>G	chr5.hg19:g.86682657A>G		66.0	0.0		62.0	4.0	NM_002890	B2R6W3|Q9UDI1	Silent	SNP	ENST00000274376.6	hg19	CCDS34200.1																																																																																			.	.		0.333	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
YTHDC2	64848	hgsc.bcm.edu	37	5	112874844	112874844	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:112874844A>G	ENST00000161863.4	+	8	1389	c.1176A>G	c.(1174-1176)aaA>aaG	p.K392K	YTHDC2_ENST00000515883.1_Silent_p.K392K	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	392					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		ATACAAACAAAGAAATGTTAA	0.229																																					p.K392K		Atlas-SNP	.											.	YTHDC2	118	.	0			c.A1176G						.						13.0	15.0	14.0					5																	112874844		2033	4170	6203	SO:0001819	synonymous_variant	64848	exon8			AAACAAAGAAATG	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.1176A>G	chr5.hg19:g.112874844A>G		55.0	0.0		63.0	4.0	NM_022828	B2RP66	Silent	SNP	ENST00000161863.4	hg19	CCDS4113.1																																																																																			.	.		0.229	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
PRRC1	133619	hgsc.bcm.edu	37	5	126859184	126859184	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:126859184A>G	ENST00000296666.8	+	2	201	c.13A>G	c.(13-15)Agt>Ggt	p.S5G	PRRC1_ENST00000442138.2_Missense_Mutation_p.S5G|PRRC1_ENST00000512635.2_Missense_Mutation_p.S5G	NM_130809.3	NP_570721.1	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	5						Golgi apparatus (GO:0005794)				endometrium(1)|large_intestine(1)|lung(4)	6		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		GATGGAAGAGAGTGGAATAGA	0.378																																					p.S5G		Atlas-SNP	.											.	PRRC1	22	.	0			c.A13G						.						114.0	98.0	103.0					5																	126859184		2203	4300	6503	SO:0001583	missense	133619	exon2			GAAGAGAGTGGAA	AJ515429	CCDS4143.1, CCDS68943.1	5q23.2	2008-02-05			ENSG00000164244	ENSG00000164244			28164	protein-coding gene	gene with protein product						15541471	Standard	NM_130809		Approved	FLJ32875	uc003kuk.3	Q96M27	OTTHUMG00000128982	ENST00000296666.8:c.13A>G	chr5.hg19:g.126859184A>G	ENSP00000296666:p.Ser5Gly	67.0	0.0		67.0	4.0	NM_130809	Q69YM8|Q7L2U7|Q86Y42|Q8IVJ4|Q8IVL4|Q8NEZ7|Q96AJ3	Missense_Mutation	SNP	ENST00000296666.8	hg19	CCDS4143.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.577166	0.86645	.	.	ENSG00000164244	ENST00000296666;ENST00000442138;ENST00000330542;ENST00000414018;ENST00000512635;ENST00000512535	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.65575	0.2704	L	0.34521	1.04	0.54753	D	0.999981	D;D	0.71674	0.997;0.998	D;D	0.80764	0.97;0.994	T	0.68953	-0.5273	9	0.87932	D	0	-21.3415	12.9591	0.58447	1.0:0.0:0.0:0.0	.	5;5	Q96M27;Q96M27-5	PRRC1_HUMAN;.	G	5	.	ENSP00000296666:S5G	S	+	1	0	PRRC1	126887083	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.511000	0.81718	2.180000	0.69256	0.528000	0.53228	AGT	.	.		0.378	PRRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250971.3	NM_130809	
FAM13B	51306	hgsc.bcm.edu	37	5	137354156	137354156	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:137354156T>C	ENST00000033079.3	-	4	656	c.205A>G	c.(205-207)Aca>Gca	p.T69A	FAM13B_ENST00000425075.2_5'UTR|FAM13B_ENST00000420893.2_Missense_Mutation_p.T69A	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	69	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						CACTCCACTGTCTCAGCATTT	0.448																																					p.T69A		Atlas-SNP	.											.	FAM13B	46	.	0			c.A205G						.						143.0	132.0	136.0					5																	137354156		2203	4300	6503	SO:0001583	missense	51306	exon4			CCACTGTCTCAGC	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.205A>G	chr5.hg19:g.137354156T>C	ENSP00000033079:p.Thr69Ala	95.0	0.0		97.0	4.0	NM_001101800	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	ENST00000033079.3	hg19	CCDS4195.1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.296644	0.60086	.	.	ENSG00000031003	ENST00000033079;ENST00000420893;ENST00000514310;ENST00000502471;ENST00000509596	T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22	5.91	4.74	0.60224	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.120607	0.64402	D	0.000020	T	0.22003	0.0530	N	0.16708	0.43	0.34644	D	0.720919	B;D	0.63046	0.264;0.992	B;D	0.67231	0.124;0.95	T	0.24190	-1.0167	10	0.18710	T	0.47	-10.5397	12.5456	0.56197	0.1248:0.0:0.0:0.8752	.	69;69	Q9NYF5-2;Q9NYF5	.;FA13B_HUMAN	A	69	ENSP00000033079:T69A;ENSP00000388521:T69A;ENSP00000425326:T69A;ENSP00000424785:T69A;ENSP00000422311:T69A	ENSP00000033079:T69A	T	-	1	0	FAM13B	137382055	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.238000	0.72350	1.045000	0.40225	0.533000	0.62120	ACA	.	.		0.448	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
CDC23	8697	hgsc.bcm.edu	37	5	137537070	137537070	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:137537070T>C	ENST00000394886.2	-	5	513	c.483A>G	c.(481-483)aaA>aaG	p.K161K		NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	161					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GAGCTTGGTGTTTTTTGCTGA	0.403																																					p.K161K		Atlas-SNP	.											.	CDC23	46	.	0			c.A483G						.						118.0	118.0	118.0					5																	137537070		2203	4300	6503	SO:0001819	synonymous_variant	8697	exon5			TTGGTGTTTTTTG	AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.483A>G	chr5.hg19:g.137537070T>C		75.0	0.0		72.0	4.0	NM_004661	A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Silent	SNP	ENST00000394886.2	hg19	CCDS4200.2																																																																																			.	.		0.403	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2		
PCDHGA3	56112	hgsc.bcm.edu	37	5	140724262	140724262	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:140724262T>C	ENST00000253812.6	+	1	662	c.662T>C	c.(661-663)gTc>gCc	p.V221A	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	221	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGACCCTGTCCACTCTGGC	0.537																																					p.V221A		Atlas-SNP	.											.	PCDHGA3	246	.	0			c.T662C						.						48.0	50.0	49.0					5																	140724262		2195	4296	6491	SO:0001583	missense	56112	exon1			ACCCTGTCCACTC	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.662T>C	chr5.hg19:g.140724262T>C	ENSP00000253812:p.Val221Ala	74.0	0.0		95.0	4.0	NM_032011	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	hg19	CCDS47290.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.697041	0.00725	.	.	ENSG00000254245	ENST00000253812	T	0.00958	5.5	5.65	3.2	0.36748	Cadherin (3);Cadherin-like (1);	0.663319	0.11337	N	0.574477	T	0.00724	0.0024	N	0.13198	0.31	0.09310	N	1	B;B	0.12013	0.005;0.001	B;B	0.15052	0.012;0.003	T	0.43845	-0.9366	10	0.06757	T	0.87	.	9.5601	0.39364	0.0:0.2082:0.0:0.7918	.	221;221	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	A	221	ENSP00000253812:V221A	ENSP00000253812:V221A	V	+	2	0	PCDHGA3	140704446	0.000000	0.05858	0.008000	0.14137	0.781000	0.44180	0.056000	0.14256	0.478000	0.27488	0.533000	0.62120	GTC	.	.		0.537	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
PCDHGA11	56105	hgsc.bcm.edu	37	5	140803211	140803211	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:140803211A>G	ENST00000398587.2	+	1	2450	c.2417A>G	c.(2416-2418)gAc>gGc	p.D806G	PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	806					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAAATGTGACCCGACAAGT	0.443																																					p.D806G		Atlas-SNP	.											.	PCDHGA11	128	.	0			c.A2417G						.						45.0	50.0	48.0					5																	140803211		2190	4299	6489	SO:0001583	missense	56105	exon1			AATGTGACCCGAC	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.2417A>G	chr5.hg19:g.140803211A>G	ENSP00000381589:p.Asp806Gly	98.0	0.0		84.0	5.0	NM_032091	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	hg19	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	a	16.92	3.254503	0.59212	.	.	ENSG00000253873	ENST00000398587	T	0.46451	0.87	5.42	4.26	0.50523	.	.	.	.	.	T	0.27489	0.0675	N	0.17800	0.525	0.80722	D	1	B;B	0.14012	0.001;0.009	B;B	0.17979	0.001;0.02	T	0.04509	-1.0946	9	0.29301	T	0.29	.	10.4744	0.44657	0.9218:0.0:0.0782:0.0	.	806;806	Q9Y5H2;Q9Y5H2-2	PCDGB_HUMAN;.	G	806	ENSP00000381589:D806G	ENSP00000381589:D806G	D	+	2	0	PCDHGA11	140783395	0.954000	0.32549	0.005000	0.12908	0.962000	0.63368	2.095000	0.41729	0.999000	0.39023	0.533000	0.62120	GAC	.	.		0.443	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
FCHSD1	89848	hgsc.bcm.edu	37	5	141024179	141024179	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:141024179T>C	ENST00000435817.2	-	16	1653	c.1603A>G	c.(1603-1605)Agc>Ggc	p.S535G	FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522783.1_Missense_Mutation_p.S461G|FCHSD1_ENST00000522126.1_3'UTR	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	535									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTCTTGGCTGCTCTCTGGG	0.552																																					p.S535G		Atlas-SNP	.											.	FCHSD1	51	.	0			c.A1603G						.						67.0	70.0	69.0					5																	141024179		1944	4147	6091	SO:0001583	missense	89848	exon16			CTTGGCTGCTCTC	AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.1603A>G	chr5.hg19:g.141024179T>C	ENSP00000399259:p.Ser535Gly	69.0	0.0		82.0	4.0	NM_033449	Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	ENST00000435817.2	hg19	CCDS47295.1	.	.	.	.	.	.	.	.	.	.	T	0.941	-0.709535	0.03230	.	.	ENSG00000197948	ENST00000435817;ENST00000522783	T;T	0.14391	2.51;2.51	5.57	-6.79	0.01715	.	0.582533	0.16375	N	0.217176	T	0.03305	0.0096	N	0.03608	-0.345	0.26524	N	0.974374	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.27673	-1.0067	10	0.21540	T	0.41	-5.7401	2.9155	0.05751	0.1955:0.2091:0.0961:0.4992	.	215;535	Q86WN1-2;Q86WN1	.;FCSD1_HUMAN	G	535;461	ENSP00000399259:S535G;ENSP00000428677:S461G	ENSP00000399259:S535G	S	-	1	0	FCHSD1	141004363	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.899000	0.01600	-1.504000	0.01810	-1.049000	0.02347	AGC	.	.		0.552	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2	NM_033449	
CYFIP2	26999	hgsc.bcm.edu	37	5	156721863	156721863	+	Silent	SNP	T	T	C	rs397712438|rs397781034|rs5872508|rs200051515		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:156721863T>C	ENST00000347377.6	+	4	710	c.279T>C	c.(277-279)atT>atC	p.I93I	CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000541131.1_Intron|CYFIP2_ENST00000318218.6_Silent_p.I93I|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000377576.3_Silent_p.I93I|CYFIP2_ENST00000521420.1_Intron	NM_001037332.2	NP_001032409.2			cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCCGGGCCATTCCCAGGTGAG	0.522																																					p.I93I		Atlas-SNP	.											.	CYFIP2	354	.	0			c.T279C						.						114.0	122.0	120.0					5																	156721863		2140	4280	6420	SO:0001819	synonymous_variant	26999	exon4			GGCCATTCCCAGG	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000347377.6:c.279T>C	chr5.hg19:g.156721863T>C		185.0	0.0		199.0	9.0	NM_001037332		Silent	SNP	ENST00000347377.6	hg19																																																																																				.	.		0.522	CYFIP2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037332	
WWC1	23286	hgsc.bcm.edu	37	5	167871522	167871522	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:167871522A>G	ENST00000265293.4	+	17	2959	c.2457A>G	c.(2455-2457)gaA>gaG	p.E819E	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Silent_p.E819E	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	819	Glu-rich.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ctctgttggaacagacagcag	0.577																																					p.E819E		Atlas-SNP	.											.	WWC1	98	.	0			c.A2457G						.						50.0	46.0	48.0					5																	167871522		2198	4298	6496	SO:0001819	synonymous_variant	23286	exon17			GTTGGAACAGACA	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2457A>G	chr5.hg19:g.167871522A>G		89.0	0.0		96.0	4.0	NM_015238	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Silent	SNP	ENST00000265293.4	hg19	CCDS4366.1	.	.	.	.	.	.	.	.	.	.	A	7.505	0.653486	0.14580	.	.	ENSG00000113645	ENST00000393895;ENST00000524228	.	.	.	4.44	3.28	0.37604	.	.	.	.	.	T	0.55273	0.1910	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49428	-0.8941	4	.	.	.	.	6.727	0.23363	0.8936:0.0:0.1064:0.0	.	.	.	.	A	781;596	.	.	T	+	1	0	WWC1	167804100	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	1.638000	0.37165	0.852000	0.35287	0.379000	0.24179	ACA	.	.		0.577	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	
RANBP17	64901	hgsc.bcm.edu	37	5	170610408	170610408	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:170610408T>C	ENST00000523189.1	+	18	2176	c.2012T>C	c.(2011-2013)cTc>cCc	p.L671P	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	671					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TACACAGCGCTCACTCGCCTT	0.408			T	TRD@	ALL																																p.L671P		Atlas-SNP	.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	108	.	0			c.T2012C						.						89.0	81.0	84.0					5																	170610408		2203	4300	6503	SO:0001583	missense	64901	exon18			CAGCGCTCACTCG	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2012T>C	chr5.hg19:g.170610408T>C	ENSP00000427975:p.Leu671Pro	88.0	0.0		98.0	4.0	NM_022897	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	hg19	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.958405	0.74016	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.76316	-1.01	5.35	5.35	0.76521	Armadillo-type fold (1);	0.000000	0.53938	D	0.000055	D	0.89273	0.6668	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.91226	0.5010	10	0.87932	D	0	-10.0203	13.8571	0.63534	0.0:0.0:0.0:1.0	.	671;671	Q546R4;Q9H2T7	.;RBP17_HUMAN	P	671;101	ENSP00000427975:L671P	ENSP00000427975:L671P	L	+	2	0	RANBP17	170543013	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.761000	0.74945	2.140000	0.66376	0.459000	0.35465	CTC	.	.		0.408	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
TXNDC5	81567	hgsc.bcm.edu	37	6	7884705	7884705	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:7884705T>C	ENST00000379757.4	-	9	1100	c.1063A>G	c.(1063-1065)Act>Gct	p.T355A	TXNDC5_ENST00000539054.1_Missense_Mutation_p.T283A|TXNDC5_ENST00000473453.1_Missense_Mutation_p.T247A|BLOC1S5-TXNDC5_ENST00000439343.2_3'UTR	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	355	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					GGAGCCAGAGTCTTACAATGA	0.493																																					p.T355A	Ovarian(119;1430 1625 3928 26125 34589)	Atlas-SNP	.											.	TXNDC5	33	.	0			c.A1063G						.						77.0	70.0	72.0					6																	7884705		2203	4300	6503	SO:0001583	missense	81567	exon9			CCAGAGTCTTACA	AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.1063A>G	chr6.hg19:g.7884705T>C	ENSP00000369081:p.Thr355Ala	49.0	0.0		82.0	4.0	NM_030810	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Missense_Mutation	SNP	ENST00000379757.4	hg19	CCDS4505.1	.	.	.	.	.	.	.	.	.	.	T	13.68	2.310369	0.40895	.	.	ENSG00000239264	ENST00000539054;ENST00000379757;ENST00000473453	T;T;T	0.19394	2.15;2.15;2.15	5.75	4.59	0.56863	Thioredoxin domain (1);Thioredoxin, conserved site (1);Thioredoxin-like fold (3);	0.123769	0.64402	D	0.000001	T	0.03220	0.0094	N	0.02708	-0.52	0.29571	N	0.849867	B;B	0.06786	0.0;0.001	B;B	0.16289	0.005;0.015	T	0.34477	-0.9827	10	0.40728	T	0.16	.	11.6927	0.51525	0.0:0.0688:0.0:0.9312	.	283;355	Q86UY0;Q8NBS9	.;TXND5_HUMAN	A	283;355;247	ENSP00000442453:T283A;ENSP00000369081:T355A;ENSP00000420784:T247A	ENSP00000442453:T283A	T	-	1	0	TXNDC5	7829704	1.000000	0.71417	0.997000	0.53966	0.912000	0.54170	6.098000	0.71458	1.007000	0.39238	0.528000	0.53228	ACT	.	.		0.493	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039792.1	NM_030810	
NFKBIL1	4795	hgsc.bcm.edu	37	6	31525591	31525591	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:31525591A>G	ENST00000376148.4	+	3	635	c.521A>G	c.(520-522)gAg>gGg	p.E174G	NFKBIL1_ENST00000376145.4_Intron	NM_005007.3	NP_004998.3	Q9UBC1	IKBL1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1	174					cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of transcription factor (GO:0042994)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)	cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7						GGTGAGCTGGAGGACGAGTGG	0.567																																					p.E174G		Atlas-SNP	.											.	NFKBIL1	17	.	0			c.A521G						.						94.0	72.0	80.0					6																	31525591		2203	4300	6503	SO:0001583	missense	4795	exon3			AGCTGGAGGACGA	X77909	CCDS4700.1, CCDS47399.1, CCDS47400.1	6p21.3	2010-02-17			ENSG00000204498	ENSG00000204498			7800	protein-coding gene	gene with protein product		601022		NFKBIL		8081366	Standard	NM_005007		Approved	IKBL	uc003nub.3	Q9UBC1	OTTHUMG00000031038	ENST00000376148.4:c.521A>G	chr6.hg19:g.31525591A>G	ENSP00000365318:p.Glu174Gly	60.0	0.0		94.0	4.0	NM_005007	A6NL91|B4DUW1|Q14625|Q5HYU4|Q5RJ72|Q5ST96|Q5STV4|Q5STV5|Q9UBX4	Missense_Mutation	SNP	ENST00000376148.4	hg19	CCDS4700.1	.	.	.	.	.	.	.	.	.	.	A	19.60	3.857136	0.71834	.	.	ENSG00000204498	ENST00000376146;ENST00000542852;ENST00000376148	T;T	0.35789	1.7;1.29	5.54	5.54	0.83059	.	0.187622	0.44688	D	0.000438	T	0.31009	0.0783	N	0.14661	0.345	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.75484	0.986;0.986	T	0.34477	-0.9827	10	0.62326	D	0.03	-16.2798	11.9958	0.53201	1.0:0.0:0.0:0.0	.	151;174	Q5STV6;Q9UBC1	.;IKBL1_HUMAN	G	151;151;174	ENSP00000365316:E151G;ENSP00000365318:E174G	ENSP00000365316:E151G	E	+	2	0	NFKBIL1	31633570	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.935000	0.63498	2.326000	0.78906	0.533000	0.62120	GAG	.	.		0.567	NFKBIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076036.3	NM_005007	
HSPA1L	3305	hgsc.bcm.edu	37	6	31778417	31778417	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:31778417A>G	ENST00000375654.4	-	2	1522	c.1333T>C	c.(1333-1335)Tat>Cat	p.Y445H	HSPA1L_ENST00000417199.3_Missense_Mutation_p.Y445H	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	445					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TCGCCCTCATACACCTGGATC	0.567																																					p.Y445H		Atlas-SNP	.											.	HSPA1L	185	.	0			c.T1333C						.						140.0	136.0	137.0					6																	31778417		2203	4300	6503	SO:0001583	missense	3305	exon2			CCTCATACACCTG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1333T>C	chr6.hg19:g.31778417A>G	ENSP00000364805:p.Tyr445His	239.0	0.0		365.0	118.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	hg19	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	A	11.72	1.724276	0.30593	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	T;T	0.07216	3.21;3.21	5.14	5.14	0.70334	.	0.000000	0.31734	N	0.007146	T	0.31451	0.0797	H	0.95645	3.7	0.45580	D	0.998523	D	0.65815	0.995	D	0.78314	0.991	T	0.46610	-0.9179	10	0.87932	D	0	-11.4216	12.941	0.58345	1.0:0.0:0.0:0.0	.	445	P34931	HS71L_HUMAN	H	445;445;390	ENSP00000364805:Y445H;ENSP00000387691:Y445H	ENSP00000364804:Y390H	Y	-	1	0	HSPA1L	31886396	1.000000	0.71417	0.114000	0.21550	0.001000	0.01503	9.139000	0.94554	2.156000	0.67533	0.477000	0.44152	TAT	.	.		0.567	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
SLC44A4	80736	hgsc.bcm.edu	37	6	31833556	31833556	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:31833556T>C	ENST00000229729.6	-	15	1513	c.1493A>G	c.(1492-1494)cAc>cGc	p.H498R	NEU1_ENST00000375631.4_5'Flank|SLC44A4_ENST00000544672.1_Missense_Mutation_p.H422R|SLC44A4_ENST00000375562.4_Missense_Mutation_p.H456R	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	498					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.H498R(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	TGACCCAGTGTGGTAACTGCA	0.577																																					p.H498R		Atlas-SNP	.											SLC44A4,NS,NS,0,1	SLC44A4	67	.	1	Substitution - Missense(1)	NS(1)	c.A1493G						.						107.0	119.0	115.0					6																	31833556		1511	2709	4220	SO:0001583	missense	80736	exon15			CCAGTGTGGTAAC	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1493A>G	chr6.hg19:g.31833556T>C	ENSP00000229729:p.His498Arg	26.0	0.0		41.0	2.0	NM_025257	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	hg19	CCDS4724.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.73|17.73	3.461402|3.461402	0.63513|0.63513	.|.	.|.	ENSG00000204385|ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672|ENST00000414427	T;T;T|.	0.26518|.	1.73;1.73;1.73|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84790|0.84790	0.5550|0.5550	H|H	0.95645|0.95645	3.7|3.7	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.87578|.	0.998|.	D|D	0.89303|0.89303	0.3627|0.3627	10|5	0.87932|.	D|.	0|.	-14.753|-14.753	14.5868|14.5868	0.68331|0.68331	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	498|.	Q53GD3|.	CTL4_HUMAN|.	R|A	498;456;422|382	ENSP00000229729:H498R;ENSP00000364712:H456R;ENSP00000444109:H422R|.	ENSP00000229729:H498R|.	H|T	-|-	2|1	0|0	SLC44A4|SLC44A4	31941535|31941535	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	7.701000|7.701000	0.84566|0.84566	2.279000|2.279000	0.76181|0.76181	0.533000|0.533000	0.62120|0.62120	CAC|ACA	.	.		0.577	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
BRD2	6046	hgsc.bcm.edu	37	6	32946061	32946061	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:32946061C>T	ENST00000374825.4	+	10	3438	c.1737C>T	c.(1735-1737)ccC>ccT	p.P579P	BRD2_ENST00000395289.2_Silent_p.P579P|BRD2_ENST00000443797.2_Silent_p.P459P|BRD2_ENST00000374831.4_Silent_p.P579P|BRD2_ENST00000395287.1_Silent_p.P579P|BRD2_ENST00000449085.2_Silent_p.P532P	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	579					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CTAGGGCACCCCGCCCACCTC	0.547																																					p.P579P		Atlas-SNP	.											.	BRD2	70	.	0			c.C1737T						.						124.0	129.0	127.0					6																	32946061		1511	2709	4220	SO:0001819	synonymous_variant	6046	exon10			GGCACCCCGCCCA	X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.1737C>T	chr6.hg19:g.32946061C>T		60.0	0.0		98.0	4.0	NM_005104	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Silent	SNP	ENST00000374825.4	hg19	CCDS4762.1	.	.	.	.	.	.	.	.	.	.	C	7.987	0.752349	0.15778	.	.	ENSG00000204256	ENST00000449025	T	0.24908	1.83	5.24	-4.01	0.04045	.	0.132292	0.35151	N	0.003403	T	0.11793	0.0287	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.10776	-1.0615	7	0.29301	T	0.29	-3.1127	8.1492	0.31130	0.0:0.3299:0.1137:0.5564	.	.	.	.	L	585	ENSP00000409613:P585L	ENSP00000409613:P585L	P	+	2	0	BRD2	33054039	0.000000	0.05858	0.555000	0.28281	0.666000	0.39218	-0.547000	0.06055	-0.713000	0.04981	-0.311000	0.09066	CCC	.	.		0.547	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076503.2		
TRERF1	55809	hgsc.bcm.edu	37	6	42227243	42227243	+	Silent	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:42227243G>T	ENST00000372922.4	-	9	2665	c.2103C>A	c.(2101-2103)ccC>ccA	p.P701P	TRERF1_ENST00000541110.1_Silent_p.P721P|TRERF1_ENST00000354325.2_Silent_p.P618P|TRERF1_ENST00000372917.4_Silent_p.P618P|TRERF1_ENST00000340840.2_Silent_p.P618P	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	701	Interacts with CREBBP.|Pro-rich.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCTCGTGGGTGGGGTCCAGGA	0.711																																					p.P701P		Atlas-SNP	.											.	TRERF1	124	.	0			c.C2103A						.						15.0	20.0	18.0					6																	42227243		2188	4282	6470	SO:0001819	synonymous_variant	55809	exon9			GTGGGTGGGGTCC	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2103C>A	chr6.hg19:g.42227243G>T		61.0	0.0		158.0	60.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	ENST00000372922.4	hg19	CCDS4867.1																																																																																			.	.		0.711	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
KLC4	89953	hgsc.bcm.edu	37	6	43039095	43039095	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:43039095A>G	ENST00000394056.2	+	10	1733	c.1238A>G	c.(1237-1239)gAg>gGg	p.E413G	KLC4_ENST00000479388.1_Missense_Mutation_p.E413G|KLC4_ENST00000347162.5_Missense_Mutation_p.E413G|KLC4_ENST00000259708.3_Missense_Mutation_p.E431G|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000394058.1_Missense_Mutation_p.E413G|KLC4_ENST00000453940.2_Missense_Mutation_p.E336G			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	413						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			CATGTACAGGAGTTTGGGTCT	0.542																																					p.E431G		Atlas-SNP	.											.	KLC4	89	.	0			c.A1292G						.						80.0	81.0	81.0					6																	43039095		2203	4300	6503	SO:0001583	missense	89953	exon9			TACAGGAGTTTGG	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1238A>G	chr6.hg19:g.43039095A>G	ENSP00000377620:p.Glu413Gly	79.0	0.0		106.0	5.0	NM_201523	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	hg19	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.397173	0.62177	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T	0.80653	-1.38;1.19;-1.4;-1.38;-1.38;-1.38	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000020	D	0.85898	0.5804	M	0.65975	2.015	0.80722	D	1	B;D;D	0.89917	0.116;1.0;1.0	B;D;D	0.79108	0.021;0.992;0.982	D	0.87094	0.2174	10	0.56958	D	0.05	-23.791	15.1124	0.72368	1.0:0.0:0.0:0.0	.	336;431;413	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	G	413;336;431;413;413;413	ENSP00000340221:E413G;ENSP00000395806:E336G;ENSP00000259708:E431G;ENSP00000418031:E413G;ENSP00000377620:E413G;ENSP00000377622:E413G	ENSP00000259708:E431G	E	+	2	0	KLC4	43147073	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.035000	0.64158	2.221000	0.72209	0.528000	0.53228	GAG	.	.		0.542	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
BACH2	60468	hgsc.bcm.edu	37	6	90661469	90661469	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:90661469T>C	ENST00000257749.4	-	7	1063	c.356A>G	c.(355-357)cAc>cGc	p.H119R	RP3-512E2.2_ENST00000445838.1_RNA|RP3-512E2.2_ENST00000413986.1_RNA|BACH2_ENST00000537989.1_Missense_Mutation_p.H119R|BACH2_ENST00000343122.3_Missense_Mutation_p.H119R	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	119						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CTCCAGGTTGTGCATGCGCAG	0.582																																					p.H119R		Atlas-SNP	.											.	BACH2	224	.	0			c.A356G						.						55.0	48.0	50.0					6																	90661469		2203	4300	6503	SO:0001583	missense	60468	exon5			AGGTTGTGCATGC	AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.356A>G	chr6.hg19:g.90661469T>C	ENSP00000257749:p.His119Arg	105.0	0.0		95.0	4.0	NM_001170794	E1P518|Q59H70|Q5T793|Q9NTS5	Missense_Mutation	SNP	ENST00000257749.4	hg19	CCDS5026.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372886	0.61624	.	.	ENSG00000112182	ENST00000257749;ENST00000537989;ENST00000343122	T;T;T	0.66280	-0.2;-0.2;-0.2	5.79	5.79	0.91817	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.60534	0.2276	L	0.28344	0.845	0.58432	D	0.999995	D	0.71674	0.998	D	0.80764	0.994	T	0.62709	-0.6797	10	0.36615	T	0.2	-23.3607	16.1293	0.81414	0.0:0.0:0.0:1.0	.	119	Q9BYV9	BACH2_HUMAN	R	119	ENSP00000257749:H119R;ENSP00000437473:H119R;ENSP00000345642:H119R	ENSP00000257749:H119R	H	-	2	0	BACH2	90718190	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.212000	0.71576	0.460000	0.39030	CAC	.	.		0.582	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041522.2	NM_021813	
FAM184A	79632	hgsc.bcm.edu	37	6	119324140	119324140	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:119324140A>G	ENST00000338891.7	-	9	2455	c.2012T>C	c.(2011-2013)cTt>cCt	p.L671P	FAM184A_ENST00000352896.5_Missense_Mutation_p.L551P|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000368475.4_Missense_Mutation_p.L551P|FAM184A_ENST00000521531.1_Missense_Mutation_p.L671P	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	671						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						CAACTGCAAAAGTTGAGACAT	0.348																																					p.L671P		Atlas-SNP	.											FAM184A,NS,carcinoma,0,1	FAM184A	109	.	0			c.T2012C						.						144.0	139.0	140.0					6																	119324140		1859	4104	5963	SO:0001583	missense	79632	exon9			TGCAAAAGTTGAG	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2012T>C	chr6.hg19:g.119324140A>G	ENSP00000342604:p.Leu671Pro	54.0	0.0		40.0	2.0	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	hg19	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.452951	0.84209	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.55721	0.1938	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.999	T	0.59611	-0.7422	10	0.66056	D	0.02	-8.6211	16.4461	0.83932	1.0:0.0:0.0:0.0	.	671;551;671	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	P	671;551;551;671	ENSP00000342604:L671P;ENSP00000326608:L551P;ENSP00000357460:L551P;ENSP00000430442:L671P	ENSP00000342604:L671P	L	-	2	0	FAM184A	119365839	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.721000	0.84768	2.285000	0.76669	0.528000	0.53228	CTT	.	.		0.348	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
TBPL1	9519	hgsc.bcm.edu	37	6	134305776	134305776	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:134305776C>T	ENST00000237264.4	+	6	723	c.448C>T	c.(448-450)Cag>Tag	p.Q150*	TBPL1_ENST00000367871.1_Nonsense_Mutation_p.Q150*|TBPL1_ENST00000477527.1_Intron	NM_001253676.1|NM_004865.3	NP_001240605.1|NP_004856.1	P62380	TBPL1_HUMAN	TBP-like 1	150					acrosome assembly (GO:0001675)|DNA-templated transcription, initiation (GO:0006352)|dTTP biosynthetic process (GO:0006235)|regulation of transcription, DNA-templated (GO:0006355)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	6	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00591)|OV - Ovarian serous cystadenocarcinoma(155;0.00848)		AGCTACATTACAGATTTTTTC	0.323																																					p.Q150X		Atlas-SNP	.											.	TBPL1	20	.	0			c.C448T						.						47.0	47.0	47.0					6																	134305776		2203	4298	6501	SO:0001587	stop_gained	9519	exon6			ACATTACAGATTT	AB020881	CCDS5168.1	6q22.1-q22.3	2008-05-23			ENSG00000028839	ENSG00000028839			11589	protein-coding gene	gene with protein product		605521				10082669, 10220372, 15767669	Standard	NM_001253676		Approved	TLP, STUD, TRF2, TLF	uc010kgg.3	P62380	OTTHUMG00000015609	ENST00000237264.4:c.448C>T	chr6.hg19:g.134305776C>T	ENSP00000237264:p.Gln150*	159.0	0.0		84.0	4.0	NM_004865	A8K8F5|O95753|Q9BWD5|Q9Z2Z0	Nonsense_Mutation	SNP	ENST00000237264.4	hg19	CCDS5168.1	.	.	.	.	.	.	.	.	.	.	C	37	6.448344	0.97577	.	.	ENSG00000028839	ENST00000367871;ENST00000237264	.	.	.	5.83	5.83	0.93111	.	0.049220	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-7.5705	19.1704	0.93575	0.0:1.0:0.0:0.0	.	.	.	.	X	150	.	ENSP00000237264:Q150X	Q	+	1	0	TBPL1	134347469	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.712000	0.68407	2.771000	0.95319	0.650000	0.86243	CAG	.	.		0.323	TBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042294.2		
IFNGR1	3459	hgsc.bcm.edu	37	6	137540422	137540422	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:137540422T>C	ENST00000367739.4	-	1	164	c.43A>G	c.(43-45)Agc>Ggc	p.S15G	IFNGR1_ENST00000478333.1_5'UTR|IFNGR1_ENST00000543628.1_5'Flank|IFNGR1_ENST00000367735.2_5'UTR	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	15					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TCAGCCCTGCTCACACCCTGC	0.687																																					p.S15G		Atlas-SNP	.											.	IFNGR1	46	.	0			c.A43G						.						42.0	42.0	42.0					6																	137540422		2201	4300	6501	SO:0001583	missense	3459	exon1			CCCTGCTCACACC		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.43A>G	chr6.hg19:g.137540422T>C	ENSP00000356713:p.Ser15Gly	104.0	0.0		98.0	5.0	NM_000416	B4DFT7|E1P587|Q53Y96	Missense_Mutation	SNP	ENST00000367739.4	hg19	CCDS5185.1	.	.	.	.	.	.	.	.	.	.	T	16.92	3.254332	0.59212	.	.	ENSG00000027697	ENST00000367739;ENST00000418947;ENST00000458076	T;D	0.82344	-0.74;-1.6	4.13	2.95	0.34219	.	1.324970	0.04835	N	0.439442	T	0.81128	0.4758	L	0.57536	1.79	0.25550	N	0.987097	D	0.55605	0.972	P	0.59825	0.864	T	0.64398	-0.6417	10	0.41790	T	0.15	-1.7691	7.8264	0.29318	0.0:0.0:0.2113:0.7887	.	15	P15260	INGR1_HUMAN	G	15	ENSP00000356713:S15G;ENSP00000389249:S15G	ENSP00000356713:S15G	S	-	1	0	IFNGR1	137582115	0.010000	0.17322	0.029000	0.17559	0.184000	0.23303	1.603000	0.36794	0.901000	0.36495	0.533000	0.62120	AGC	.	.		0.687	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1		
ARID1B	57492	hgsc.bcm.edu	37	6	157256613	157256613	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:157256613A>G	ENST00000350026.5	+	4	1902	c.1901A>G	c.(1900-1902)gAa>gGa	p.E634G	ARID1B_ENST00000346085.5_Missense_Mutation_p.E647G|ARID1B_ENST00000275248.4_Missense_Mutation_p.E576G|ARID1B_ENST00000367148.1_Missense_Mutation_p.E634G	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	634					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ATGTCTCAGGAAGGCTATGGA	0.368																																					p.E647G		Atlas-SNP	.											.	ARID1B	320	.	0			c.A1940G						.						174.0	163.0	167.0					6																	157256613		2203	4300	6503	SO:0001583	missense	57492	exon5			CTCAGGAAGGCTA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.1901A>G	chr6.hg19:g.157256613A>G	ENSP00000055163:p.Glu634Gly	99.0	0.0		73.0	4.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	hg19	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284890	0.80803	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000535255;ENST00000414678;ENST00000319584	T;T;T;T;T;T	0.22945	4.62;4.64;4.67;4.67;4.33;1.93	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000004	T	0.32645	0.0836	L	0.38175	1.15	0.41782	D	0.989823	D;D;D;D	0.89917	0.99;0.999;1.0;1.0	D;D;D;D	0.80764	0.972;0.986;0.994;0.994	T	0.14420	-1.0473	10	0.72032	D	0.01	.	15.9855	0.80147	1.0:0.0:0.0:0.0	.	4;634;647;576	F5H333;Q8NFD5;Q8NFD5-2;G3XAA0	.;ARI1B_HUMAN;.;.	G	647;634;634;576;55;4;133;56	ENSP00000344546:E647G;ENSP00000055163:E634G;ENSP00000356116:E634G;ENSP00000275248:E576G;ENSP00000412835:E133G;ENSP00000313006:E56G	ENSP00000275248:E576G	E	+	2	0	ARID1B	157298305	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.141000	0.77330	2.179000	0.69175	0.528000	0.53228	GAA	.	.		0.368	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
FOXK1	221937	hgsc.bcm.edu	37	7	4794874	4794874	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:4794874T>C	ENST00000328914.4	+	4	910	c.910T>C	c.(910-912)Tca>Cca	p.S304P	FOXK1_ENST00000446823.1_Missense_Mutation_p.S141P	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GCAGGATGAGTCAAAGCCGCC	0.632																																					p.S304P		Atlas-SNP	.											.	FOXK1	64	.	0			c.T910C						.						58.0	49.0	52.0					7																	4794874		2203	4300	6503	SO:0001583	missense	221937	exon4			GATGAGTCAAAGC	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.910T>C	chr7.hg19:g.4794874T>C	ENSP00000328720:p.Ser304Pro	42.0	0.0		59.0	4.0	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	hg19	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.343591	0.61073	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.95447	-3.71;-3.71	5.35	5.35	0.76521	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (1);	0.000000	0.85682	D	0.000000	D	0.96855	0.8973	M	0.62723	1.935	0.52501	D	0.999952	D;D	0.71674	0.998;0.997	D;D	0.81914	0.995;0.972	D	0.96357	0.9263	10	0.37606	T	0.19	.	14.5447	0.68020	0.0:0.0:0.0:1.0	.	304;141	P85037;P85037-2	FOXK1_HUMAN;.	P	141;68;304;187	ENSP00000394442:S141P;ENSP00000328720:S304P	ENSP00000328720:S304P	S	+	1	0	FOXK1	4761400	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	4.991000	0.63883	2.026000	0.59711	0.533000	0.62120	TCA	.	.		0.632	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
PAPOLB	56903	hgsc.bcm.edu	37	7	4899811	4899811	+	Missense_Mutation	SNP	T	T	C	rs557252177		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:4899811T>C	ENST00000404991.1	-	1	1814	c.1628A>G	c.(1627-1629)aAg>aGg	p.K543R	RADIL_ENST00000536091.1_Intron|RADIL_ENST00000399583.3_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	543					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		TGGGCCTGTCTTCATAGTGCT	0.453																																					p.K544R		Atlas-SNP	.											.	PAPOLB	93	.	0			c.A1631G						.						113.0	105.0	107.0					7																	4899811		1980	4186	6166	SO:0001583	missense	56903	exon1			CCTGTCTTCATAG	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.1628A>G	chr7.hg19:g.4899811T>C	ENSP00000384700:p.Lys543Arg	69.0	0.0		77.0	4.0	NM_020144	Q75LH1|Q8NE14	Missense_Mutation	SNP	ENST00000404991.1	hg19		.	.	.	.	.	.	.	.	.	.	T	9.985	1.229099	0.22542	.	.	ENSG00000218823	ENST00000404991	.	.	.	3.84	3.84	0.44239	.	.	.	.	.	T	0.26159	0.0638	N	0.12746	0.255	0.31992	N	0.604462	B	0.11235	0.004	B	0.10450	0.005	T	0.19679	-1.0298	8	0.26408	T	0.33	.	5.9879	0.19444	0.0:0.1136:0.0:0.8864	.	544	A4D1Z6	.	R	543	.	ENSP00000384700:K543R	K	-	2	0	PAPOLB	4866337	1.000000	0.71417	0.765000	0.31456	0.985000	0.73830	1.287000	0.33284	1.982000	0.57802	0.482000	0.46254	AAG	.	.		0.453	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1	NM_020144	
TNRC18	84629	hgsc.bcm.edu	37	7	5355649	5355649	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:5355649C>G	ENST00000430969.1	-	25	7148	c.6800G>C	c.(6799-6801)gGa>gCa	p.G2267A	TNRC18_ENST00000399537.4_Missense_Mutation_p.G2267A	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2267							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCCGTGTCTCCGTCGTCAAA	0.602																																					p.G2267A		Atlas-SNP	.											.	TNRC18	311	.	0			c.G6800C						.						56.0	51.0	52.0					7																	5355649		1568	3582	5150	SO:0001583	missense	84629	exon25			GTGTCTCCGTCGT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.6800G>C	chr7.hg19:g.5355649C>G	ENSP00000395538:p.Gly2267Ala	65.0	0.0		66.0	27.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	c	17.92	3.506922	0.64410	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.58652	0.32;0.32	4.46	4.46	0.54185	.	.	.	.	.	T	0.74665	0.3746	M	0.72353	2.195	0.47341	D	0.999393	D	0.89917	1.0	D	0.87578	0.998	T	0.76460	-0.2951	9	0.45353	T	0.12	.	16.6933	0.85327	0.0:1.0:0.0:0.0	.	2267	O15417	TNC18_HUMAN	A	2267	ENSP00000382452:G2267A;ENSP00000395538:G2267A	ENSP00000382452:G2267A	G	-	2	0	TNRC18	5322175	1.000000	0.71417	0.838000	0.33150	0.286000	0.27126	7.420000	0.80191	2.010000	0.58986	0.511000	0.50034	GGA	.	.		0.602	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
SP8	221833	hgsc.bcm.edu	37	7	20824956	20824956	+	Silent	SNP	C	C	G	rs201180283		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:20824956C>G	ENST00000361443.4	-	3	663	c.426G>C	c.(424-426)ggG>ggC	p.G142G	SP8_ENST00000418710.2_Silent_p.G160G	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	142					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						cgccgccgcccccgccgccgc	0.741																																					p.G160G		Atlas-SNP	.											.	SP8	43	.	0			c.G480C						.						2.0	2.0	2.0					7																	20824956		542	1367	1909	SO:0001819	synonymous_variant	221833	exon2			GCCGCCCCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.426G>C	chr7.hg19:g.20824956C>G		2.0	0.0		10.0	6.0	NM_182700	Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	hg19	CCDS5372.1																																																																																			.	.		0.741	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
KLHL7	55975	hgsc.bcm.edu	37	7	23145743	23145743	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:23145743T>C	ENST00000339077.5	+	1	341	c.98T>C	c.(97-99)gTc>gCc	p.V33A	KLHL7_ENST00000539124.1_5'UTR|KLHL7_ENST00000479288.1_3'UTR|KLHL7_ENST00000409689.1_5'Flank|KLHL7-AS1_ENST00000419813.1_lincRNA|KLHL7_ENST00000410047.1_5'Flank|KLHL7_ENST00000322275.5_Missense_Mutation_p.V33A|KLHL7_ENST00000542558.1_5'UTR|KLHL7_ENST00000322231.7_5'UTR|KLHL7_ENST00000545771.1_5'Flank	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	33					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TTCATGGGCGTCATGAATAAC	0.597																																					p.V33A		Atlas-SNP	.											.	KLHL7	102	.	0			c.T98C						.						59.0	49.0	52.0					7																	23145743		2202	4300	6502	SO:0001583	missense	55975	exon1			TGGGCGTCATGAA		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.98T>C	chr7.hg19:g.23145743T>C	ENSP00000343273:p.Val33Ala	59.0	0.0		52.0	4.0	NM_001172428	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	ENST00000339077.5	hg19	CCDS34609.1	.	.	.	.	.	.	.	.	.	.	T	19.57	3.852242	0.71719	.	.	ENSG00000122550	ENST00000538858;ENST00000536369;ENST00000339077;ENST00000322275	T;T	0.70631	-0.5;-0.5	4.87	4.87	0.63330	BTB/POZ fold (2);	0.139712	0.47455	D	0.000232	T	0.49490	0.1560	N	0.08118	0	0.80722	D	1	B;P	0.39847	0.001;0.691	B;B	0.40199	0.002;0.322	T	0.52961	-0.8505	10	0.07030	T	0.85	.	14.916	0.70798	0.0:0.0:0.0:1.0	.	33;33	Q8IXQ5;Q8IXQ5-3	KLHL7_HUMAN;.	A	33	ENSP00000343273:V33A;ENSP00000323270:V33A	ENSP00000323270:V33A	V	+	2	0	KLHL7	23112268	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	5.567000	0.67378	2.163000	0.67991	0.482000	0.46254	GTC	.	.		0.597	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
FAM188B	84182	hgsc.bcm.edu	37	7	30821784	30821784	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:30821784A>G	ENST00000265299.6	+	3	452	c.375A>G	c.(373-375)gaA>gaG	p.E125E	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	125										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTTCAGATGAAGATGCAGGAT	0.373																																					p.E125E		Atlas-SNP	.											.	FAM188B	62	.	0			c.A375G						.						76.0	66.0	69.0					7																	30821784		1883	4119	6002	SO:0001819	synonymous_variant	84182	exon3			AGATGAAGATGCA	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.375A>G	chr7.hg19:g.30821784A>G		49.0	0.0		77.0	4.0	NM_032222	Q71AZ7|Q9H6D2	Silent	SNP	ENST00000265299.6	hg19	CCDS43565.1																																																																																			.	.		0.373	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1	NM_032222	
AVL9	23080	hgsc.bcm.edu	37	7	32609744	32609744	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:32609744A>G	ENST00000318709.4	+	11	1549	c.1328A>G	c.(1327-1329)cAc>cGc	p.H443R	AVL9_ENST00000404479.1_Intron|AVL9_ENST00000409301.1_Missense_Mutation_p.H443R	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	443					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CAACAGAAACACCTCAGTGAT	0.438																																					p.H443R		Atlas-SNP	.											.	AVL9	66	.	0			c.A1328G						.						266.0	256.0	259.0					7																	32609744		2203	4300	6503	SO:0001583	missense	23080	exon11			AGAAACACCTCAG	D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.1328A>G	chr7.hg19:g.32609744A>G	ENSP00000315568:p.His443Arg	91.0	0.0		123.0	5.0	NM_015060	Q92573	Missense_Mutation	SNP	ENST00000318709.4	hg19	CCDS34613.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.869688	0.91587	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000446718	T;T;T	0.41400	1.0;1.0;1.0	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.48857	0.1523	N	0.17838	0.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.983;0.998	T	0.41610	-0.9499	10	0.21014	T	0.42	-12.9117	16.1708	0.81812	1.0:0.0:0.0:0.0	.	443;443	Q8NBF6-2;Q8NBF6	.;AVL9_HUMAN	R	443;443;443;374	ENSP00000315568:H443R;ENSP00000387011:H443R;ENSP00000395134:H374R	ENSP00000315568:H443R	H	+	2	0	AVL9	32576269	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.284000	0.95882	2.225000	0.72522	0.533000	0.62120	CAC	.	.		0.438	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328643.1	NM_015060	
PKD1L1	168507	hgsc.bcm.edu	37	7	47873952	47873952	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:47873952T>C	ENST00000289672.2	-	40	6209	c.6159A>G	c.(6157-6159)gcA>gcG	p.A2053A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2053					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GTGGCTCCTGTGCGTCTGGTA	0.408																																					p.A2053A		Atlas-SNP	.											.	PKD1L1	328	.	0			c.A6159G						.						132.0	118.0	123.0					7																	47873952		2203	4300	6503	SO:0001819	synonymous_variant	168507	exon40			CTCCTGTGCGTCT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6159A>G	chr7.hg19:g.47873952T>C		77.0	0.0		73.0	4.0	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	hg19	CCDS34633.1																																																																																			.	.		0.408	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
LANCL2	55915	hgsc.bcm.edu	37	7	55466298	55466298	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:55466298T>C	ENST00000254770.2	+	3	1083	c.505T>C	c.(505-507)Tgt>Cgt	p.C169R	LANCL2_ENST00000486376.1_3'UTR	NM_018697.3	NP_061167.1	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2 (bacterial)	169					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of abscisic acid-activated signaling pathway (GO:0009789)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|GTP binding (GO:0005525)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	25	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			CAGAAGTGACTGTGAGTCCCA	0.478																																					p.C169R		Atlas-SNP	.											.	LANCL2	54	.	0			c.T505C						.						57.0	52.0	54.0					7																	55466298		2203	4300	6503	SO:0001583	missense	55915	exon3			AGTGACTGTGAGT	AJ278245	CCDS5517.1	7q31.1-q31.33	2008-07-18	2001-12-04		ENSG00000132434	ENSG00000132434			6509	protein-coding gene	gene with protein product	"""testis-specific adriamycin sensitivity protein"", ""G protein-coupled receptor 69B"""	612919	"""LanC (bacterial lantibiotic synthetase component C)-like 2"""	GPR69B		11762191	Standard	NM_018697		Approved	TASP	uc003tqp.3	Q9NS86	OTTHUMG00000023779	ENST00000254770.2:c.505T>C	chr7.hg19:g.55466298T>C	ENSP00000254770:p.Cys169Arg	88.0	0.0		82.0	4.0	NM_018697	B2R8D4|Q6NSL4|Q8TCQ3|Q9BSR1	Missense_Mutation	SNP	ENST00000254770.2	hg19	CCDS5517.1	.	.	.	.	.	.	.	.	.	.	T	3.861	-0.029863	0.07543	.	.	ENSG00000132434	ENST00000254770	T	0.39229	1.09	5.54	-1.04	0.10068	Six-hairpin glycosidase-like (1);	0.534882	0.21667	N	0.070928	T	0.10465	0.0256	N	0.00729	-1.24	0.09310	N	0.999996	B	0.14012	0.009	B	0.15052	0.012	T	0.33777	-0.9855	10	0.19147	T	0.46	.	5.7589	0.18188	0.4958:0.0:0.2349:0.2693	.	169	Q9NS86	LANC2_HUMAN	R	169	ENSP00000254770:C169R	ENSP00000254770:C169R	C	+	1	0	LANCL2	55433792	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	0.483000	0.22292	0.068000	0.16574	0.459000	0.35465	TGT	.	.		0.478	LANCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251459.1	NM_018697	
ZNF117	51351	hgsc.bcm.edu	37	7	64439846	64439846	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:64439846T>C	ENST00000282869.6	-	4	1387	c.103A>G	c.(103-105)Acc>Gcc	p.T35A		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	35					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CTTCTTAGGGTCACTTTCTGG	0.343																																					p.T35A		Atlas-SNP	.											.	ZNF117	56	.	0			c.A103G						.						47.0	48.0	48.0					7																	64439846		2086	4242	6328	SO:0001583	missense	51351	exon4			TTAGGGTCACTTT	M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.103A>G	chr7.hg19:g.64439846T>C	ENSP00000282869:p.Thr35Ala	68.0	0.0		60.0	4.0	NM_015852	Q02313|Q7Z7Q7	Missense_Mutation	SNP	ENST00000282869.6	hg19	CCDS43593.1	.	.	.	.	.	.	.	.	.	.	.	7.157	0.584955	0.13749	.	.	ENSG00000152926	ENST00000398695;ENST00000282869	T	0.08193	3.12	1.59	0.306	0.15806	.	.	.	.	.	T	0.06781	0.0173	L	0.37507	1.11	0.09310	N	1	B	0.16802	0.019	B	0.19391	0.025	T	0.37361	-0.9709	9	0.66056	D	0.02	.	4.1993	0.10458	0.0:0.445:0.0:0.555	.	35	Q03924	ZN117_HUMAN	A	35	ENSP00000282869:T35A	ENSP00000282869:T35A	T	-	1	0	ZNF117	64077281	0.008000	0.16893	0.000000	0.03702	0.010000	0.07245	0.543000	0.23237	-0.263000	0.09378	0.254000	0.18369	ACC	.	.		0.343	ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344863.3	NM_024498	
FKBP6	8468	hgsc.bcm.edu	37	7	72744311	72744311	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:72744311T>C	ENST00000252037.4	+	4	493	c.424T>C	c.(424-426)Ttc>Ctc	p.F142L	TRIM50_ENST00000333149.2_5'Flank|FKBP6_ENST00000431982.2_Missense_Mutation_p.F137L|FKBP6_ENST00000413573.2_Missense_Mutation_p.F112L|TRIM50_ENST00000493498.1_5'Flank	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	142	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				GCTGCTTGACTTCCTGGACTG	0.502																																					p.F142L		Atlas-SNP	.											.	FKBP6	35	.	0			c.T424C						.						112.0	101.0	105.0					7																	72744311		2203	4300	6503	SO:0001583	missense	8468	exon4			CTTGACTTCCTGG	AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.424T>C	chr7.hg19:g.72744311T>C	ENSP00000252037:p.Phe142Leu	69.0	0.0		117.0	6.0	NM_003602	B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Missense_Mutation	SNP	ENST00000252037.4	hg19	CCDS43595.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.713311	0.89112	.	.	ENSG00000077800	ENST00000431982;ENST00000442793;ENST00000413573;ENST00000252037	T;T;T;T	0.54071	1.0;1.0;0.59;1.0	4.93	4.93	0.64822	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (1);	0.049620	0.85682	D	0.000000	T	0.64068	0.2565	L	0.46885	1.475	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.66979	0.948;0.938	T	0.66400	-0.5933	10	0.59425	D	0.04	-18.0584	13.4692	0.61273	0.0:0.0:0.0:1.0	.	137;142	O75344-2;O75344	.;FKBP6_HUMAN	L	137;137;112;142	ENSP00000416277:F137L;ENSP00000402360:F137L;ENSP00000394952:F112L;ENSP00000252037:F142L	ENSP00000252037:F142L	F	+	1	0	FKBP6	72382247	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.598000	0.82745	1.877000	0.54381	0.477000	0.44152	TTC	.	.		0.502	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318723.1	NM_003602	
HGF	3082	hgsc.bcm.edu	37	7	81358964	81358964	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:81358964A>G	ENST00000222390.5	-	8	1223	c.997T>C	c.(997-999)Tat>Cat	p.Y333H	HGF_ENST00000457544.2_Missense_Mutation_p.Y328H	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	333	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						TCGTGAGGATACTGAGAATCC	0.438																																					p.Y333H		Atlas-SNP	.											.	HGF	171	.	0			c.T997C						.						154.0	141.0	145.0					7																	81358964		2203	4300	6503	SO:0001583	missense	3082	exon8			GAGGATACTGAGA		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.997T>C	chr7.hg19:g.81358964A>G	ENSP00000222390:p.Tyr333His	60.0	0.0		83.0	5.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	hg19	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	A	10.63	1.403435	0.25291	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	T;T	0.62498	0.02;0.02	5.76	4.63	0.57726	Kringle (4);Kringle-like fold (1);	0.170349	0.52532	D	0.000073	T	0.38081	0.1027	N	0.12637	0.245	0.80722	D	1	B;B	0.15930	0.007;0.015	B;B	0.18561	0.013;0.022	T	0.24119	-1.0169	10	0.15952	T	0.53	.	7.0421	0.25025	0.7955:0.0:0.0714:0.1331	.	328;333	P14210-3;P14210	.;HGF_HUMAN	H	333;328	ENSP00000222390:Y333H;ENSP00000391238:Y328H	ENSP00000222390:Y333H	Y	-	1	0	HGF	81196900	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.894000	0.28350	2.182000	0.69389	0.533000	0.62120	TAT	.	.		0.438	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
TECPR1	25851	hgsc.bcm.edu	37	7	97873966	97873966	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:97873966T>C	ENST00000447648.2	-	5	747	c.448A>G	c.(448-450)Aaa>Gaa	p.K150E	TECPR1_ENST00000542604.1_Missense_Mutation_p.K71E|TECPR1_ENST00000379795.3_Missense_Mutation_p.K150E			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	150					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTCTTGTCTTTCGTGTAGGTG	0.567																																					p.K150E		Atlas-SNP	.											.	TECPR1	77	.	0			c.A448G						.						99.0	102.0	101.0					7																	97873966		1948	4130	6078	SO:0001583	missense	25851	exon5			TGTCTTTCGTGTA		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.448A>G	chr7.hg19:g.97873966T>C	ENSP00000404923:p.Lys150Glu	56.0	0.0		75.0	4.0	NM_015395	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	ENST00000447648.2	hg19	CCDS47648.1	.	.	.	.	.	.	.	.	.	.	T	8.419	0.845965	0.16963	.	.	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	D;D;T	0.94046	-3.34;-3.34;1.46	5.2	2.8	0.32819	Ferlin/Peroxisome membrane (1);	0.088931	0.85682	D	0.000000	D	0.89663	0.6780	L	0.61036	1.89	0.26140	N	0.980298	P;B	0.40834	0.73;0.444	B;B	0.42959	0.318;0.403	T	0.79017	-0.1975	10	0.06891	T	0.86	-13.4199	7.1024	0.25344	0.0:0.0787:0.1611:0.7602	.	71;150	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	E	150;150;71	ENSP00000404923:K150E;ENSP00000369121:K150E;ENSP00000441121:K71E	ENSP00000369121:K150E	K	-	1	0	TECPR1	97711902	0.964000	0.33143	0.275000	0.24674	0.674000	0.39518	3.330000	0.52068	0.306000	0.22856	-0.406000	0.06334	AAA	.	.		0.567	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395	
TMEM130	222865	hgsc.bcm.edu	37	7	98460878	98460878	+	Silent	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:98460878G>T	ENST00000416379.2	-	2	235	c.231C>A	c.(229-231)acC>acA	p.T77T	TMEM130_ENST00000345589.4_Intron|TMEM130_ENST00000546258.1_Silent_p.T58T|TMEM130_ENST00000450876.1_5'UTR|TMEM130_ENST00000339375.4_Silent_p.T77T			Q8N3G9	TM130_HUMAN	transmembrane protein 130	77						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCACCAGCGGGGTGTGGATCC	0.657																																					p.T77T		Atlas-SNP	.											.	TMEM130	54	.	0			c.C231A						.						60.0	58.0	59.0					7																	98460878		2203	4300	6503	SO:0001819	synonymous_variant	222865	exon2			CAGCGGGGTGTGG		CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.231C>A	chr7.hg19:g.98460878G>T		74.0	0.0		94.0	39.0	NM_152913	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Silent	SNP	ENST00000416379.2	hg19	CCDS47650.1																																																																																			.	.		0.657	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913	
C7orf43	55262	hgsc.bcm.edu	37	7	99755336	99755336	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:99755336T>C	ENST00000316937.3	-	3	742	c.557A>G	c.(556-558)gAt>gGt	p.D186G	C7orf43_ENST00000498638.1_5'Flank|C7orf43_ENST00000457641.1_5'UTR|MIR4658_ENST00000584344.1_RNA|C7orf43_ENST00000419841.1_5'UTR|C7orf43_ENST00000394035.2_5'Flank	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43	186										breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTAGCCTTGATCTCTGACCTC	0.572											OREG0018198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D186G		Atlas-SNP	.											.	C7orf43	28	.	0			c.A557G						.						114.0	118.0	117.0					7																	99755336		2203	4300	6503	SO:0001583	missense	55262	exon3			CCTTGATCTCTGA		CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.557A>G	chr7.hg19:g.99755336T>C	ENSP00000324741:p.Asp186Gly	62.0	0.0	1346	95.0	4.0	NM_018275	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Missense_Mutation	SNP	ENST00000316937.3	hg19	CCDS5687.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.036074	0.75617	.	.	ENSG00000146826	ENST00000316937	T	0.30714	1.52	5.91	5.91	0.95273	.	0.062472	0.64402	D	0.000007	T	0.18425	0.0442	N	0.08118	0	0.80722	D	1	P	0.46512	0.879	B	0.42827	0.399	T	0.04976	-1.0914	10	0.52906	T	0.07	-13.0401	10.3604	0.43989	0.0:0.0:0.1645:0.8355	.	186	Q8WVR3	CG043_HUMAN	G	186	ENSP00000324741:D186G	ENSP00000324741:D186G	D	-	2	0	C7orf43	99593272	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.089000	0.71384	2.263000	0.75096	0.379000	0.24179	GAT	.	.		0.572	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337395.2	NM_018275	
KMT2E	55904	hgsc.bcm.edu	37	7	104717613	104717613	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:104717613C>T	ENST00000311117.3	+	10	1517	c.972C>T	c.(970-972)aaC>aaT	p.N324N	KMT2E_ENST00000257745.4_Silent_p.N324N|KMT2E_ENST00000334877.4_Silent_p.N324N|KMT2E_ENST00000476671.1_Silent_p.N324N|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	324					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TGAATACCAACAATTTGCTCT	0.343																																					p.N324N		Atlas-SNP	.											.	MLL5	173	.	0			c.C972T						.						76.0	69.0	71.0					7																	104717613		2203	4299	6502	SO:0001819	synonymous_variant	55904	exon9			TACCAACAATTTG	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.972C>T	chr7.hg19:g.104717613C>T		65.0	0.0		97.0	4.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	ENST00000311117.3	hg19	CCDS34723.1																																																																																			.	.		0.343	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
TMEM168	64418	hgsc.bcm.edu	37	7	112423763	112423763	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:112423763A>G	ENST00000312814.6	-	2	1678	c.1118T>C	c.(1117-1119)gTt>gCt	p.V373A	TMEM168_ENST00000454074.1_Missense_Mutation_p.V373A	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	373						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						CTGCCAGGAAACTGCTCCCAA	0.398																																					p.V373A		Atlas-SNP	.											.	TMEM168	84	.	0			c.T1118C						.						112.0	112.0	112.0					7																	112423763		2203	4300	6503	SO:0001583	missense	64418	exon2			CAGGAAACTGCTC		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1118T>C	chr7.hg19:g.112423763A>G	ENSP00000323068:p.Val373Ala	33.0	0.0		75.0	4.0	NM_022484	A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Missense_Mutation	SNP	ENST00000312814.6	hg19	CCDS5757.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.105945	0.77096	.	.	ENSG00000146802	ENST00000312814;ENST00000454074;ENST00000418785;ENST00000441474	.	.	.	6.07	6.07	0.98685	.	0.112361	0.64402	D	0.000010	T	0.60143	0.2246	L	0.53249	1.67	0.80722	D	1	P	0.46784	0.884	P	0.44623	0.455	T	0.64563	-0.6378	9	0.72032	D	0.01	-17.6008	16.6406	0.85098	1.0:0.0:0.0:0.0	.	373	Q9H0V1	TM168_HUMAN	A	373;373;13;25	.	ENSP00000323068:V373A	V	-	2	0	TMEM168	112210999	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.306000	0.96204	2.326000	0.78906	0.533000	0.62120	GTT	.	.		0.398	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484	
ING3	54556	hgsc.bcm.edu	37	7	120607623	120607623	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:120607623T>C	ENST00000315870.5	+	7	625	c.477T>C	c.(475-477)gaT>gaC	p.D159D	ING3_ENST00000431467.1_Silent_p.D144D	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	159					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					CGACAACAGATCATATTCCTG	0.299																																					p.D159D		Atlas-SNP	.											.	ING3	36	.	0			c.T477C						.						73.0	75.0	75.0					7																	120607623		2203	4296	6499	SO:0001819	synonymous_variant	54556	exon7			AACAGATCATATT	AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.477T>C	chr7.hg19:g.120607623T>C		54.0	0.0		87.0	4.0	NM_019071	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Silent	SNP	ENST00000315870.5	hg19	CCDS5778.1																																																																																			.	.		0.299	ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280453.2	NM_019071	
CREB3L2	64764	hgsc.bcm.edu	37	7	137612918	137612918	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:137612918G>A	ENST00000330387.6	-	2	648	c.297C>T	c.(295-297)acC>acT	p.T99T	CREB3L2_ENST00000456390.1_Silent_p.T99T|CREB3L2_ENST00000452463.1_Silent_p.T99T|CREB3L2_ENST00000458726.1_Silent_p.T36T	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	99					cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)		FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						TGTCACTGGTGGTAATGTGGG	0.582			T	FUS	fibromyxoid sarcoma																																p.T99T		Atlas-SNP	.		Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	.	CREB3L2	62	.	0			c.C297T						.						49.0	36.0	41.0					7																	137612918		2202	4299	6501	SO:0001819	synonymous_variant	64764	exon2			ACTGGTGGTAATG	AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.297C>T	chr7.hg19:g.137612918G>A		186.0	0.0		360.0	23.0	NM_001253775	Q6P454|Q6ZMR6	Silent	SNP	ENST00000330387.6	hg19	CCDS34760.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384817	0.42308	.	.	ENSG00000182158	ENST00000420629	T	0.55760	0.5	5.59	-0.0727	0.13738	.	.	.	.	.	T	0.51024	0.1650	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.51364	-0.8715	6	0.87932	D	0	1.1491	2.8513	0.05559	0.282:0.2118:0.4074:0.0987	.	.	.	.	L	33	ENSP00000402889:P33L	ENSP00000402889:P33L	P	-	2	0	CREB3L2	137263458	0.026000	0.19158	0.008000	0.14137	0.738000	0.42128	-0.137000	0.10389	0.037000	0.15575	0.655000	0.94253	CCA	.	.		0.582	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341462.1	NM_194071	
AKR1D1	6718	hgsc.bcm.edu	37	7	137782670	137782670	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:137782670A>G	ENST00000242375.3	+	4	479	c.437A>G	c.(436-438)aAt>aGt	p.N146S	AKR1D1_ENST00000468877.2_3'UTR|AKR1D1_ENST00000432161.1_Missense_Mutation_p.N146S|AKR1D1_ENST00000411726.2_Missense_Mutation_p.N146S	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	146					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)			endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	CACAAGTCAAATCTGTGTGCC	0.299																																					p.N146S		Atlas-SNP	.											.	AKR1D1	52	.	0			c.A437G						.						126.0	128.0	127.0					7																	137782670		2203	4299	6502	SO:0001583	missense	6718	exon4			AGTCAAATCTGTG	Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.437A>G	chr7.hg19:g.137782670A>G	ENSP00000242375:p.Asn146Ser	29.0	0.0		52.0	4.0	NM_001190907	A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	ENST00000242375.3	hg19	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	A	13.06	2.123910	0.37533	.	.	ENSG00000122787	ENST00000297463;ENST00000432161;ENST00000411726;ENST00000242375;ENST00000438242	T;T;T;T	0.48836	0.8;1.92;0.8;0.8	5.14	3.97	0.46021	NADP-dependent oxidoreductase domain (3);	0.182530	0.50627	D	0.000107	T	0.35008	0.0917	N	0.04636	-0.2	0.32396	N	0.552565	P;P;B	0.46512	0.879;0.581;0.019	P;B;B	0.51657	0.676;0.115;0.041	T	0.49606	-0.8922	10	0.59425	D	0.04	.	9.5377	0.39233	0.8424:0.0:0.0:0.1576	.	146;146;146	B4DPN8;B4DPN3;P51857	.;.;AK1D1_HUMAN	S	24;146;146;146;90	ENSP00000389197:N146S;ENSP00000402374:N146S;ENSP00000242375:N146S;ENSP00000397042:N90S	ENSP00000242375:N146S	N	+	2	0	AKR1D1	137433210	0.973000	0.33851	0.567000	0.28434	0.195000	0.23768	7.901000	0.87382	0.948000	0.37687	-0.333000	0.08304	AAT	.	.		0.299	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989	
SSPO	23145	hgsc.bcm.edu	37	7	149489269	149489269	+	RNA	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:149489269A>G	ENST00000378016.2	+	0	5514							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCACGTGCCCACCTGATTGGC	0.657																																					p.P1838P		Atlas-SNP	.											.	.	.	.	0			c.A5514G						.						33.0	34.0	33.0					7																	149489269		1995	4154	6149			23145	exon36			GTGCCCACCTGAT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149489269A>G		42.0	0.0		99.0	4.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.657	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
NEFL	4747	hgsc.bcm.edu	37	8	24811079	24811079	+	RNA	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:24811079T>A	ENST00000221169.5	-	0	1994							P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GGGCTCATCCTTGGCTTCCTC	0.567																																					p.K467M		Atlas-SNP	.											.	NEFL	47	.	0			c.A1400T						.						49.0	51.0	51.0					8																	24811079		1966	4155	6121			4747	exon3			TCATCCTTGGCTT		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		chr8.hg19:g.24811079T>A		52.0	0.0		30.0	24.0	NM_006158	B9ZVN2|Q16154|Q8IU72	Missense_Mutation	SNP	ENST00000221169.5	hg19																																																																																				.	.		0.567	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
IDO1	3620	hgsc.bcm.edu	37	8	39776332	39776332	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:39776332A>G	ENST00000518237.1	+	4	942		c.e4-1		RP11-44K6.4_ENST00000522970.1_RNA|RP11-44K6.3_ENST00000517623.1_RNA|IDO1_ENST00000522495.1_Splice_Site	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1						cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	TATTTTAATCAGGTCTTGCCA	0.388																																					.		Atlas-SNP	.											.	IDO1	43	.	0			c.304-2A>G						.						101.0	95.0	97.0					8																	39776332		1857	4089	5946	SO:0001630	splice_region_variant	3620	exon4			TTAATCAGGTCTT	M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.304-1A>G	chr8.hg19:g.39776332A>G		71.0	0.0		60.0	4.0	NM_002164	Q540B4	Splice_Site	SNP	ENST00000518237.1	hg19	CCDS47847.1	.	.	.	.	.	.	.	.	.	.	A	14.47	2.544293	0.45280	.	.	ENSG00000131203	ENST00000519154;ENST00000522495;ENST00000518237	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6362	0.56685	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IDO1	39895489	1.000000	0.71417	0.939000	0.37840	0.507000	0.33981	7.242000	0.78210	2.233000	0.73108	0.455000	0.32223	.	.	.		0.388	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376987.1	NM_002164	Intron
PPP1R42	286187	hgsc.bcm.edu	37	8	67900622	67900622	+	Missense_Mutation	SNP	T	T	C	rs570555073		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:67900622T>C	ENST00000324682.5	-	6	827	c.683A>G	c.(682-684)tAt>tGt	p.Y228C	PPP1R42_ENST00000522909.1_Intron	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42	0	LRRCT.				regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										attatattaatataaatatGT	0.313																																					p.Y228C		Atlas-SNP	.											.	PPP1R42	2	.	0			c.A683G						.						19.0	20.0	20.0					8																	67900622		2079	4102	6181	SO:0001583	missense	286187	exon6			TATTAATATAAAT	BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.683A>G	chr8.hg19:g.67900622T>C	ENSP00000315035:p.Tyr228Cys	3.0	0.0		19.0	10.0	NM_001013626		Missense_Mutation	SNP	ENST00000324682.5	hg19	CCDS34902.1	.	.	.	.	.	.	.	.	.	.	T	14.05	2.420933	0.42918	.	.	ENSG00000178125	ENST00000324682	T	0.38722	1.12	5.26	5.26	0.73747	.	1.715750	0.03082	N	0.158618	T	0.43809	0.1264	.	.	.	0.25321	N	0.989111	P	0.44816	0.844	B	0.42555	0.391	T	0.39396	-0.9616	9	0.59425	D	0.04	.	10.6756	0.45783	0.1428:0.0:0.0:0.8572	.	228	Q7Z4L9-2	.	C	228	ENSP00000315035:Y228C	ENSP00000315035:Y228C	Y	-	2	0	LRRC67	68063176	0.981000	0.34729	0.998000	0.56505	0.874000	0.50279	1.343000	0.33930	2.116000	0.64780	0.528000	0.53228	TAT	.	.		0.313	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380034.2	NM_001013626	
KCNB2	9312	hgsc.bcm.edu	37	8	73849087	73849087	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:73849087G>A	ENST00000523207.1	+	3	2085	c.1497G>A	c.(1495-1497)ctG>ctA	p.L499L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	499					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GGAAGGCTCTGTCGGAAACAA	0.552																																					p.L499L		Atlas-SNP	.											.	KCNB2	228	.	0			c.G1497A						.						106.0	114.0	112.0					8																	73849087		2203	4300	6503	SO:0001819	synonymous_variant	9312	exon3			GGCTCTGTCGGAA	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1497G>A	chr8.hg19:g.73849087G>A		17.0	0.0		48.0	12.0	NM_004770	Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	hg19	CCDS6209.1																																																																																			.	.		0.552	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
RNF19A	25897	hgsc.bcm.edu	37	8	101271049	101271049	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:101271049T>C	ENST00000519449.1	-	11	2568	c.2252A>G	c.(2251-2253)cAc>cGc	p.H751R	RNF19A_ENST00000341084.2_Missense_Mutation_p.H751R|RNF19A_ENST00000523255.1_5'Flank	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	751	Interaction with CASR.				microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			AAAGCGGGTGTGATAATCACT	0.408																																					p.H751R		Atlas-SNP	.											.	RNF19A	67	.	0			c.A2252G						.						101.0	99.0	100.0					8																	101271049		2203	4300	6503	SO:0001583	missense	25897	exon11			CGGGTGTGATAAT	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.2252A>G	chr8.hg19:g.101271049T>C	ENSP00000428968:p.His751Arg	70.0	0.0		99.0	4.0	NM_015435	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	hg19	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.596398	0.46318	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.84070	-1.8;-1.8	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.79834	0.4514	L	0.50333	1.59	0.58432	D	0.999999	P	0.37466	0.596	B	0.34722	0.188	T	0.81376	-0.0961	10	0.62326	D	0.03	.	16.1016	0.81175	0.0:0.0:0.0:1.0	.	751	Q9NV58	RN19A_HUMAN	R	751	ENSP00000428968:H751R;ENSP00000342667:H751R	ENSP00000342667:H751R	H	-	2	0	RNF19A	101340225	1.000000	0.71417	0.972000	0.41901	0.954000	0.61252	7.495000	0.81514	2.274000	0.75844	0.477000	0.44152	CAC	.	.		0.408	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	
UBR5	51366	hgsc.bcm.edu	37	8	103300480	103300480	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:103300480C>T	ENST00000520539.1	-	36	5334	c.4728G>A	c.(4726-4728)gaG>gaA	p.E1576E	UBR5_ENST00000220959.4_Silent_p.E1576E|UBR5_ENST00000519528.1_5'UTR|UBR5_ENST00000521922.1_Silent_p.E1570E	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1576					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CAGCCACACCCTCCACCACCT	0.413																																					p.E1576E	Ovarian(131;96 1741 5634 7352 27489)	Atlas-SNP	.											.	UBR5	285	.	0			c.G4728A						.						158.0	139.0	145.0					8																	103300480		2203	4300	6503	SO:0001819	synonymous_variant	51366	exon36			CACACCCTCCACC	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4728G>A	chr8.hg19:g.103300480C>T		75.0	0.0		141.0	35.0	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	ENST00000520539.1	hg19	CCDS34933.1																																																																																			.	.		0.413	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110457871	110457871	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:110457871A>G	ENST00000378402.5	+	38	5877	c.5773A>G	c.(5773-5775)Aga>Gga	p.R1925G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1925	IPT/TIG 12.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATCCCAAGCAGAGGTACTCC	0.318										HNSCC(38;0.096)																											p.R1925G		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.A5773G						.						16.0	16.0	16.0					8																	110457871		1826	4089	5915	SO:0001583	missense	93035	exon38			CCAAGCAGAGGTA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5773A>G	chr8.hg19:g.110457871A>G	ENSP00000367655:p.Arg1925Gly	52.0	0.0		84.0	30.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	4.041	0.005151	0.07866	.	.	ENSG00000205038	ENST00000378402	T	0.77620	-1.11	6.03	4.85	0.62838	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.530979	0.19590	N	0.110642	T	0.69415	0.3108	L	0.40543	1.245	0.50171	D	0.999857	B	0.02656	0.0	B	0.12156	0.007	T	0.63161	-0.6699	10	0.41790	T	0.15	.	11.0488	0.47874	0.8612:0.0:0.0:0.1388	.	1925	Q86WI1	PKHL1_HUMAN	G	1925	ENSP00000367655:R1925G	ENSP00000367655:R1925G	R	+	1	2	PKHD1L1	110527047	0.141000	0.22595	0.175000	0.22980	0.011000	0.07611	1.002000	0.29796	1.065000	0.40693	0.533000	0.62120	AGA	.	.		0.318	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CSMD3	114788	hgsc.bcm.edu	37	8	113331087	113331087	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:113331087C>T	ENST00000297405.5	-	47	7583	c.7339G>A	c.(7339-7341)Gga>Aga	p.G2447R	CSMD3_ENST00000343508.3_Missense_Mutation_p.G2407R|CSMD3_ENST00000352409.3_Missense_Mutation_p.G2377R|CSMD3_ENST00000455883.2_Missense_Mutation_p.G2343R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2447	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGAGGTGCTCCATCCATCTGC	0.328										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.G2447R		Atlas-SNP	.											CSMD3_ENST00000343508,NS,malignant_melanoma,0,2	CSMD3	2325	.	0			c.G7339A						.						107.0	97.0	100.0					8																	113331087		2203	4300	6503	SO:0001583	missense	114788	exon47			GTGCTCCATCCAT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7339G>A	chr8.hg19:g.113331087C>T	ENSP00000297405:p.Gly2447Arg	26.0	0.0		39.0	2.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626087	0.87560	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7	5.82	5.82	0.92795	Complement control module (2);Sushi/SCR/CCP (3);	0.076577	0.52532	D	0.000079	T	0.55337	0.1914	M	0.78049	2.395	0.51233	D	0.999916	P;D;D	0.76494	0.948;0.958;0.999	P;P;D	0.80764	0.848;0.906;0.994	T	0.52779	-0.8530	10	0.49607	T	0.09	.	20.1059	0.97895	0.0:1.0:0.0:0.0	.	2343;2447;2407	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	2407;2447;1717;2343;2377	ENSP00000345799:G2407R;ENSP00000297405:G2447R;ENSP00000341558:G1717R;ENSP00000412263:G2343R;ENSP00000343124:G2377R	ENSP00000297405:G2447R	G	-	1	0	CSMD3	113400263	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.606000	0.54095	2.770000	0.95276	0.579000	0.79373	GGA	.	.		0.328	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
TRPS1	7227	hgsc.bcm.edu	37	8	116430680	116430680	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:116430680T>C	ENST00000220888.5	-	5	2821	c.2662A>G	c.(2662-2664)Agg>Ggg	p.R888G	TRPS1_ENST00000395715.3_Splice_Site_p.R901G|TRPS1_ENST00000519076.1_Splice_Site_p.R642G|TRPS1_ENST00000520276.1_Splice_Site_p.R892G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	888					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CCTCTACGCCTCTGAAACAGG	0.468									Langer-Giedion syndrome																												p.R901G		Atlas-SNP	.											.	TRPS1	516	.	0			c.A2701G						.						84.0	86.0	86.0					8																	116430680		1905	4119	6024	SO:0001630	splice_region_variant	7227	exon6	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	TACGCCTCTGAAA	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2662-1A>G	chr8.hg19:g.116430680T>C		104.0	0.0		114.0	5.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.53|16.53	3.149075|3.149075	0.57151|0.57151	.|.	.|.	ENSG00000104447|ENSG00000104447	ENST00000518018|ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	.|D;D;D;D	.|0.99671	.|-6.35;-6.35;-6.35;-6.35	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99199|0.99199	0.9722|0.9722	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;1.0	.|D;D;D	.|0.83275	.|0.996;0.991;0.996	D|D	0.99890|0.99890	1.1132|1.1132	5|10	.|0.72032	.|D	.|0.01	.|.	16.1671|16.1671	0.81777|0.81777	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|892;888;901	.|Q9UHF7-3;Q9UHF7;Q9UHF7-2	.|.;TRPS1_HUMAN;.	G|G	12|901;888;642;892	.|ENSP00000379065:R901G;ENSP00000220888:R888G;ENSP00000428910:R642G;ENSP00000428680:R892G	.|ENSP00000220888:R888G	E|R	-|-	2|1	0|2	TRPS1|TRPS1	116499856|116499856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.116000|6.116000	0.71571|0.71571	2.224000|2.224000	0.72417|0.72417	0.528000|0.528000	0.53228|0.53228	GAG|AGG	.	.		0.468	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	Missense_Mutation
DERL1	79139	hgsc.bcm.edu	37	8	124037286	124037286	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:124037286A>G	ENST00000259512.4	-	3	570	c.270T>C	c.(268-270)gcT>gcC	p.A90A	RP11-557C18.3_ENST00000521258.1_RNA|DERL1_ENST00000523036.1_5'UTR|DERL1_ENST00000405944.3_Silent_p.A90A|DERL1_ENST00000519018.1_5'UTR|DERL1_ENST00000419562.2_Intron	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	90					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TCCCATCAAAAGCTCCTGGAA	0.388																																					p.A90A		Atlas-SNP	.											.	DERL1	27	.	0			c.T270C						.						58.0	55.0	56.0					8																	124037286		2203	4300	6503	SO:0001819	synonymous_variant	79139	exon3			ATCAAAAGCTCCT	BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.270T>C	chr8.hg19:g.124037286A>G		37.0	0.0		61.0	4.0	NM_001134671	B3KW41|E9PH19	Silent	SNP	ENST00000259512.4	hg19	CCDS6337.1																																																																																			.	.		0.388	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381714.2	NM_024295	
KCNK9	51305	hgsc.bcm.edu	37	8	140631049	140631049	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:140631049A>G	ENST00000520439.1	-	2	640	c.577T>C	c.(577-579)Tgc>Cgc	p.C193R	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.C193R	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	193					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GTGATGAAGCAGTAGTAGTAG	0.587																																					p.C193R		Atlas-SNP	.											.	KCNK9	100	.	0			c.T577C						.						87.0	85.0	86.0					8																	140631049		2203	4300	6503	SO:0001583	missense	51305	exon2			TGAAGCAGTAGTA	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.577T>C	chr8.hg19:g.140631049A>G	ENSP00000430676:p.Cys193Arg	87.0	0.0		141.0	46.0	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	hg19	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.897449	0.72639	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.31769	1.48;1.48;1.48	5.85	5.85	0.93711	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.69441	0.3111	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.80819	-0.1212	10	0.87932	D	0	.	15.4187	0.74995	1.0:0.0:0.0:0.0	.	193	Q9NPC2	KCNK9_HUMAN	R	193	ENSP00000429847:C193R;ENSP00000302166:C193R;ENSP00000430676:C193R	ENSP00000302166:C193R	C	-	1	0	KCNK9	140700231	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.117000	0.94347	2.222000	0.72286	0.533000	0.62120	TGC	.	.		0.587	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
SLURP1	57152	hgsc.bcm.edu	37	8	143823269	143823269	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:143823269T>C	ENST00000246515.1	-	2	155	c.130A>G	c.(130-132)Aag>Gag	p.K44E		NM_020427.2	NP_065160.1	P55000	SLUR1_HUMAN	secreted LY6/PLAUR domain containing 1	44	UPAR/Ly6.				cell activation (GO:0001775)|cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			breast(1)|lung(7)|ovary(1)	9	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					TCCTCTGGCTTGCAGCGGGTA	0.647																																					p.K44E		Atlas-SNP	.											.	SLURP1	16	.	0			c.A130G						.						106.0	94.0	98.0					8																	143823269		2201	4299	6500	SO:0001583	missense	57152	exon2			CTGGCTTGCAGCG	AY579080	CCDS6387.1	8q24.3	2004-11-16			ENSG00000126233	ENSG00000126233			18746	protein-coding gene	gene with protein product	"""lymphocyte antigen 6-like secreted"", ""ARS component B"""	606119				11285253, 10211827	Standard	NM_020427		Approved	ARS, ANUP, MDM, ArsB, LY6LS	uc003ywy.3	P55000	OTTHUMG00000164685	ENST00000246515.1:c.130A>G	chr8.hg19:g.143823269T>C	ENSP00000246515:p.Lys44Glu	43.0	0.0		100.0	4.0	NM_020427	Q53YJ6|Q6PUA6|Q92483	Missense_Mutation	SNP	ENST00000246515.1	hg19	CCDS6387.1	.	.	.	.	.	.	.	.	.	.	T	7.483	0.649117	0.14516	.	.	ENSG00000126233	ENST00000246515	T	0.69175	-0.38	3.81	-0.688	0.11317	Ly-6 antigen / uPA receptor -like (1);CD59 antigen (1);	0.687158	0.13123	N	0.412023	T	0.55970	0.1954	M	0.65975	2.015	0.09310	N	1	P	0.43885	0.82	B	0.41088	0.347	T	0.46789	-0.9166	10	0.17832	T	0.49	-16.5723	4.1918	0.10424	0.0:0.1256:0.4235:0.4508	.	44	P55000	SLUR1_HUMAN	E	44	ENSP00000246515:K44E	ENSP00000246515:K44E	K	-	1	0	SLURP1	143820271	0.037000	0.19845	0.168000	0.22838	0.254000	0.26022	0.381000	0.20619	0.037000	0.15575	0.379000	0.24179	AAG	.	.		0.647	SLURP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379741.1	NM_020427	
EPPK1	83481	hgsc.bcm.edu	37	8	144940614	144940614	+	Missense_Mutation	SNP	C	C	T	rs200821582		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:144940614C>T	ENST00000525985.1	-	2	6879	c.6808G>A	c.(6808-6810)Ggc>Agc	p.G2270S				P58107	EPIPL_HUMAN	epiplakin 1	2270						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.G2270S(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ATGACGAAGCCGGTGGCCGCC	0.721																																					p.G2270S		Atlas-SNP	.											EPPK1,NS,carcinoma,0,1	EPPK1	199	.	1	Substitution - Missense(1)	lung(1)	c.G6808A						.	C	SER/GLY	1,4305		0,1,2152	38.0	37.0	37.0		6808	4.6	1.0	8		37	2,8468		0,2,4233	no	missense	EPPK1	NM_031308.1	56	0,3,6385	TT,TC,CC		0.0236,0.0232,0.0235	probably-damaging	2270/2420	144940614	3,12773	2153	4235	6388	SO:0001583	missense	83481	exon1			CGAAGCCGGTGGC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6808G>A	chr8.hg19:g.144940614C>T	ENSP00000436337:p.Gly2270Ser	3.0	1.0		20.0	8.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	C	36	5.600172	0.96614	2.32E-4	2.36E-4	ENSG00000227184	ENST00000525985	D	0.86497	-2.13	4.63	4.63	0.57726	.	.	.	.	.	D	0.94935	0.8362	M	0.93150	3.385	0.52501	D	0.999952	D	0.89917	1.0	D	0.97110	1.0	D	0.95948	0.8952	9	0.72032	D	0.01	.	15.1031	0.72299	0.0:1.0:0.0:0.0	.	2270	E9PPU0	.	S	2270	ENSP00000436337:G2270S	ENSP00000436337:G2270S	G	-	1	0	EPPK1	145012602	1.000000	0.71417	0.984000	0.44739	0.988000	0.76386	7.595000	0.82710	2.416000	0.81992	0.586000	0.80456	GGC	.	C|0.998;T|0.002		0.721	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	hgsc.bcm.edu	37	8	144944633	144944633	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:144944633C>T	ENST00000525985.1	-	2	2860	c.2789G>A	c.(2788-2790)gGa>gAa	p.G930E				P58107	EPIPL_HUMAN	epiplakin 1	930						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCCACAGCTCCCAGGCCGCA	0.682																																					p.G930E		Atlas-SNP	.											.	EPPK1	199	.	0			c.G2789A						.						14.0	18.0	17.0					8																	144944633		2051	4175	6226	SO:0001583	missense	83481	exon1			ACAGCTCCCAGGC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.2789G>A	chr8.hg19:g.144944633C>T	ENSP00000436337:p.Gly930Glu	14.0	0.0		35.0	12.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.54	3.152170	0.57259	.	.	ENSG00000227184	ENST00000525985	T	0.72615	-0.67	4.94	4.04	0.47022	.	.	.	.	.	T	0.64692	0.2621	N	0.19112	0.55	0.09310	N	1	D	0.58268	0.982	P	0.57620	0.824	T	0.51513	-0.8696	9	0.23891	T	0.37	.	6.6665	0.23042	0.0:0.7232:0.1825:0.0943	.	930	E9PPU0	.	E	930	ENSP00000436337:G930E	ENSP00000436337:G930E	G	-	2	0	EPPK1	145016621	0.011000	0.17503	0.031000	0.17742	0.002000	0.02628	1.450000	0.35134	1.271000	0.44313	0.655000	0.94253	GGA	.	.		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PLAA	9373	hgsc.bcm.edu	37	9	26905635	26905635	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:26905635A>G	ENST00000397292.3	-	14	2679	c.2262T>C	c.(2260-2262)agT>agC	p.S754S		NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	754	PUL. {ECO:0000255|PROSITE- ProRule:PRU00729}.				inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TTGAATCATCACTGATAAGTG	0.373																																					p.S754S	Melanoma(175;2670 2735 14091 35526)	Atlas-SNP	.											.	PLAA	48	.	0			c.T2262C						.						107.0	105.0	106.0					9																	26905635		2203	4300	6503	SO:0001819	synonymous_variant	9373	exon14			ATCATCACTGATA	AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.2262T>C	chr9.hg19:g.26905635A>G		103.0	0.0		76.0	4.0	NM_001031689	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Silent	SNP	ENST00000397292.3	hg19	CCDS35000.1																																																																																			.	.		0.373	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	
FANCG	2189	hgsc.bcm.edu	37	9	35077012	35077012	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:35077012A>G	ENST00000378643.3	-	6	1224	c.733T>C	c.(733-735)Ttg>Ctg	p.L245L	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	245					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ACCTGGACCAACACAGGCCGT	0.537			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																													p.L245L		Atlas-SNP	.	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	.	FANCG	56	.	0			c.T733C						.						88.0	92.0	91.0					9																	35077012		2203	4300	6503	SO:0001819	synonymous_variant	2189	exon6			GGACCAACACAGG	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.733T>C	chr9.hg19:g.35077012A>G		83.0	0.0		93.0	4.0	NM_004629		Silent	SNP	ENST00000378643.3	hg19	CCDS6574.1																																																																																			.	.		0.537	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629	
CCIN	881	hgsc.bcm.edu	37	9	36169807	36169807	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:36169807A>T	ENST00000335119.2	+	1	419	c.308A>T	c.(307-309)gAg>gTg	p.E103V		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	103	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			AATGTGGAGGAGCTGCTTCGT	0.522																																					p.E103V		Atlas-SNP	.											.	CCIN	56	.	0			c.A308T						.						84.0	72.0	76.0					9																	36169807		2203	4300	6503	SO:0001583	missense	881	exon1			TGGAGGAGCTGCT	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.308A>T	chr9.hg19:g.36169807A>T	ENSP00000334996:p.Glu103Val	104.0	0.0		126.0	46.0	NM_005893	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	hg19	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.926934	0.52759	.	.	ENSG00000185972	ENST00000335119	T	0.72615	-0.67	5.26	5.26	0.73747	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.56097	D	0.000040	T	0.69287	0.3094	M	0.61703	1.905	0.38593	D	0.95047	D	0.54207	0.965	P	0.46419	0.516	T	0.69684	-0.5079	10	0.21540	T	0.41	.	11.8391	0.52344	1.0:0.0:0.0:0.0	.	103	Q13939	CALI_HUMAN	V	103	ENSP00000334996:E103V	ENSP00000334996:E103V	E	+	2	0	CCIN	36159807	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.309000	0.65774	2.118000	0.64928	0.379000	0.24179	GAG	.	.		0.522	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
C9orf85	138241	hgsc.bcm.edu	37	9	74561974	74561974	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:74561974T>C	ENST00000377031.3	+	2	345	c.155T>C	c.(154-156)cTt>cCt	p.L52P	C9orf85_ENST00000334731.2_Missense_Mutation_p.L52P|C9orf85_ENST00000486911.2_Missense_Mutation_p.L52P			Q96MD7	CI085_HUMAN	chromosome 9 open reading frame 85	52	Lys-rich.									kidney(2)|large_intestine(1)|lung(4)	7						AAAGAAGTTCTTGAGTGGCGT	0.343																																					p.L52P		Atlas-SNP	.											.	C9orf85	28	.	0			c.T155C						.						95.0	86.0	89.0					9																	74561974		2203	4300	6503	SO:0001583	missense	138241	exon2			AAGTTCTTGAGTG	BC010179	CCDS6639.1	9q21.2	2012-03-16			ENSG00000155621	ENSG00000155621			28784	protein-coding gene	gene with protein product						12477932	Standard	NM_182505		Approved	MGC61599	uc004ain.3	Q96MD7	OTTHUMG00000020002	ENST00000377031.3:c.155T>C	chr9.hg19:g.74561974T>C	ENSP00000366230:p.Leu52Pro	61.0	0.0		81.0	4.0	NM_182505	Q5W0N1|Q5W0N3|Q6PJW9|Q86U95	Missense_Mutation	SNP	ENST00000377031.3	hg19		.	.	.	.	.	.	.	.	.	.	T	19.93	3.918533	0.73098	.	.	ENSG00000155621	ENST00000334731;ENST00000377031	T	0.35789	1.29	5.69	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.60459	-0.7259	10	0.87932	D	0	-15.2433	10.6569	0.45680	0.0:0.0763:0.0:0.9237	.	52	Q96MD7-1	.	P	52	ENSP00000366230:L52P	ENSP00000334289:L52P	L	+	2	0	C9orf85	73751794	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.175000	0.77632	0.998000	0.38996	0.454000	0.30748	CTT	.	.		0.343	C9orf85-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052628.2	NM_182505	
PHF2	5253	hgsc.bcm.edu	37	9	96438992	96438992	+	Silent	SNP	A	A	T	rs10821200		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:96438992A>T	ENST00000359246.4	+	21	3316	c.2949A>T	c.(2947-2949)ccA>ccT	p.P983P	PHF2_ENST00000375376.4_Silent_p.P214P	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	983	Ser/Thr-rich.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		ccaccacgccagcctctacca	0.667																																					p.P983P		Atlas-SNP	.											PHF2,caecum,carcinoma,0,1	PHF2	113	.	0			c.A2949T						.						87.0	65.0	72.0					9																	96438992		2163	4255	6418	SO:0001819	synonymous_variant	5253	exon21			CACGCCAGCCTCT	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2949A>T	chr9.hg19:g.96438992A>T		23.0	1.0		43.0	6.0	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Silent	SNP	ENST00000359246.4	hg19	CCDS35069.1																																																																																			.	.		0.667	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
TDRD7	23424	hgsc.bcm.edu	37	9	100222509	100222509	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:100222509A>G	ENST00000355295.4	+	7	1200	c.905A>G	c.(904-906)aAg>aGg	p.K302R	TDRD7_ENST00000422139.2_Missense_Mutation_p.K228R	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	302	HTH OST-type 2. {ECO:0000255|PROSITE- ProRule:PRU00975}.				germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				TATCCAGCTAAGAGAAAGCAG	0.403																																					p.K302R		Atlas-SNP	.											.	TDRD7	78	.	0			c.A905G						.						79.0	80.0	80.0					9																	100222509		2203	4300	6503	SO:0001583	missense	23424	exon7			CAGCTAAGAGAAA	AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.905A>G	chr9.hg19:g.100222509A>G	ENSP00000347444:p.Lys302Arg	100.0	0.0		96.0	4.0	NM_014290	A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	ENST00000355295.4	hg19	CCDS6725.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312093	0.40895	.	.	ENSG00000196116	ENST00000355295;ENST00000422139	T;T	0.14766	2.48;2.51	5.54	4.36	0.52297	.	0.489199	0.25804	N	0.028193	T	0.12390	0.0301	L	0.50333	1.59	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.07849	-1.0751	10	0.33940	T	0.23	-16.8141	7.0874	0.25266	0.7758:0.1471:0.0771:0.0	.	302	Q8NHU6	TDRD7_HUMAN	R	302;228	ENSP00000347444:K302R;ENSP00000413608:K228R	ENSP00000347444:K302R	K	+	2	0	TDRD7	99262330	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.837000	0.39201	0.992000	0.38840	0.533000	0.62120	AAG	.	.		0.403	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053322.1	NM_014290	
ANKS6	203286	hgsc.bcm.edu	37	9	101544811	101544811	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:101544811A>G	ENST00000353234.4	-	5	1204	c.1157T>C	c.(1156-1158)gTc>gCc	p.V386A	ANKS6_ENST00000540940.1_Missense_Mutation_p.V191A|ANKS6_ENST00000375018.1_Missense_Mutation_p.V386A|ANKS6_ENST00000375019.2_Missense_Mutation_p.V85A			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	386						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				ACGAAGAGTGACATCGGCCCC	0.433																																					p.V386A		Atlas-SNP	.											.	ANKS6	59	.	0			c.T1157C						.						134.0	126.0	129.0					9																	101544811		1888	4111	5999	SO:0001583	missense	203286	exon5			AGAGTGACATCGG	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1157T>C	chr9.hg19:g.101544811A>G	ENSP00000297837:p.Val386Ala	81.0	0.0		90.0	4.0	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	hg19	CCDS43856.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.751332	0.89753	.	.	ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.5	5.5	0.81552	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.74756	0.3758	L	0.41236	1.265	0.58432	D	0.999992	D	0.76494	0.999	D	0.78314	0.991	T	0.77233	-0.2663	10	0.72032	D	0.01	-23.678	13.5651	0.61813	1.0:0.0:0.0:0.0	.	386	Q68DC2	ANKS6_HUMAN	A	85;386;386;191	ENSP00000364159:V85A;ENSP00000364158:V386A;ENSP00000297837:V386A;ENSP00000442189:V191A	ENSP00000297837:V386A	V	-	2	0	ANKS6	100584632	1.000000	0.71417	0.992000	0.48379	0.926000	0.56050	8.661000	0.91125	2.083000	0.62718	0.533000	0.62120	GTC	.	.		0.433	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
LCN2	3934	hgsc.bcm.edu	37	9	130911936	130911936	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:130911936C>A	ENST00000373017.1	+	2	369	c.132C>A	c.(130-132)gaC>gaA	p.D44E	LCN2_ENST00000470902.1_3'UTR|LCN2_ENST00000373013.2_Missense_Mutation_p.D44E|LCN2_ENST00000372998.1_Missense_Mutation_p.D44E|LCN2_ENST00000540948.1_Missense_Mutation_p.D44E|LCN2_ENST00000277480.2_Missense_Mutation_p.D44E			P80188	NGAL_HUMAN	lipocalin 2	44					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|small molecule binding (GO:0036094)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	8						ACTTCCAGGACAACCAAGTAA	0.637																																					p.D44E		Atlas-SNP	.											.	LCN2	12	.	0			c.C132A						.						61.0	62.0	62.0					9																	130911936		2203	4300	6503	SO:0001583	missense	3934	exon1			CCAGGACAACCAA		CCDS6892.1	9q34	2011-10-24	2007-12-18		ENSG00000148346	ENSG00000148346		"""Lipocalins"""	6526	protein-coding gene	gene with protein product	"""oncogene 24p3"", ""neutrophil gelatinase-associated lipocalin"", ""siderocalin"""	600181	"""lipocalin 2 (oncogene 24p3)"""			7683678	Standard	NM_005564		Approved	NGAL, 24p3	uc004bto.1	P80188	OTTHUMG00000020734	ENST00000373017.1:c.132C>A	chr9.hg19:g.130911936C>A	ENSP00000362108:p.Asp44Glu	68.0	0.0		75.0	29.0	NM_005564	A6NII8|B4DWV4|B7ZAA2|P30150|Q5SYV9|Q5SYW0|Q6FGL5|Q92683	Missense_Mutation	SNP	ENST00000373017.1	hg19	CCDS6892.1	.	.	.	.	.	.	.	.	.	.	C	9.271	1.045625	0.19748	.	.	ENSG00000148346	ENST00000373017;ENST00000277480;ENST00000373013;ENST00000540948;ENST00000372998	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.02	3.45	-4.42	0.03579	Lipocalin conserved site (1);Calycin-like (1);Calycin (1);	1.755640	0.02919	N	0.137663	T	0.09598	0.0236	N	0.24115	0.695	0.09310	N	1	B;B;B	0.20261	0.043;0.025;0.025	B;B;B	0.18561	0.022;0.01;0.01	T	0.20806	-1.0264	10	0.02654	T	1	-3.6543	1.6794	0.02829	0.1697:0.4154:0.1722:0.2427	.	44;45;44	P80188-2;B2ZDQ1;P80188	.;.;NGAL_HUMAN	E	44	ENSP00000362108:D44E;ENSP00000277480:D44E;ENSP00000362104:D44E;ENSP00000441666:D44E;ENSP00000362089:D44E	ENSP00000277480:D44E	D	+	3	2	LCN2	129951757	0.000000	0.05858	0.000000	0.03702	0.602000	0.36980	-3.139000	0.00587	-0.919000	0.03803	0.456000	0.33151	GAC	.	.		0.637	LCN2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054375.1	NM_005564	
GTF3C4	9329	hgsc.bcm.edu	37	9	135562687	135562687	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:135562687A>G	ENST00000372146.4	+	4	2941	c.2377A>G	c.(2377-2379)Agc>Ggc	p.S793G		NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	793					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		GCTCCATGACAGCATTGCCCG	0.527																																					p.S793G	Pancreas(142;417 1875 11086 31973 47667)	Atlas-SNP	.											.	GTF3C4	53	.	0			c.A2377G						.						239.0	233.0	235.0					9																	135562687		2203	4300	6503	SO:0001583	missense	9329	exon4			CATGACAGCATTG	AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.2377A>G	chr9.hg19:g.135562687A>G	ENSP00000361219:p.Ser793Gly	76.0	0.0		78.0	4.0	NM_012204	Q5VZJ7	Missense_Mutation	SNP	ENST00000372146.4	hg19	CCDS6953.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093657	0.76870	.	.	ENSG00000125484	ENST00000372146	T	0.48836	0.8	5.58	5.58	0.84498	Transcription factor IIIC, putative zinc-finger (1);	0.125061	0.64402	D	0.000001	T	0.45316	0.1336	N	0.12182	0.205	0.47094	D	0.999315	D	0.56287	0.975	P	0.59012	0.85	T	0.39742	-0.9599	10	0.23302	T	0.38	-32.194	14.5866	0.68328	1.0:0.0:0.0:0.0	.	793	Q9UKN8	TF3C4_HUMAN	G	793	ENSP00000361219:S793G	ENSP00000361219:S793G	S	+	1	0	GTF3C4	134552508	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.047000	0.64232	2.132000	0.65825	0.528000	0.53228	AGC	.	.		0.527	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054792.1		
SARDH	1757	hgsc.bcm.edu	37	9	136578161	136578161	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:136578161T>C	ENST00000371872.4	-	9	1493	c.1236A>G	c.(1234-1236)gcA>gcG	p.A412A	SARDH_ENST00000422262.2_Splice_Site_p.A244A|SARDH_ENST00000439388.1_Splice_Site_p.A412A	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	412					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CGGACTCACCTGCGCTGTTGA	0.662																																					p.A412A		Atlas-SNP	.											.	SARDH	112	.	0			c.A1236G						.						32.0	34.0	33.0					9																	136578161		2202	4300	6502	SO:0001630	splice_region_variant	1757	exon9			CTCACCTGCGCTG		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1237+1A>G	chr9.hg19:g.136578161T>C		26.0	0.0		41.0	15.0	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	hg19	CCDS6978.1																																																																																			.	.		0.662	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		Silent
PMPCA	23203	hgsc.bcm.edu	37	9	139306975	139306975	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:139306975A>G	ENST00000371717.3	+	3	317	c.308A>G	c.(307-309)aAa>aGa	p.K103R	PMPCA_ENST00000371720.1_Missense_Mutation_p.K103R|PMPCA_ENST00000399219.3_Missense_Mutation_p.N4D|SDCCAG3_ENST00000298537.7_5'Flank|SDCCAG3_ENST00000357365.3_5'Flank|SDCCAG3_ENST00000371725.3_5'Flank	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	103					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		TATGAAGCGAAATACCTTAGT	0.308																																					p.K103R		Atlas-SNP	.											.	PMPCA	29	.	0			c.A308G						.						87.0	86.0	87.0					9																	139306975		2201	4297	6498	SO:0001583	missense	23203	exon3			AAGCGAAATACCT	D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.308A>G	chr9.hg19:g.139306975A>G	ENSP00000360782:p.Lys103Arg	82.0	0.0		94.0	4.0	NM_015160	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371717.3	hg19	CCDS35180.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.94|16.94	3.261105|3.261105	0.59431|0.59431	.|.	.|.	ENSG00000165688|ENSG00000165688	ENST00000371720;ENST00000371717|ENST00000399219	T;T|T	0.18657|0.12672	2.2;2.2|2.66	4.96|4.96	4.96|4.96	0.65561|0.65561	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.08268|0.08268	0.0206|0.0206	L|L	0.29908|0.29908	0.895|0.895	0.28300|0.28300	N|N	0.923179|0.923179	P;P|P	0.38335|0.39665	0.584;0.627|0.682	B;B|B	0.42062|0.27380	0.348;0.374|0.079	T|T	0.09729|0.09729	-1.0661|-1.0661	10|9	0.17832|0.08179	T|T	0.49|0.78	.|.	14.1026|14.1026	0.65068|0.65068	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	103;103|4	B4DRK5;Q10713|B4DKL3	.;MPPA_HUMAN|.	R|D	103|4	ENSP00000360785:K103R;ENSP00000360782:K103R|ENSP00000416702:N4D	ENSP00000360782:K103R|ENSP00000416702:N4D	K|N	+|+	2|1	0|0	PMPCA|PMPCA	138426796|138426796	1.000000|1.000000	0.71417|0.71417	0.722000|0.722000	0.30670|0.30670	0.925000|0.925000	0.55904|0.55904	8.978000|8.978000	0.93450|0.93450	1.966000|1.966000	0.57179|0.57179	0.533000|0.533000	0.62120|0.62120	AAA|AAT	.	.		0.308	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055054.1	NM_015160	
CCDC3	83643	hgsc.bcm.edu	37	10	13040436	13040436	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:13040436T>C	ENST00000378825.3	-	2	577	c.451A>G	c.(451-453)Aga>Gga	p.R151G	CCDC3_ENST00000378839.1_Missense_Mutation_p.R26G	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	151						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			AACATCCTTCTGTTCTCTTGA	0.458																																					p.R151G		Atlas-SNP	.											.	CCDC3	27	.	0			c.A451G						.						128.0	115.0	119.0					10																	13040436		2203	4300	6503	SO:0001583	missense	83643	exon2			TCCTTCTGTTCTC	BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.451A>G	chr10.hg19:g.13040436T>C	ENSP00000368102:p.Arg151Gly	83.0	0.0		94.0	26.0	NM_031455	Q5VYV8|Q5VYV9	Missense_Mutation	SNP	ENST00000378825.3	hg19	CCDS7093.1	.	.	.	.	.	.	.	.	.	.	T	19.37	3.814588	0.70912	.	.	ENSG00000151468	ENST00000378839;ENST00000378825	.	.	.	4.92	3.76	0.43208	.	0.042937	0.85682	D	0.000000	T	0.67088	0.2856	M	0.72894	2.215	0.48696	D	0.999695	D	0.60575	0.988	P	0.56216	0.794	T	0.67325	-0.5699	9	0.46703	T	0.11	-3.219	11.3499	0.49581	0.0:0.0:0.1522:0.8478	.	151	Q9BQI4	CCDC3_HUMAN	G	26;151	.	ENSP00000368102:R151G	R	-	1	2	CCDC3	13080442	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.910000	0.39927	0.809000	0.34255	0.379000	0.24179	AGA	.	.		0.458	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046829.1	NM_031455	
MYO3A	53904	hgsc.bcm.edu	37	10	26442791	26442791	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:26442791A>T	ENST00000265944.5	+	24	2814	c.2648A>T	c.(2647-2649)cAt>cTt	p.H883L	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	883	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AATCTGCCACATTCTAAAACT	0.294																																					p.H883L		Atlas-SNP	.											.	MYO3A	371	.	0			c.A2648T						.						33.0	36.0	35.0					10																	26442791		2196	4288	6484	SO:0001583	missense	53904	exon24			TGCCACATTCTAA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2648A>T	chr10.hg19:g.26442791A>T	ENSP00000265944:p.His883Leu	140.0	0.0		142.0	6.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	A	10.57	1.387816	0.25031	.	.	ENSG00000095777	ENST00000265944	T	0.70045	-0.45	5.46	3.11	0.35812	Myosin head, motor domain (2);	0.095322	0.64402	N	0.000001	T	0.49762	0.1576	L	0.41415	1.275	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.24764	-1.0151	10	0.10902	T	0.67	.	6.5446	0.22398	0.7604:0.0:0.0776:0.162	.	883	Q8NEV4	MYO3A_HUMAN	L	883	ENSP00000265944:H883L	ENSP00000265944:H883L	H	+	2	0	MYO3A	26482797	1.000000	0.71417	0.986000	0.45419	0.812000	0.45895	2.348000	0.44045	0.370000	0.24538	0.377000	0.23210	CAT	.	.		0.294	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
ANKRD26	22852	hgsc.bcm.edu	37	10	27349321	27349321	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:27349321A>G	ENST00000376087.4	-	15	1682	c.1517T>C	c.(1516-1518)gTt>gCt	p.V506A	ANKRD26_ENST00000436985.2_Missense_Mutation_p.V522A	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	506					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TTTATTTGGAACAGAATCTTT	0.284																																					p.V506A		Atlas-SNP	.											.	ANKRD26	179	.	0			c.T1517C						.						106.0	103.0	104.0					10																	27349321		1803	4069	5872	SO:0001583	missense	22852	exon15			TTTGGAACAGAAT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1517T>C	chr10.hg19:g.27349321A>G	ENSP00000365255:p.Val506Ala	88.0	0.0		124.0	5.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	hg19	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.072952	0.36566	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.36157	1.35;1.27	4.5	0.6	0.17524	.	1.170640	0.06861	U	0.799102	T	0.30978	0.0782	L	0.51422	1.61	0.09310	N	1	B;B;B	0.14012	0.002;0.001;0.009	B;B;B	0.12156	0.006;0.003;0.007	T	0.34750	-0.9816	10	0.62326	D	0.03	.	4.0926	0.09976	0.4988:0.1815:0.3197:0.0	.	506;506;522	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	A	506;522	ENSP00000365255:V506A;ENSP00000405112:V522A	ENSP00000365255:V506A	V	-	2	0	ANKRD26	27389327	0.106000	0.21978	0.052000	0.19188	0.846000	0.48090	1.273000	0.33121	-0.148000	0.11234	0.260000	0.18958	GTT	.	.		0.284	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
KIAA1462	57608	hgsc.bcm.edu	37	10	30317392	30317392	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:30317392T>C	ENST00000375377.1	-	3	1786	c.1685A>G	c.(1684-1686)cAa>cGa	p.Q562R		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	562					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						AGTCCCAGTTTGGAACTTTTT	0.463																																					p.Q562R		Atlas-SNP	.											.	KIAA1462	162	.	0			c.A1685G						.						99.0	100.0	100.0					10																	30317392		1873	4111	5984	SO:0001583	missense	57608	exon3			CCAGTTTGGAACT	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1685A>G	chr10.hg19:g.30317392T>C	ENSP00000364526:p.Gln562Arg	24.0	0.0		40.0	4.0	NM_020848	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	hg19	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.301727	0.40694	.	.	ENSG00000165757	ENST00000375377	T	0.11821	2.74	5.62	5.62	0.85841	.	0.161766	0.51477	D	0.000081	T	0.12008	0.0292	N	0.22421	0.69	0.30408	N	0.779399	B	0.19817	0.039	B	0.18871	0.023	T	0.05500	-1.0881	10	0.72032	D	0.01	-21.2059	15.806	0.78513	0.0:0.0:0.0:1.0	.	562	Q9P266	K1462_HUMAN	R	562	ENSP00000364526:Q562R	ENSP00000364526:Q562R	Q	-	2	0	KIAA1462	30357398	1.000000	0.71417	0.956000	0.39512	0.166000	0.22503	4.534000	0.60622	2.142000	0.66516	0.459000	0.35465	CAA	.	.		0.463	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
EPC1	80314	hgsc.bcm.edu	37	10	32576101	32576101	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:32576101A>G	ENST00000263062.8	-	7	1346	c.1077T>C	c.(1075-1077)gcT>gcC	p.A359A	EPC1_ENST00000319778.6_Silent_p.A359A|EPC1_ENST00000375110.2_Silent_p.A309A	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	359					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				CTGGCAGTGCAGCAGGACTCG	0.458																																					p.A359A		Atlas-SNP	.											.	EPC1	74	.	0			c.T1077C						.						153.0	135.0	141.0					10																	32576101		2203	4300	6503	SO:0001819	synonymous_variant	80314	exon7			CAGTGCAGCAGGA	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1077T>C	chr10.hg19:g.32576101A>G		48.0	0.0		71.0	4.0	NM_025209	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Silent	SNP	ENST00000263062.8	hg19	CCDS7172.1																																																																																			.	.		0.458	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
ANK3	288	hgsc.bcm.edu	37	10	61874003	61874003	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:61874003A>G	ENST00000280772.2	-	26	3119	c.2928T>C	c.(2926-2928)gtT>gtC	p.V976V	ANK3_ENST00000355288.2_Silent_p.V110V|ANK3_ENST00000373827.2_Silent_p.V970V|ANK3_ENST00000503366.1_Silent_p.V977V	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	976					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TGGGGCTTGAAACAAGATTGA	0.343																																					p.V977V		Atlas-SNP	.											ANK3_ENST00000395293,NS,carcinoma,0,3	ANK3	703	.	0			c.T2931C						.						85.0	78.0	80.0					10																	61874003		2203	4300	6503	SO:0001819	synonymous_variant	288	exon27			GCTTGAAACAAGA	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.2928T>C	chr10.hg19:g.61874003A>G		45.0	0.0		44.0	2.0	NM_001204404	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	A	10.27	1.305170	0.23736	.	.	ENSG00000151150	ENST00000467420	.	.	.	5.48	1.44	0.22558	.	.	.	.	.	T	0.43700	0.1259	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19549	-1.0302	4	.	.	.	.	2.7304	0.05225	0.2278:0.1239:0.5211:0.1272	.	.	.	.	S	1	.	.	F	-	2	0	ANK3	61544009	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	0.690000	0.25451	-0.006000	0.14370	-0.242000	0.12053	TTT	.	.		0.343	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
MYPN	84665	hgsc.bcm.edu	37	10	69918260	69918260	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:69918260A>G	ENST00000358913.5	+	7	1823	c.1335A>G	c.(1333-1335)tcA>tcG	p.S445S	MYPN_ENST00000354393.2_Silent_p.S170S|MYPN_ENST00000373675.3_Silent_p.S445S|RN7SKP202_ENST00000410439.1_RNA|MYPN_ENST00000540630.1_Silent_p.S445S	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	445	Ig-like 2.|Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						AAAATTTGTCAGCTTCTGAGG	0.348																																					p.S445S		Atlas-SNP	.											.	MYPN	189	.	0			c.A1335G						.						91.0	90.0	91.0					10																	69918260		2203	4300	6503	SO:0001819	synonymous_variant	84665	exon7			TTTGTCAGCTTCT	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1335A>G	chr10.hg19:g.69918260A>G		61.0	0.0		89.0	4.0	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	ENST00000358913.5	hg19	CCDS7275.1																																																																																			.	.		0.348	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
CFAP70	118491	hgsc.bcm.edu	37	10	75058853	75058853	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:75058853T>C	ENST00000310715.3	-	15	1654	c.1534A>G	c.(1534-1536)Agt>Ggt	p.S512G	TTC18_ENST00000355577.3_5'UTR|snoU13_ENST00000459292.1_RNA|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000394865.1_Missense_Mutation_p.S512G|TTC18_ENST00000401621.2_Missense_Mutation_p.S512G|TTC18_ENST00000340329.3_Intron	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		512						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TGGTAGTCACTCACTGCCTAA	0.393																																					p.S512G		Atlas-SNP	.											.	TTC18	106	.	0			c.A1534G						.						82.0	77.0	79.0					10																	75058853		2203	4300	6503	SO:0001583	missense	118491	exon15			AGTCACTCACTGC																												ENST00000310715.3:c.1534A>G	chr10.hg19:g.75058853T>C	ENSP00000310829:p.Ser512Gly	55.0	0.0		85.0	4.0	NM_145170	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	ENST00000310715.3	hg19	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	T	12.05	1.821197	0.32237	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000372928;ENST00000394865	D;D;D	0.94457	-3.43;-3.43;-3.43	5.35	4.0	0.46444	.	0.628928	0.16871	N	0.196120	D	0.91202	0.7228	L	0.44542	1.39	0.23632	N	0.997248	B;B	0.24368	0.082;0.102	B;B	0.29942	0.109;0.047	D	0.84685	0.0719	10	0.49607	T	0.09	-14.3771	9.4665	0.38816	0.0:0.0983:0.0:0.9017	.	512;512	Q5T0N1-2;Q5T0N1	.;TTC18_HUMAN	G	512	ENSP00000310829:S512G;ENSP00000384479:S512G;ENSP00000378334:S512G	ENSP00000310829:S512G	S	-	1	0	TTC18	74728859	1.000000	0.71417	0.997000	0.53966	0.941000	0.58515	1.341000	0.33907	2.022000	0.59522	0.455000	0.32223	AGT	.	.		0.393	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
RGR	5995	hgsc.bcm.edu	37	10	86018358	86018358	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:86018358T>C	ENST00000359452.4	+	7	889	c.851T>C	c.(850-852)cTc>cCc	p.L284P	RGR_ENST00000358110.5_Missense_Mutation_p.L242P|RGR_ENST00000479725.1_3'UTR	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor	280					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						TGGCAGTGCCTCTCACCGCAG	0.607																																					p.L284P	NSCLC(15;204 545 5889 6385 32445)	Atlas-SNP	.											.	RGR	42	.	0			c.T851C						.						87.0	74.0	78.0					10																	86018358		2203	4300	6503	SO:0001583	missense	5995	exon7			AGTGCCTCTCACC	BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.851T>C	chr10.hg19:g.86018358T>C	ENSP00000352427:p.Leu284Pro	65.0	0.0		117.0	5.0	NM_002921	A6NKK7|Q96FC5	Missense_Mutation	SNP	ENST00000359452.4	hg19	CCDS7374.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.703835	0.88924	.	.	ENSG00000148604	ENST00000359452;ENST00000358110	T;T	0.51325	0.71;0.71	4.95	3.78	0.43462	.	0.143549	0.48286	D	0.000190	T	0.64283	0.2584	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.972	D;D;P	0.73380	0.969;0.98;0.786	T	0.66344	-0.5947	10	0.87932	D	0	.	10.3927	0.44181	0.0:0.0:0.164:0.8359	.	242;284;280	P47804-3;P47804-2;P47804	.;.;RGR_HUMAN	P	284;242	ENSP00000352427:L284P;ENSP00000350823:L242P	ENSP00000350823:L242P	L	+	2	0	RGR	86008338	1.000000	0.71417	0.007000	0.13788	0.730000	0.41778	5.271000	0.65553	0.939000	0.37446	0.533000	0.62120	CTC	.	.		0.607	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049116.1	NM_002921	
PTEN	5728	hgsc.bcm.edu	37	10	89653817	89653817	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:89653817G>A	ENST00000371953.3	+	2	1472	c.115G>A	c.(115-117)Gca>Aca	p.A39T		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	39	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(8)|p.Y27fs*1(2)|p.A39T(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGGATTTCCTGCAGAAAGACT	0.289		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.A39T		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,colon,carcinoma,-2,1	PTEN	3652	.	48	Whole gene deletion(37)|Unknown(8)|Deletion - Frameshift(2)|Substitution - Missense(1)	prostate(14)|central_nervous_system(9)|skin(8)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|ovary(3)|breast(2)|soft_tissue(1)|urinary_tract(1)|NS(1)|kidney(1)	c.G115A	GRCh37	CM083057	PTEN	M		.						111.0	111.0	111.0					10																	89653817		2203	4296	6499	SO:0001583	missense	5728	exon2	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	TTTCCTGCAGAAA	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.115G>A	chr10.hg19:g.89653817G>A	ENSP00000361021:p.Ala39Thr	66.0	1.0		88.0	4.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	G	35	5.510400	0.96386	.	.	ENSG00000171862	ENST00000371953	D	0.98567	-5.0	5.19	5.19	0.71726	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.98883	0.9622	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99624	1.0984	9	.	.	.	-9.7723	17.4682	0.87639	0.0:0.0:1.0:0.0	.	39	P60484	PTEN_HUMAN	T	39	ENSP00000361021:A39T	.	A	+	1	0	PTEN	89643797	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.022000	0.93678	2.421000	0.82119	0.655000	0.94253	GCA	.	.		0.289	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
MARCH5	54708	hgsc.bcm.edu	37	10	94109142	94109142	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:94109142A>G	ENST00000358935.2	+	4	738	c.406A>G	c.(406-408)Aga>Gga	p.R136G	MARCH5_ENST00000467521.2_3'UTR	NM_017824.4	NP_060294.1	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	136					negative regulation of cell aging (GO:0090344)|positive regulation of mitochondrial fission (GO:0090141)|protein autoubiquitination (GO:0051865)|protein localization to mitochondrion (GO:0070585)|protein polyubiquitination (GO:0000209)|regulation of mitochondrial fission (GO:0090140)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	GTPase binding (GO:0051020)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						TGTTATGGAGAGAGCTGATCC	0.383																																					p.R136G		Atlas-SNP	.											.	MARCH5	28	.	0			c.A406G						.						167.0	159.0	162.0					10																	94109142		2203	4300	6503	SO:0001583	missense	54708	exon4			ATGGAGAGAGCTG	BC015480	CCDS7420.1	10q23.32-q23.33	2013-01-09	2005-01-26	2005-01-27	ENSG00000198060	ENSG00000198060		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26025	protein-coding gene	gene with protein product		610637	"""ring finger protein 153"""	RNF153		14722266	Standard	XM_005269923		Approved	FLJ20445, MARCH-V	uc001khx.1	Q9NX47	OTTHUMG00000018757	ENST00000358935.2:c.406A>G	chr10.hg19:g.94109142A>G	ENSP00000351813:p.Arg136Gly	87.0	0.0		97.0	4.0	NM_017824		Missense_Mutation	SNP	ENST00000358935.2	hg19	CCDS7420.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.538717	0.45176	.	.	ENSG00000198060	ENST00000358935	T	0.46063	0.88	5.93	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.36441	0.0967	L	0.47716	1.5	0.58432	D	0.999995	B	0.09022	0.002	B	0.10450	0.005	T	0.09930	-1.0652	10	0.34782	T	0.22	-13.2259	11.9167	0.52769	0.7128:0.2872:0.0:0.0	.	136	Q9NX47	MARH5_HUMAN	G	136	ENSP00000351813:R136G	ENSP00000351813:R136G	R	+	1	2	MARCH5	94099122	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.841000	0.55850	1.053000	0.40415	0.482000	0.46254	AGA	.	.		0.383	MARCH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049388.1	NM_017824	
SMC3	9126	hgsc.bcm.edu	37	10	112338437	112338437	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:112338437T>C	ENST00000361804.4	+	7	528	c.402T>C	c.(400-402)aaT>aaC	p.N134N	SMC3_ENST00000462899.1_3'UTR|snoU13_ENST00000458966.1_RNA	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	134					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CTCGAAGCAATCCTTATTATA	0.303																																					p.N134N		Atlas-SNP	.											.	SMC3	103	.	0			c.T402C						.						95.0	91.0	92.0					10																	112338437		2203	4300	6503	SO:0001819	synonymous_variant	9126	exon7			AAGCAATCCTTAT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.402T>C	chr10.hg19:g.112338437T>C		51.0	0.0		55.0	4.0	NM_005445	A8K156|O60464|Q5T482	Silent	SNP	ENST00000361804.4	hg19	CCDS31285.1																																																																																			.	.		0.303	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
PLEKHS1	79949	hgsc.bcm.edu	37	10	115515016	115515016	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:115515016A>G	ENST00000361048.1	+	2	308		c.e2-1		PLEKHS1_ENST00000369312.4_Splice_Site	NM_024889.4	NP_079165.3	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1																		TCCTTTTGACAGGGGAGGACA	0.483																																					.		Atlas-SNP	.											.	PLEKHS1	19	.	0			.						.						112.0	103.0	106.0					10																	115515016		2203	4300	6503	SO:0001630	splice_region_variant	79949	.			TTTGACAGGGGAG	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000361048.1:c.-19-1A>G	chr10.hg19:g.115515016A>G		64.0	0.0		65.0	4.0	.	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Splice_Site	SNP	ENST00000361048.1	hg19	CCDS7583.1																																																																																			.	.		0.483	PLEKHS1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_024889	Intron
FAM160B1	57700	hgsc.bcm.edu	37	10	116605202	116605202	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:116605202T>C	ENST00000369248.4	+	8	1425	c.1090T>C	c.(1090-1092)Ttt>Ctt	p.F364L	FAM160B1_ENST00000369250.3_Missense_Mutation_p.F364L	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	364										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						TCTTTCCTGGTTTGATTATTG	0.308																																					p.F364L		Atlas-SNP	.											.	FAM160B1	107	.	0			c.T1090C						.						114.0	106.0	109.0					10																	116605202		2203	4300	6503	SO:0001583	missense	57700	exon8			TCCTGGTTTGATT	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1090T>C	chr10.hg19:g.116605202T>C	ENSP00000358251:p.Phe364Leu	78.0	0.0		80.0	4.0	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	hg19	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638410	0.29157	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.19669	2.13;2.13	5.43	5.43	0.79202	.	0.049336	0.85682	D	0.000000	T	0.09247	0.0228	N	0.03253	-0.375	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.15052	0.012;0.003	T	0.11991	-1.0565	10	0.02654	T	1	-29.9027	15.7673	0.78138	0.0:0.0:0.0:1.0	.	364;364	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	L	364	ENSP00000358251:F364L;ENSP00000358253:F364L	ENSP00000358251:F364L	F	+	1	0	FAM160B1	116595192	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.768000	0.62293	2.186000	0.69663	0.450000	0.29827	TTT	.	.		0.308	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
HMX2	3167	hgsc.bcm.edu	37	10	124909334	124909334	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:124909334T>C	ENST00000339992.3	+	2	774	c.517T>C	c.(517-519)Tac>Cac	p.Y173H		NM_005519.1	NP_005510.1	A2RU54	HMX2_HUMAN	H6 family homeobox 2	173					brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|lung(4)|prostate(1)	7		all_neural(114;0.169)|Colorectal(57;0.207)|Glioma(114;0.222)		Colorectal(40;0.123)|COAD - Colon adenocarcinoma(40;0.141)		CATGAAGCGCTACCTGAGCAG	0.652																																					p.Y173H		Atlas-SNP	.											.	HMX2	21	.	0			c.T517C						.						19.0	20.0	20.0					10																	124909334		2188	4261	6449	SO:0001583	missense	3167	exon2			AAGCGCTACCTGA		CCDS31305.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188816	ENSG00000188816		"""Homeoboxes / ANTP class : NKL subclass"""	5018	protein-coding gene	gene with protein product		600647	"""homeo box (H6 family) 2"""			7647458	Standard	XM_005269743		Approved	NKX5-2	uc001lhc.1	A2RU54	OTTHUMG00000019198	ENST00000339992.3:c.517T>C	chr10.hg19:g.124909334T>C	ENSP00000341108:p.Tyr173His	66.0	0.0		82.0	37.0	NM_005519	B2RNV5	Missense_Mutation	SNP	ENST00000339992.3	hg19	CCDS31305.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.722846	0.89298	.	.	ENSG00000188816	ENST00000339992	D	0.97328	-4.34	5.3	5.3	0.74995	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98645	0.9546	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99787	1.1030	10	0.87932	D	0	.	15.4082	0.74897	0.0:0.0:0.0:1.0	.	173	A2RU54	HMX2_HUMAN	H	173	ENSP00000341108:Y173H	ENSP00000341108:Y173H	Y	+	1	0	HMX2	124899324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.780000	0.85658	2.212000	0.71576	0.533000	0.62120	TAC	.	.		0.652	HMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050841.1	XM_370580	
AP2A2	161	hgsc.bcm.edu	37	11	992671	992671	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:992671A>T	ENST00000448903.2	+	11	1579	c.1438A>T	c.(1438-1440)Aag>Tag	p.K480*	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Nonsense_Mutation_p.K481*	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	480					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTACGCGGCCAAGACTGTGTT	0.577																																					p.K481X		Atlas-SNP	.											.	AP2A2	50	.	0			c.A1441T						.						94.0	92.0	93.0					11																	992671		2173	4253	6426	SO:0001587	stop_gained	161	exon11			GCGGCCAAGACTG	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1438A>T	chr11.hg19:g.992671A>T	ENSP00000413234:p.Lys480*	118.0	0.0		155.0	65.0	NM_001242837	O75403|Q53ET1|Q96SI8	Nonsense_Mutation	SNP	ENST00000448903.2	hg19	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	A	38	7.273358	0.98179	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	.	.	.	3.5	3.5	0.40072	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.4067	12.7311	0.57199	1.0:0.0:0.0:0.0	.	.	.	.	X	480;481;481;217;220	.	ENSP00000327694:K481X	K	+	1	0	AP2A2	982671	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.190000	0.94934	1.560000	0.49568	0.379000	0.24179	AAG	.	.		0.577	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305	
OR51I2	390064	hgsc.bcm.edu	37	11	5475431	5475431	+	Missense_Mutation	SNP	T	T	A	rs199654892|rs35301588	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:5475431T>A	ENST00000341449.2	+	1	794	c.713T>A	c.(712-714)cTc>cAc	p.L238H	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	238					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCAAAGCTCTCAACACATGT	0.498																																					p.L238H		Atlas-SNP	.											.	OR51I2	76	.	0			c.T713A						.						282.0	237.0	252.0					11																	5475431		2201	4297	6498	SO:0001583	missense	390064	exon1			AAGCTCTCAACAC	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.713T>A	chr11.hg19:g.5475431T>A	ENSP00000341987:p.Leu238His	206.0	0.0		230.0	14.0	NM_001004754	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	hg19	CCDS31383.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.594810	0.46318	.	.	ENSG00000187918	ENST00000341449	T	0.00207	8.55	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.110868	0.40908	D	0.000997	T	0.00875	0.0029	H	0.95574	3.69	0.31649	N	0.647016	D	0.76494	0.999	D	0.66847	0.947	T	0.03325	-1.1048	10	0.87932	D	0	.	14.7227	0.69320	0.0:0.0:0.0:1.0	.	238	Q9H344	O51I2_HUMAN	H	238	ENSP00000341987:L238H	ENSP00000341987:L238H	L	+	2	0	OR51I2	5432007	0.880000	0.30214	1.000000	0.80357	0.415000	0.31203	5.792000	0.69052	2.343000	0.79666	0.533000	0.62120	CTC	.	.		0.498	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
LDHA	3939	hgsc.bcm.edu	37	11	18425285	18425285	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:18425285A>G	ENST00000422447.3	+	6	910	c.637A>G	c.(637-639)Act>Gct	p.T213A	LDHA_ENST00000227157.4_Missense_Mutation_p.T213A|LDHA_ENST00000540430.1_Missense_Mutation_p.T242A|LDHA_ENST00000430553.2_Missense_Mutation_p.T155A|AC084117.3_ENST00000496975.2_RNA|LDHA_ENST00000542179.1_Missense_Mutation_p.T213A|LDHA_ENST00000379412.5_Missense_Mutation_p.T213A|LDHA_ENST00000396222.2_Missense_Mutation_p.T213A	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	213					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)			central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						CTCTCTGAAGACTCTGCACCC	0.388																																					p.T242A		Atlas-SNP	.											.	LDHA	118	.	0			c.A724G						.						147.0	141.0	143.0					11																	18425285		2199	4293	6492	SO:0001583	missense	3939	exon6			CTGAAGACTCTGC	X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.637A>G	chr11.hg19:g.18425285A>G	ENSP00000395337:p.Thr213Ala	64.0	0.0		68.0	5.0	NM_001165414	B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Missense_Mutation	SNP	ENST00000422447.3	hg19	CCDS7839.1	.	.	.	.	.	.	.	.	.	.	A	10.22	1.289613	0.23478	.	.	ENSG00000134333	ENST00000422447;ENST00000430553;ENST00000396222;ENST00000541620;ENST00000445376;ENST00000227157;ENST00000540430;ENST00000379412;ENST00000542179	T;T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01;0.01	5.34	2.93	0.34026	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.646731	0.16302	N	0.220393	T	0.39489	0.1080	N	0.25144	0.715	0.20926	N	0.999825	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.002;0.002;0.0;0.0	T	0.18053	-1.0349	10	0.29301	T	0.29	-0.0884	0.9978	0.01470	0.4256:0.1542:0.1021:0.318	.	242;155;186;213;213	B7Z5E3;B4DKQ2;B4DJI1;F8W819;P00338	.;.;.;.;LDHA_HUMAN	A	213;155;213;185;186;213;242;213;213	ENSP00000395337:T213A;ENSP00000406172:T155A;ENSP00000379524:T213A;ENSP00000227157:T213A;ENSP00000445175:T242A;ENSP00000368722:T213A;ENSP00000445331:T213A	ENSP00000227157:T213A	T	+	1	0	LDHA	18381861	0.508000	0.26154	0.998000	0.56505	0.986000	0.74619	1.005000	0.29834	0.371000	0.24564	0.477000	0.44152	ACT	.	.		0.388	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258172.2	NM_005566	
SYT13	57586	hgsc.bcm.edu	37	11	45307751	45307751	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:45307751A>G	ENST00000020926.3	-	1	119	c.8T>C	c.(7-9)cTg>cCg	p.L3P		NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	3					vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)				breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						AGGCACCGACAGCACCATGGT	0.741																																					p.L3P		Atlas-SNP	.											.	SYT13	45	.	0			c.T8C						.						9.0	8.0	8.0					11																	45307751		2156	4212	6368	SO:0001583	missense	57586	exon1			ACCGACAGCACCA	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.8T>C	chr11.hg19:g.45307751A>G	ENSP00000020926:p.Leu3Pro	24.0	0.0		61.0	4.0	NM_020826	A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	ENST00000020926.3	hg19	CCDS31470.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.792786	0.70452	.	.	ENSG00000019505	ENST00000020926	T	0.11169	2.8	3.75	3.75	0.43078	.	0.000000	0.41605	U	0.000855	T	0.15652	0.0377	N	0.14661	0.345	0.58432	D	0.999997	D	0.71674	0.998	D	0.79784	0.993	T	0.05649	-1.0872	10	0.87932	D	0	.	9.9836	0.41828	1.0:0.0:0.0:0.0	.	3	Q7L8C5	SYT13_HUMAN	P	3	ENSP00000020926:L3P	ENSP00000020926:L3P	L	-	2	0	SYT13	45264327	0.968000	0.33430	0.999000	0.59377	0.853000	0.48598	2.281000	0.43452	1.333000	0.45449	0.254000	0.18369	CTG	.	.		0.741	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826	
CKAP5	9793	hgsc.bcm.edu	37	11	46819406	46819406	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:46819406A>G	ENST00000529230.1	-	11	1333	c.1287T>C	c.(1285-1287)gcT>gcC	p.A429A	CKAP5_ENST00000415402.1_Silent_p.A429A|CKAP5_ENST00000312055.5_Silent_p.A429A|CKAP5_ENST00000354558.3_Silent_p.A429A|CKAP5_ENST00000532321.1_5'UTR			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	429					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GCAGGGTAGAAGCAGTGCAGT	0.413																																					p.A429A	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											.	CKAP5	134	.	0			c.T1287C						.						155.0	154.0	155.0					11																	46819406		2201	4299	6500	SO:0001819	synonymous_variant	9793	exon11			GGTAGAAGCAGTG		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1287T>C	chr11.hg19:g.46819406A>G		69.0	0.0		100.0	4.0	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	hg19	CCDS31477.1																																																																																			.	.		0.413	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
FNBP4	23360	hgsc.bcm.edu	37	11	47788670	47788670	+	Silent	SNP	G	G	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:47788670G>C	ENST00000263773.5	-	1	183	c.171C>G	c.(169-171)acC>acG	p.T57T	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	57						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CCGCGGTGGTGGTGGTCGTCG	0.751																																					p.T57T		Atlas-SNP	.											.	FNBP4	99	.	0			c.C171G						.																																			SO:0001819	synonymous_variant	23360	exon1			GGTGGTGGTGGTC	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.171C>G	chr11.hg19:g.47788670G>C		0.0	0.0		7.0	5.0	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	ENST00000263773.5	hg19	CCDS41644.1																																																																																			.	.		0.751	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
OR5L1	219437	hgsc.bcm.edu	37	11	55579735	55579736	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:55579735_55579736GG>TT	ENST00000333973.2	+	1	882_883	c.793_794GG>TT	c.(793-795)GGc>TTc	p.G265F		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				GCCCAGTTCAGGCAATAGTGGA	0.485																																					p.G265C|p.G265V		Atlas-SNP	.											.	OR5L1	145	.	0			c.G793T|c.G794T						.																																			SO:0001583	missense	219437	exon1			AGTTCAGGCAATA|GTTCAGGCAATAG	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	Exception_encountered	chr11.hg19:g.55579735_55579736delinsTT	ENSP00000335529:p.Gly265Phe	58.0|60.0	0.0		82.0	34.0	NM_001004738	B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	hg19	CCDS31509.1																																																																																			.	.		0.485	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
MS4A6A	64231	hgsc.bcm.edu	37	11	59947440	59947440	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:59947440T>C	ENST00000530839.1	-	4	640		c.e4-2		MS4A6A_ENST00000532169.1_Splice_Site|MS4A6A_ENST00000529054.1_Splice_Site|MS4A6A_ENST00000529906.1_5'Flank|MS4A6A_ENST00000426738.2_Intron|MS4A6A_ENST00000528851.1_Splice_Site|MS4A6A_ENST00000420732.2_Splice_Site|MS4A6A_ENST00000323961.3_Splice_Site|MS4A6A_ENST00000533023.1_Intron|MS4A6A_ENST00000412309.2_Splice_Site	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A							integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTGGATAGTCTGTGGGAAGAG	0.453																																					.		Atlas-SNP	.											.	MS4A6A	85	.	0			c.148-2A>G						.						86.0	80.0	82.0					11																	59947440		2201	4295	6496	SO:0001630	splice_region_variant	64231	exon4			ATAGTCTGTGGGA	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.148-2A>G	chr11.hg19:g.59947440T>C		88.0	0.0		89.0	4.0	NM_152851	A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Splice_Site	SNP	ENST00000530839.1	hg19	CCDS7981.1	.	.	.	.	.	.	.	.	.	.	T	6.404	0.442636	0.12164	.	.	ENSG00000110077	ENST00000323961;ENST00000528851;ENST00000420732;ENST00000530839;ENST00000529054;ENST00000412309;ENST00000532169;ENST00000534596	.	.	.	4.28	4.28	0.50868	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0387	0.42144	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MS4A6A	59704016	0.999000	0.42202	0.488000	0.27440	0.261000	0.26267	3.223000	0.51231	1.926000	0.55796	0.529000	0.55759	.	.	.		0.453	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1		Intron
INCENP	3619	hgsc.bcm.edu	37	11	61906200	61906200	+	Silent	SNP	A	A	G	rs150865728|rs34042792		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:61906200A>G	ENST00000394818.3	+	6	1333	c.1131A>G	c.(1129-1131)gaA>gaG	p.E377E	INCENP_ENST00000278849.4_Silent_p.E377E	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	377					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGCAGAAGGAACCCCCCGAGG	0.627																																					p.E377E		Atlas-SNP	.											.	INCENP	122	.	0			c.A1131G						.	A	,	1,4403	2.1+/-5.4	0,1,2201	50.0	54.0	52.0		1131,1131	-1.8	0.0	11	dbSNP_134	52	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	INCENP	NM_001040694.1,NM_020238.2	,	0,1,6500	GG,GA,AA		0.0,0.0227,0.0077	,	377/919,377/915	61906200	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	3619	exon6			GAAGGAACCCCCC	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1131A>G	chr11.hg19:g.61906200A>G		34.0	0.0		40.0	4.0	NM_001040694	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	hg19	CCDS44624.1																																																																																			.	A|1.000;G|0.000		0.627	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
NUDT22	84304	hgsc.bcm.edu	37	11	63994260	63994260	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:63994260G>A	ENST00000279206.3	+	2	292	c.136G>A	c.(136-138)Gag>Aag	p.E46K	TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000394547.3_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA|TRPT1_ENST00000317459.6_5'Flank|TRPT1_ENST00000546133.1_5'Flank|TRPT1_ENST00000541278.1_5'Flank|TRPT1_ENST00000394546.2_5'Flank|TRPT1_ENST00000546089.1_5'Flank|NUDT22_ENST00000441250.2_Missense_Mutation_p.E46K	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	46							hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						TGCCATCTGGGAGACCCGGCT	0.692																																					p.E46K		Atlas-SNP	.											.	NUDT22	24	.	0			c.G136A						.						52.0	52.0	52.0					11																	63994260		2201	4297	6498	SO:0001583	missense	84304	exon2			ATCTGGGAGACCC	BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.136G>A	chr11.hg19:g.63994260G>A	ENSP00000279206:p.Glu46Lys	78.0	0.0		93.0	4.0	NM_001128613	C9JY06|Q71RD5	Missense_Mutation	SNP	ENST00000279206.3	hg19	CCDS8061.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211742	0.58452	.	.	ENSG00000149761	ENST00000539325;ENST00000279206;ENST00000441250;ENST00000428347;ENST00000536237	T;T;T;T	0.44482	0.92;2.26;2.25;1.5	4.55	4.55	0.56014	.	0.292060	0.38005	N	0.001853	T	0.32852	0.0843	L	0.36672	1.1	0.41193	D	0.986318	B;B;B	0.25955	0.138;0.012;0.034	B;B;B	0.24701	0.055;0.009;0.019	T	0.10132	-1.0643	10	0.29301	T	0.29	-12.6074	13.0094	0.58724	0.0:0.1638:0.8362:0.0	.	46;46;46	Q9BRQ3-2;C9JY06;Q9BRQ3	.;.;NUD22_HUMAN	K	46	ENSP00000444022:E46K;ENSP00000279206:E46K;ENSP00000407970:E46K;ENSP00000401085:E46K	ENSP00000279206:E46K	E	+	1	0	NUDT22	63750836	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.152000	0.42272	2.528000	0.85240	0.491000	0.48974	GAG	.	.		0.692	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396304.2	NM_032344	
SART1	9092	hgsc.bcm.edu	37	11	65745300	65745300	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:65745300A>G	ENST00000312397.5	+	17	2194	c.2102A>G	c.(2101-2103)aAg>aGg	p.K701R		NM_005146.4	NP_005137.1	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T cells	701					cell cycle arrest (GO:0007050)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of cytotoxic T cell differentiation (GO:0045585)|spliceosomal snRNP assembly (GO:0000387)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TTCAAGGAGAAGGACGGCTAC	0.587																																					p.K701R		Atlas-SNP	.											.	SART1	41	.	0			c.A2102G						.						93.0	79.0	83.0					11																	65745300		2201	4296	6497	SO:0001583	missense	9092	exon17			AGGAGAAGGACGG	AB006198	CCDS31611.1	11q13.1	2009-01-06	2006-12-07		ENSG00000175467	ENSG00000175467			10538	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 110kDa (U4/U6.U5)"""	605941	"""squamous cell carcinoma antigen recognised by T cells"""			9449708	Standard	NM_005146		Approved	Ara1, Snu66, SNRNP110	uc001ogl.3	O43290	OTTHUMG00000166771	ENST00000312397.5:c.2102A>G	chr11.hg19:g.65745300A>G	ENSP00000310448:p.Lys701Arg	72.0	0.0		82.0	4.0	NM_005146	A6NDN1|Q53GB5	Missense_Mutation	SNP	ENST00000312397.5	hg19	CCDS31611.1	.	.	.	.	.	.	.	.	.	.	A	18.71	3.682236	0.68042	.	.	ENSG00000175467	ENST00000312397;ENST00000542816	T	0.27104	1.69	4.96	4.96	0.65561	.	0.123932	0.52532	D	0.000077	T	0.45316	0.1336	L	0.55481	1.735	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.43081	-0.9413	10	0.87932	D	0	-41.6454	12.5837	0.56406	1.0:0.0:0.0:0.0	.	701	O43290	SNUT1_HUMAN	R	701;543	ENSP00000310448:K701R	ENSP00000310448:K701R	K	+	2	0	SART1	65501876	1.000000	0.71417	0.998000	0.56505	0.128000	0.20619	8.686000	0.91250	1.869000	0.54173	0.402000	0.26972	AAG	.	.		0.587	SART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391409.1		
GSTP1	2950	hgsc.bcm.edu	37	11	67352159	67352159	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:67352159T>C	ENST00000398606.3	+	4	397	c.148T>C	c.(148-150)Tac>Cac	p.Y50H	GSTP1_ENST00000398603.1_Missense_Mutation_p.Y50H|GSTP1_ENST00000498765.1_3'UTR	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	50	GST N-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	CCAACAGCTATACGGGCAGCT	0.642																																					p.Y50H		Atlas-SNP	.											.	GSTP1	21	.	0			c.T148C						.						89.0	101.0	97.0					11																	67352159		2020	4163	6183	SO:0001583	missense	2950	exon4			CAGCTATACGGGC	U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.148T>C	chr11.hg19:g.67352159T>C	ENSP00000381607:p.Tyr50His	92.0	0.0		116.0	48.0	NM_000852	O00460|Q15690|Q5TZY3	Missense_Mutation	SNP	ENST00000398606.3	hg19	CCDS41679.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.659769	0.47572	.	.	ENSG00000084207	ENST00000398606;ENST00000398603	T;T	0.06528	3.29;3.29	5.65	3.22	0.36961	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.440715	0.20425	N	0.092595	T	0.19167	0.0460	M	0.78916	2.43	0.25396	N	0.988486	D	0.55172	0.97	D	0.64237	0.923	T	0.16100	-1.0414	9	0.87932	D	0	-11.2425	6.068	0.19873	0.0:0.0853:0.1624:0.7523	.	50	P09211	GSTP1_HUMAN	H	50	ENSP00000381607:Y50H;ENSP00000381604:Y50H	ENSP00000381604:Y50H	Y	+	1	0	GSTP1	67108735	0.999000	0.42202	0.309000	0.25155	0.033000	0.12548	3.847000	0.55895	0.971000	0.38288	0.529000	0.55759	TAC	.	.		0.642	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852	
CHKA	1119	hgsc.bcm.edu	37	11	67821492	67821492	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:67821492T>C	ENST00000265689.4	-	12	1363	c.1337A>G	c.(1336-1338)gAt>gGt	p.D446G	CHKA_ENST00000533728.1_5'UTR|RP11-802E16.3_ENST00000534517.1_RNA|RP11-802E16.3_ENST00000526897.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA|CHKA_ENST00000356135.5_Missense_Mutation_p.D428G	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	446					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	GAAATAGGCATCAAACCTTGC	0.587																																					p.D446G		Atlas-SNP	.											.	CHKA	41	.	0			c.A1337G						.						130.0	98.0	109.0					11																	67821492		2200	4294	6494	SO:0001583	missense	1119	exon12			TAGGCATCAAACC	D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.1337A>G	chr11.hg19:g.67821492T>C	ENSP00000265689:p.Asp446Gly	69.0	0.0		82.0	4.0	NM_001277	Q8NE29	Missense_Mutation	SNP	ENST00000265689.4	hg19	CCDS8178.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855347	0.51376	.	.	ENSG00000110721	ENST00000265689;ENST00000356135	T;T	0.58652	0.32;0.32	4.76	4.76	0.60689	Protein kinase-like domain (1);	0.272209	0.34676	N	0.003772	T	0.63498	0.2516	L	0.49126	1.545	0.58432	D	0.999999	P;B	0.34955	0.477;0.419	P;P	0.49752	0.621;0.455	T	0.58358	-0.7650	10	0.19590	T	0.45	-15.1956	14.4096	0.67106	0.0:0.0:0.0:1.0	.	428;446	P35790-2;P35790	.;CHKA_HUMAN	G	446;428	ENSP00000265689:D446G;ENSP00000348454:D428G	ENSP00000265689:D446G	D	-	2	0	CHKA	67578068	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.335000	0.72949	1.993000	0.58246	0.379000	0.24179	GAT	.	.		0.587	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394570.1	NM_001277	
KRTAP5-10	387273	hgsc.bcm.edu	37	11	71277087	71277087	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:71277087T>G	ENST00000398531.1	+	1	479	c.454T>G	c.(454-456)Tca>Gca	p.S152A	KRTAP5-10_ENST00000376536.4_Missense_Mutation_p.S104A	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	152	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						ctgctgctcctcaggctgtgg	0.632																																					p.S152A		Atlas-SNP	.											.	KRTAP5-10	37	.	0			c.T454G						.						87.0	106.0	99.0					11																	71277087		2200	4293	6493	SO:0001583	missense	387273	exon1			TGCTCCTCAGGCT	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.454T>G	chr11.hg19:g.71277087T>G	ENSP00000381542:p.Ser152Ala	157.0	0.0		145.0	51.0	NM_001012710	B9EHA4	Missense_Mutation	SNP	ENST00000398531.1	hg19	CCDS41684.1	.	.	.	.	.	.	.	.	.	.	.	5.031	0.191477	0.09547	.	.	ENSG00000204572	ENST00000398531;ENST00000376536	T;T	0.01133	5.29;5.59	1.13	-0.0925	0.13656	.	.	.	.	.	T	0.01695	0.0054	M	0.69823	2.125	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.40270	-0.9572	9	0.48119	T	0.1	.	4.4099	0.11427	0.0:0.2215:0.0:0.7785	.	152	Q6L8G5	KR510_HUMAN	A	152;104	ENSP00000381542:S152A;ENSP00000365719:S104A	ENSP00000365719:S104A	S	+	1	0	KRTAP5-10	70954735	0.040000	0.19996	0.001000	0.08648	0.067000	0.16453	0.110000	0.15437	-0.020000	0.14032	0.260000	0.18958	TCA	.	.		0.632	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
ARHGEF17	9828	hgsc.bcm.edu	37	11	73020389	73020389	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:73020389A>T	ENST00000263674.3	+	1	1056	c.706A>T	c.(706-708)Atc>Ttc	p.I236F	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	236					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CTCCTCCTCCATCGCCGCCTC	0.677																																					p.I236F		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.A706T						.						12.0	15.0	14.0					11																	73020389		2048	3983	6031	SO:0001583	missense	9828	exon1			TCCTCCATCGCCG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.706A>T	chr11.hg19:g.73020389A>T	ENSP00000263674:p.Ile236Phe	160.0	0.0		226.0	14.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.870463	0.33069	.	.	ENSG00000110237	ENST00000263674	T	0.59638	0.25	4.61	0.695	0.18070	.	0.993735	0.08148	N	0.990484	T	0.35480	0.0933	N	0.24115	0.695	0.19775	N	0.999951	P	0.35982	0.531	B	0.24394	0.053	T	0.25117	-1.0141	10	0.54805	T	0.06	-1.1385	5.2264	0.15397	0.6445:0.1573:0.1981:0.0	.	236	Q96PE2	ARHGH_HUMAN	F	236	ENSP00000263674:I236F	ENSP00000263674:I236F	I	+	1	0	ARHGEF17	72698037	0.000000	0.05858	0.765000	0.31456	0.926000	0.56050	-0.104000	0.10923	0.647000	0.30713	0.379000	0.24179	ATC	.	.		0.677	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
C2CD3	26005	hgsc.bcm.edu	37	11	73785299	73785299	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:73785299T>C	ENST00000334126.7	-	24	5176	c.4950A>G	c.(4948-4950)aaA>aaG	p.K1650K	C2CD3_ENST00000313663.7_Splice_Site_p.K1650K			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1650	C2 2.				brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AGAGCATACCTTTCAAGCTCA	0.483																																					p.K1650K		Atlas-SNP	.											.	C2CD3	288	.	0			c.A4950G						.						85.0	70.0	75.0					11																	73785299		2200	4293	6493	SO:0001630	splice_region_variant	26005	exon24			CATACCTTTCAAG	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.4951+1A>G	chr11.hg19:g.73785299T>C		89.0	0.0		100.0	4.0	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Silent	SNP	ENST00000334126.7	hg19																																																																																				.	.		0.483	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	Silent
C11orf30	56946	hgsc.bcm.edu	37	11	76227256	76227256	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:76227256T>C	ENST00000529032.1	+	10	1584	c.1584T>C	c.(1582-1584)gcT>gcC	p.A528A	C11orf30_ENST00000525919.1_Silent_p.A529A|C11orf30_ENST00000533248.1_Silent_p.A542A|C11orf30_ENST00000334736.3_Silent_p.A528A|C11orf30_ENST00000524767.1_Silent_p.A543A|C11orf30_ENST00000524490.1_Silent_p.A444A|C11orf30_ENST00000525038.1_Silent_p.A543A|C11orf30_ENST00000343878.3_Silent_p.A528A			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	528	Thr-rich.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						CCCCTGGAGCTGCAACCTATG	0.463																																					p.A528A		Atlas-SNP	.											.	C11orf30	123	.	0			c.T1584C						.						119.0	114.0	116.0					11																	76227256		2200	4292	6492	SO:0001819	synonymous_variant	56946	exon11			TGGAGCTGCAACC	AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1584T>C	chr11.hg19:g.76227256T>C		68.0	0.0		95.0	4.0	NM_020193	B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Silent	SNP	ENST00000529032.1	hg19	CCDS8244.1																																																																																			.	.		0.463	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383288.2	NM_020193	
PAK1	5058	hgsc.bcm.edu	37	11	77090324	77090324	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:77090324T>C	ENST00000356341.3	-	4	932	c.401A>G	c.(400-402)aAg>aGg	p.K134R	PAK1_ENST00000528203.1_Missense_Mutation_p.K36R|PAK1_ENST00000278568.4_Missense_Mutation_p.K134R|PAK1_ENST00000530617.1_Missense_Mutation_p.K134R	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	134	Autoregulatory region.|Interaction with CRIPAK.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					GGATGTCTTCTTCGAGTTGTA	0.478																																					p.K134R		Atlas-SNP	.											.	PAK1	89	.	0			c.A401G						.						184.0	183.0	183.0					11																	77090324		2200	4292	6492	SO:0001583	missense	5058	exon4			GTCTTCTTCGAGT	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.401A>G	chr11.hg19:g.77090324T>C	ENSP00000348696:p.Lys134Arg	59.0	0.0		112.0	5.0	NM_001128620	O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	ENST00000356341.3	hg19	CCDS8250.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.626498	0.66901	.	.	ENSG00000149269	ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203	T;T;T;T	0.71817	-0.54;-0.57;-0.57;-0.6	5.32	5.32	0.75619	.	0.041769	0.85682	D	0.000000	T	0.64371	0.2592	M	0.64997	1.995	0.58432	D	0.999996	P;B;B;B	0.37781	0.608;0.004;0.017;0.03	B;B;B;B	0.27380	0.079;0.003;0.015;0.021	T	0.66180	-0.5988	10	0.33940	T	0.23	.	15.5743	0.76362	0.0:0.0:0.0:1.0	.	36;134;134;134	E9PM17;B3KNX7;Q13153;Q13153-2	.;.;PAK1_HUMAN;.	R	134;134;134;36	ENSP00000348696:K134R;ENSP00000433423:K134R;ENSP00000278568:K134R;ENSP00000433211:K36R	ENSP00000278568:K134R	K	-	2	0	PAK1	76767972	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.698000	0.84413	2.139000	0.66308	0.460000	0.39030	AAG	.	.		0.478	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576	
PCF11	51585	hgsc.bcm.edu	37	11	82872485	82872485	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:82872485G>A	ENST00000298281.4	+	2	761	c.309G>A	c.(307-309)gtG>gtA	p.V103V		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	103	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TTATTTGTGTGTTTGAAAAGG	0.308																																					p.V103V		Atlas-SNP	.											.	PCF11	220	.	0			c.G309A						.						81.0	74.0	76.0					11																	82872485		1805	4067	5872	SO:0001819	synonymous_variant	51585	exon2			TTGTGTGTTTGAA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.309G>A	chr11.hg19:g.82872485G>A		66.0	0.0		87.0	5.0	NM_015885	A6H8W7|O43671|Q6P0X8	Silent	SNP	ENST00000298281.4	hg19	CCDS44689.1																																																																																			.	.		0.308	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
TMEM126A	84233	hgsc.bcm.edu	37	11	85365266	85365266	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:85365266T>C	ENST00000304511.2	+	3	355	c.246T>C	c.(244-246)acT>acC	p.T82T	TMEM126A_ENST00000528105.1_Silent_p.T12T|TMEM126A_ENST00000532180.1_Silent_p.T12T	NM_032273.3	NP_115649.1	Q9H061	T126A_HUMAN	transmembrane protein 126A	82					optic nerve development (GO:0021554)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(1)	7		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CAGACTTAACTTACAGATGTT	0.378																																					p.T82T		Atlas-SNP	.											.	TMEM126A	20	.	0			c.T246C						.						128.0	121.0	123.0					11																	85365266		2203	4299	6502	SO:0001819	synonymous_variant	84233	exon3			CTTAACTTACAGA		CCDS8268.1, CCDS58165.1	11q14.1	2011-03-25			ENSG00000171202	ENSG00000171202			25382	protein-coding gene	gene with protein product		612988				11230166	Standard	NM_032273		Approved	DKFZp586C1924, OPA7	uc001par.3	Q9H061	OTTHUMG00000166975	ENST00000304511.2:c.246T>C	chr11.hg19:g.85365266T>C		64.0	0.0		61.0	4.0	NM_032273	B2R570|E9PI16	Silent	SNP	ENST00000304511.2	hg19	CCDS8268.1																																																																																			.	.		0.378	TMEM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392177.1	NM_032273	
CCDC83	220047	hgsc.bcm.edu	37	11	85627242	85627242	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:85627242A>G	ENST00000342404.3	+	10	1262	c.1046A>G	c.(1045-1047)aAg>aGg	p.K349R	RP11-90K17.2_ENST00000531414.1_RNA|CCDC83_ENST00000280245.4_Missense_Mutation_p.K380R|CCDC83_ENST00000376067.1_Missense_Mutation_p.K249R			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	349										breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ACTGATATGAAGTACTTACTA	0.343																																					p.K380R		Atlas-SNP	.											.	CCDC83	48	.	0			c.A1139G						.						119.0	128.0	125.0					11																	85627242		2202	4299	6501	SO:0001583	missense	220047	exon11			ATATGAAGTACTT	AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.1046A>G	chr11.hg19:g.85627242A>G	ENSP00000344512:p.Lys349Arg	91.0	0.0		62.0	4.0	NM_173556	B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Missense_Mutation	SNP	ENST00000342404.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.978|8.978	0.974696|0.974696	0.18736|0.18736	.|.	.|.	ENSG00000150676|ENSG00000150676	ENST00000280245;ENST00000376067;ENST00000342404|ENST00000526729	T;T;T|.	0.44482|.	0.92;0.92;0.92|.	5.02|5.02	3.85|3.85	0.44370|0.44370	.|.	0.587434|.	0.17323|.	N|.	0.178424|.	T|T	0.49098|0.49098	0.1537|0.1537	M|M	0.70595|0.70595	2.14|2.14	0.09310|0.09310	N|N	1|1	P;P;P|.	0.47910|.	0.782;0.822;0.902|.	B;B;B|.	0.38458|.	0.274;0.268;0.268|.	T|T	0.40757|0.40757	-0.9546|-0.9546	9|5	.|.	.|.	.|.	-24.4625|-24.4625	7.6134|7.6134	0.28144|0.28144	0.9017:0.0:0.0983:0.0|0.9017:0.0:0.0983:0.0	.|.	249;349;380|.	Q8IWF9-3;Q8IWF9;Q8IWF9-2|.	.;CCD83_HUMAN;.|.	R|G	380;249;349|254	ENSP00000280245:K380R;ENSP00000365235:K249R;ENSP00000344512:K349R|.	.|.	K|S	+|+	2|1	0|0	CCDC83|CCDC83	85304890|85304890	0.003000|0.003000	0.15002|0.15002	0.028000|0.028000	0.17463|0.17463	0.169000|0.169000	0.22640|0.22640	1.471000|1.471000	0.35365|0.35365	2.096000|2.096000	0.63516|0.63516	0.482000|0.482000	0.46254|0.46254	AAG|AGT	.	.		0.343	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392215.1	NM_173556	
PIWIL4	143689	hgsc.bcm.edu	37	11	94335097	94335097	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:94335097T>C	ENST00000299001.6	+	12	1728	c.1517T>C	c.(1516-1518)tTg>tCg	p.L506S	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	506					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CTGAACTGCTTGAGAAGAGTT	0.363																																					p.L506S		Atlas-SNP	.											.	PIWIL4	70	.	0			c.T1517C						.						130.0	127.0	128.0					11																	94335097		2201	4298	6499	SO:0001583	missense	143689	exon12			ACTGCTTGAGAAG	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1517T>C	chr11.hg19:g.94335097T>C	ENSP00000299001:p.Leu506Ser	131.0	0.0		74.0	4.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	hg19	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.566781	0.65651	.	.	ENSG00000134627	ENST00000299001	T	0.08193	3.12	5.24	5.24	0.73138	Ribonuclease H-like (1);	0.000000	0.50627	D	0.000108	T	0.31949	0.0813	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08597	-1.0714	10	0.87932	D	0	-18.4283	14.2686	0.66138	0.0:0.0:0.0:1.0	.	506	Q7Z3Z4	PIWL4_HUMAN	S	506	ENSP00000299001:L506S	ENSP00000299001:L506S	L	+	2	0	PIWIL4	93974745	1.000000	0.71417	1.000000	0.80357	0.628000	0.37860	6.194000	0.72082	2.216000	0.71823	0.528000	0.53228	TTG	.	.		0.363	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
GRIA4	2893	hgsc.bcm.edu	37	11	105774565	105774565	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:105774565G>A	ENST00000530497.1	+	7	911	c.911G>A	c.(910-912)gGa>gAa	p.G304E	GRIA4_ENST00000393127.2_Missense_Mutation_p.G304E|GRIA4_ENST00000393125.2_Missense_Mutation_p.G304E|GRIA4_ENST00000525187.1_Missense_Mutation_p.G304E|GRIA4_ENST00000428631.2_Missense_Mutation_p.G304E|GRIA4_ENST00000282499.5_Missense_Mutation_p.G304E			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	304					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACTTATGATGGAGTCCTTGTG	0.418																																					p.G304E		Atlas-SNP	.											.	GRIA4	380	.	0			c.G911A						.						147.0	141.0	143.0					11																	105774565		2202	4299	6501	SO:0001583	missense	2893	exon8			ATGATGGAGTCCT	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.911G>A	chr11.hg19:g.105774565G>A	ENSP00000435775:p.Gly304Glu	104.0	0.0		99.0	4.0	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457096	0.84317	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	T;T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8;1.8	5.65	5.65	0.86999	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	T	0.42449	0.1203	L	0.34521	1.04	0.80722	D	1	B;D;D	0.63880	0.037;0.986;0.993	B;D;D	0.66497	0.098;0.913;0.944	T	0.22871	-1.0204	10	0.87932	D	0	.	20.0855	0.97800	0.0:0.0:1.0:0.0	.	304;304;304	P48058;G3V164;Q86XE8	GRIA4_HUMAN;.;.	E	304	ENSP00000376833:G304E;ENSP00000282499:G304E;ENSP00000376835:G304E;ENSP00000415551:G304E;ENSP00000435775:G304E;ENSP00000432180:G304E	ENSP00000282499:G304E	G	+	2	0	GRIA4	105279775	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	2.174000	0.42482	2.813000	0.96785	0.655000	0.94253	GGA	.	.		0.418	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
ZBTB16	7704	hgsc.bcm.edu	37	11	114112895	114112895	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:114112895A>G	ENST00000335953.4	+	5	1840	c.1460A>G	c.(1459-1461)gAc>gGc	p.D487G	ZBTB16_ENST00000535379.1_3'UTR|ZBTB16_ENST00000392996.2_Missense_Mutation_p.D487G|RP11-64D24.2_ENST00000544925.1_RNA	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	487					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		ACAGGCACTGACATGGCCGTC	0.602																																					p.D487G		Atlas-SNP	.											.	ZBTB16	101	.	0			c.A1460G						.						84.0	55.0	65.0					11																	114112895		2201	4296	6497	SO:0001583	missense	7704	exon5			GCACTGACATGGC	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1460A>G	chr11.hg19:g.114112895A>G	ENSP00000338157:p.Asp487Gly	61.0	0.0		54.0	4.0	NM_006006	Q8TAL4	Missense_Mutation	SNP	ENST00000335953.4	hg19	CCDS8367.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.417968	0.83449	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.10960	2.82;2.82	5.33	5.33	0.75918	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.12305	0.0299	L	0.41632	1.29	0.53005	D	0.999969	B	0.17268	0.021	B	0.18871	0.023	T	0.03068	-1.1076	10	0.87932	D	0	-17.7069	15.6241	0.76840	1.0:0.0:0.0:0.0	.	487	Q05516	ZBT16_HUMAN	G	487;487;364	ENSP00000338157:D487G;ENSP00000376721:D487G	ENSP00000309507:D364G	D	+	2	0	ZBTB16	113618105	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.426000	0.80270	2.145000	0.66743	0.533000	0.62120	GAC	.	.		0.602	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
STT3A	3703	hgsc.bcm.edu	37	11	125474114	125474114	+	Silent	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:125474114A>T	ENST00000529196.1	+	7	686	c.480A>T	c.(478-480)cgA>cgT	p.R160R	STT3A_ENST00000392708.4_Silent_p.R160R|STT3A_ENST00000531491.1_Silent_p.R68R			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	160					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.R160R(1)		NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		ATATCTCCCGATCTGTGGCTG	0.423																																					p.R160R		Atlas-SNP	.											STT3A,NS,carcinoma,0,1	STT3A	52	.	1	Substitution - coding silent(1)	endometrium(1)	c.A480T						.						125.0	117.0	119.0					11																	125474114		2201	4299	6500	SO:0001819	synonymous_variant	3703	exon6			CTCCCGATCTGTG	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.480A>T	chr11.hg19:g.125474114A>T		144.0	1.0		92.0	68.0	NM_152713	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Silent	SNP	ENST00000529196.1	hg19	CCDS8458.1																																																																																			.	.		0.423	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128932193	128932193	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:128932193T>C	ENST00000310343.9	-	9	902	c.903A>G	c.(901-903)agA>agG	p.R301R	ARHGAP32_ENST00000524655.1_Silent_p.R227R	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	301	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CGTGCTTGCCTCTCCACCATG	0.383																																					p.R301R		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.A903G						.						129.0	119.0	122.0					11																	128932193		1566	3579	5145	SO:0001819	synonymous_variant	9743	exon9			CTTGCCTCTCCAC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.903A>G	chr11.hg19:g.128932193T>C		42.0	0.0		33.0	4.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	ENST00000310343.9	hg19	CCDS44769.1																																																																																			.	.		0.383	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
DCP1B	196513	hgsc.bcm.edu	37	12	2062353	2062353	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:2062353G>C	ENST00000280665.6	-	7	832	c.753C>G	c.(751-753)caC>caG	p.H251Q	DCP1B_ENST00000540622.1_Missense_Mutation_p.H125Q|DCP1B_ENST00000541700.1_5'UTR|DCP1B_ENST00000397173.4_Missense_Mutation_p.H149Q	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	251				H -> HQ (in Ref. 1; AAN62764, 2; BAB71118 and 4; AAH15368/AAH43437). {ECO:0000305}.	exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			gctgctgctgGTGGAGAGTCT	0.552																																					p.H251Q		Atlas-SNP	.											DCP1B,rectum,carcinoma,0,1	DCP1B	63	.	0			c.C753G						.						36.0	42.0	40.0					12																	2062353		2203	4300	6503	SO:0001583	missense	196513	exon7			CTGCTGGTGGAGA	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.753C>G	chr12.hg19:g.2062353G>C	ENSP00000280665:p.His251Gln	13.0	0.0		20.0	3.0	NM_152640	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	ENST00000280665.6	hg19	CCDS31727.1	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.346987	0.01266	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.17054	2.32;2.31;2.3	4.5	0.369	0.16151	.	1.548950	0.03620	N	0.236163	T	0.16769	0.0403	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.41822	-0.9487	10	0.12766	T	0.61	0.002	15.1763	0.72913	0.0:0.5449:0.4551:0.0	.	149;251	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	Q	251;149;125	ENSP00000280665:H251Q;ENSP00000380358:H149Q;ENSP00000444374:H125Q	ENSP00000280665:H251Q	H	-	3	2	DCP1B	1932614	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	-0.086000	0.11233	-0.095000	0.12351	-0.835000	0.03068	CAC	.	.		0.552	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
PLEKHG6	55200	hgsc.bcm.edu	37	12	6436467	6436467	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:6436467A>G	ENST00000396988.3	+	15	1948	c.1718A>G	c.(1717-1719)gAc>gGc	p.D573G	PLEKHG6_ENST00000304581.8_Missense_Mutation_p.D103G|PLEKHG6_ENST00000449001.2_Missense_Mutation_p.D541G|PLEKHG6_ENST00000011684.7_Missense_Mutation_p.D573G	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	573						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						GTGACAGAAGACACAGATGAA	0.562											OREG0021622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D573G		Atlas-SNP	.											.	PLEKHG6	62	.	0			c.A1718G						.						144.0	136.0	138.0					12																	6436467		2203	4300	6503	SO:0001583	missense	55200	exon15			CAGAAGACACAGA	AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.1718A>G	chr12.hg19:g.6436467A>G	ENSP00000380185:p.Asp573Gly	98.0	0.0	634	85.0	4.0	NM_001144856	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Missense_Mutation	SNP	ENST00000396988.3	hg19	CCDS8541.1	.	.	.	.	.	.	.	.	.	.	A	10.88	1.476935	0.26511	.	.	ENSG00000008323	ENST00000011684;ENST00000396988;ENST00000449001;ENST00000304581	T;T;T	0.65732	-0.06;-0.06;-0.17	5.45	4.23	0.50019	.	0.000000	0.64402	D	0.000016	T	0.66446	0.2790	L	0.36672	1.1	0.09310	N	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.55347	-0.8155	10	0.42905	T	0.14	-30.1755	7.9911	0.30242	0.8185:0.0:0.0:0.1815	.	541;573	Q3KR16-2;Q3KR16	.;PKHG6_HUMAN	G	573;573;541;103	ENSP00000011684:D573G;ENSP00000380185:D573G;ENSP00000393194:D541G	ENSP00000011684:D573G	D	+	2	0	PLEKHG6	6306728	0.993000	0.37304	0.186000	0.23195	0.073000	0.16967	1.826000	0.39092	2.059000	0.61396	0.533000	0.62120	GAC	.	.		0.562	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399031.1	NM_018173	
CLECL1	160365	hgsc.bcm.edu	37	12	9885713	9885713	+	Missense_Mutation	SNP	A	A	T	rs200639830		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:9885713A>T	ENST00000327839.3	-	1	182	c.148T>A	c.(148-150)Tac>Aac	p.Y50N		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						TCTGATAAGTAAATTGAGATG	0.403																																					p.Y50N		Atlas-SNP	.											.	CLECL1	18	.	0			c.T148A						.						77.0	80.0	79.0					12																	9885713		2203	4300	6503	SO:0001583	missense	160365	exon1			ATAAGTAAATTGA	AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.148T>A	chr12.hg19:g.9885713A>T	ENSP00000331766:p.Tyr50Asn	56.0	0.0		102.0	6.0	NM_001267701		Missense_Mutation	SNP	ENST00000327839.3	hg19	CCDS8603.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.915|6.915	0.538458|0.538458	0.13250|0.13250	.|.	.|.	ENSG00000184293|ENSG00000184293	ENST00000542530|ENST00000327839	.|T	.|0.56275	.|0.47	1.86|1.86	0.666|0.666	0.17901|0.17901	.|.	.|.	.|.	.|.	.|.	T|T	0.21590|0.21590	0.0520|0.0520	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|P	.|0.51147	.|0.942	.|B	.|0.39217	.|0.294	T|T	0.08027|0.08027	-1.0742|-1.0742	5|8	.|.	.|.	.|.	.|.	3.7406|3.7406	0.08528|0.08528	0.7983:0.0:0.2017:0.0|0.7983:0.0:0.2017:0.0	.|.	.|50	.|Q8IZS7	.|CLCL1_HUMAN	L|N	1|50	.|ENSP00000331766:Y50N	.|.	F|Y	-|-	3|1	2|0	CLECL1|CLECL1	9776980|9776980	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	1.812000|1.812000	0.38952|0.38952	0.170000|0.170000	0.19704|0.19704	-0.463000|-0.463000	0.05309|0.05309	TTT|TAC	.	.		0.403	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399815.1	NM_172004	
GUCY2C	2984	hgsc.bcm.edu	37	12	14829836	14829836	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:14829836A>G	ENST00000261170.3	-	7	1036	c.900T>C	c.(898-900)tcT>tcC	p.S300S	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	300					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	AATTCCCAGGAGACAGCGTCA	0.343																																					p.S300S		Atlas-SNP	.											.	GUCY2C	126	.	0			c.T900C						.						72.0	71.0	71.0					12																	14829836		2203	4300	6503	SO:0001819	synonymous_variant	2984	exon7			CCCAGGAGACAGC		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.900T>C	chr12.hg19:g.14829836A>G		138.0	0.0		94.0	4.0	NM_004963	B2RMY6	Silent	SNP	ENST00000261170.3	hg19	CCDS8664.1																																																																																			.	.		0.343	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
GUCY2C	2984	hgsc.bcm.edu	37	12	14836124	14836124	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:14836124C>T	ENST00000261170.3	-	4	599	c.463G>A	c.(463-465)Gaa>Aaa	p.E155K	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	155					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GTTAAGGTTTCTTTATAGTCA	0.408																																					p.E155K		Atlas-SNP	.											GUCY2C,NS,carcinoma,0,1	GUCY2C	126	.	0			c.G463A						.						90.0	84.0	86.0					12																	14836124		2203	4300	6503	SO:0001583	missense	2984	exon4			AGGTTTCTTTATA		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.463G>A	chr12.hg19:g.14836124C>T	ENSP00000261170:p.Glu155Lys	63.0	0.0		36.0	2.0	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	hg19	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.271348	0.40194	.	.	ENSG00000070019	ENST00000261170	T	0.73575	-0.76	5.46	5.46	0.80206	Extracellular ligand-binding receptor (1);	0.430696	0.26788	N	0.022491	T	0.71871	0.3391	L	0.60455	1.87	0.34441	D	0.699563	P	0.38223	0.623	B	0.41988	0.372	T	0.73675	-0.3908	10	0.11182	T	0.66	.	14.8157	0.70034	0.0:1.0:0.0:0.0	.	155	P25092	GUC2C_HUMAN	K	155	ENSP00000261170:E155K	ENSP00000261170:E155K	E	-	1	0	GUCY2C	14727391	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.188000	0.42612	2.567000	0.86603	0.655000	0.94253	GAA	.	.		0.408	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
GUCY2C	2984	hgsc.bcm.edu	37	12	14840921	14840921	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:14840921G>T	ENST00000261170.3	-	2	430	c.294C>A	c.(292-294)agC>agA	p.S98R	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	98					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CTTCACAGGTGCTACTCCGGC	0.483																																					p.S98R		Atlas-SNP	.											.	GUCY2C	126	.	0			c.C294A						.						100.0	95.0	97.0					12																	14840921		2203	4300	6503	SO:0001583	missense	2984	exon2			ACAGGTGCTACTC		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.294C>A	chr12.hg19:g.14840921G>T	ENSP00000261170:p.Ser98Arg	53.0	0.0		34.0	25.0	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	hg19	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.778838	0.70107	.	.	ENSG00000070019	ENST00000261170	T	0.75938	-0.98	5.48	1.53	0.23141	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.82107	0.4965	M	0.74881	2.28	0.43187	D	0.995011	D	0.89917	1.0	D	0.79784	0.993	T	0.80155	-0.1500	10	0.87932	D	0	.	7.3263	0.26557	0.3561:0.0:0.6439:0.0	.	98	P25092	GUC2C_HUMAN	R	98	ENSP00000261170:S98R	ENSP00000261170:S98R	S	-	3	2	GUCY2C	14732188	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	0.803000	0.27083	0.354000	0.24105	0.591000	0.81541	AGC	.	.		0.483	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
PLCZ1	89869	hgsc.bcm.edu	37	12	18837138	18837138	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:18837138A>C	ENST00000538330.1	-	10	1394	c.1013T>G	c.(1012-1014)gTt>gGt	p.V338G	PLCZ1_ENST00000539875.1_Missense_Mutation_p.V363G|PLCZ1_ENST00000541695.1_3'UTR|PLCZ1_ENST00000435379.1_Missense_Mutation_p.V361G|PLCZ1_ENST00000447925.2_Missense_Mutation_p.V554G|PLCZ1_ENST00000266505.7_Missense_Mutation_p.V556G|PLCZ1_ENST00000534932.1_Missense_Mutation_p.V37G					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TTGACCTTCAACAACAAAACG	0.323																																					p.V556G		Atlas-SNP	.											PLCZ1,NS,carcinoma,0,1	PLCZ1	107	.	0			c.T1667G						.						105.0	103.0	104.0					12																	18837138		2202	4298	6500	SO:0001583	missense	89869	exon14			CCTTCAACAACAA	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.1013T>G	chr12.hg19:g.18837138A>C	ENSP00000445880:p.Val338Gly	32.0	0.0		23.0	2.0	NM_033123		Missense_Mutation	SNP	ENST00000538330.1	hg19		.	.	.	.	.	.	.	.	.	.	A	18.01	3.527203	0.64860	.	.	ENSG00000139151	ENST00000534932;ENST00000538330;ENST00000266505;ENST00000447925;ENST00000435379;ENST00000539875	T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48	5.15	1.53	0.23141	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.209202	0.40469	N	0.001085	T	0.56906	0.2017	M	0.94021	3.485	0.80722	D	1	D;D	0.61697	0.99;0.99	P;D	0.63703	0.89;0.917	T	0.59752	-0.7395	10	0.66056	D	0.02	.	7.3986	0.26950	0.7088:0.0:0.2912:0.0	.	556;338	Q86YW0;Q8N7S5	PLCZ1_HUMAN;.	G	37;338;556;554;361;363	ENSP00000438826:V37G;ENSP00000445880:V338G;ENSP00000266505:V556G;ENSP00000402358:V554G;ENSP00000400504:V361G;ENSP00000445026:V363G	ENSP00000266505:V556G	V	-	2	0	PLCZ1	18728405	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.544000	0.53640	0.440000	0.26502	0.533000	0.62120	GTT	.	.		0.323	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123	
TM7SF3	51768	hgsc.bcm.edu	37	12	27128524	27128524	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:27128524G>A	ENST00000343028.4	-	11	1580	c.1355C>T	c.(1354-1356)tCc>tTc	p.S452F	RP11-421F16.3_ENST00000500632.1_RNA	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	452						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					AAGGCTTGTGGACCAGTAACT	0.443																																					p.S452F		Atlas-SNP	.											.	TM7SF3	41	.	0			c.C1355T						.						126.0	111.0	116.0					12																	27128524		2203	4300	6503	SO:0001583	missense	51768	exon11			CTTGTGGACCAGT	AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.1355C>T	chr12.hg19:g.27128524G>A	ENSP00000342322:p.Ser452Phe	127.0	0.0		101.0	73.0	NM_016551	B3KMZ3|Q9NUS4	Missense_Mutation	SNP	ENST00000343028.4	hg19	CCDS8710.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347733	0.24426	.	.	ENSG00000064115	ENST00000343028;ENST00000545344;ENST00000537406	T	0.30448	1.53	5.52	-0.586	0.11694	.	0.248069	0.42548	N	0.000699	T	0.08537	0.0212	N	0.02011	-0.69	0.27910	N	0.93865	B	0.02656	0.0	B	0.04013	0.001	T	0.34254	-0.9836	10	0.11182	T	0.66	-3.8215	6.6569	0.22992	0.3947:0.0:0.2307:0.3746	.	452	Q9NS93	TM7S3_HUMAN	F	452;166;70	ENSP00000342322:S452F	ENSP00000342322:S452F	S	-	2	0	TM7SF3	27019791	1.000000	0.71417	0.740000	0.30986	0.902000	0.53008	2.500000	0.45381	-0.256000	0.09473	-0.271000	0.10264	TCC	.	.		0.443	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	NM_016551	
ARID2	196528	hgsc.bcm.edu	37	12	46231166	46231166	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:46231166T>C	ENST00000334344.6	+	9	1258	c.1086T>C	c.(1084-1086)tgT>tgC	p.C362C	ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000422737.1_Silent_p.C213C|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	362					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTACAAAATGTCTAATGTCAA	0.303			"""N, S, F"""		hepatocellular carcinoma																																p.C362C		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.T1086C						.						83.0	91.0	88.0					12																	46231166		2203	4295	6498	SO:0001819	synonymous_variant	196528	exon9			AAAATGTCTAATG		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1086T>C	chr12.hg19:g.46231166T>C		73.0	0.0		84.0	4.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.		0.303	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
DDX23	9416	hgsc.bcm.edu	37	12	49226344	49226344	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:49226344T>C	ENST00000308025.3	-	14	1895	c.1816A>G	c.(1816-1818)Acg>Gcg	p.T606A		NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	606	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						ATGGTGGCCGTGAACATGACT	0.587																																					p.T606A		Atlas-SNP	.											.	DDX23	82	.	0			c.A1816G						.						45.0	39.0	41.0					12																	49226344		2203	4300	6503	SO:0001583	missense	9416	exon14			TGGCCGTGAACAT	AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.1816A>G	chr12.hg19:g.49226344T>C	ENSP00000310723:p.Thr606Ala	53.0	0.0		73.0	4.0	NM_004818	B2R600|B4DH15|O43188	Missense_Mutation	SNP	ENST00000308025.3	hg19	CCDS8770.1	.	.	.	.	.	.	.	.	.	.	T	33	5.257996	0.95368	.	.	ENSG00000174243	ENST00000308025	T	0.11277	2.79	5.65	5.65	0.86999	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.049681	0.85682	D	0.000000	T	0.24928	0.0605	L	0.48362	1.52	0.80722	D	1	D	0.55385	0.971	P	0.62298	0.9	T	0.00233	-1.1894	10	0.87932	D	0	-16.2225	14.9931	0.71406	0.0:0.0:0.0:1.0	.	606	Q9BUQ8	DDX23_HUMAN	A	606	ENSP00000310723:T606A	ENSP00000310723:T606A	T	-	1	0	DDX23	47512611	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.542000	0.82095	2.371000	0.80710	0.533000	0.62120	ACG	.	.		0.587	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408897.2	NM_004818	
FKBP11	51303	hgsc.bcm.edu	37	12	49318403	49318403	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:49318403T>C	ENST00000550765.1	-	3	622	c.224A>G	c.(223-225)gAc>gGc	p.D75G	FKBP11_ENST00000453172.2_Missense_Mutation_p.D75G|CCDC65_ENST00000266984.5_Intron|AC073610.5_ENST00000537495.1_Intron|FKBP11_ENST00000444214.2_5'UTR|FKBP11_ENST00000552878.1_Missense_Mutation_p.D75G|RP11-302B13.5_ENST00000398092.4_Intron	NM_016594.2	NP_057678.1	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11, 19 kDa	75	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(3)|lung(1)	5						CAGGGAGGTGTCAATAATACG	0.542											OREG0021773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D75G		Atlas-SNP	.											.	FKBP11	12	.	0			c.A224G						.						145.0	131.0	136.0					12																	49318403		2203	4300	6503	SO:0001583	missense	51303	exon3			GAGGTGTCAATAA	AF238079	CCDS8773.1, CCDS44870.1, CCDS44871.1	12q13.12	2008-08-04	2002-08-29			ENSG00000134285			18624	protein-coding gene	gene with protein product		610571	"""FK506 binding protein 11 (19 kDa)"""			12036304, 16596453	Standard	NM_016594		Approved	FKBP19	uc001rsp.3	Q9NYL4		ENST00000550765.1:c.224A>G	chr12.hg19:g.49318403T>C	ENSP00000449751:p.Asp75Gly	54.0	0.0	961	91.0	4.0	NM_016594	B4DWB7	Missense_Mutation	SNP	ENST00000550765.1	hg19	CCDS8773.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690300	0.48097	.	.	ENSG00000134285	ENST00000550765;ENST00000552878;ENST00000453172	T;T;T	0.63417	-0.04;-0.04;-0.04	4.5	4.5	0.54988	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.054834	0.64402	D	0.000001	D	0.83202	0.5203	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.87576	0.2481	10	0.87932	D	0	-11.4586	13.1354	0.59405	0.0:0.0:0.0:1.0	.	75;75	B4DWB7;Q9NYL4	.;FKB11_HUMAN	G	75	ENSP00000449751:D75G;ENSP00000447911:D75G;ENSP00000396874:D75G	ENSP00000396874:D75G	D	-	2	0	FKBP11	47604670	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.772000	0.75001	1.810000	0.52873	0.533000	0.62120	GAC	.	.		0.542	FKBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408927.1	NM_016594	
LMBR1L	55716	hgsc.bcm.edu	37	12	49498580	49498580	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:49498580A>G	ENST00000267102.8	-	4	622	c.280T>C	c.(280-282)Tcc>Ccc	p.S94P	LMBR1L_ENST00000553204.1_5'UTR|LMBR1L_ENST00000395141.4_Missense_Mutation_p.S89P|LMBR1L_ENST00000547382.1_Missense_Mutation_p.S94P	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	94					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGAGGCAGGGAGAGCAGCACC	0.592																																					p.S94P		Atlas-SNP	.											.	LMBR1L	61	.	0			c.T280C						.						125.0	89.0	101.0					12																	49498580		2203	4300	6503	SO:0001583	missense	55716	exon4			GCAGGGAGAGCAG	AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.280T>C	chr12.hg19:g.49498580A>G	ENSP00000267102:p.Ser94Pro	82.0	0.0		100.0	4.0	NM_018113	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	ENST00000267102.8	hg19	CCDS8780.2	.	.	.	.	.	.	.	.	.	.	A	17.05	3.290183	0.59976	.	.	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000395141;ENST00000547675;ENST00000551854;ENST00000551782	T;T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26;1.26	6.07	6.07	0.98685	LMBR1-like membrane protein (1);	0.107607	0.64402	D	0.000005	T	0.54224	0.1845	M	0.61703	1.905	0.47183	D	0.999341	P;D;D	0.67145	0.95;0.984;0.996	P;P;P	0.62298	0.698;0.855;0.9	T	0.49652	-0.8917	10	0.33940	T	0.23	.	15.6114	0.76721	1.0:0.0:0.0:0.0	.	94;94;89	Q6UX01-3;Q6UX01;Q6UX01-4	.;LMBRL_HUMAN;.	P	94;94;89;94;99;94	ENSP00000267102:S94P;ENSP00000447329:S94P;ENSP00000378573:S89P;ENSP00000447240:S94P;ENSP00000446641:S99P;ENSP00000449633:S94P	ENSP00000267102:S94P	S	-	1	0	LMBR1L	47784847	1.000000	0.71417	0.994000	0.49952	0.421000	0.31385	5.802000	0.69122	2.326000	0.78906	0.533000	0.62120	TCC	.	.		0.592	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318696.1	NM_018113	
BIN2	51411	hgsc.bcm.edu	37	12	51693495	51693495	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:51693495T>C	ENST00000267012.4	-	6	473	c.412A>G	c.(412-414)Aga>Gga	p.R138G	BIN2_ENST00000452142.2_Missense_Mutation_p.R106G|BIN2_ENST00000544402.1_Missense_Mutation_p.R112G|BIN2_ENST00000604560.1_Missense_Mutation_p.R111G	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	138	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						TTGGCAATTCTCTCCTGACCC	0.507																																					p.R138G		Atlas-SNP	.											.	BIN2	58	.	0			c.A412G						.						94.0	91.0	92.0					12																	51693495		2203	4300	6503	SO:0001583	missense	51411	exon6			CAATTCTCTCCTG	AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.412A>G	chr12.hg19:g.51693495T>C	ENSP00000267012:p.Arg138Gly	39.0	0.0		71.0	4.0	NM_016293	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	ENST00000267012.4	hg19	CCDS8811.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710147	0.68730	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	T;T;T	0.64260	-0.09;-0.09;-0.09	5.05	3.83	0.44106	BAR (3);	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.83774	2.66	0.36007	D	0.837806	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.69824	0.958;0.962;0.966	D	0.83569	0.0111	10	0.66056	D	0.02	-9.568	10.3602	0.43989	0.0:0.0:0.1637:0.8363	.	112;106;138	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	G	106;138;112	ENSP00000410217:R106G;ENSP00000267012:R138G;ENSP00000445874:R112G	ENSP00000267012:R138G	R	-	1	2	BIN2	49979762	0.996000	0.38824	1.000000	0.80357	0.855000	0.48748	1.901000	0.39838	2.260000	0.74910	0.533000	0.62120	AGA	.	.		0.507	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000469800.1		
GRASP	160622	hgsc.bcm.edu	37	12	52407934	52407934	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:52407934A>G	ENST00000293662.4	+	7	711	c.631A>G	c.(631-633)Aag>Gag	p.K211E	GRASP_ENST00000552049.1_Missense_Mutation_p.K68E|GRASP_ENST00000380039.2_Missense_Mutation_p.K68E|GRASP_ENST00000552963.1_3'UTR	NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	211	Interaction with PSCD3. {ECO:0000250}.				protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CCTGTATGAGAAGTGGGGAGA	0.572																																					p.K211E		Atlas-SNP	.											.	GRASP	23	.	0			c.A631G						.						80.0	68.0	72.0					12																	52407934		2202	4300	6502	SO:0001583	missense	160622	exon7			TATGAGAAGTGGG	AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.631A>G	chr12.hg19:g.52407934A>G	ENSP00000293662:p.Lys211Glu	74.0	0.0		99.0	4.0	NM_181711	Q6PIF8|Q7Z741	Missense_Mutation	SNP	ENST00000293662.4	hg19	CCDS8817.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.590597	0.86851	.	.	ENSG00000161835	ENST00000293662;ENST00000552049;ENST00000546756;ENST00000380039	T;T	0.66099	-0.19;0.1	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.74137	0.3677	M	0.61703	1.905	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.991	T	0.76501	-0.2936	10	0.72032	D	0.01	-0.0184	10.9268	0.47195	1.0:0.0:0.0:0.0	.	68;211	Q7Z6J2-2;Q7Z6J2	.;GRASP_HUMAN	E	211;68;81;68	ENSP00000293662:K211E;ENSP00000448476:K81E	ENSP00000293662:K211E	K	+	1	0	GRASP	50694201	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.920000	0.87521	1.849000	0.53698	0.377000	0.23210	AAG	.	.		0.572	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404972.1		
STAT6	6778	hgsc.bcm.edu	37	12	57499264	57499264	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:57499264T>C	ENST00000300134.3	-	8	1124	c.799A>G	c.(799-801)Acc>Gcc	p.T267A	STAT6_ENST00000556155.1_Missense_Mutation_p.T267A|STAT6_ENST00000454075.3_Missense_Mutation_p.T267A|STAT6_ENST00000538913.2_Missense_Mutation_p.T157A|STAT6_ENST00000543873.2_Missense_Mutation_p.T267A|STAT6_ENST00000537215.2_Missense_Mutation_p.T157A	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	267					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						GTGACGAGGGTTCTCAGGACT	0.622																																					p.T267A		Atlas-SNP	.											.	STAT6	69	.	0			c.A799G						.						53.0	58.0	56.0					12																	57499264		2203	4300	6503	SO:0001583	missense	6778	exon8			CGAGGGTTCTCAG	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.799A>G	chr12.hg19:g.57499264T>C	ENSP00000300134:p.Thr267Ala	42.0	0.0		77.0	4.0	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	hg19	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	T	4.072	0.011193	0.07912	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516	T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	5.19	2.85	0.33270	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);p53-like transcription factor, DNA-binding (1);	0.412136	0.26481	N	0.024130	T	0.59555	0.2202	L	0.29908	0.895	0.18873	N	0.999987	B;B	0.06786	0.0;0.001	B;B	0.10450	0.005;0.004	T	0.37454	-0.9705	10	0.09590	T	0.72	-6.5242	6.4315	0.21798	0.0:0.1902:0.0:0.8098	.	267;267	A8K4S9;P42226	.;STAT6_HUMAN	A	267;157;157;267;267;157;267;157;267	ENSP00000300134:T267A;ENSP00000445409:T157A;ENSP00000438451:T267A;ENSP00000451742:T267A;ENSP00000444530:T157A;ENSP00000401486:T267A	ENSP00000300134:T267A	T	-	1	0	STAT6	55785531	0.000000	0.05858	0.066000	0.19879	0.841000	0.47740	-0.136000	0.10405	0.455000	0.26910	0.533000	0.62120	ACC	.	.		0.622	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
OTOGL	283310	hgsc.bcm.edu	37	12	80714407	80714407	+	Silent	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:80714407A>T	ENST00000547103.1	+	33	3987	c.3981A>T	c.(3979-3981)acA>acT	p.T1327T	OTOGL_ENST00000458043.2_Silent_p.T1327T			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1327					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TCATATTCACAGATTCTAGTG	0.373																																					p.T1327T		Atlas-SNP	.											.	OTOGL	235	.	0			c.A3981T						.						56.0	53.0	54.0					12																	80714407		1844	4098	5942	SO:0001819	synonymous_variant	283310	exon33			ATTCACAGATTCT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3981A>T	chr12.hg19:g.80714407A>T		68.0	0.0		86.0	52.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	ENST00000547103.1	hg19																																																																																				.	.		0.373	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
OTOGL	283310	hgsc.bcm.edu	37	12	80747200	80747200	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:80747200T>C	ENST00000547103.1	+	45	5446	c.5440T>C	c.(5440-5442)Tgt>Cgt	p.C1814R	OTOGL_ENST00000458043.2_Missense_Mutation_p.C1826R|OTOGL_ENST00000546620.1_5'Flank			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1814					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						ACACACTTCCTGTTTGAATCT	0.473																																					p.C1826R		Atlas-SNP	.											.	OTOGL	235	.	0			c.T5476C						.						72.0	70.0	70.0					12																	80747200		1943	4144	6087	SO:0001583	missense	283310	exon45			ACTTCCTGTTTGA	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.5440T>C	chr12.hg19:g.80747200T>C	ENSP00000447211:p.Cys1814Arg	89.0	0.0		131.0	6.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.18	2.458902	0.43634	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.81415	-1.49;-1.49	5.74	4.57	0.56435	.	.	.	.	.	D	0.89125	0.6626	M	0.92691	3.335	0.58432	D	0.999997	.	.	.	.	.	.	D	0.87798	0.2623	7	0.24483	T	0.36	.	12.1334	0.53957	0.1286:0.0:0.0:0.8714	.	.	.	.	R	1814;1826	ENSP00000447211:C1814R;ENSP00000400895:C1826R	ENSP00000400895:C1826R	C	+	1	0	OTOGL	79271331	1.000000	0.71417	0.399000	0.26333	0.218000	0.24690	5.600000	0.67599	0.982000	0.38575	0.533000	0.62120	TGT	.	.		0.473	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PLEKHG7	440107	hgsc.bcm.edu	37	12	93155594	93155594	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:93155594A>G	ENST00000344636.3	+	9	951	c.767A>G	c.(766-768)aAg>aGg	p.K256R		NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	256	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						ACGAAAACTAAGTGCAACAAA	0.318																																					p.K256R		Atlas-SNP	.											.	PLEKHG7	38	.	0			c.A767G						.						71.0	67.0	68.0					12																	93155594		2198	4295	6493	SO:0001583	missense	440107	exon9			AAACTAAGTGCAA	AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.767A>G	chr12.hg19:g.93155594A>G	ENSP00000344961:p.Lys256Arg	34.0	0.0		77.0	4.0	NM_001004330	B2RNR7	Missense_Mutation	SNP	ENST00000344636.3	hg19	CCDS31873.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.734292	0.48939	.	.	ENSG00000187510	ENST00000344636	T	0.66815	-0.23	5.38	4.19	0.49359	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.200532	0.53938	D	0.000060	T	0.51041	0.1651	L	0.47716	1.5	0.51767	D	0.999936	P	0.44281	0.831	B	0.32980	0.156	T	0.46803	-0.9165	10	0.14656	T	0.56	-14.1153	11.4409	0.50096	0.9269:0.0:0.0731:0.0	.	256	Q6ZR37	PKHG7_HUMAN	R	256	ENSP00000344961:K256R	ENSP00000344961:K256R	K	+	2	0	PLEKHG7	91679725	1.000000	0.71417	0.997000	0.53966	0.968000	0.65278	6.038000	0.70964	0.934000	0.37316	0.391000	0.25812	AAG	.	.		0.318	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1	NM_001004330	
SRRM4	84530	hgsc.bcm.edu	37	12	119568550	119568550	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:119568550A>G	ENST00000267260.4	+	8	1070	c.682A>G	c.(682-684)Acc>Gcc	p.T228A	SRRM4_ENST00000537597.1_3'UTR	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	228	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CTGCTCCAAGACCCTCTGCAA	0.647																																					p.T228A		Atlas-SNP	.											.	SRRM4	131	.	0			c.A682G						.						24.0	30.0	28.0					12																	119568550		1927	4122	6049	SO:0001583	missense	84530	exon8			TCCAAGACCCTCT	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.682A>G	chr12.hg19:g.119568550A>G	ENSP00000267260:p.Thr228Ala	16.0	0.0		43.0	4.0	NM_194286	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	hg19	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	A	19.41	3.822999	0.71028	.	.	ENSG00000139767	ENST00000267260	T	0.21932	1.98	5.07	3.93	0.45458	.	0.756494	0.12339	N	0.477628	T	0.15435	0.0372	L	0.36672	1.1	0.21604	N	0.999627	B	0.02656	0.0	B	0.04013	0.001	T	0.10800	-1.0614	10	0.34782	T	0.22	-9.589	5.7856	0.18331	0.794:0.0:0.206:0.0	.	228	A7MD48	SRRM4_HUMAN	A	228	ENSP00000267260:T228A	ENSP00000267260:T228A	T	+	1	0	SRRM4	118052933	0.894000	0.30519	1.000000	0.80357	0.985000	0.73830	1.557000	0.36299	1.909000	0.55274	0.368000	0.22195	ACC	.	.		0.647	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
LRRC43	254050	hgsc.bcm.edu	37	12	122676094	122676094	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:122676094T>C	ENST00000339777.4	+	6	1097	c.1069T>C	c.(1069-1071)Tcc>Ccc	p.S357P	LRRC43_ENST00000425921.1_Missense_Mutation_p.S172P	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	357	Glu-rich.									NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		AATGAATGAGTCCGCGGGCGT	0.532											OREG0022219	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S357P		Atlas-SNP	.											.	LRRC43	105	.	0			c.T1069C						.						81.0	81.0	81.0					12																	122676094		1905	4118	6023	SO:0001583	missense	254050	exon6			AATGAGTCCGCGG	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1069T>C	chr12.hg19:g.122676094T>C	ENSP00000344233:p.Ser357Pro	27.0	0.0	1520	79.0	4.0	NM_001098519	Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	hg19	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	T	10.21	1.288273	0.23478	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.56275	0.47;0.91	5.39	-2.78	0.05859	.	1.733180	0.02914	N	0.137085	T	0.25232	0.0613	N	0.08118	0	0.09310	N	1	B	0.32653	0.379	B	0.28139	0.086	T	0.05257	-1.0896	9	.	.	.	-0.2897	1.3738	0.02216	0.1846:0.2531:0.105:0.4573	.	357	Q8N309	LRC43_HUMAN	P	357;228;172	ENSP00000344233:S357P;ENSP00000416628:S172P	.	S	+	1	0	LRRC43	121242047	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.676000	0.05221	-0.304000	0.08843	-1.795000	0.00624	TCC	.	.		0.532	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
TCTN2	79867	hgsc.bcm.edu	37	12	124158356	124158356	+	Splice_Site	SNP	A	A	T	rs111689585		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:124158356A>T	ENST00000303372.5	+	4	590	c.462A>T	c.(460-462)tcA>tcT	p.S154S	TCTN2_ENST00000426174.2_Splice_Site_p.S153S	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	154					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		ATAATGCCTCAGGCAAGTGAA	0.443																																					p.S154S		Atlas-SNP	.											.	TCTN2	50	.	0			c.A462T						.						173.0	169.0	170.0					12																	124158356		2203	4300	6503	SO:0001630	splice_region_variant	79867	exon4			TGCCTCAGGCAAG	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.463+1A>T	chr12.hg19:g.124158356A>T		143.0	0.0		216.0	118.0	NM_024809	A8K7Y8|B3KPW5|Q9H966	Silent	SNP	ENST00000303372.5	hg19	CCDS9253.1																																																																																			.	A|0.500;G|0.500		0.443	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809	Silent
DHX37	57647	hgsc.bcm.edu	37	12	125435267	125435267	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:125435267T>C	ENST00000308736.2	-	22	3050	c.2952A>G	c.(2950-2952)gaA>gaG	p.E984E	DHX37_ENST00000544745.1_Silent_p.E771E	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	984							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		TCTCCACGATTTCCTGGTAGA	0.587																																					p.E984E		Atlas-SNP	.											.	DHX37	114	.	0			c.A2952G						.						78.0	83.0	82.0					12																	125435267		2203	4300	6503	SO:0001819	synonymous_variant	57647	exon22			CACGATTTCCTGG	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2952A>G	chr12.hg19:g.125435267T>C		62.0	0.0		95.0	4.0	NM_032656	Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	hg19	CCDS9261.1																																																																																			.	.		0.587	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
DHX37	57647	hgsc.bcm.edu	37	12	125451369	125451369	+	Silent	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:125451369T>A	ENST00000308736.2	-	12	1658	c.1560A>T	c.(1558-1560)tcA>tcT	p.S520S	DHX37_ENST00000544745.1_Silent_p.S307S	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	520	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CCCTGGCCCTTGACTTCTTAA	0.617																																					p.S520S		Atlas-SNP	.											.	DHX37	114	.	0			c.A1560T						.						119.0	115.0	116.0					12																	125451369		2203	4300	6503	SO:0001819	synonymous_variant	57647	exon12			GGCCCTTGACTTC	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1560A>T	chr12.hg19:g.125451369T>A		155.0	0.0		168.0	69.0	NM_032656	Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	hg19	CCDS9261.1																																																																																			.	.		0.617	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
TMEM132B	114795	hgsc.bcm.edu	37	12	126138907	126138907	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:126138907T>C	ENST00000299308.3	+	9	2896	c.2888T>C	c.(2887-2889)cTc>cCc	p.L963P	TMEM132B_ENST00000535886.1_Missense_Mutation_p.L475P	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	963						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		GACATTACACTCCCATCAGAG	0.507																																					p.L963P		Atlas-SNP	.											.	TMEM132B	207	.	0			c.T2888C						.						75.0	72.0	73.0					12																	126138907		1921	4130	6051	SO:0001583	missense	114795	exon9			TTACACTCCCATC	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.2888T>C	chr12.hg19:g.126138907T>C	ENSP00000299308:p.Leu963Pro	83.0	0.0		86.0	4.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	hg19	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	T	5.140	0.211523	0.09757	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.09350	3.8;2.99	5.3	4.15	0.48705	.	0.000000	0.53938	D	0.000050	T	0.04952	0.0133	N	0.10837	0.055	0.80722	D	1	B	0.19583	0.037	B	0.19148	0.024	T	0.22068	-1.0227	10	0.02654	T	1	.	10.9829	0.47506	0.0:0.0732:0.0:0.9268	.	963	Q14DG7	T132B_HUMAN	P	963;475	ENSP00000299308:L963P;ENSP00000440436:L475P	ENSP00000299308:L963P	L	+	2	0	TMEM132B	124704860	1.000000	0.71417	0.023000	0.16930	0.570000	0.35934	4.348000	0.59379	0.860000	0.35481	0.533000	0.62120	CTC	.	.		0.507	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
BRCA2	675	hgsc.bcm.edu	37	13	32912226	32912226	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:32912226A>G	ENST00000380152.3	+	11	3967	c.3734A>G	c.(3733-3735)gAg>gGg	p.E1245G	BRCA2_ENST00000544455.1_Missense_Mutation_p.E1245G			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1245					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGTGATATTGAGAATATTAGT	0.343			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.E1245G	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.A3734G						.						46.0	47.0	46.0					13																	32912226		2203	4299	6502	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	ATATTGAGAATAT	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.3734A>G	chr13.hg19:g.32912226A>G	ENSP00000369497:p.Glu1245Gly	39.0	0.0		39.0	4.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	hg19	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909787	0.72983	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.81078	-1.45;-1.45	5.72	5.72	0.89469	.	0.176318	0.39834	N	0.001251	D	0.88403	0.6427	M	0.66939	2.045	0.46774	D	0.999195	D	0.76494	0.999	D	0.70935	0.971	D	0.89571	0.3813	10	0.87932	D	0	.	15.9966	0.80256	1.0:0.0:0.0:0.0	.	1245	P51587	BRCA2_HUMAN	G	1245	ENSP00000369497:E1245G;ENSP00000439902:E1245G	ENSP00000369497:E1245G	E	+	2	0	BRCA2	31810226	1.000000	0.71417	0.926000	0.36857	0.834000	0.47266	6.820000	0.75267	2.177000	0.69029	0.528000	0.53228	GAG	.	.		0.343	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
CCDC122	160857	hgsc.bcm.edu	37	13	44433973	44433973	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:44433973T>C	ENST00000444614.3	-	5	648	c.390A>G	c.(388-390)gcA>gcG	p.A130A	CCDC122_ENST00000476570.2_5'UTR|CCDC122_ENST00000281508.3_Silent_p.A130A	NM_144974.3	NP_659411.2	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	130										endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		CTTTTATTTTTGCATAATATG	0.294																																					p.A130A		Atlas-SNP	.											.	CCDC122	21	.	0			c.A390G						.						112.0	110.0	110.0					13																	44433973		2203	4298	6501	SO:0001819	synonymous_variant	160857	exon5			TATTTTTGCATAA	AK056408	CCDS9390.2	13q14.11	2008-10-30			ENSG00000151773	ENSG00000151773			26478	protein-coding gene	gene with protein product		613408					Standard	NM_144974		Approved	FLJ31846	uc010acf.3	Q5T0U0	OTTHUMG00000017413	ENST00000444614.3:c.390A>G	chr13.hg19:g.44433973T>C		63.0	0.0		49.0	35.0	NM_144974	B2RP70|B7ZMI9|Q96MV0	Silent	SNP	ENST00000444614.3	hg19	CCDS9390.2																																																																																			.	.		0.294	CCDC122-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276172.4	NM_144974	
RCBTB2	1102	hgsc.bcm.edu	37	13	49073817	49073817	+	Missense_Mutation	SNP	G	G	A	rs529818415		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:49073817G>A	ENST00000344532.3	-	13	1747	c.1324C>T	c.(1324-1326)Cgg>Tgg	p.R442W	RCBTB2_ENST00000430805.2_Missense_Mutation_p.R447W|RCBTB2_ENST00000544492.1_Missense_Mutation_p.R168W	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	442	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		AGGAAGGCCCGGTAAACAGGA	0.408													G|||	0	0.0	0.0	0.0	5008	,	,		21051	0.0		0.0	False		,,,				2504	0.0				p.R442W		Atlas-SNP	.											.	RCBTB2	62	.	0			c.C1324T						.						133.0	130.0	131.0					13																	49073817		2203	4300	6503	SO:0001583	missense	1102	exon13			AGGCCCGGTAAAC	AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.1324C>T	chr13.hg19:g.49073817G>A	ENSP00000345144:p.Arg442Trp	81.0	0.0		67.0	5.0	NM_001268	B2RDW8	Missense_Mutation	SNP	ENST00000344532.3	hg19	CCDS9411.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455952	0.43634	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544492	T;T;T	0.69175	-0.38;-0.38;-0.38	5.09	4.22	0.49857	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.79986	0.4541	M	0.66297	2.02	0.80722	D	1	B;D;D;B	0.89917	0.244;0.999;1.0;0.125	B;D;D;B	0.87578	0.117;0.953;0.998;0.117	T	0.82571	-0.0391	10	0.87932	D	0	.	15.1174	0.72413	0.0:0.0:0.8573:0.1427	.	168;447;394;442	B4E372;B4DWG0;B3KVB1;O95199	.;.;.;RCBT2_HUMAN	W	442;394;447;447;168	ENSP00000345144:R442W;ENSP00000389910:R447W;ENSP00000443862:R168W	ENSP00000345144:R442W	R	-	1	2	RCBTB2	47971818	1.000000	0.71417	0.988000	0.46212	0.987000	0.75469	4.023000	0.57211	1.237000	0.43756	0.478000	0.44815	CGG	.	.		0.408	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268	
CYSLTR2	57105	hgsc.bcm.edu	37	13	49281801	49281801	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:49281801T>C	ENST00000282018.3	+	1	851	c.848T>C	c.(847-849)cTg>cCg	p.L283P		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	283					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)			endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	AAAGACAGACTGCATAAAGCT	0.458																																					p.L283P		Atlas-SNP	.											.	CYSLTR2	55	.	0			c.T848C						.						167.0	145.0	152.0					13																	49281801		2203	4300	6503	SO:0001583	missense	57105	exon1			ACAGACTGCATAA	AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.848T>C	chr13.hg19:g.49281801T>C	ENSP00000282018:p.Leu283Pro	88.0	0.0		71.0	4.0	NM_020377	Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	hg19	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	T	13.14	2.147339	0.37923	.	.	ENSG00000152207	ENST00000282018	T	0.32753	1.44	5.51	4.3	0.51218	GPCR, rhodopsin-like superfamily (1);	0.265818	0.24796	N	0.035531	T	0.57330	0.2046	M	0.87381	2.88	0.46798	D	0.999209	D	0.62365	0.991	D	0.66847	0.947	T	0.62520	-0.6837	10	0.87932	D	0	.	11.0643	0.47966	0.139:0.0:0.0:0.861	.	283	Q9NS75	CLTR2_HUMAN	P	283	ENSP00000282018:L283P	ENSP00000282018:L283P	L	+	2	0	CYSLTR2	48179802	1.000000	0.71417	0.411000	0.26484	0.327000	0.28475	5.009000	0.63998	0.903000	0.36546	0.533000	0.62120	CTG	.	.		0.458	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1		
CAB39L	81617	hgsc.bcm.edu	37	13	49913821	49913821	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:49913821A>G	ENST00000355854.4	-	7	1179	c.682T>C	c.(682-684)Tct>Cct	p.S228P	CAB39L_ENST00000347776.5_Missense_Mutation_p.S228P|CAB39L_ENST00000409308.1_Missense_Mutation_p.S228P|CAB39L_ENST00000410043.1_Missense_Mutation_p.S228P|CAB39L_ENST00000409130.1_Missense_Mutation_p.S84P	NM_030925.2	NP_112187.2	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	228					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|stomach(1)	12		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		ACCTTTAAAGACTGTCTCTTA	0.313																																					p.S228P		Atlas-SNP	.											.	CAB39L	35	.	0			c.T682C						.						48.0	48.0	48.0					13																	49913821		2196	4295	6491	SO:0001583	missense	81617	exon7			TTAAAGACTGTCT	AK022639	CCDS9416.2	13q14.11	2008-02-05			ENSG00000102547	ENSG00000102547			20290	protein-coding gene	gene with protein product		612175					Standard	NM_030925		Approved	bA103J18.3, FLJ12577, MO2L	uc001vcw.3	Q9H9S4	OTTHUMG00000016914	ENST00000355854.4:c.682T>C	chr13.hg19:g.49913821A>G	ENSP00000348113:p.Ser228Pro	126.0	0.0		92.0	4.0	NM_030925	Q5TAW6|Q6WG71|Q96FG1|Q9BZ33	Missense_Mutation	SNP	ENST00000355854.4	hg19	CCDS9416.2	.	.	.	.	.	.	.	.	.	.	A	24.0	4.482094	0.84747	.	.	ENSG00000102547	ENST00000355854;ENST00000347776;ENST00000378341;ENST00000409308;ENST00000409130;ENST00000425242;ENST00000410043	T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22	5.43	5.43	0.79202	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71151	0.3306	H	0.95850	3.73	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.81502	-0.0904	9	.	.	.	-19.2664	14.6657	0.68907	1.0:0.0:0.0:0.0	.	228	Q9H9S4	CB39L_HUMAN	P	228;228;205;228;84;171;228	ENSP00000348113:S228P;ENSP00000261669:S228P;ENSP00000386375:S228P;ENSP00000387245:S84P;ENSP00000416719:S171P;ENSP00000386328:S228P	.	S	-	1	0	CAB39L	48811822	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.827000	0.92041	2.071000	0.62044	0.418000	0.28097	TCT	.	.		0.313	CAB39L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044908.3	NM_030925	
ATP7B	540	hgsc.bcm.edu	37	13	52532539	52532539	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:52532539T>C	ENST00000242839.4	-	8	2419	c.2263A>G	c.(2263-2265)Aag>Gag	p.K755E	ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000542656.1_3'UTR|ATP7B_ENST00000418097.2_Missense_Mutation_p.K755E|ATP7B_ENST00000400366.3_Missense_Mutation_p.K644E|ATP7B_ENST00000417240.2_Missense_Mutation_p.K27E|ATP7B_ENST00000344297.5_Intron|ATP7B_ENST00000482841.1_Intron|ATP7B_ENST00000448424.2_Intron	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	755					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CTCTCCGCCTTCTCAGCCACA	0.552									Wilson disease																												p.K755E		Atlas-SNP	.											ATP7B,rectum,carcinoma,0,1	ATP7B	123	.	0			c.A2263G						.						112.0	118.0	116.0					13																	52532539		2081	4217	6298	SO:0001583	missense	540	exon8	Familial Cancer Database		CCGCCTTCTCAGC	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.2263A>G	chr13.hg19:g.52532539T>C	ENSP00000242839:p.Lys755Glu	99.0	0.0		88.0	5.0	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	hg19	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380353	0.61845	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000417240;ENST00000418097	D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62	5.54	3.12	0.35913	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.340362	0.34986	N	0.003532	D	0.90693	0.7080	L	0.38692	1.165	0.80722	D	1	P;B;B;P	0.38129	0.619;0.0;0.103;0.491	B;B;B;B	0.44108	0.441;0.001;0.024;0.184	D	0.84076	0.0382	10	0.19590	T	0.45	-7.6007	8.1175	0.30953	0.0:0.071:0.1469:0.782	.	755;27;644;755	F5H748;E7EQQ2;P35670-3;P35670	.;.;.;ATP7B_HUMAN	E	755;644;27;755	ENSP00000242839:K755E;ENSP00000383217:K644E;ENSP00000390360:K27E;ENSP00000393343:K755E	ENSP00000242839:K755E	K	-	1	0	ATP7B	51430540	1.000000	0.71417	0.984000	0.44739	0.884000	0.51177	2.560000	0.45896	0.386000	0.24997	0.460000	0.39030	AAG	.	.		0.552	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
VPS36	51028	hgsc.bcm.edu	37	13	52992177	52992177	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:52992177T>C	ENST00000378060.4	-	11	882	c.855A>G	c.(853-855)gaA>gaG	p.E285E		NM_001282168.1|NM_001282169.1|NM_016075.2	NP_001269097.1|NP_001269098.1|NP_057159.2	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36 homolog (S. cerevisiae)	285					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	17		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		TCACTAAATCTTCTGGTGAGA	0.373																																					p.E285E		Atlas-SNP	.											.	VPS36	38	.	0			c.A855G						.						82.0	75.0	77.0					13																	52992177		2203	4300	6503	SO:0001819	synonymous_variant	51028	exon11			TAAATCTTCTGGT	AF151903	CCDS9434.1, CCDS73577.1	13q14.13	2008-02-05	2007-01-12	2005-08-02	ENSG00000136100	ENSG00000136100			20312	protein-coding gene	gene with protein product		610903	"""chromosome 13 open reading frame 9"", ""vacuolar protein sorting 36 homolog (yeast)"""	C13orf9		11278625, 15755741	Standard	NM_016075		Approved	CGI-145, Eap45	uc001vgs.3	Q86VN1	OTTHUMG00000016964	ENST00000378060.4:c.855A>G	chr13.hg19:g.52992177T>C		55.0	0.0		41.0	4.0	NM_016075	A8K125|Q3ZCV7|Q5H9S1|Q5VXB6|Q9H8Z5|Q9Y3E3	Silent	SNP	ENST00000378060.4	hg19	CCDS9434.1																																																																																			.	.		0.373	VPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045059.3		
TEP1	7011	hgsc.bcm.edu	37	14	20840992	20840992	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:20840992T>C	ENST00000262715.5	-	49	7016	c.6976A>G	c.(6976-6978)Atc>Gtc	p.I2326V	TEP1_ENST00000545983.1_Intron|TEP1_ENST00000556935.1_Missense_Mutation_p.I2218V	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2326					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GAGGACCAGATCAGAGCACCA	0.512																																					p.I2326V		Atlas-SNP	.											.	TEP1	224	.	0			c.A6976G						.						117.0	103.0	108.0					14																	20840992		2203	4300	6503	SO:0001583	missense	7011	exon49			ACCAGATCAGAGC		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.6976A>G	chr14.hg19:g.20840992T>C	ENSP00000262715:p.Ile2326Val	69.0	0.0		98.0	5.0	NM_007110	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	hg19	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	T	0.161	-1.081192	0.01888	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.17370	2.28;2.28	5.91	-2.06	0.07298	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	1.308390	0.04774	N	0.428499	T	0.08358	0.0208	N	0.20685	0.6	0.26731	N	0.970588	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.31696	-0.9934	10	0.12103	T	0.63	-1.0348	1.5854	0.02643	0.129:0.1545:0.238:0.4786	.	2218;1669;2326	G3V5X7;G3V2A4;Q99973	.;.;TEP1_HUMAN	V	2326;2326;2218	ENSP00000262715:I2326V;ENSP00000452574:I2218V	ENSP00000262715:I2326V	I	-	1	0	TEP1	19910832	0.170000	0.23016	0.519000	0.27824	0.071000	0.16799	-0.683000	0.05179	-0.112000	0.11979	0.533000	0.62120	ATC	.	.		0.512	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
NDRG2	57447	hgsc.bcm.edu	37	14	21488710	21488710	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:21488710A>G	ENST00000556147.1	-	8	1440	c.500T>C	c.(499-501)gTc>gCc	p.V167A	NDRG2_ENST00000397844.2_Missense_Mutation_p.V153A|NDRG2_ENST00000397851.2_Missense_Mutation_p.V167A|NDRG2_ENST00000298687.5_Missense_Mutation_p.V167A|NDRG2_ENST00000298684.5_Intron|NDRG2_ENST00000397853.3_Missense_Mutation_p.V167A|NDRG2_ENST00000554277.1_5'UTR|NDRG2_ENST00000554143.1_Missense_Mutation_p.V153A|NDRG2_ENST00000350792.3_Missense_Mutation_p.V153A|NDRG2_ENST00000554104.1_Missense_Mutation_p.V80A|NDRG2_ENST00000403829.3_Missense_Mutation_p.V163A|NDRG2_ENST00000553503.1_Missense_Mutation_p.V153A|NDRG2_ENST00000397858.1_Missense_Mutation_p.V167A|NDRG2_ENST00000555158.1_Missense_Mutation_p.V153A|NDRG2_ENST00000397856.3_Missense_Mutation_p.V153A|NDRG2_ENST00000397855.3_Intron|NDRG2_ENST00000397847.2_Missense_Mutation_p.V167A|NDRG2_ENST00000360463.3_Missense_Mutation_p.V153A			Q9UN36	NDRG2_HUMAN	NDRG family member 2	167					cell differentiation (GO:0030154)|negative regulation of cytokine production (GO:0001818)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of platelet-derived growth factor production (GO:0090361)|regulation of vascular endothelial growth factor production (GO:0010574)|substantia nigra development (GO:0021762)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)				breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	23	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GTTGATGAGGACAAGACCTTC	0.557																																					p.V167A		Atlas-SNP	.											.	NDRG2	37	.	0			c.T500C						.						110.0	87.0	95.0					14																	21488710		2203	4300	6503	SO:0001583	missense	57447	exon8			ATGAGGACAAGAC	AB033074	CCDS9564.1, CCDS9565.1, CCDS61384.1, CCDS61386.1, CCDS73613.1	14q11.2	2008-07-09			ENSG00000165795	ENSG00000165795			14460	protein-coding gene	gene with protein product		605272				10831399	Standard	NM_201535		Approved	KIAA1248, SYLD	uc001vyx.3	Q9UN36	OTTHUMG00000029619	ENST00000556147.1:c.500T>C	chr14.hg19:g.21488710A>G	ENSP00000451712:p.Val167Ala	66.0	0.0		84.0	4.0	NM_201537	B3KUE3|B4DE86|B7WP11|B7WPD5|D3DS07|D3DS10|Q567T1|Q68DW2|Q86U08|Q86U46|Q96FD3|Q96FT0|Q96JU0|Q96PN0|Q9BQH5|Q9ULH2	Missense_Mutation	SNP	ENST00000556147.1	hg19	CCDS9565.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.9|24.9	4.581141|4.581141	0.86748|0.86748	.|.	.|.	ENSG00000165795|ENSG00000165795	ENST00000553593|ENST00000298687;ENST00000350792;ENST00000554770;ENST00000397858;ENST00000557633;ENST00000554104;ENST00000555158;ENST00000553503;ENST00000397853;ENST00000360463;ENST00000556147;ENST00000554143;ENST00000397851;ENST00000397847;ENST00000397856;ENST00000397844;ENST00000403829;ENST00000556008;ENST00000556366;ENST00000556974;ENST00000555026;ENST00000553867;ENST00000557169;ENST00000555869;ENST00000557182;ENST00000555733;ENST00000555384;ENST00000554094;ENST00000553442;ENST00000556420;ENST00000553784;ENST00000557149;ENST00000555142	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.27104	.|1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69;1.69	5.55|5.55	4.39|4.39	0.52855|0.52855	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52709|0.52709	0.1751|0.1751	M|M	0.86268|0.86268	2.805|2.805	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.91635	.|0.999;0.999;0.998;0.998;0.999	T|T	0.57522|0.57522	-0.7797|-0.7797	5|10	.|0.87932	.|D	.|0	-20.1741|-20.1741	10.4698|10.4698	0.44629|0.44629	0.8544:0.0:0.0:0.1456|0.8544:0.0:0.0:0.1456	.|.	.|163;167;153;148;167	.|B4DE86;Q9UN36-3;Q9UN36-5;G3V3N4;Q9UN36	.|.;.;.;.;NDRG2_HUMAN	P|A	83|167;153;148;167;110;80;153;153;167;153;167;153;167;167;153;153;163;153;80;153;153;167;153;153;112;167;167;153;153;153;167;153;153	.|ENSP00000298687:V167A;ENSP00000344620:V153A;ENSP00000380956:V167A;ENSP00000450835:V110A;ENSP00000452216:V80A;ENSP00000452038:V153A;ENSP00000452306:V153A;ENSP00000380951:V167A;ENSP00000353649:V153A;ENSP00000451712:V167A;ENSP00000452006:V153A;ENSP00000380949:V167A;ENSP00000380945:V167A;ENSP00000380954:V153A;ENSP00000380943:V153A;ENSP00000385889:V163A;ENSP00000451966:V153A;ENSP00000452413:V80A;ENSP00000452362:V153A;ENSP00000451274:V153A;ENSP00000450691:V167A;ENSP00000452334:V153A;ENSP00000451105:V153A;ENSP00000450545:V112A;ENSP00000452482:V167A;ENSP00000451094:V167A;ENSP00000452278:V153A;ENSP00000450493:V153A;ENSP00000451951:V153A;ENSP00000451059:V167A;ENSP00000452592:V153A;ENSP00000450513:V153A	.|ENSP00000298687:V167A	S|V	-|-	1|2	0|0	NDRG2|NDRG2	20558550|20558550	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.989000|0.989000	0.77384|0.77384	8.565000|8.565000	0.90730|0.90730	1.019000|1.019000	0.39547|0.39547	0.533000|0.533000	0.62120|0.62120	TCC|GTC	.	.		0.557	NDRG2-013	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411717.1		
ACIN1	22985	hgsc.bcm.edu	37	14	23532238	23532238	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:23532238T>C	ENST00000262710.1	-	14	3284	c.2957A>G	c.(2956-2958)aAg>aGg	p.K986R	ACIN1_ENST00000555053.1_Missense_Mutation_p.K973R|ACIN1_ENST00000357481.2_Missense_Mutation_p.K228R|ACIN1_ENST00000397341.3_Missense_Mutation_p.K228R|ACIN1_ENST00000605057.1_Missense_Mutation_p.K928R|ACIN1_ENST00000557515.1_Missense_Mutation_p.K227R|ACIN1_ENST00000457657.1_Missense_Mutation_p.K946R|ACIN1_ENST00000338631.6_Missense_Mutation_p.K259R	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	986					apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		AACTCCGGACTTCTGCTGGCT	0.483																																					p.K986R		Atlas-SNP	.											.	ACIN1	147	.	0			c.A2957G						.						175.0	162.0	166.0					14																	23532238		2203	4300	6503	SO:0001583	missense	22985	exon14			CCGGACTTCTGCT	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.2957A>G	chr14.hg19:g.23532238T>C	ENSP00000262710:p.Lys986Arg	71.0	0.0		82.0	4.0	NM_014977	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	hg19	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.531915	0.64972	.	.	ENSG00000100813	ENST00000557515;ENST00000338631;ENST00000357481;ENST00000262710;ENST00000457657;ENST00000397341;ENST00000555053	T;T;T;T;T;T	0.19394	3.42;3.42;2.2;2.21;3.42;2.15	5.5	4.35	0.52113	.	0.000000	0.42964	D	0.000622	T	0.26304	0.0642	L	0.40543	1.245	0.48341	D	0.999634	P;P;P;P;P	0.41498	0.708;0.584;0.752;0.607;0.607	P;B;P;B;B	0.53062	0.595;0.39;0.717;0.254;0.254	T	0.03641	-1.1017	10	0.22109	T	0.4	-21.1323	8.4596	0.32921	0.0:0.1566:0.0:0.8434	.	973;986;946;259;228	G3V3M7;Q9UKV3;E7EQT4;Q9UKV3-2;Q9UKV3-3	.;ACINU_HUMAN;.;.;.	R	227;259;228;986;946;228;973	ENSP00000345541:K259R;ENSP00000350073:K228R;ENSP00000262710:K986R;ENSP00000405677:K946R;ENSP00000380502:K228R;ENSP00000451328:K973R	ENSP00000262710:K986R	K	-	2	0	ACIN1	22602078	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.855000	0.48333	1.092000	0.41356	0.533000	0.62120	AAG	.	.		0.483	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
CTSG	1511	hgsc.bcm.edu	37	14	25044539	25044539	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:25044539A>G	ENST00000216336.2	-	2	171	c.135T>C	c.(133-135)ggT>ggC	p.G45G		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	45	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		ATCTGCTCTGACCTGCTGGAC	0.592																																					p.G45G		Atlas-SNP	.											.	CTSG	63	.	0			c.T135C						.						121.0	116.0	118.0					14																	25044539		2203	4300	6503	SO:0001819	synonymous_variant	1511	exon2			GCTCTGACCTGCT	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.135T>C	chr14.hg19:g.25044539A>G		68.0	0.0		82.0	4.0	NM_001911	Q6IBJ6|Q9UCA5|Q9UCU6	Silent	SNP	ENST00000216336.2	hg19	CCDS9631.1																																																																																			.	.		0.592	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911	
BAZ1A	11177	hgsc.bcm.edu	37	14	35272095	35272095	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:35272095T>C	ENST00000382422.2	-	6	1153	c.826A>G	c.(826-828)Aga>Gga	p.R276G	BAZ1A_ENST00000358716.4_Missense_Mutation_p.R276G|AL355885.1_ENST00000581314.1_RNA|BAZ1A_ENST00000360310.1_Missense_Mutation_p.R276G			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	276					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GGTCTCCCTCTTCGTCTGTTA	0.353																																					p.R276G		Atlas-SNP	.											.	BAZ1A	128	.	0			c.A826G						.						118.0	120.0	119.0					14																	35272095		2203	4300	6503	SO:0001583	missense	11177	exon7			TCCCTCTTCGTCT	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.826A>G	chr14.hg19:g.35272095T>C	ENSP00000371859:p.Arg276Gly	39.0	0.0		68.0	4.0	NM_182648	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	hg19	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.218559	0.39201	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310	T;T;T	0.59638	0.25;0.25;0.25	5.42	4.25	0.50352	.	0.050989	0.85682	D	0.000000	T	0.49423	0.1556	L	0.43152	1.355	0.44562	D	0.997526	P;P	0.46859	0.885;0.817	B;B	0.42495	0.389;0.217	T	0.45512	-0.9256	10	0.41790	T	0.15	.	10.5901	0.45304	0.0:0.0:0.3318:0.6681	.	276;276	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	G	276	ENSP00000351555:R276G;ENSP00000371859:R276G;ENSP00000353458:R276G	ENSP00000351555:R276G	R	-	1	2	BAZ1A	34341846	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.745000	0.38278	0.953000	0.37825	0.533000	0.62120	AGA	.	.		0.353	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
PPP2R3C	55012	hgsc.bcm.edu	37	14	35585916	35585916	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:35585916T>C	ENST00000261475.5	-	2	439	c.86A>G	c.(85-87)gAt>gGt	p.D29G	PPP2R3C_ENST00000555644.1_Missense_Mutation_p.D29G	NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	29					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		CATTTCTTCATCTTTTAATTC	0.303																																					p.D29G		Atlas-SNP	.											PPP2R3C,right_upper_lobe,carcinoma,0,1	PPP2R3C	44	.	0			c.A86G						.						64.0	66.0	66.0					14																	35585916		2202	4298	6500	SO:0001583	missense	55012	exon2			TCTTCATCTTTTA	AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.86A>G	chr14.hg19:g.35585916T>C	ENSP00000261475:p.Asp29Gly	39.0	0.0		55.0	4.0	NM_017917	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	ENST00000261475.5	hg19	CCDS9654.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.817984	0.50633	.	.	ENSG00000092020	ENST00000261475;ENST00000554361;ENST00000555644;ENST00000557278	T	0.49720	0.77	5.02	5.02	0.67125	.	0.154878	0.56097	D	0.000023	T	0.36138	0.0956	L	0.29908	0.895	0.40099	D	0.976348	B;P;B	0.34977	0.073;0.478;0.102	B;B;B	0.33960	0.059;0.173;0.049	T	0.20009	-1.0288	10	0.24483	T	0.36	-9.371	15.0444	0.71816	0.0:0.0:0.0:1.0	.	29;29;29	G3V2K1;Q86US5;Q969Q6	.;.;P2R3C_HUMAN	G	29	ENSP00000450716:D29G	ENSP00000261475:D29G	D	-	2	0	PPP2R3C	34655667	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.085000	0.64468	1.999000	0.58509	0.459000	0.35465	GAT	.	.		0.303	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276687.1	NM_017917	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36128344	36128344	+	Splice_Site	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:36128344C>T	ENST00000389698.3	-	27	4259	c.3869G>A	c.(3868-3870)cGa>cAa	p.R1290Q	RALGAPA1_ENST00000258840.6_Splice_Site_p.R1337Q|RALGAPA1_ENST00000307138.6_Splice_Site_p.R1290Q|RALGAPA1_ENST00000382366.3_Splice_Site_p.R1303Q	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1290					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCCGACCTACCGTGCAGGACC	0.368																																					p.R1290Q		Atlas-SNP	.											RALGAPA1_ENST00000307138,bladder,carcinoma,0,2	RALGAPA1	289	.	0			c.G3869A						.						63.0	60.0	61.0					14																	36128344		2202	4300	6502	SO:0001630	splice_region_variant	253959	exon27			ACCTACCGTGCAG	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.3869+1G>A	chr14.hg19:g.36128344C>T		27.0	1.0		28.0	2.0	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	hg19	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	36	5.774933	0.96922	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.88463	0.6443	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.98;0.999;0.994	D	0.87228	0.2258	9	.	.	.	-7.1273	20.0763	0.97746	0.0:1.0:0.0:0.0	.	1337;1303;1290;1290	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	Q	1290;1290;1290;1337;1303;1337	ENSP00000374348:R1290Q;ENSP00000302647:R1290Q;ENSP00000258840:R1337Q;ENSP00000371803:R1303Q;ENSP00000451877:R1337Q	.	R	-	2	0	RALGAPA1	35198095	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.636000	0.74299	2.756000	0.94617	0.655000	0.94253	CGA	.	.		0.368	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	Missense_Mutation
CLEC14A	161198	hgsc.bcm.edu	37	14	38725216	38725216	+	Silent	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:38725216C>A	ENST00000342213.2	-	1	358	c.12G>T	c.(10-12)gcG>gcT	p.A4A		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	4						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		ACAGGGCGAACGCCGGCCTCA	0.726																																					p.A4A		Atlas-SNP	.											.	CLEC14A	83	.	0			c.G12T						.						2.0	2.0	2.0					14																	38725216		1382	2852	4234	SO:0001819	synonymous_variant	161198	exon1			GGCGAACGCCGGC		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.12G>T	chr14.hg19:g.38725216C>A		38.0	0.0		85.0	46.0	NM_175060	Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	ENST00000342213.2	hg19	CCDS9667.1																																																																																			.	.		0.726	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
FANCM	57697	hgsc.bcm.edu	37	14	45623916	45623916	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:45623916A>G	ENST00000267430.5	+	7	1285	c.1200A>G	c.(1198-1200)aaA>aaG	p.K400K	FANCM_ENST00000542564.2_Silent_p.K374K|FANCM_ENST00000556036.1_Silent_p.K400K	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	400					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CACGGTCAAAAAATGAACTTG	0.284								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.K400K		Atlas-SNP	.											.	FANCM	225	.	0			c.A1200G						.						74.0	72.0	73.0					14																	45623916		2203	4300	6503	SO:0001819	synonymous_variant	57697	exon7	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GTCAAAAAATGAA	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1200A>G	chr14.hg19:g.45623916A>G		68.0	0.0		75.0	23.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	hg19	CCDS32070.1																																																																																			.	.		0.284	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
WDHD1	11169	hgsc.bcm.edu	37	14	55408356	55408356	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:55408356T>C	ENST00000360586.3	-	26	3307	c.3242A>G	c.(3241-3243)aAg>aGg	p.K1081R	WDHD1_ENST00000420358.2_Missense_Mutation_p.K958R|WDHD1_ENST00000359167.4_Missense_Mutation_p.K599R|WDHD1_ENST00000421192.1_Missense_Mutation_p.K958R	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	1081					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						TTTTCGCTTCTTTGCTTCAGT	0.373																																					p.K1081R		Atlas-SNP	.											.	WDHD1	82	.	0			c.A3242G						.						147.0	151.0	150.0					14																	55408356		2202	4300	6502	SO:0001583	missense	11169	exon26			CGCTTCTTTGCTT	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.3242A>G	chr14.hg19:g.55408356T>C	ENSP00000353793:p.Lys1081Arg	138.0	0.0		82.0	4.0	NM_007086	C9JW18|F6W0U7	Missense_Mutation	SNP	ENST00000360586.3	hg19	CCDS9721.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.698135	0.68386	.	.	ENSG00000198554	ENST00000360586;ENST00000359167;ENST00000421192	T;T;T	0.65364	0.21;0.66;-0.15	5.68	5.68	0.88126	High mobility group, HMG1/HMG2 (2);	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	M	0.76002	2.32	0.53688	D	0.999971	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.79135	-0.1928	10	0.48119	T	0.1	.	14.1504	0.65381	0.0:0.0:0.0:1.0	.	599;1081	F8W7P7;O75717	.;WDHD1_HUMAN	R	1081;599;958	ENSP00000353793:K1081R;ENSP00000352085:K599R;ENSP00000391049:K958R	ENSP00000352085:K599R	K	-	2	0	WDHD1	54478106	1.000000	0.71417	1.000000	0.80357	0.376000	0.30014	4.985000	0.63845	2.166000	0.68216	0.533000	0.62120	AAG	.	.		0.373	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086	
SPTB	6710	hgsc.bcm.edu	37	14	65249105	65249105	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:65249105T>C	ENST00000389721.5	-	19	4201	c.4169A>G	c.(4168-4170)gAc>gGc	p.D1390G	SPTB_ENST00000389722.3_Missense_Mutation_p.D1390G|SPTB_ENST00000556626.1_Missense_Mutation_p.D1390G|SPTB_ENST00000542895.1_Missense_Mutation_p.D1390G|SPTB_ENST00000389720.3_Missense_Mutation_p.D1390G	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1390					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTTGTTGAGGTCAGCATGGGT	0.622																																					p.D1390G		Atlas-SNP	.											.	SPTB	378	.	0			c.A4169G						.						104.0	94.0	97.0					14																	65249105		2203	4300	6503	SO:0001583	missense	6710	exon19			TTGAGGTCAGCAT		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4169A>G	chr14.hg19:g.65249105T>C	ENSP00000374371:p.Asp1390Gly	100.0	0.0		94.0	4.0	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	hg19	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.701811	0.88924	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48	5.36	5.36	0.76844	.	0.048891	0.85682	D	0.000000	T	0.73567	0.3603	M	0.81682	2.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.991;0.964	T	0.77702	-0.2489	10	0.72032	D	0.01	.	14.6216	0.68588	0.0:0.0:0.0:1.0	.	174;1390;1394	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	G	1394;1390;174;55;1390;1390;1390;1390	ENSP00000374372:D1390G;ENSP00000451324:D55G;ENSP00000451752:D1390G;ENSP00000374371:D1390G;ENSP00000443882:D1390G;ENSP00000374370:D1390G	ENSP00000334218:D174G	D	-	2	0	SPTB	64318858	1.000000	0.71417	0.997000	0.53966	0.886000	0.51366	6.290000	0.72712	2.165000	0.68154	0.379000	0.24179	GAC	.	.		0.622	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
LTBP2	4053	hgsc.bcm.edu	37	14	75070369	75070369	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:75070369T>C	ENST00000261978.4	-	2	920	c.534A>G	c.(532-534)acA>acG	p.T178T	LTBP2_ENST00000557425.1_Intron|LTBP2_ENST00000556690.1_Silent_p.T178T	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	178					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGTTTGCTGTTGTCCATCCTG	0.552																																					p.T178T		Atlas-SNP	.											.	LTBP2	158	.	0			c.A534G						.						389.0	267.0	309.0					14																	75070369		2203	4300	6503	SO:0001819	synonymous_variant	4053	exon2			TGCTGTTGTCCAT		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.534A>G	chr14.hg19:g.75070369T>C		165.0	0.0		94.0	4.0	NM_000428	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	hg19	CCDS9831.1																																																																																			.	.		0.552	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
YLPM1	56252	hgsc.bcm.edu	37	14	75230847	75230847	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:75230847A>G	ENST00000552421.1	+	1	779	c.655A>G	c.(655-657)Agc>Ggc	p.S219G	YLPM1_ENST00000325680.7_Missense_Mutation_p.S219G|YLPM1_ENST00000238571.3_Missense_Mutation_p.S219G			P49750	YLPM1_HUMAN	YLP motif containing 1	219					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		ATCCTATTTGAGCCATTCCCA	0.592																																					p.S219G		Atlas-SNP	.											.	YLPM1	298	.	0			c.A655G						.						104.0	109.0	108.0					14																	75230847		2002	4167	6169	SO:0001583	missense	56252	exon1			TATTTGAGCCATT	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.655A>G	chr14.hg19:g.75230847A>G	ENSP00000447921:p.Ser219Gly	129.0	0.0		91.0	4.0	NM_019589	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	ENST00000552421.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.838	1.190255	0.21954	.	.	ENSG00000119596	ENST00000552421;ENST00000325680;ENST00000238571	T;T;T	0.24723	1.84;1.84;1.84	4.55	3.39	0.38822	.	0.232528	0.31092	N	0.008276	T	0.11153	0.0272	N	0.08118	0	0.19945	N	0.999942	B	0.28636	0.218	B	0.30029	0.11	T	0.26503	-1.0101	10	0.16896	T	0.51	-5.33	7.5504	0.27793	0.7604:0.2396:0.0:0.0	.	219	P49750-4	.	G	219	ENSP00000447921:S219G;ENSP00000324463:S219G;ENSP00000238571:S219G	ENSP00000238571:S219G	S	+	1	0	YLPM1	74300600	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.507000	0.35758	1.901000	0.55032	0.528000	0.53228	AGC	.	.		0.592	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
LRRC74A	145497	hgsc.bcm.edu	37	14	77292857	77292857	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:77292857T>C	ENST00000393774.3	+	1	143	c.19T>C	c.(19-21)Tca>Cca	p.S7P	C14orf166B_ENST00000460005.1_3'UTR|C14orf166B_ENST00000450042.2_5'UTR|C14orf166B_ENST00000216453.5_5'Flank	NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CCAATTCCCATCAAAGCCTAC	0.547																																					p.S7P	Ovarian(165;1056 1958 32571 36789 48728)	Atlas-SNP	.											.	C14orf166B	52	.	0			c.T19C						.						68.0	71.0	70.0					14																	77292857		692	1591	2283	SO:0001583	missense	145497	exon1			TTCCCATCAAAGC																												ENST00000393774.3:c.19T>C	chr14.hg19:g.77292857T>C	ENSP00000377369:p.Ser7Pro	83.0	0.0		73.0	5.0	NM_194287		Missense_Mutation	SNP	ENST00000393774.3	hg19	CCDS9853.2	.	.	.	.	.	.	.	.	.	.	T	0.794	-0.757828	0.03019	.	.	ENSG00000100565	ENST00000393774;ENST00000555189	T	0.37058	1.22	5.23	-1.77	0.07982	.	.	.	.	.	T	0.13756	0.0333	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.19811	-1.0294	9	0.34782	T	0.22	.	0.2718	0.00232	0.2958:0.2877:0.1449:0.2717	.	7	Q0VAA2	CN16B_HUMAN	P	7	ENSP00000377369:S7P	ENSP00000216450:S7P	S	+	1	0	C14orf166B	76362610	0.016000	0.18221	0.002000	0.10522	0.016000	0.09150	-0.442000	0.06871	-0.333000	0.08476	-0.621000	0.04028	TCA	.	.		0.547	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316592.1		
WDR20	91833	hgsc.bcm.edu	37	14	102676047	102676047	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:102676047T>C	ENST00000342702.3	+	3	1571	c.1540T>C	c.(1540-1542)Tgt>Cgt	p.C514R	WDR20_ENST00000335263.5_Missense_Mutation_p.C514R|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000499851.2_Missense_Mutation_p.C257R|WDR20_ENST00000556807.1_Missense_Mutation_p.C453R|WDR20_ENST00000556511.2_Missense_Mutation_p.C453R|WDR20_ENST00000545563.1_Missense_Mutation_p.C341R|WDR20_ENST00000424963.2_Missense_Mutation_p.C390R|WDR20_ENST00000454394.2_Missense_Mutation_p.C545R	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	514										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						AACGCCCCTGTGTCCTCGAAT	0.418											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C545R		Atlas-SNP	.											.	WDR20	35	.	0			c.T1633C						.						96.0	93.0	94.0					14																	102676047		2203	4300	6503	SO:0001583	missense	91833	exon4			CCCCTGTGTCCTC	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1540T>C	chr14.hg19:g.102676047T>C	ENSP00000341037:p.Cys514Arg	103.0	0.0	1368	61.0	4.0	NM_001242417	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	ENST00000342702.3	hg19	CCDS9969.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.12|17.12	3.308261|3.308261	0.60305|0.60305	.|.	.|.	ENSG00000140153|ENSG00000140153	ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000499851;ENST00000454394;ENST00000401892;ENST00000545563|ENST00000556511	D;D;D;D;D;D;D|.	0.92199|.	-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78622|0.78622	0.4312|0.4312	M|M	0.82716|0.82716	2.605|2.605	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;0.992;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	0.999;0.999;0.998;1.0;1.0;0.982;0.999|.	T|T	0.80358|0.80358	-0.1416|-0.1416	10|5	0.72032|.	D|.	0.01|.	.|.	16.2159|16.2159	0.82217|0.82217	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	545;526;453;514;453;390;514|.	E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3|.	.;.;.;.;.;.;WDR20_HUMAN|.	R|A	514;453;390;514;453;257;545;444;341|444	ENSP00000335434:C514R;ENSP00000395793:C390R;ENSP00000341037:C514R;ENSP00000450636:C453R;ENSP00000443641:C257R;ENSP00000406084:C545R;ENSP00000437927:C341R|.	ENSP00000299135:C453R|.	C|V	+|+	1|2	0|0	WDR20|WDR20	101745800|101745800	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.691000|7.691000	0.84191|0.84191	2.243000|2.243000	0.73865|0.73865	0.533000|0.533000	0.62120|0.62120	TGT|GTG	.	.		0.418	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
TRPM1	4308	hgsc.bcm.edu	37	15	31355371	31355371	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:31355371T>C	ENST00000256552.6	-	8	1062	c.915A>G	c.(913-915)ggA>ggG	p.G305G	MIR211_ENST00000384969.1_RNA|TRPM1_ENST00000397795.2_Silent_p.G283G|TRPM1_ENST00000542188.1_Silent_p.G322G	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CCGAGGCACGTCCGCTGCCAT	0.577																																					p.G322G		Atlas-SNP	.											.	TRPM1	183	.	0			c.A966G						.						61.0	66.0	64.0					15																	31355371		2052	4210	6262	SO:0001819	synonymous_variant	4308	exon7			GGCACGTCCGCTG	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.915A>G	chr15.hg19:g.31355371T>C		61.0	0.0		94.0	36.0	NM_001252020		Silent	SNP	ENST00000256552.6	hg19	CCDS58346.1																																																																																			.	.		0.577	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
RYR3	6263	hgsc.bcm.edu	37	15	33993260	33993260	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:33993260A>G	ENST00000389232.4	+	42	6532	c.6462A>G	c.(6460-6462)ttA>ttG	p.L2154L	RYR3_ENST00000415757.3_Silent_p.L2154L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2154	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGCTGAGCTTAGAGGAACCAG	0.582											OREG0023030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L2154L		Atlas-SNP	.											.	RYR3	760	.	0			c.A6462G						.						60.0	64.0	63.0					15																	33993260		2003	4183	6186	SO:0001819	synonymous_variant	6263	exon42			GAGCTTAGAGGAA		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6462A>G	chr15.hg19:g.33993260A>G		60.0	0.0	844	72.0	4.0	NM_001243996	O15175|Q15412	Silent	SNP	ENST00000389232.4	hg19	CCDS45210.1																																																																																			.	.		0.582	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
AQR	9716	hgsc.bcm.edu	37	15	35222481	35222481	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:35222481T>A	ENST00000156471.5	-	12	1217	c.992A>T	c.(991-993)tAt>tTt	p.Y331F		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	331					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AATTCTATCATAGTGAATTGT	0.323																																					p.Y331F		Atlas-SNP	.											.	AQR	139	.	0			c.A992T						.						147.0	141.0	143.0					15																	35222481		1816	4072	5888	SO:0001583	missense	9716	exon12			CTATCATAGTGAA	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.992A>T	chr15.hg19:g.35222481T>A	ENSP00000156471:p.Tyr331Phe	27.0	0.0		35.0	11.0	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	hg19	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.973549	0.92919	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.94650	-3.48	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.97832	0.9288	M	0.93854	3.465	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	D	0.98019	1.0370	10	0.37606	T	0.19	-17.9983	16.1448	0.81559	0.0:0.0:0.0:1.0	.	331	O60306	AQR_HUMAN	F	331	ENSP00000156471:Y331F	ENSP00000156471:Y331F	Y	-	2	0	AQR	33009773	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.920000	0.87521	2.216000	0.71823	0.482000	0.46254	TAT	.	.		0.323	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
PLCB2	5330	hgsc.bcm.edu	37	15	40584596	40584596	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:40584596A>G	ENST00000260402.3	-	22	2624	c.2375T>C	c.(2374-2376)aTg>aCg	p.M792T	PLCB2_ENST00000456256.2_Missense_Mutation_p.M792T|PLCB2_ENST00000557821.1_Missense_Mutation_p.M788T	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	792					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GAGCGCAGGCATGGTGAGGGG	0.607																																					p.M792T		Atlas-SNP	.											.	PLCB2	177	.	0			c.T2375C						.						78.0	87.0	84.0					15																	40584596		2110	4232	6342	SO:0001583	missense	5330	exon22			GCAGGCATGGTGA		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.2375T>C	chr15.hg19:g.40584596A>G	ENSP00000260402:p.Met792Thr	64.0	0.0		80.0	4.0	NM_004573	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	hg19	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.476398	0.63737	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.13307	2.6;2.6	5.1	5.1	0.69264	C2 calcium/lipid-binding domain, CaLB (1);	0.049953	0.85682	D	0.000000	T	0.21468	0.0517	L	0.39898	1.24	0.80722	D	1	D;P;P	0.60575	0.988;0.602;0.508	P;B;B	0.52957	0.714;0.055;0.129	T	0.00645	-1.1629	10	0.66056	D	0.02	.	15.0426	0.71803	1.0:0.0:0.0:0.0	.	792;788;792	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	T	792	ENSP00000260402:M792T;ENSP00000411991:M792T	ENSP00000260402:M792T	M	-	2	0	PLCB2	38371888	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.074000	0.93998	2.142000	0.66516	0.533000	0.62120	ATG	.	.		0.607	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
MGA	23269	hgsc.bcm.edu	37	15	42003112	42003112	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:42003112T>C	ENST00000570161.1	+	7	2649	c.2649T>C	c.(2647-2649)tcT>tcC	p.S883S	MGA_ENST00000566586.1_Silent_p.S883S|MGA_ENST00000219905.7_Silent_p.S883S|MGA_ENST00000545763.1_Silent_p.S883S|MGA_ENST00000389936.4_Silent_p.S883S			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTTCTACCTCTTATTCTTTGA	0.413																																					p.S883S		Atlas-SNP	.											.	MGA	264	.	0			c.T2649C						.						137.0	132.0	134.0					15																	42003112		1852	4089	5941	SO:0001819	synonymous_variant	23269	exon8			TACCTCTTATTCT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.2649T>C	chr15.hg19:g.42003112T>C		61.0	0.0		65.0	4.0	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	hg19	CCDS55959.1																																																																																			.	.		0.413	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
SPTBN5	51332	hgsc.bcm.edu	37	15	42173320	42173320	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:42173320T>C	ENST00000320955.6	-	13	2797	c.2570A>G	c.(2569-2571)gAg>gGg	p.E857G		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	857					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		AGGGTCAGGCTCAGCTGGGAG	0.597																																					p.E822G		Atlas-SNP	.											.	SPTBN5	171	.	0			c.A2465G						.						59.0	64.0	62.0					15																	42173320		2032	4190	6222	SO:0001583	missense	51332	exon13			TCAGGCTCAGCTG	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.2570A>G	chr15.hg19:g.42173320T>C	ENSP00000317790:p.Glu857Gly	98.0	0.0		100.0	4.0	NM_016642		Missense_Mutation	SNP	ENST00000320955.6	hg19		.	.	.	.	.	.	.	.	.	.	.	9.740	1.164692	0.21538	.	.	ENSG00000137877	ENST00000320955	T	0.68181	-0.31	4.17	3.02	0.34903	.	0.857644	0.10341	N	0.686334	T	0.53012	0.1770	L	0.32530	0.975	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.39251	-0.9623	10	0.33141	T	0.24	.	7.6684	0.28445	0.0:0.0:0.2154:0.7846	.	857	Q9NRC6	SPTN5_HUMAN	G	857	ENSP00000317790:E857G	ENSP00000317790:E857G	E	-	2	0	SPTBN5	39960612	0.149000	0.22717	0.001000	0.08648	0.015000	0.08874	1.983000	0.40648	0.463000	0.27118	0.379000	0.24179	GAG	.	.		0.597	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
MAPK6	5597	hgsc.bcm.edu	37	15	52350974	52350974	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:52350974T>C	ENST00000261845.5	+	4	1652	c.845T>C	c.(844-846)cTt>cCt	p.L282P	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	282	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		ACTCAGCTGCTTCCAGGAATT	0.448																																					p.L282P		Atlas-SNP	.											.	MAPK6	70	.	0			c.T845C						.						78.0	68.0	71.0					15																	52350974		2195	4293	6488	SO:0001583	missense	5597	exon4			AGCTGCTTCCAGG	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.845T>C	chr15.hg19:g.52350974T>C	ENSP00000261845:p.Leu282Pro	76.0	0.0		94.0	4.0	NM_002748	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	hg19	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.646411	0.87958	.	.	ENSG00000069956	ENST00000261845	T	0.41758	0.99	5.08	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49098	0.1537	N	0.16368	0.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56872	-0.7907	10	0.87932	D	0	-8.0325	14.8562	0.70338	0.0:0.0:0.0:1.0	.	282	Q16659	MK06_HUMAN	P	282	ENSP00000261845:L282P	ENSP00000261845:L282P	L	+	2	0	MAPK6	50138266	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.031000	0.88826	1.931000	0.55961	0.377000	0.23210	CTT	.	.		0.448	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
DAPK2	23604	hgsc.bcm.edu	37	15	64275877	64275877	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:64275877G>A	ENST00000457488.1	-	3	199	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	DAPK2_ENST00000558069.1_Missense_Mutation_p.R57W|DAPK2_ENST00000261891.3_Missense_Mutation_p.R57W|DAPK2_ENST00000558482.1_5'UTR	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	57	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		CGGCTCTGCCGCTTCTTGATG	0.622																																					p.R57W		Atlas-SNP	.											.	DAPK2	31	.	0			c.C169T						.						35.0	35.0	35.0					15																	64275877		2203	4300	6503	SO:0001583	missense	23604	exon3			TCTGCCGCTTCTT	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.169C>T	chr15.hg19:g.64275877G>A	ENSP00000408277:p.Arg57Trp	39.0	0.0		108.0	20.0	NM_014326	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	hg19	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438708	0.83885	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.67698	-0.28;-0.28	5.35	3.38	0.38709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.78342	0.4268	M	0.62154	1.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79157	-0.1919	10	0.87932	D	0	.	13.1348	0.59403	0.0:0.0:0.6989:0.3011	.	57;57	E9JGM7;Q9UIK4	.;DAPK2_HUMAN	W	57	ENSP00000261891:R57W;ENSP00000408277:R57W	ENSP00000261891:R57W	R	-	1	2	DAPK2	62062930	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.616000	0.61197	0.557000	0.29117	0.555000	0.69702	CGG	.	.		0.622	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
DPP8	54878	hgsc.bcm.edu	37	15	65739300	65739300	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:65739300T>C	ENST00000341861.5	-	20	4199	c.2619A>G	c.(2617-2619)ggA>ggG	p.G873G	DPP8_ENST00000339244.5_Silent_p.G700G|DPP8_ENST00000300141.6_Silent_p.G857G|DPP8_ENST00000321118.7_Silent_p.G824G|DPP8_ENST00000559233.1_Silent_p.G873G|DPP8_ENST00000321147.6_Silent_p.G822G|DPP8_ENST00000358939.4_Silent_p.G757G	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	873					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CATAATGTTCTCCCGATTCAG	0.343																																					p.G873G		Atlas-SNP	.											.	DPP8	78	.	0			c.A2619G						.						148.0	145.0	146.0					15																	65739300		2201	4299	6500	SO:0001819	synonymous_variant	54878	exon21			ATGTTCTCCCGAT	AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.2619A>G	chr15.hg19:g.65739300T>C		50.0	0.0		112.0	5.0	NM_197960	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Silent	SNP	ENST00000341861.5	hg19	CCDS10207.1																																																																																			.	.		0.343	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256847.1	NM_017743	
ANKRD34C	390616	hgsc.bcm.edu	37	15	79587136	79587136	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:79587136A>T	ENST00000558647.2	+	1	1510	c.1510A>T	c.(1510-1512)Aga>Tga	p.R504*	ANKRD34C_ENST00000421388.2_Nonsense_Mutation_p.R504*			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	504										endometrium(3)|kidney(1)|skin(1)	5						TTCACCAAAGAGAGTTGACTT	0.393																																					p.R504X		Atlas-SNP	.											.	ANKRD34C	29	.	0			c.A1510T						.						57.0	45.0	48.0					15																	79587136		685	1584	2269	SO:0001587	stop_gained	390616	exon2			CCAAAGAGAGTTG		CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1510A>T	chr15.hg19:g.79587136A>T	ENSP00000454921:p.Arg504*	52.0	0.0		60.0	36.0	NM_001146341	H3BNM1	Nonsense_Mutation	SNP	ENST00000558647.2	hg19	CCDS53965.1	.	.	.	.	.	.	.	.	.	.	A	38	7.209483	0.98136	.	.	ENSG00000235711	ENST00000421388	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.487	0.33078	0.8034:0.1966:0.0:0.0	.	.	.	.	X	504	.	ENSP00000401089:R504X	R	+	1	2	ANKRD34C	77374191	1.000000	0.71417	0.985000	0.45067	0.218000	0.24690	1.285000	0.33261	1.966000	0.57179	0.533000	0.62120	AGA	.	.		0.393	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2	NM_001146341	
CPEB1	64506	hgsc.bcm.edu	37	15	83296065	83296065	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:83296065A>G	ENST00000562019.1	-	2	385	c.69T>C	c.(67-69)gcT>gcC	p.A23A	CPEB1_ENST00000568757.1_5'UTR|CPEB1_ENST00000450751.2_5'UTR|CPEB1_ENST00000568128.1_Silent_p.A23A|CPEB1_ENST00000563800.1_Silent_p.A50A			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	23					cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			ACGTGGAGAGAGCAGGTGCTT	0.393																																					p.A23A		Atlas-SNP	.											.	CPEB1	114	.	0			c.T69C						.						98.0	96.0	97.0					15																	83296065		1886	4118	6004	SO:0001819	synonymous_variant	64506	exon2			GGAGAGAGCAGGT	AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.69T>C	chr15.hg19:g.83296065A>G		57.0	0.0		87.0	4.0	NM_030594	B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Silent	SNP	ENST00000562019.1	hg19																																																																																				.	.		0.393	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000421102.1	NM_030594	
SLC28A1	9154	hgsc.bcm.edu	37	15	85438313	85438313	+	Silent	SNP	C	C	T	rs371921369|rs2277576		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:85438313C>T	ENST00000286749.3	+	5	510	c.420C>T	c.(418-420)ctC>ctT	p.L140L	SLC28A1_ENST00000537703.1_Silent_p.L62L|SLC28A1_ENST00000338602.2_Silent_p.L140L|SLC28A1_ENST00000537216.1_Silent_p.L140L|SLC28A1_ENST00000394573.1_Silent_p.L140L|SLC28A1_ENST00000537624.1_Silent_p.L140L|SLC28A1_ENST00000538177.1_Silent_p.L140L			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	140			L -> LV (in A). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9124315}.		nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)	p.L140L(2)		breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	GGAGGTTTCTCAAGCCTCAGG	0.637																																					p.L140L		Atlas-SNP	.											SLC28A1_ENST00000338602,NS,carcinoma,0,1	SLC28A1	118	.	2	Substitution - coding silent(2)	lung(2)	c.C420T						.						45.0	47.0	47.0					15																	85438313		2203	4298	6501	SO:0001819	synonymous_variant	9154	exon6			GTTTCTCAAGCCT	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.420C>T	chr15.hg19:g.85438313C>T		67.0	1.0		124.0	5.0	NM_201651	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	hg19	CCDS10334.1																																																																																			.	.		0.637	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
WDR90	197335	hgsc.bcm.edu	37	16	699822	699822	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:699822T>C	ENST00000293879.4	+	2	70	c.70T>C	c.(70-72)Tcc>Ccc	p.S24P	WDR90_ENST00000549091.1_Missense_Mutation_p.S24P|AL022341.3_ENST00000455294.1_RNA			Q96KV7	WDR90_HUMAN	WD repeat domain 90	24										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GTGGAAGCGCTCCGCCAAGCA	0.751																																					p.S24P		Atlas-SNP	.											.	WDR90	107	.	0			c.T70C						.						5.0	7.0	6.0					16																	699822		1828	3983	5811	SO:0001583	missense	197335	exon2			AAGCGCTCCGCCA	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.70T>C	chr16.hg19:g.699822T>C	ENSP00000293879:p.Ser24Pro	33.0	0.0		37.0	4.0	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	hg19	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685818	0.47991	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.44083	0.93;0.93	4.33	4.33	0.51752	.	0.000000	0.28052	U	0.016793	T	0.60235	0.2253	M	0.65975	2.015	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.995	D;D;P	0.71184	0.952;0.972;0.885	T	0.64093	-0.6488	10	0.66056	D	0.02	.	12.6356	0.56681	0.0:0.0:0.0:1.0	.	24;24;24	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	P	24	ENSP00000448122:S24P;ENSP00000293879:S24P	ENSP00000293879:S24P	S	+	1	0	WDR90	639823	0.999000	0.42202	0.864000	0.33941	0.151000	0.21798	3.170000	0.50816	1.734000	0.51633	0.496000	0.49642	TCC	.	.		0.751	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
CCNF	899	hgsc.bcm.edu	37	16	2487180	2487180	+	Missense_Mutation	SNP	C	C	T	rs138913390		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:2487180C>T	ENST00000397066.4	+	5	485	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	133					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GAAGGCCTCTCGCTTCTTCAG	0.607																																					p.R133C		Atlas-SNP	.											.	CCNF	110	.	0			c.C397T						.	C	CYS/ARG	1,4395	2.1+/-5.4	0,1,2197	93.0	92.0	92.0		397	5.0	0.9	16	dbSNP_134	92	0,8600		0,0,4300	no	missense	CCNF	NM_001761.2	180	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	133/787	2487180	1,12995	2198	4300	6498	SO:0001583	missense	899	exon5			GCCTCTCGCTTCT	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.397C>T	chr16.hg19:g.2487180C>T	ENSP00000380256:p.Arg133Cys	47.0	0.0		58.0	4.0	NM_001761	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	hg19	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470467	0.63625	2.27E-4	0.0	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.26067	1.76	5.92	4.98	0.66077	.	0.263540	0.45126	D	0.000392	T	0.29061	0.0722	L	0.60455	1.87	0.58432	D	0.999999	D	0.55605	0.972	B	0.42386	0.386	T	0.12553	-1.0543	10	0.87932	D	0	-23.4429	13.8262	0.63352	0.0:0.9263:0.0:0.0737	.	133	P41002	CCNF_HUMAN	C	133;48	ENSP00000380256:R133C	ENSP00000293968:R48C	R	+	1	0	CCNF	2427181	1.000000	0.71417	0.931000	0.37212	0.384000	0.30261	5.888000	0.69758	1.518000	0.48934	-0.136000	0.14681	CGC	.	C|1.000;T|0.000		0.607	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	
OR1F1	4992	hgsc.bcm.edu	37	16	3254975	3254975	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:3254975T>C	ENST00000304646.2	+	1	729	c.729T>C	c.(727-729)tcT>tcC	p.S243S	AJ003147.9_ENST00000576468.1_RNA	NM_012360.1	NP_036492.1	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F, member 1	243					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(2)|lung(7)	11						CCTGTGGTTCTCACCTGGCTG	0.493																																					p.S243S		Atlas-SNP	.											.	OR1F1	36	.	0			c.T729C						.						205.0	187.0	193.0					16																	3254975		2197	4300	6497	SO:0001819	synonymous_variant	4992	exon1			TGGTTCTCACCTG	Y14442	CCDS10496.1	16p13.3	2012-08-09			ENSG00000168124	ENSG00000168124		"""GPCR / Class A : Olfactory receptors"""	8194	protein-coding gene	gene with protein product		603232		OR1F4, OR1F6, OR1F7, OR1F8, OR1F9, OR1F5, OR1F10, OR1F13P		9288094, 9500546	Standard	NM_012360		Approved	Olfmf, OR16-36, OR16-37, OR16-88, OR16-89, OR16-90, OLFMF, OR3-145	uc010uwu.2	O43749	OTTHUMG00000133153	ENST00000304646.2:c.729T>C	chr16.hg19:g.3254975T>C		158.0	0.0		83.0	4.0	NM_012360	O15246|Q6IFL5	Silent	SNP	ENST00000304646.2	hg19	CCDS10496.1																																																																																			.	.		0.493	OR1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206985.1		
ADCY9	115	hgsc.bcm.edu	37	16	4039054	4039054	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:4039054T>C	ENST00000294016.3	-	6	2789	c.2251A>G	c.(2251-2253)Agc>Ggc	p.S751G	ADCY9_ENST00000571889.1_5'Flank	NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	751					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						AAGTTCAGGCTGAACTGATTA	0.448																																					p.S751G		Atlas-SNP	.											.	ADCY9	151	.	0			c.A2251G						.						132.0	121.0	125.0					16																	4039054		2197	4300	6497	SO:0001583	missense	115	exon6			TCAGGCTGAACTG	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2251A>G	chr16.hg19:g.4039054T>C	ENSP00000294016:p.Ser751Gly	54.0	0.0		37.0	4.0	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	hg19	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	t	33	5.290889	0.95546	.	.	ENSG00000162104	ENST00000294016	D	0.84660	-1.88	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.90580	0.7047	L	0.55481	1.735	0.53688	D	0.99997	D	0.69078	0.997	D	0.75020	0.985	D	0.91244	0.5024	10	0.72032	D	0.01	.	16.564	0.84574	0.0:0.0:0.0:1.0	.	751	O60503	ADCY9_HUMAN	G	751	ENSP00000294016:S751G	ENSP00000294016:S751G	S	-	1	0	ADCY9	3979055	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.037000	0.88933	2.314000	0.78098	0.454000	0.30748	AGC	.	.		0.448	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
ERCC4	2072	hgsc.bcm.edu	37	16	14024746	14024746	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:14024746A>G	ENST00000311895.7	+	5	981	c.972A>G	c.(970-972)tcA>tcG	p.S324S	CTD-2135D7.2_ENST00000575137.1_RNA|ERCC4_ENST00000575156.1_Splice_Site_p.S324S|CTD-2135D7.2_ENST00000570663.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	324	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						GTCAGAATTCAGGTGGGAGAT	0.353			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.S324S		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	.	ERCC4	100	.	0			c.A972G						.						39.0	39.0	39.0					16																	14024746		2197	4300	6497	SO:0001630	splice_region_variant	2072	exon5	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GAATTCAGGTGGG	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.973+1A>G	chr16.hg19:g.14024746A>G		66.0	0.0		54.0	4.0	NM_005236	A5PKV6|A8K111|O00140|Q8TD83	Silent	SNP	ENST00000311895.7	hg19	CCDS32390.1																																																																																			.	.		0.353	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	Silent
USP31	57478	hgsc.bcm.edu	37	16	23117594	23117594	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:23117594T>C	ENST00000219689.7	-	4	892	c.893A>G	c.(892-894)cAg>cGg	p.Q298R		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	229	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		AGTGTTGCTCTGTTTCTGACA	0.363																																					p.Q298R		Atlas-SNP	.											.	USP31	122	.	0			c.A893G						.						106.0	106.0	106.0					16																	23117594		2197	4300	6497	SO:0001583	missense	57478	exon4			TTGCTCTGTTTCT	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.893A>G	chr16.hg19:g.23117594T>C	ENSP00000219689:p.Gln298Arg	92.0	0.0		113.0	5.0	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	hg19	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.653026	0.88056	.	.	ENSG00000103404	ENST00000219689	T	0.29655	1.56	5.82	5.82	0.92795	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.172968	0.43579	D	0.000558	T	0.44603	0.1301	L	0.38838	1.175	0.80722	D	1	D	0.64830	0.994	D	0.76575	0.988	T	0.17048	-1.0382	10	0.23302	T	0.38	-14.6144	15.3651	0.74516	0.0:0.0:0.0:1.0	.	298	Q70CQ4	UBP31_HUMAN	R	298	ENSP00000219689:Q298R	ENSP00000219689:Q298R	Q	-	2	0	USP31	23025095	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.649000	0.83500	2.222000	0.72286	0.533000	0.62120	CAG	.	.		0.363	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
ITGAL	3683	hgsc.bcm.edu	37	16	30507878	30507878	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:30507878T>C	ENST00000356798.6	+	15	2003	c.1823T>C	c.(1822-1824)aTc>aCc	p.I608T	RP11-297C4.1_ENST00000563751.1_RNA|ITGAL_ENST00000358164.5_Missense_Mutation_p.I525T|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	608					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	AGCCAGATGATCGTGCTGAGG	0.468																																					p.I608T	NSCLC(110;1462 1641 3311 33990 49495)	Atlas-SNP	.											.	ITGAL	149	.	0			c.T1823C						.						92.0	78.0	82.0					16																	30507878		2197	4300	6497	SO:0001583	missense	3683	exon15			AGATGATCGTGCT		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1823T>C	chr16.hg19:g.30507878T>C	ENSP00000349252:p.Ile608Thr	81.0	0.0		119.0	6.0	NM_002209	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	hg19	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.048303	0.36181	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.55052	0.54;0.54	5.94	5.94	0.96194	.	0.562934	0.17117	N	0.186415	T	0.50137	0.1598	L	0.56199	1.76	0.80722	D	1	B;B	0.26876	0.162;0.096	B;B	0.21546	0.035;0.024	T	0.50197	-0.8856	10	0.72032	D	0.01	.	13.9183	0.63914	0.0:0.0:0.0:1.0	.	525;608	Q96HB1;P20701	.;ITAL_HUMAN	T	608;525	ENSP00000349252:I608T;ENSP00000350886:I525T	ENSP00000349252:I608T	I	+	2	0	ITGAL	30415379	0.633000	0.27181	0.977000	0.42913	0.246000	0.25737	4.432000	0.59922	2.272000	0.75746	0.460000	0.39030	ATC	.	.		0.468	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
ZNF646	9726	hgsc.bcm.edu	37	16	31088548	31088548	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:31088548T>C	ENST00000394979.2	+	1	1326	c.903T>C	c.(901-903)cgT>cgC	p.R301R	ZNF668_ENST00000300849.4_5'Flank|ZNF646_ENST00000300850.5_Silent_p.R301R			O15015	ZN646_HUMAN	zinc finger protein 646	301					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						ACTGCCCCCGTGTCTTCCGGC	0.597																																					p.R301R		Atlas-SNP	.											.	ZNF646	133	.	0			c.T903C						.						62.0	60.0	61.0					16																	31088548		2197	4300	6497	SO:0001819	synonymous_variant	9726	exon2			CCCCCGTGTCTTC	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.903T>C	chr16.hg19:g.31088548T>C		58.0	0.0		87.0	4.0	NM_014699	Q8IVD8	Silent	SNP	ENST00000394979.2	hg19																																																																																				.	.		0.597	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699	
CDH5	1003	hgsc.bcm.edu	37	16	66423413	66423413	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:66423413T>C	ENST00000341529.3	+	5	917	c.769T>C	c.(769-771)Ttc>Ctc	p.F257L	CDH5_ENST00000563425.2_Missense_Mutation_p.F257L	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	257	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CAACTTCCCCTTCTTCACCCA	0.607																																					p.F257L		Atlas-SNP	.											.	CDH5	111	.	0			c.T769C						.						55.0	53.0	54.0					16																	66423413		2202	4300	6502	SO:0001583	missense	1003	exon5			TTCCCCTTCTTCA	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.769T>C	chr16.hg19:g.66423413T>C	ENSP00000344115:p.Phe257Leu	84.0	0.0		75.0	4.0	NM_001795	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	hg19	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.466979	0.43839	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.36520	1.25	5.69	3.39	0.38822	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.15219	0.0367	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05225	-1.0898	9	0.52906	T	0.07	.	4.9485	0.14002	0.6954:0.0:0.1612:0.1434	.	257	P33151	CADH5_HUMAN	L	257	ENSP00000344115:F257L	ENSP00000344115:F257L	F	+	1	0	CDH5	64980914	0.001000	0.12720	1.000000	0.80357	0.983000	0.72400	0.774000	0.26675	0.392000	0.25172	-0.339000	0.08088	TTC	.	.		0.607	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
E2F4	1874	hgsc.bcm.edu	37	16	67229817	67229817	+	Missense_Mutation	SNP	G	G	A	rs140980388		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:67229817G>A	ENST00000379378.3	+	7	1000	c.941G>A	c.(940-942)aGc>aAc	p.S314N		NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	314	Poly-Ser.				blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		agcagcagcagcagcagcagc	0.602																																					p.S314N		Atlas-SNP	.											.	E2F4	25	.	0			c.G941A						.						40.0	44.0	42.0					16																	67229817		2197	4291	6488	SO:0001583	missense	1874	exon7			GCAGCAGCAGCAG	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.941G>A	chr16.hg19:g.67229817G>A	ENSP00000368686:p.Ser314Asn	53.0	0.0		84.0	15.0	NM_001950	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	hg19	CCDS32464.1	.	.	.	.	.	.	.	.	.	.	g	7.432	0.638851	0.14386	.	.	ENSG00000205250	ENST00000379378	D	0.83591	-1.74	2.15	2.15	0.27550	.	1.244700	0.06489	U	0.734309	T	0.73799	0.3633	N	0.22421	0.69	0.27325	N	0.956935	P	0.48350	0.909	P	0.45506	0.483	T	0.63537	-0.6615	10	0.16896	T	0.51	.	7.8521	0.29462	0.0:0.0:1.0:0.0	.	314	Q16254	E2F4_HUMAN	N	314	ENSP00000368686:S314N	ENSP00000368686:S314N	S	+	2	0	E2F4	65787318	1.000000	0.71417	0.997000	0.53966	0.074000	0.17049	0.847000	0.27696	1.540000	0.49301	0.467000	0.42956	AGC	.	.		0.602	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
E2F4	1874	hgsc.bcm.edu	37	16	67229823	67229823	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:67229823G>A	ENST00000379378.3	+	7	1006	c.947G>A	c.(946-948)aGc>aAc	p.S316N		NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	316	Poly-Ser.				blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		agcagcagcagcagcagcagc	0.612																																					p.S316N		Atlas-SNP	.											.	E2F4	25	.	0			c.G947A						.						43.0	47.0	46.0					16																	67229823		2198	4299	6497	SO:0001583	missense	1874	exon7			GCAGCAGCAGCAG	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.947G>A	chr16.hg19:g.67229823G>A	ENSP00000368686:p.Ser316Asn	53.0	0.0		89.0	11.0	NM_001950	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	hg19	CCDS32464.1	.	.	.	.	.	.	.	.	.	.	g	6.844	0.525009	0.13066	.	.	ENSG00000205250	ENST00000379378	D	0.85556	-2.0	2.3	2.3	0.28687	.	1.331100	0.05353	U	0.532219	T	0.73528	0.3598	N	0.08118	0	0.23653	N	0.997193	P	0.48350	0.909	P	0.45506	0.483	T	0.65952	-0.6043	10	0.17832	T	0.49	.	8.179	0.31300	0.0:0.0:1.0:0.0	.	316	Q16254	E2F4_HUMAN	N	316	ENSP00000368686:S316N	ENSP00000368686:S316N	S	+	2	0	E2F4	65787324	0.992000	0.36948	0.999000	0.59377	0.063000	0.16089	-0.571000	0.05889	1.624000	0.50355	0.655000	0.94253	AGC	.	.		0.612	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
KCTD19	146212	hgsc.bcm.edu	37	16	67337084	67337084	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:67337084A>G	ENST00000304372.5	-	4	663	c.608T>C	c.(607-609)cTc>cCc	p.L203P	KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	203					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GCACTCGATGAGGGCCACCGT	0.617																																					p.L203P		Atlas-SNP	.											.	KCTD19	82	.	0			c.T608C						.						76.0	78.0	77.0					16																	67337084		2079	4198	6277	SO:0001583	missense	146212	exon4			TCGATGAGGGCCA	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.608T>C	chr16.hg19:g.67337084A>G	ENSP00000305702:p.Leu203Pro	99.0	0.0		111.0	5.0	NM_001100915	B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	hg19	CCDS42179.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449620	0.84101	.	.	ENSG00000168676	ENST00000304372	T	0.72051	-0.62	5.82	5.82	0.92795	BTB/POZ fold (1);	0.000000	0.53938	D	0.000047	T	0.74764	0.3759	N	0.24115	0.695	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	T	0.78306	-0.2255	10	0.87932	D	0	-9.1363	13.5596	0.61782	1.0:0.0:0.0:0.0	.	203	Q17RG1	KCD19_HUMAN	P	203	ENSP00000305702:L203P	ENSP00000305702:L203P	L	-	2	0	KCTD19	65894585	1.000000	0.71417	0.994000	0.49952	0.965000	0.64279	6.054000	0.71096	2.225000	0.72522	0.533000	0.62120	CTC	.	.		0.617	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367	
CENPT	80152	hgsc.bcm.edu	37	16	67861436	67861436	+	IGR	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:67861436A>G	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Missense_Mutation_p.K564E|TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.K549E|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.K618E|CENPT_ENST00000562947.1_5'Flank	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		CATGGATGAGAAGGACGAGTA	0.562																																					p.K564E		Atlas-SNP	.											.	TSNAXIP1	66	.	0			c.A1690G						.						113.0	110.0	111.0					16																	67861436		2198	4300	6498	SO:0001628	intergenic_variant	55815	exon15			GATGAGAAGGACG	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			chr16.hg19:g.67861436A>G		67.0	0.0		85.0	4.0	NM_018430	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	hg19	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.392167	0.42410	.	.	ENSG00000102904	ENST00000415766;ENST00000388833	.	.	.	5.65	5.65	0.86999	.	0.058377	0.64402	D	0.000002	T	0.72112	0.3420	M	0.64997	1.995	0.37134	D	0.901403	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.998;0.999	D;D;D;D;D	0.85130	0.994;0.997;0.996;0.994;0.994	T	0.78137	-0.2321	9	0.72032	D	0.01	-44.9555	12.1892	0.54261	1.0:0.0:0.0:0.0	.	549;618;272;564;549	E7ENJ7;B4DXD0;Q2TAA8-2;Q2TAA8;B4E1H3	.;.;.;TXIP1_HUMAN;.	E	549;564	.	ENSP00000373485:K564E	K	+	1	0	TSNAXIP1	66418937	1.000000	0.71417	0.997000	0.53966	0.003000	0.03518	3.356000	0.52269	2.371000	0.80710	0.533000	0.62120	AAG	.	.		0.562	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
EDC4	23644	hgsc.bcm.edu	37	16	67916365	67916365	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:67916365G>A	ENST00000358933.5	+	25	3549	c.3310G>A	c.(3310-3312)Gac>Aac	p.D1104N	CTC-479C5.10_ENST00000572067.1_lincRNA|NRN1L_ENST00000339176.3_5'Flank	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1104					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		AGCAGCTGCAGACACATTACA	0.602																																					p.D1104N		Atlas-SNP	.											.	EDC4	101	.	0			c.G3310A						.						58.0	59.0	58.0					16																	67916365		2198	4300	6498	SO:0001583	missense	23644	exon25			GCTGCAGACACAT	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3310G>A	chr16.hg19:g.67916365G>A	ENSP00000351811:p.Asp1104Asn	70.0	0.0		89.0	33.0	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	hg19	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352703	0.61293	.	.	ENSG00000038358	ENST00000358933	.	.	.	6.04	6.04	0.98038	.	0.045285	0.85682	D	0.000000	T	0.42404	0.1201	N	0.13098	0.295	0.51767	D	0.999936	B	0.26672	0.156	B	0.17098	0.017	T	0.25882	-1.0119	9	0.18710	T	0.47	-25.5092	20.1899	0.98228	0.0:0.0:1.0:0.0	.	1104	Q6P2E9	EDC4_HUMAN	N	1104	.	ENSP00000351811:D1104N	D	+	1	0	EDC4	66473866	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.711000	0.98735	2.873000	0.98535	0.563000	0.77884	GAC	.	.		0.602	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
NOB1	28987	hgsc.bcm.edu	37	16	69783156	69783156	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:69783156T>C	ENST00000268802.5	-	5	514	c.485A>G	c.(484-486)aAc>aGc	p.N162S		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	162					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGGCAAAGGGTTTCTCCAGAA	0.473																																					p.N162S		Atlas-SNP	.											.	NOB1	24	.	0			c.A485G						.						65.0	62.0	63.0					16																	69783156		2198	4300	6498	SO:0001583	missense	28987	exon5			AAAGGGTTTCTCC	AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.485A>G	chr16.hg19:g.69783156T>C	ENSP00000268802:p.Asn162Ser	51.0	0.0		71.0	4.0	NM_014062	Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Missense_Mutation	SNP	ENST00000268802.5	hg19	CCDS10884.1	.	.	.	.	.	.	.	.	.	.	T	8.943	0.966211	0.18659	.	.	ENSG00000141101	ENST00000268802	T	0.29655	1.56	5.42	-1.75	0.08031	.	0.345423	0.34200	N	0.004170	T	0.12518	0.0304	N	0.22421	0.69	0.28403	N	0.918533	B	0.09022	0.002	B	0.04013	0.001	T	0.08743	-1.0707	9	.	.	.	.	0.4658	0.00523	0.3171:0.1343:0.2216:0.327	.	162	Q9ULX3	NOB1_HUMAN	S	162	ENSP00000268802:N162S	.	N	-	2	0	NOB1	68340657	0.964000	0.33143	0.947000	0.38551	0.824000	0.46624	0.626000	0.24492	-0.174000	0.10743	0.528000	0.53228	AAC	.	.		0.473	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268958.2	NM_014062	
SF3B3	23450	hgsc.bcm.edu	37	16	70588379	70588379	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:70588379T>C	ENST00000302516.5	+	12	1644	c.1433T>C	c.(1432-1434)tTc>tCc	p.F478S		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	478					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				ATTGTGTCTTTCGTGAATGCC	0.423																																					p.F478S		Atlas-SNP	.											.	SF3B3	99	.	0			c.T1433C						.						169.0	149.0	156.0					16																	70588379		2198	4300	6498	SO:0001583	missense	23450	exon12			TGTCTTTCGTGAA	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.1433T>C	chr16.hg19:g.70588379T>C	ENSP00000305790:p.Phe478Ser	73.0	0.0		85.0	4.0	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	hg19	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	T	33	5.227121	0.95173	.	.	ENSG00000189091	ENST00000302516	T	0.47528	0.84	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.75517	0.3860	M	0.92738	3.34	0.80722	D	1	D	0.61080	0.989	D	0.68039	0.955	T	0.81773	-0.0779	10	0.66056	D	0.02	.	16.4069	0.83677	0.0:0.0:0.0:1.0	.	478	Q15393	SF3B3_HUMAN	S	478	ENSP00000305790:F478S	ENSP00000305790:F478S	F	+	2	0	SF3B3	69145880	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.806000	0.86020	2.272000	0.75746	0.460000	0.39030	TTC	.	.		0.423	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
IL34	146433	hgsc.bcm.edu	37	16	70688456	70688456	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:70688456T>A	ENST00000288098.2	+	2	427	c.44T>A	c.(43-45)cTt>cAt	p.L15H	IL34_ENST00000566361.1_5'UTR|IL34_ENST00000569641.1_Intron|IL34_ENST00000429149.2_Missense_Mutation_p.L15H	NM_001172772.1	NP_001166243.1	Q6ZMJ4	IL34_HUMAN	interleukin 34	15					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	extracellular space (GO:0005615)	macrophage colony-stimulating factor receptor binding (GO:0005157)			breast(1)|central_nervous_system(1)|kidney(9)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(2)	17						GGGATCTTCCTTGGCGTGGCC	0.572											OREG0023916	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L15H		Atlas-SNP	.											.	IL34	26	.	0			c.T44A						.						383.0	253.0	297.0					16																	70688456		2198	4300	6498	SO:0001583	missense	146433	exon3			TCTTCCTTGGCGT	BC029804	CCDS10895.1	16q22.1	2008-08-01	2008-06-04	2008-06-04	ENSG00000157368	ENSG00000157368		"""Interleukins and interleukin receptors"""	28529	protein-coding gene	gene with protein product		612081	"""chromosome 16 open reading frame 77"""	C16orf77		18467591	Standard	NM_152456		Approved	MGC34647, IL-34	uc002ezh.2	Q6ZMJ4	OTTHUMG00000137581	ENST00000288098.2:c.44T>A	chr16.hg19:g.70688456T>A	ENSP00000288098:p.Leu15His	165.0	0.0	1124	190.0	68.0	NM_152456	B2RC28|B2Z4A8|B2ZC70|Q8N6L2	Missense_Mutation	SNP	ENST00000288098.2	hg19	CCDS10895.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759491	0.31137	.	.	ENSG00000157368	ENST00000429149;ENST00000288098	T;T	0.51071	0.72;0.72	4.89	4.89	0.63831	.	0.102151	0.39274	N	0.001412	T	0.62756	0.2454	M	0.75447	2.3	0.09310	N	0.999999	D;D	0.69078	0.997;0.997	D;D	0.63192	0.912;0.912	T	0.58578	-0.7612	10	0.87932	D	0	-6.13	8.871	0.35316	0.0:0.0:0.1888:0.8112	.	15;15	Q6ZMJ4-2;Q6ZMJ4	.;IL34_HUMAN	H	15	ENSP00000397863:L15H;ENSP00000288098:L15H	ENSP00000288098:L15H	L	+	2	0	IL34	69245957	1.000000	0.71417	0.889000	0.34880	0.017000	0.09413	2.881000	0.48538	1.835000	0.53391	0.379000	0.24179	CTT	.	.		0.572	IL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268971.3	NM_152456	
FA2H	79152	hgsc.bcm.edu	37	16	74761274	74761274	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:74761274T>C	ENST00000219368.3	-	3	443	c.374A>G	c.(373-375)gAc>gGc	p.D125G	FA2H_ENST00000544337.1_Intron	NM_024306.4	NP_077282.3	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	125					cell death (GO:0008219)|central nervous system myelin maintenance (GO:0032286)|fatty acid biosynthetic process (GO:0006633)|lipid modification (GO:0030258)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of cell proliferation (GO:0042127)|regulation of hair cycle (GO:0042634)|sebaceous gland cell differentiation (GO:0001949)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	fatty acid alpha-hydroxylase activity (GO:0080132)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						CTTTCGCCAGTCCACCAGGTC	0.557																																					p.D125G		Atlas-SNP	.											.	FA2H	21	.	0			c.A374G						.						60.0	57.0	58.0					16																	74761274		2198	4300	6498	SO:0001583	missense	79152	exon3			CGCCAGTCCACCA	BC002679	CCDS10911.1	16q23	2013-03-04	2003-10-29	2003-10-31	ENSG00000103089	ENSG00000103089		"""Fatty acid hydroxylase domain containing"""	21197	protein-coding gene	gene with protein product	"""fatty acid hydroxylase"""	611026	"""fatty acid hydroxylase domain containing 1"", ""spastic paraplegia 35 (autosomal recessive)"""	FAXDC1, SPG35		20104589	Standard	NM_024306		Approved	FAAH, FLJ25287	uc002fde.2	Q7L5A8	OTTHUMG00000137603	ENST00000219368.3:c.374A>G	chr16.hg19:g.74761274T>C	ENSP00000219368:p.Asp125Gly	41.0	0.0		53.0	4.0	NM_024306	B7Z8T6|O75213|Q96DK1|Q9H1A5	Missense_Mutation	SNP	ENST00000219368.3	hg19	CCDS10911.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816930	0.90790	.	.	ENSG00000103089	ENST00000219368	D	0.91577	-2.87	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.96266	0.8782	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97154	0.9833	10	0.87932	D	0	-13.4363	15.7053	0.77573	0.0:0.0:0.0:1.0	.	125	Q7L5A8	FA2H_HUMAN	G	125	ENSP00000219368:D125G	ENSP00000219368:D125G	D	-	2	0	FA2H	73318775	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.811000	0.86092	2.119000	0.64992	0.533000	0.62120	GAC	.	.		0.557	FA2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269015.2	NM_024306	
VPS53	55275	hgsc.bcm.edu	37	17	465918	465918	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:465918T>C	ENST00000571805.1	-	14	1517	c.1381A>G	c.(1381-1383)Act>Gct	p.T461A	VPS53_ENST00000574029.1_Intron|VPS53_ENST00000291074.5_Missense_Mutation_p.T432A|VPS53_ENST00000401468.3_Missense_Mutation_p.T184A|VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000437048.2_Missense_Mutation_p.T461A|VPS53_ENST00000446250.2_Missense_Mutation_p.T263A			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	461					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		CCTTCATCAGTGTTGGGCTTA	0.512																																					p.T461A		Atlas-SNP	.											.	VPS53	109	.	0			c.A1381G						.						66.0	62.0	63.0					17																	465918		2203	4300	6503	SO:0001583	missense	55275	exon14			CATCAGTGTTGGG		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.1381A>G	chr17.hg19:g.465918T>C	ENSP00000459312:p.Thr461Ala	81.0	0.0		80.0	4.0	NM_001128159	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	ENST00000571805.1	hg19		.	.	.	.	.	.	.	.	.	.	T	8.857	0.946010	0.18356	.	.	ENSG00000141252	ENST00000437048;ENST00000446250;ENST00000291074;ENST00000401468;ENST00000389040	T;T;T;T;T	0.44881	1.49;1.5;1.5;0.91;1.48	5.97	4.88	0.63580	.	0.299613	0.41500	D	0.000865	T	0.22003	0.0530	L	0.27053	0.805	0.35481	D	0.798209	B;B;B;B;B	0.15719	0.014;0.001;0.0;0.0;0.0	B;B;B;B;B	0.17098	0.017;0.007;0.003;0.001;0.009	T	0.24621	-1.0155	10	0.02654	T	1	-1.4858	4.7658	0.13132	0.1493:0.1356:0.0:0.7151	.	184;461;263;461;432	E7EVT8;Q5VIR6-4;G3V0H8;Q5VIR6;Q5VIR6-2	.;.;.;VPS53_HUMAN;.	A	461;263;432;184;413	ENSP00000401435:T461A;ENSP00000394386:T263A;ENSP00000291074:T432A;ENSP00000384294:T184A;ENSP00000373692:T413A	ENSP00000291074:T432A	T	-	1	0	VPS53	412668	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	1.742000	0.38248	2.281000	0.76405	0.533000	0.62120	ACT	.	.		0.512	VPS53-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000436940.2	NM_018289	
FLII	2314	hgsc.bcm.edu	37	17	18148691	18148691	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:18148691T>C	ENST00000327031.4	-	29	3877	c.3652A>G	c.(3652-3654)Aag>Gag	p.K1218E	FLII_ENST00000379450.4_Missense_Mutation_p.K1132E|FLII_ENST00000545457.2_Missense_Mutation_p.K1163E|FLII_ENST00000579294.1_Missense_Mutation_p.K1207E|FLII_ENST00000578558.1_Intron	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	1218					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					AGGCTCAGCTTGATCTCCACC	0.647																																					p.K1218E		Atlas-SNP	.											.	FLII	79	.	0			c.A3652G						.						83.0	84.0	83.0					17																	18148691		2203	4300	6503	SO:0001583	missense	2314	exon29			TCAGCTTGATCTC	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.3652A>G	chr17.hg19:g.18148691T>C	ENSP00000324573:p.Lys1218Glu	51.0	0.0		120.0	5.0	NM_002018	B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	ENST00000327031.4	hg19	CCDS11192.1	.	.	.	.	.	.	.	.	.	.	T	35	5.451160	0.96205	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T;T	0.55234	0.53;0.94;0.53	5.42	5.42	0.78866	Gelsolin domain (1);	0.048627	0.85682	D	0.000000	T	0.66674	0.2813	L	0.45470	1.425	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.998;0.999	D;D;D;D	0.81914	0.965;0.965;0.99;0.995	T	0.69829	-0.5039	10	0.87932	D	0	-22.6087	15.4544	0.75302	0.0:0.0:0.0:1.0	.	1132;1132;1218;1187	E7EPM0;B4DIL0;Q13045;B4DIX0	.;.;FLII_HUMAN;.	E	1218;1097;1132	ENSP00000324573:K1218E;ENSP00000438536:K1097E;ENSP00000368763:K1132E	ENSP00000324573:K1218E	K	-	1	0	FLII	18089416	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.738000	0.68613	2.054000	0.61138	0.533000	0.62120	AAG	.	.		0.647	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
KIAA0100	9703	hgsc.bcm.edu	37	17	26961916	26961916	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:26961916T>C	ENST00000528896.2	-	16	2763	c.2689A>G	c.(2689-2691)Atg>Gtg	p.M897V	KIAA0100_ENST00000389003.3_Missense_Mutation_p.M754V|RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.M754V|RP11-192H23.7_ENST00000583787.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	897						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCATCCTTCATCAGCTCGTAG	0.478																																					p.M897V		Atlas-SNP	.											.	KIAA0100	175	.	0			c.A2689G						.						219.0	239.0	232.0					17																	26961916		2203	4300	6503	SO:0001583	missense	9703	exon16			CCTTCATCAGCTC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2689A>G	chr17.hg19:g.26961916T>C	ENSP00000436773:p.Met897Val	50.0	0.0		74.0	5.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.493281	0.64186	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.24350	1.86;1.86	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	M	0.61703	1.905	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.18178	-1.0345	10	0.30854	T	0.27	.	16.2996	0.82804	0.0:0.0:0.0:1.0	.	897	Q14667	K0100_HUMAN	V	897;867;897;754	ENSP00000436773:M897V;ENSP00000446443:M754V	ENSP00000005905:M897V	M	-	1	0	KIAA0100	23986043	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.828000	0.69307	2.252000	0.74401	0.455000	0.32223	ATG	.	.		0.478	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
SLFN12L	100506736	hgsc.bcm.edu	37	17	33807038	33807038	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:33807038C>A	ENST00000260908.7	-	2	308	c.191G>T	c.(190-192)cGa>cTa	p.R64L	RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000361112.4_Missense_Mutation_p.R93L|SLFN12L_ENST00000449046.1_Missense_Mutation_p.R95L	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	64						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)			breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						ACACACAGCTCGTGAGACATT	0.403																																					p.R64L		Atlas-SNP	.											.	SLFN12L	140	.	0			c.G191T						.						90.0	75.0	79.0					17																	33807038		692	1591	2283	SO:0001583	missense	100506736	exon2			ACAGCTCGTGAGA	AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.191G>T	chr17.hg19:g.33807038C>A	ENSP00000437635:p.Arg64Leu	144.0	0.0		163.0	71.0	NM_001195790	F5H6G3	Missense_Mutation	SNP	ENST00000260908.7	hg19	CCDS56026.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995899	0.54147	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	T;T;T	0.03920	3.77;3.87;3.76	2.72	-5.44	0.02624	.	.	.	.	.	T	0.03564	0.0102	N	0.11560	0.145	0.09310	N	1	P	0.49696	0.927	P	0.49999	0.628	T	0.27157	-1.0082	9	0.46703	T	0.11	.	5.9558	0.19273	0.0:0.5432:0.1875:0.2692	.	93	Q6IEE8-2	.	L	64;93;95	ENSP00000437635:R64L;ENSP00000354412:R93L;ENSP00000389348:R95L	ENSP00000437635:R64L	R	-	2	0	SLFN12L	30831151	0.000000	0.05858	0.000000	0.03702	0.398000	0.30690	-2.933000	0.00687	-1.156000	0.02818	0.205000	0.17691	CGA	.	.		0.403	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395748.2	XM_496206	
TADA2A	6871	hgsc.bcm.edu	37	17	35766386	35766386	+	5'Flank	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:35766386A>G	ENST00000394395.2	+	0	0				RP11-378E13.4_ENST00000590364.1_RNA|ACACA_ENST00000416895.1_5'UTR|ACACA_ENST00000353139.5_Missense_Mutation_p.W2R|TADA2A_ENST00000225396.6_5'Flank|TADA2A_ENST00000417170.1_5'Flank|TADA2A_ENST00000586023.1_5'Flank|ACACA_ENST00000589665.1_5'UTR	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						gtagacCACCACATCCTCTCA	0.438																																					p.W2R		Atlas-SNP	.											.	ACACA	395	.	0			c.T4C						.						229.0	238.0	235.0					17																	35766386		2094	4227	6321	SO:0001631	upstream_gene_variant	31	exon1			ACCACCACATCCT	AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469		chr17.hg19:g.35766386A>G	Exception_encountered	85.0	0.0		85.0	4.0	NM_198834	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Missense_Mutation	SNP	ENST00000394395.2	hg19	CCDS11319.1	.	.	.	.	.	.	.	.	.	.	A	14.84	2.656778	0.47467	.	.	ENSG00000132142	ENST00000353139	D	0.94828	-3.53	4.42	3.31	0.37934	.	0.493351	0.17435	N	0.174325	D	0.90380	0.6989	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.86518	0.1814	9	0.87932	D	0	-0.0511	6.2662	0.20928	0.8822:0.0:0.1178:0.0	.	2	Q13085-4	.	R	2	ENSP00000344789:W2R	ENSP00000344789:W2R	W	-	1	0	ACACA	32840499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.195000	0.42677	1.005000	0.39183	0.528000	0.53228	TGG	.	.		0.438	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256677.3	NM_001488	
GHDC	84514	hgsc.bcm.edu	37	17	40342899	40342899	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:40342899G>A	ENST00000301671.8	-	6	1546	c.1105C>T	c.(1105-1107)Cga>Tga	p.R369*	GHDC_ENST00000428494.2_Nonsense_Mutation_p.R330*|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000587427.1_Nonsense_Mutation_p.R369*|GHDC_ENST00000436923.2_Nonsense_Mutation_p.R369*|GHDC_ENST00000593209.1_Nonsense_Mutation_p.R369*|GHDC_ENST00000414034.3_Nonsense_Mutation_p.R369*			Q8N2G8	GHDC_HUMAN	GH3 domain containing	369						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CCAACCACTCGCACCACATCA	0.627																																					p.R369X		Atlas-SNP	.											.	GHDC	63	.	0			c.C1105T						.						92.0	91.0	91.0					17																	40342899		2203	4300	6503	SO:0001587	stop_gained	84514	exon7			CCACTCGCACCAC	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.1105C>T	chr17.hg19:g.40342899G>A	ENSP00000301671:p.Arg369*	59.0	0.0		55.0	25.0	NM_001142623	B4DQS4|E9PDB5|Q9BXM6	Nonsense_Mutation	SNP	ENST00000301671.8	hg19	CCDS11422.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070655	0.76301	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.18	4.18	0.49190	.	0.643001	0.15310	N	0.269145	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0714	13.8103	0.63260	0.0:0.0:1.0:0.0	.	.	.	.	X	313;330;369;369;369	.	ENSP00000301671:R369X	R	-	1	2	GHDC	37596425	0.238000	0.23825	0.049000	0.19019	0.218000	0.24690	3.442000	0.52900	2.146000	0.66826	0.561000	0.74099	CGA	.	.		0.627	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
STAT3	6774	hgsc.bcm.edu	37	17	40500452	40500452	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:40500452A>T	ENST00000264657.5	-	2	395	c.83T>A	c.(82-84)aTg>aAg	p.M28K	STAT3_ENST00000404395.3_Missense_Mutation_p.M28K|STAT3_ENST00000588969.1_Missense_Mutation_p.M28K|STAT3_ENST00000389272.3_Intron|STAT3_ENST00000585517.1_Missense_Mutation_p.M28K	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	28					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CCGCAGCTCCATTGGGAAGCT	0.493									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.M28K		Atlas-SNP	.											.	STAT3	268	.	0			c.T83A						.						94.0	89.0	91.0					17																	40500452		2203	4300	6503	SO:0001583	missense	6774	exon2	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	AGCTCCATTGGGA	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.83T>A	chr17.hg19:g.40500452A>T	ENSP00000264657:p.Met28Lys	106.0	0.0		110.0	50.0	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	hg19	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.027571	0.93518	.	.	ENSG00000168610	ENST00000264657;ENST00000404395	T;T	0.54071	0.59;0.59	5.28	5.28	0.74379	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.81497	2.545	0.80722	D	1	D;P;P	0.53462	0.96;0.845;0.845	D;P;P	0.66979	0.948;0.899;0.899	T	0.76694	-0.2865	10	0.62326	D	0.03	-30.1868	15.3678	0.74538	1.0:0.0:0.0:0.0	.	28;28;28	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	K	28	ENSP00000264657:M28K;ENSP00000384943:M28K	ENSP00000264657:M28K	M	-	2	0	STAT3	37753978	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	8.972000	0.93424	2.219000	0.72066	0.533000	0.62120	ATG	.	.		0.493	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
VEZF1	7716	hgsc.bcm.edu	37	17	56056598	56056598	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:56056598T>C	ENST00000581208.1	-	5	1093	c.1053A>G	c.(1051-1053)caA>caG	p.Q351Q	VEZF1_ENST00000584396.1_Silent_p.Q342Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	351	Poly-Gln.			Missing (in Ref. 1; BAA05663). {ECO:0000305}.	angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgttgttgct	0.473																																					p.Q351Q		Atlas-SNP	.											.	VEZF1	50	.	0			c.A1053G						.						185.0	168.0	174.0					17																	56056598		2203	4300	6503	SO:0001819	synonymous_variant	7716	exon5			TTGTTGTTGTTGT	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1053A>G	chr17.hg19:g.56056598T>C		123.0	0.0		142.0	10.0	NM_007146		Silent	SNP	ENST00000581208.1	hg19	CCDS32687.1																																																																																			.	.		0.473	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
VEZF1	7716	hgsc.bcm.edu	37	17	56056601	56056601	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:56056601T>C	ENST00000581208.1	-	5	1090	c.1050A>G	c.(1048-1050)caA>caG	p.Q350Q	VEZF1_ENST00000584396.1_Silent_p.Q341Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	350	Poly-Gln.			Missing (in Ref. 1; BAA05663). {ECO:0000305}.	angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gttgttgttgttgttgctgct	0.473																																					p.Q350Q		Atlas-SNP	.											.	VEZF1	50	.	0			c.A1050G						.						173.0	159.0	164.0					17																	56056601		2203	4300	6503	SO:0001819	synonymous_variant	7716	exon5			TTGTTGTTGTTGC	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1050A>G	chr17.hg19:g.56056601T>C		118.0	0.0		142.0	13.0	NM_007146		Silent	SNP	ENST00000581208.1	hg19	CCDS32687.1																																																																																			.	.		0.473	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
MPO	4353	hgsc.bcm.edu	37	17	56350840	56350841	+	Missense_Mutation	DNP	AT	AT	GG	rs536522394	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A|T	A|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:56350840_56350841AT>GG	ENST00000225275.3	-	9	1731_1732	c.1555_1556AT>CC	c.(1555-1557)ATg>CCg	p.M519P	MPO_ENST00000340482.3_Missense_Mutation_p.M551P|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	519					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GTTGGGTTCCATGGGCTGGTAC	0.609																																					p.M519T|p.M519L		Atlas-SNP	.											.	MPO	114	.	0			c.T1556C|c.A1555C						.																																			SO:0001583	missense	4353	exon9			GGTTCCATGGGCT|GTTCCATGGGCTG		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1555_1556delinsGG	chr17.hg19:g.56350840_56350841delinsGG	ENSP00000225275:p.Met519Pro	42.0|43.0	0.0		61.0|62.0	5.0|6.0	NM_000250	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	hg19	CCDS11604.1																																																																																			.	.		0.609	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1		
PRR11	55771	hgsc.bcm.edu	37	17	57247212	57247212	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:57247212A>G	ENST00000262293.4	+	2	411	c.99A>G	c.(97-99)acA>acG	p.T33T		NM_018304.3	NP_060774.2	Q96HE9	PRR11_HUMAN	proline rich 11	33						cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|pancreas(1)	16	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					AGCTAATTACACCTCCTCCTC	0.388																																					p.T33T		Atlas-SNP	.											.	PRR11	36	.	0			c.A99G						.						94.0	93.0	94.0					17																	57247212		2203	4300	6503	SO:0001819	synonymous_variant	55771	exon2			AATTACACCTCCT		CCDS11614.1	17q23.2	2005-12-13				ENSG00000068489			25619	protein-coding gene	gene with protein product		615920				11799066	Standard	NM_018304		Approved	FLJ11029	uc002ixf.2	Q96HE9		ENST00000262293.4:c.99A>G	chr17.hg19:g.57247212A>G		122.0	0.0		129.0	6.0	NM_018304	Q9NUZ7|Q9NXE9	Silent	SNP	ENST00000262293.4	hg19	CCDS11614.1																																																																																			.	.		0.388	PRR11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445949.1	NM_018304	
INTS2	57508	hgsc.bcm.edu	37	17	59984985	59984985	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:59984985T>C	ENST00000444766.3	-	8	1064	c.989A>G	c.(988-990)gAg>gGg	p.E330G	INTS2_ENST00000251334.6_Missense_Mutation_p.E322G	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	330					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						ACTGCTGGTCTCTCTTTTTCT	0.423																																					p.E330G		Atlas-SNP	.											.	INTS2	89	.	0			c.A989G						.						36.0	35.0	35.0					17																	59984985		1870	4094	5964	SO:0001583	missense	57508	exon8			CTGGTCTCTCTTT	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.989A>G	chr17.hg19:g.59984985T>C	ENSP00000414237:p.Glu330Gly	96.0	0.0		121.0	5.0	NM_020748	Q9ULD3	Missense_Mutation	SNP	ENST00000444766.3	hg19	CCDS45750.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.010608	0.54361	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.48836	0.8	5.52	5.52	0.82312	.	0.045770	0.85682	D	0.000000	T	0.42063	0.1186	L	0.44542	1.39	0.80722	D	1	B	0.29301	0.241	B	0.29942	0.109	T	0.24297	-1.0164	9	.	.	.	-13.0156	15.6487	0.77073	0.0:0.0:0.0:1.0	.	330	Q9H0H0	INT2_HUMAN	G	330;329	ENSP00000414237:E330G	.	E	-	2	0	INTS2	57339767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.499000	0.81566	2.106000	0.64143	0.533000	0.62120	GAG	.	.		0.423	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
ABCA8	10351	hgsc.bcm.edu	37	17	66879991	66879991	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:66879991A>G	ENST00000269080.2	-	27	3665	c.3528T>C	c.(3526-3528)acT>acC	p.T1176T	ABCA8_ENST00000430352.2_Silent_p.T1216T|ABCA8_ENST00000586539.1_Silent_p.T1216T	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1176					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GACATCGAAGAGTAAAAAGAA	0.284																																					p.T1176T		Atlas-SNP	.											.	ABCA8	213	.	0			c.T3528C						.						47.0	47.0	47.0					17																	66879991		2203	4297	6500	SO:0001819	synonymous_variant	10351	exon27			TCGAAGAGTAAAA	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3528T>C	chr17.hg19:g.66879991A>G		104.0	0.0		111.0	5.0	NM_007168	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	hg19	CCDS11680.1																																																																																			.	.		0.284	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
SOX9	6662	hgsc.bcm.edu	37	17	70120374	70120374	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:70120374G>T	ENST00000245479.2	+	3	1748	c.1376G>T	c.(1375-1377)gGc>gTc	p.G459V		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	459					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GCAGGCCAGGGCACCGGCCTC	0.647																																					p.G459V	Pancreas(42;83 1041 2320 35205 39456)	Atlas-SNP	.											.	SOX9	91	.	0			c.G1376T						.						148.0	141.0	144.0					17																	70120374		2203	4300	6503	SO:0001583	missense	6662	exon3			GCCAGGGCACCGG	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1376G>T	chr17.hg19:g.70120374G>T	ENSP00000245479:p.Gly459Val	67.0	0.0		77.0	33.0	NM_000346	Q53Y80	Missense_Mutation	SNP	ENST00000245479.2	hg19	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658077	0.47467	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	T	0.75938	-0.98	4.27	3.27	0.37495	.	0.288040	0.38005	N	0.001847	T	0.58694	0.2140	L	0.34521	1.04	0.80722	D	1	B	0.32245	0.361	B	0.29440	0.102	T	0.54899	-0.8224	10	0.41790	T	0.15	.	7.0933	0.25295	0.0889:0.0:0.7391:0.1721	.	459	P48436	SOX9_HUMAN	V	459;395	ENSP00000245479:G459V	ENSP00000245479:G459V	G	+	2	0	SOX9	67631969	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.228000	0.65310	0.882000	0.36016	0.462000	0.41574	GGC	.	.		0.647	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
SMCHD1	23347	hgsc.bcm.edu	37	18	2738452	2738452	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:2738452G>A	ENST00000320876.6	+	26	3672	c.3334G>A	c.(3334-3336)Gtg>Atg	p.V1112M	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.V1112M	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1112					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GCTTCCTGATGTGCAAGTACC	0.383																																					p.V1112M		Atlas-SNP	.											.	SMCHD1	88	.	0			c.G3334A						.						123.0	111.0	115.0					18																	2738452		1885	4108	5993	SO:0001583	missense	23347	exon26			CCTGATGTGCAAG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3334G>A	chr18.hg19:g.2738452G>A	ENSP00000326603:p.Val1112Met	88.0	0.0		82.0	4.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536586	0.85812	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.30182	1.54;1.55	5.22	5.22	0.72569	.	0.139747	0.47455	D	0.000233	T	0.55353	0.1915	M	0.62723	1.935	0.40555	D	0.981152	D	0.71674	0.998	D	0.78314	0.991	T	0.58973	-0.7541	10	0.87932	D	0	-15.3187	19.1396	0.93443	0.0:0.0:1.0:0.0	.	1112	A6NHR9	SMHD1_HUMAN	M	1112	ENSP00000326603:V1112M;ENSP00000261598:V1112M	ENSP00000261598:V1112M	V	+	1	0	SMCHD1	2728452	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.026000	0.76455	2.573000	0.86826	0.585000	0.79938	GTG	.	.		0.383	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
ANKRD12	23253	hgsc.bcm.edu	37	18	9255794	9255794	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:9255794A>G	ENST00000262126.4	+	9	2769	c.2529A>G	c.(2527-2529)aaA>aaG	p.K843K	ANKRD12_ENST00000400020.3_Silent_p.K820K|ANKRD12_ENST00000383440.2_Silent_p.K820K	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	843						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CCTTTGAAAAAGAAAAGAAGA	0.294																																					p.K843K		Atlas-SNP	.											.	ANKRD12	167	.	0			c.A2529G						.						25.0	27.0	26.0					18																	9255794		2194	4280	6474	SO:0001819	synonymous_variant	23253	exon9			TGAAAAAGAAAAG	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2529A>G	chr18.hg19:g.9255794A>G		66.0	0.0		86.0	4.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	hg19	CCDS11843.1																																																																																			.	.		0.294	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
PSMG2	56984	hgsc.bcm.edu	37	18	12718587	12718587	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:12718587T>C	ENST00000317615.6	+	4	1042	c.360T>C	c.(358-360)gtT>gtC	p.V120V	PSMG2_ENST00000590217.1_Silent_p.V120V|PSMG2_ENST00000585331.2_Silent_p.V89V	NM_020232.4	NP_064617.2			proteasome (prosome, macropain) assembly chaperone 2											lung(1)|prostate(2)|skin(1)	4						GAGTCATTGTTCTTTCAAGCA	0.378																																					p.V120V		Atlas-SNP	.											.	PSMG2	17	.	0			c.T360C						.						143.0	133.0	136.0					18																	12718587		2203	4300	6503	SO:0001819	synonymous_variant	56984	exon4			CATTGTTCTTTCA	AF276707	CCDS11862.1, CCDS67440.1	18p11.21	2012-01-25	2007-10-23	2007-10-23	ENSG00000128789	ENSG00000128789			24929	protein-coding gene	gene with protein product	"""hepatocellular carcinoma susceptibility protein"", ""CD40 ligand-activated specific transcript 3"""	609702	"""tumor necrosis factor superfamily, member 5-induced protein 1"""	TNFSF5IP1		11854909, 12147697, 17189198	Standard	NM_147163		Approved	HCCA3, MDS003, MGC15092, CLAST3, HsT1707, PAC2	uc002krk.3	Q969U7	OTTHUMG00000131703	ENST00000317615.6:c.360T>C	chr18.hg19:g.12718587T>C		75.0	0.0		84.0	4.0	NM_020232		Silent	SNP	ENST00000317615.6	hg19	CCDS11862.1																																																																																			.	.		0.378	PSMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254615.1	NM_020232	
RIOK3	8780	hgsc.bcm.edu	37	18	21061218	21061218	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:21061218A>G	ENST00000339486.3	+	13	2152	c.1535A>G	c.(1534-1536)gAc>gGc	p.D512G	RIOK3_ENST00000577501.1_Missense_Mutation_p.D509G|RIOK3_ENST00000581585.1_Missense_Mutation_p.D496G	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	512	Protein kinase.				chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GATGATGGAGACCCACCACTA	0.378																																					p.D512G		Atlas-SNP	.											.	RIOK3	42	.	0			c.A1535G						.						98.0	92.0	94.0					18																	21061218		2203	4300	6503	SO:0001583	missense	8780	exon13			ATGGAGACCCACC	AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.1535A>G	chr18.hg19:g.21061218A>G	ENSP00000341874:p.Asp512Gly	49.0	0.0		65.0	4.0	NM_003831	Q8IXN9	Missense_Mutation	SNP	ENST00000339486.3	hg19	CCDS11877.1	.	.	.	.	.	.	.	.	.	.	A	0.194	-1.050687	0.01981	.	.	ENSG00000101782	ENST00000339486	T	0.07021	3.23	6.04	3.31	0.37934	.	0.217594	0.47093	N	0.000245	T	0.02455	0.0075	N	0.00926	-1.1	0.22127	N	0.999342	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.0;0.0;0.0	T	0.46345	-0.9198	10	0.11485	T	0.65	-10.8054	9.7321	0.40368	0.3:0.0:0.7:0.0	.	256;496;509;512	E7ESK5;B4E1Q4;O14730-2;O14730	.;.;.;RIOK3_HUMAN	G	512	ENSP00000341874:D512G	ENSP00000341874:D512G	D	+	2	0	RIOK3	19315216	0.999000	0.42202	0.635000	0.29338	0.341000	0.28922	2.928000	0.48908	0.448000	0.26722	-0.248000	0.11899	GAC	.	.		0.378	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254756.1	NM_003831	
NEDD4L	23327	hgsc.bcm.edu	37	18	56008984	56008984	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:56008984T>C	ENST00000400345.3	+	15	1615	c.1332T>C	c.(1330-1332)ccT>ccC	p.P444P	NEDD4L_ENST00000357895.5_Silent_p.P436P|NEDD4L_ENST00000431212.2_Silent_p.P323P|NEDD4L_ENST00000256832.7_Silent_p.P303P|NEDD4L_ENST00000382850.4_Silent_p.P424P|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000586263.1_Silent_p.P416P|NEDD4L_ENST00000256830.9_Intron|NEDD4L_ENST00000435432.2_Silent_p.P303P|NEDD4L_ENST00000456986.1_Silent_p.P323P|NEDD4L_ENST00000356462.6_Silent_p.P380P|NEDD4L_ENST00000456173.2_Silent_p.P303P	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	444					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						TCCGCCGGCCTCGTAGCCTCA	0.517																																					p.P444P		Atlas-SNP	.											.	NEDD4L	126	.	0			c.T1332C						.						59.0	66.0	63.0					18																	56008984		2043	4184	6227	SO:0001819	synonymous_variant	23327	exon15			CCGGCCTCGTAGC	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1332T>C	chr18.hg19:g.56008984T>C		84.0	0.0		90.0	4.0	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	hg19	CCDS45872.1																																																																																			.	.		0.517	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
PHLPP1	23239	hgsc.bcm.edu	37	18	60563017	60563017	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:60563017A>G	ENST00000262719.5	+	6	2451	c.2217A>G	c.(2215-2217)ttA>ttG	p.L739L	PHLPP1_ENST00000400316.4_Silent_p.L227L			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	739					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CTAATAGCTTACAGACATTTT	0.328																																					p.L739L		Atlas-SNP	.											.	PHLPP1	164	.	0			c.A2217G						.						117.0	110.0	112.0					18																	60563017		1821	4072	5893	SO:0001819	synonymous_variant	23239	exon6			TAGCTTACAGACA	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2217A>G	chr18.hg19:g.60563017A>G		63.0	0.0		56.0	4.0	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Silent	SNP	ENST00000262719.5	hg19	CCDS45881.2																																																																																			.	.		0.328	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
SERPINB12	89777	hgsc.bcm.edu	37	18	61232745	61232745	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:61232745T>C	ENST00000269491.1	+	6	713	c.713T>C	c.(712-714)gTg>gCg	p.V238A	SERPINB12_ENST00000382768.1_Missense_Mutation_p.V258A	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	238					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						ATAGAGGAGGTGAAGGCACAG	0.483																																					p.V238A		Atlas-SNP	.											.	SERPINB12	55	.	0			c.T713C						.						158.0	139.0	146.0					18																	61232745		2203	4300	6503	SO:0001583	missense	89777	exon6			AGGAGGTGAAGGC	AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.713T>C	chr18.hg19:g.61232745T>C	ENSP00000269491:p.Val238Ala	53.0	0.0		62.0	6.0	NM_080474	Q3SYB4	Missense_Mutation	SNP	ENST00000269491.1	hg19	CCDS11984.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.488975	0.26686	.	.	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.82526	-1.62;-1.62	5.59	5.59	0.84812	Serpin domain (3);	0.704404	0.12673	N	0.448613	T	0.76807	0.4039	L	0.33245	0.995	0.24245	N	0.995344	B;B	0.30824	0.201;0.296	B;B	0.33846	0.171;0.109	T	0.66264	-0.5967	10	0.30854	T	0.27	.	12.3322	0.55046	0.1263:0.0:0.0:0.8737	.	258;238	Q3SYB4;Q96P63	.;SPB12_HUMAN	A	238;258	ENSP00000269491:V238A;ENSP00000372218:V258A	ENSP00000269491:V238A	V	+	2	0	SERPINB12	59383725	0.008000	0.16893	0.309000	0.25155	0.076000	0.17211	1.785000	0.38684	2.254000	0.74563	0.528000	0.53228	GTG	.	.		0.483	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256197.1	NM_080474	
DOT1L	84444	hgsc.bcm.edu	37	19	2216382	2216382	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:2216382A>G	ENST00000398665.3	+	20	2062	c.2026A>G	c.(2026-2028)Aag>Gag	p.K676E	DOT1L_ENST00000608122.1_3'UTR|AC004490.1_ENST00000585593.1_RNA	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	676					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCGTGGGAAGGGCGCCCT	0.667																																					p.K676E		Atlas-SNP	.											.	DOT1L	205	.	0			c.A2026G						.						28.0	32.0	31.0					19																	2216382		2033	4167	6200	SO:0001583	missense	84444	exon20			CGTGGGAAGGGCG	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.2026A>G	chr19.hg19:g.2216382A>G	ENSP00000381657:p.Lys676Glu	70.0	0.0		106.0	5.0	NM_032482	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	hg19	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851861	0.51270	.	.	ENSG00000104885	ENST00000398665;ENST00000221482	T	0.27402	1.67	5.13	5.13	0.70059	.	0.179593	0.50627	D	0.000104	T	0.50786	0.1636	M	0.61703	1.905	0.09310	N	0.999998	D	0.71674	0.998	D	0.66084	0.941	T	0.47724	-0.9095	10	0.87932	D	0	-19.9061	14.1294	0.65242	1.0:0.0:0.0:0.0	.	676	Q8TEK3-2	.	E	676	ENSP00000381657:K676E	ENSP00000221482:K676E	K	+	1	0	DOT1L	2167382	1.000000	0.71417	0.088000	0.20740	0.020000	0.10135	8.375000	0.90135	1.928000	0.55862	0.533000	0.62120	AAG	.	.		0.667	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
MPND	84954	hgsc.bcm.edu	37	19	4345914	4345914	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:4345914A>G	ENST00000262966.8	+	3	534	c.467A>G	c.(466-468)gAc>gGc	p.D156G	MPND_ENST00000359935.4_Missense_Mutation_p.D156G|AC007292.4_ENST00000594776.1_RNA|AC007292.7_ENST00000598582.1_RNA|MPND_ENST00000599840.1_Missense_Mutation_p.D156G	NM_032868.4	NP_116257.2	Q8N594	MPND_HUMAN	MPN domain containing	156							peptidase activity (GO:0008233)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGAAACTGGACAAGTACAAG	0.637																																					p.D156G		Atlas-SNP	.											.	MPND	28	.	0			c.A467G						.						30.0	35.0	33.0					19																	4345914		2117	4254	6371	SO:0001583	missense	84954	exon3			AACTGGACAAGTA		CCDS42470.1, CCDS54200.1, CCDS74261.1	19p13.3	2014-08-12			ENSG00000008382				25934	protein-coding gene	gene with protein product							Standard	XM_005259663		Approved	FLJ14981	uc002mae.3	Q8N594	OTTHUMG00000181914	ENST00000262966.8:c.467A>G	chr19.hg19:g.4345914A>G	ENSP00000262966:p.Asp156Gly	89.0	0.0		116.0	5.0	NM_032868	Q96SJ0|Q9Y2P1|Q9Y2P2	Missense_Mutation	SNP	ENST00000262966.8	hg19	CCDS42470.1	.	.	.	.	.	.	.	.	.	.	a	12.69	2.014520	0.35511	.	.	ENSG00000008382	ENST00000262966;ENST00000359935	T;T	0.50277	0.75;0.75	4.24	4.24	0.50183	.	0.124737	0.51477	D	0.000085	T	0.45756	0.1358	M	0.66939	2.045	0.46336	D	0.998993	B;B;B	0.30542	0.096;0.182;0.284	B;B;B	0.28011	0.081;0.085;0.085	T	0.52472	-0.8571	10	0.87932	D	0	-39.2889	11.5543	0.50739	1.0:0.0:0.0:0.0	.	156;156;156	Q8N594-2;A6NI36;Q8N594	.;.;MPND_HUMAN	G	156	ENSP00000262966:D156G;ENSP00000353015:D156G	ENSP00000262966:D156G	D	+	2	0	MPND	4296914	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.157000	0.58144	1.665000	0.50811	0.402000	0.26972	GAC	.	.		0.637	MPND-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458292.1	NM_032868	
TICAM1	148022	hgsc.bcm.edu	37	19	4817286	4817286	+	Silent	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:4817286T>A	ENST00000248244.5	-	2	1333	c.1104A>T	c.(1102-1104)tcA>tcT	p.S368S		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	368	Pro-rich.				apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		AAGGAGTAGATGAaggaggag	0.522																																					p.S368S		Atlas-SNP	.											.	TICAM1	69	.	0			c.A1104T						.						45.0	48.0	47.0					19																	4817286		2203	4300	6503	SO:0001819	synonymous_variant	148022	exon2			AGTAGATGAAGGA	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.1104A>T	chr19.hg19:g.4817286T>A		166.0	0.0		193.0	10.0	NM_182919	B3Y691|O75532|Q86XP8|Q96GA0	Silent	SNP	ENST00000248244.5	hg19	CCDS12136.1																																																																																			.	.		0.522	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	NM_014261	
CATSPERD	257062	hgsc.bcm.edu	37	19	5737210	5737210	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:5737210T>C	ENST00000381624.3	+	6	514	c.453T>C	c.(451-453)ttT>ttC	p.F151F	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	151					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											GAAGTTTGTTTTGTGTGGTAA	0.338																																					p.F151F		Atlas-SNP	.											.	.	.	.	0			c.T453C						.						201.0	173.0	182.0					19																	5737210		1824	4091	5915	SO:0001819	synonymous_variant	257062	exon6			TTTGTTTTGTGTG	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.453T>C	chr19.hg19:g.5737210T>C		77.0	0.0		60.0	4.0	NM_152784	Q6ZRP1	Silent	SNP	ENST00000381624.3	hg19	CCDS12149.2																																																																																			.	.		0.338	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
COL5A3	50509	hgsc.bcm.edu	37	19	10112330	10112330	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:10112330T>C	ENST00000264828.3	-	8	1065	c.980A>G	c.(979-981)gAc>gGc	p.D327G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	327	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGTTCCACTGTCAGGGTCCAA	0.562											OREG0025228	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D327G		Atlas-SNP	.											.	COL5A3	243	.	0			c.A980G						.						87.0	86.0	86.0					19																	10112330		2203	4300	6503	SO:0001583	missense	50509	exon8			CCACTGTCAGGGT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.980A>G	chr19.hg19:g.10112330T>C	ENSP00000264828:p.Asp327Gly	71.0	0.0	662	99.0	39.0	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	hg19	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	9.307	1.054540	0.19907	.	.	ENSG00000080573	ENST00000264828	D	0.89617	-2.54	4.88	0.97	0.19692	.	0.752143	0.11294	N	0.578891	T	0.72614	0.3482	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.57087	-0.7871	10	0.22109	T	0.4	.	3.6501	0.08199	0.0:0.2717:0.1921:0.5362	.	327	P25940	CO5A3_HUMAN	G	327	ENSP00000264828:D327G	ENSP00000264828:D327G	D	-	2	0	COL5A3	9973330	0.002000	0.14202	0.001000	0.08648	0.227000	0.25037	0.039000	0.13884	-0.055000	0.13244	0.379000	0.24179	GAC	.	.		0.562	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
ZNF709	163051	hgsc.bcm.edu	37	19	12575010	12575010	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:12575010G>A	ENST00000397732.3	-	4	1897	c.1726C>T	c.(1726-1728)Cga>Tga	p.R576*	ZNF709_ENST00000428311.1_Nonsense_Mutation_p.R576*|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	576					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						TCATGCATTCGAACAGAACTA	0.418																																					p.R576X	GBM(33;565 669 12371 29134 51667)	Atlas-SNP	.											.	ZNF709	80	.	0			c.C1726T						.						142.0	150.0	147.0					19																	12575010		2202	4300	6502	SO:0001587	stop_gained	163051	exon4			GCATTCGAACAGA	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1726C>T	chr19.hg19:g.12575010G>A	ENSP00000380840:p.Arg576*	57.0	0.0		72.0	4.0	NM_152601	A8K4E6	Nonsense_Mutation	SNP	ENST00000397732.3	hg19	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	G	37	6.530123	0.97641	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	.	.	.	2.89	-0.709	0.11237	.	.	.	.	.	.	.	.	.	.	.	0.48288	D	0.999626	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	.	1.5721	0.02617	0.2167:0.1626:0.4556:0.1652	.	.	.	.	X	576	.	ENSP00000404127:R576X	R	-	1	2	ZNF709;CTD-2192J16.17	12436010	0.000000	0.05858	0.000000	0.03702	0.778000	0.44026	-0.393000	0.07305	-0.040000	0.13580	-0.150000	0.13652	CGA	.	.		0.418	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
NOTCH3	4854	hgsc.bcm.edu	37	19	15302655	15302655	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:15302655C>T	ENST00000263388.2	-	5	778	c.703G>A	c.(703-705)Gtg>Atg	p.V235M		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	235					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TCCACGTTCACTTCACAATTC	0.607																																					p.V235M		Atlas-SNP	.											.	NOTCH3	340	.	0			c.G703A						.						116.0	92.0	100.0					19																	15302655		2203	4300	6503	SO:0001583	missense	4854	exon5			CGTTCACTTCACA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.703G>A	chr19.hg19:g.15302655C>T	ENSP00000263388:p.Val235Met	95.0	0.0		99.0	4.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	hg19	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	c	10.73	1.433183	0.25813	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.90444	-2.67	5.44	3.25	0.37280	EGF-like calcium-binding, conserved site (1);	0.000000	0.29602	N	0.011693	D	0.86879	0.6039	L	0.48174	1.505	0.20403	N	0.99991	P;P	0.43352	0.804;0.626	P;B	0.45856	0.495;0.227	T	0.78370	-0.2230	10	0.46703	T	0.11	.	4.762	0.13113	0.0:0.5923:0.1625:0.2452	.	238;235	Q59FL3;Q9UM47	.;NOTC3_HUMAN	M	235;237	ENSP00000263388:V235M	ENSP00000263388:V235M	V	-	1	0	NOTCH3	15163655	0.970000	0.33590	0.755000	0.31263	0.472000	0.32918	1.454000	0.35178	0.630000	0.30394	0.558000	0.71614	GTG	.	.		0.607	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
MED26	9441	hgsc.bcm.edu	37	19	16687921	16687921	+	Silent	SNP	T	T	C	rs372755647		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:16687921T>C	ENST00000263390.3	-	3	982	c.720A>G	c.(718-720)ggA>ggG	p.G240G	CTC-429P9.4_ENST00000593962.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_Silent_p.G248G	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	240	Pro-rich.				gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						GCAAGCAGGGTCCAGGGGGCT	0.672																																					p.G240G		Atlas-SNP	.											.	MED26	25	.	0			c.A720G						.	T		0,4406		0,0,2203	27.0	31.0	29.0		720	-8.5	0.3	19		29	1,8591		0,1,4295	no	coding-synonymous	MED26	NM_004831.3		0,1,6498	CC,CT,TT		0.0116,0.0,0.0077		240/601	16687921	1,12997	2203	4296	6499	SO:0001819	synonymous_variant	9441	exon3			GCAGGGTCCAGGG	AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.720A>G	chr19.hg19:g.16687921T>C		66.0	0.0		99.0	4.0	NM_004831	A1A4S3|Q0VGB6	Silent	SNP	ENST00000263390.3	hg19	CCDS12347.1																																																																																			.	.		0.672	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461178.1	NM_004831	
PDE4C	5143	hgsc.bcm.edu	37	19	18333125	18333125	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:18333125A>G	ENST00000355502.3	-	6	1122	c.251T>C	c.(250-252)cTg>cCg	p.L84P	PDE4C_ENST00000594617.3_Missense_Mutation_p.L84P|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000447275.3_5'UTR|PDE4C_ENST00000539010.1_5'Flank|PDE4C_ENST00000598111.2_5'Flank|PDE4C_ENST00000594465.3_Missense_Mutation_p.L84P|PDE4C_ENST00000597297.1_5'Flank|PDE4C_ENST00000262805.12_Missense_Mutation_p.L52P			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	84					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CCCATTTTCCAGGTCAAAGCT	0.652																																					p.L84P		Atlas-SNP	.											.	PDE4C	80	.	0			c.T251C						.						37.0	39.0	38.0					19																	18333125		2203	4300	6503	SO:0001583	missense	5143	exon3			TTTTCCAGGTCAA		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.251T>C	chr19.hg19:g.18333125A>G	ENSP00000347689:p.Leu84Pro	38.0	0.0		66.0	4.0	NM_000923	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	ENST00000355502.3	hg19	CCDS12373.1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.816918	0.70912	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000543547	T;T	0.71817	0.95;-0.6	4.35	4.35	0.52113	.	1.648800	0.04170	N	0.324672	T	0.79131	0.4394	L	0.54323	1.7	0.80722	D	1	P;P;P	0.47962	0.903;0.712;0.886	P;P;P	0.52758	0.514;0.534;0.708	T	0.65948	-0.6044	10	0.87932	D	0	.	12.4205	0.55518	1.0:0.0:0.0:0.0	.	193;84;52	B7Z2S3;Q08493;Q08493-3	.;PDE4C_HUMAN;.	P	163;84;72;52;193	ENSP00000347689:L84P;ENSP00000262805:L52P	ENSP00000262805:L52P	L	-	2	0	PDE4C	18194125	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	6.979000	0.76154	1.615000	0.50252	0.254000	0.18369	CTG	.	.		0.652	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1		
MAU2	23383	hgsc.bcm.edu	37	19	19466193	19466193	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:19466193T>C	ENST00000392313.6	+	18	1939	c.1760T>C	c.(1759-1761)cTc>cCc	p.L587P	MAU2_ENST00000262815.8_Missense_Mutation_p.L587P	NM_015329.3	NP_056144.3	Q9Y6X3	SCC4_HUMAN	MAU2 sister chromatid cohesion factor	587					maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	protein N-terminus binding (GO:0047485)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	18						GAACACAACCTCATCACGGTA	0.597																																					p.L587P		Atlas-SNP	.											.	MAU2	38	.	0			c.T1760C						.						88.0	81.0	84.0					19																	19466193		2203	4300	6503	SO:0001583	missense	23383	exon18			ACAACCTCATCAC	AB020699	CCDS32969.2	19p13.11	2013-08-28	2013-08-28	2013-08-28	ENSG00000129933	ENSG00000129933			29140	protein-coding gene	gene with protein product	"""sister chromatid cohesion 4"""	614560	"""KIAA0892"", ""MAU2 chromatid cohesion factor homolog (C. elegans)"""	KIAA0892		10048485	Standard	NM_015329		Approved	MGC75361, mau-2, MAU2L, SCC4	uc002nmk.4	Q9Y6X3	OTTHUMG00000150188	ENST00000392313.6:c.1760T>C	chr19.hg19:g.19466193T>C	ENSP00000376127:p.Leu587Pro	33.0	0.0		57.0	4.0	NM_015329	Q66PT1|Q6P3S7|Q6ZTT2|Q9UFX8	Missense_Mutation	SNP	ENST00000392313.6	hg19	CCDS32969.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.7|24.7	4.562407|4.562407	0.86335|0.86335	.|.	.|.	ENSG00000129933|ENSG00000129933	ENST00000392313;ENST00000262815|ENST00000262816;ENST00000499453	.|.	.|.	.|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.71702|0.71702	0.3371|0.3371	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.983;0.983;0.999|.	P;P;P|.	0.60541|.	0.731;0.827;0.876|.	T|T	0.71510|0.71510	-0.4571|-0.4571	9|5	0.87932|.	D|.	0|.	.|.	14.3201|14.3201	0.66479|0.66479	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	163;192;587|.	Q9Y6X3-3;Q9Y6X3-2;Q9Y6X3|.	.;.;SCC4_HUMAN|.	P|P	587|31	.|.	ENSP00000262815:L587P|.	L|S	+|+	2|1	0|0	MAU2|MAU2	19327193|19327193	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.537000|7.537000	0.82033|0.82033	2.072000|2.072000	0.62099|0.62099	0.459000|0.459000	0.35465|0.35465	CTC|TCA	.	.		0.597	MAU2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000316748.6	NM_015329	
ZNF566	84924	hgsc.bcm.edu	37	19	36940828	36940828	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:36940828T>C	ENST00000434377.2	-	5	389	c.308A>G	c.(307-309)gAa>gGa	p.E103G	ZNF566_ENST00000454319.1_Missense_Mutation_p.E104G|ZNF566_ENST00000424129.2_Missense_Mutation_p.E103G|ZNF566_ENST00000493391.1_5'UTR|ZNF566_ENST00000392170.2_Missense_Mutation_p.E104G	NM_032838.4	NP_116227.1	Q969W8	ZN566_HUMAN	zinc finger protein 566	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24	Esophageal squamous(110;0.162)					TTCCATTATTTCCCACTGGGT	0.368																																					p.E104G		Atlas-SNP	.											.	ZNF566	40	.	0			c.A311G						.						108.0	113.0	111.0					19																	36940828		2203	4300	6503	SO:0001583	missense	84924	exon5			ATTATTTCCCACT	AK074497	CCDS12494.1, CCDS46061.1, CCDS74346.1	19q13.12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25919	protein-coding gene	gene with protein product						12477932	Standard	NM_001145343		Approved	FLJ14779, MGC12515	uc010xtf.2	Q969W8		ENST00000434377.2:c.308A>G	chr19.hg19:g.36940828T>C	ENSP00000415520:p.Glu103Gly	120.0	0.0		95.0	4.0	NM_001145343	B7ZL95|Q2M3J1	Missense_Mutation	SNP	ENST00000434377.2	hg19	CCDS12494.1	.	.	.	.	.	.	.	.	.	.	T	12.27	1.886484	0.33348	.	.	ENSG00000186017	ENST00000454319;ENST00000434377;ENST00000392170;ENST00000424129;ENST00000452939;ENST00000427002	T;T;T;T;T;T	0.05925	3.47;3.47;3.47;3.47;3.37;5.93	4.4	2.06	0.26882	.	0.501050	0.16834	N	0.197623	T	0.11623	0.0283	L	0.49126	1.545	0.26839	N	0.968426	P;D	0.71674	0.94;0.998	B;P	0.61477	0.416;0.889	T	0.15235	-1.0444	10	0.25106	T	0.35	.	4.3257	0.11039	0.3053:0.0:0.1752:0.5195	.	104;103	B7ZL95;Q969W8	.;ZN566_HUMAN	G	104;103;104;103;103;104	ENSP00000394207:E104G;ENSP00000415520:E103G;ENSP00000376010:E104G;ENSP00000401259:E103G;ENSP00000411526:E103G;ENSP00000400651:E104G	ENSP00000376010:E104G	E	-	2	0	ZNF566	41632668	0.000000	0.05858	0.962000	0.40283	0.516000	0.34256	-0.023000	0.12456	0.794000	0.33899	0.454000	0.30748	GAA	.	.		0.368	ZNF566-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000341054.1	NM_032838	
ZNF573	126231	hgsc.bcm.edu	37	19	38229627	38229627	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:38229627T>C	ENST00000590414.2	-	4	1785	c.1764A>G	c.(1762-1764)ggA>ggG	p.G588G	ZNF573_ENST00000392138.1_Silent_p.G501G|ZNF573_ENST00000339503.4_Silent_p.G530G|ZNF573_ENST00000357309.3_Silent_p.G500G|ZNF573_ENST00000536220.1_Silent_p.G500G			Q86YE8	ZN573_HUMAN	zinc finger protein 573	588					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			TAAAGGCCTTTCCACATTCTT	0.393																																					p.G588G		Atlas-SNP	.											ZNF573,NS,carcinoma,0,1	ZNF573	63	.	0			c.A1764G						.						77.0	78.0	78.0					19																	38229627		2203	4300	6503	SO:0001819	synonymous_variant	126231	exon5			GGCCTTTCCACAT	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1764A>G	chr19.hg19:g.38229627T>C		61.0	0.0		49.0	2.0	NM_001172690	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Silent	SNP	ENST00000590414.2	hg19	CCDS59381.1																																																																																			.	.		0.393	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459773.2	NM_152360	
ACP7	390928	hgsc.bcm.edu	37	19	39591791	39591791	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:39591791T>C	ENST00000331256.5	+	9	1191	c.917T>C	c.(916-918)gTc>gCc	p.V306A	PAPL_ENST00000594229.1_Splice_Site_p.S265P	NM_001004318.2	NP_001004318.2	Q6ZNF0	PAPL_HUMAN		306						extracellular region (GO:0005576)	acid phosphatase activity (GO:0003993)|metal ion binding (GO:0046872)										CCTGCCCAGGTCCGCAAAGGC	0.612																																					p.V306A		Atlas-SNP	.											.	.	.	.	0			c.T917C						.						57.0	50.0	53.0					19																	39591791		2203	4300	6503	SO:0001630	splice_region_variant	0	exon9			CCCAGGTCCGCAA																												ENST00000331256.5:c.916-1T>C	chr19.hg19:g.39591791T>C		20.0	0.0		26.0	4.0	NM_001004318	B2RN68	Missense_Mutation	SNP	ENST00000331256.5	hg19	CCDS33018.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.674224	0.88445	.	.	ENSG00000183760	ENST00000331256	.	.	.	5.43	5.43	0.79202	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.74733	0.3755	M	0.79475	2.455	0.53688	D	0.999974	D	0.63880	0.993	P	0.61132	0.884	T	0.73350	-0.4010	9	0.23302	T	0.38	-35.1554	13.4493	0.61161	0.0:0.0:0.0:1.0	.	306	Q6ZNF0	PAPL_HUMAN	A	306	.	ENSP00000327557:V306A	V	+	2	0	AC011443.1	44283631	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.376000	0.66178	2.057000	0.61298	0.533000	0.62120	GTC	.	.		0.612	PAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463810.1		Missense_Mutation
PSMC4	5704	hgsc.bcm.edu	37	19	40486011	40486011	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:40486011G>A	ENST00000157812.2	+	8	1074	c.876G>A	c.(874-876)ctG>ctA	p.L292L	PSMC4_ENST00000455878.2_Silent_p.L261L	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	292					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGCTGGAGCTGCTGAATCAGA	0.562																																					p.L292L	Colon(105;1478 1543 4034 6132 38638)	Atlas-SNP	.											.	PSMC4	48	.	0			c.G876A						.						146.0	143.0	144.0					19																	40486011		2203	4300	6503	SO:0001819	synonymous_variant	5704	exon8			GGAGCTGCTGAAT	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.876G>A	chr19.hg19:g.40486011G>A		224.0	0.0		259.0	108.0	NM_006503	Q96FV5|Q9UBM3|Q9UEX3	Silent	SNP	ENST00000157812.2	hg19	CCDS12547.1																																																																																			.	.		0.562	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	
LYPD5	284348	hgsc.bcm.edu	37	19	44306520	44306520	+	Missense_Mutation	SNP	C	C	T	rs575058964		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:44306520C>T	ENST00000377950.3	-	1	93	c.13G>A	c.(13-15)Gtc>Atc	p.V5I	LYPD5_ENST00000414615.2_Intron|LYPD5_ENST00000594013.1_5'Flank	NM_001031749.2	NP_001026919.2	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5	5						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	8		Prostate(69;0.0352)				ACTCTGGGGACCCCCATTGCC	0.602																																					p.V5I		Atlas-SNP	.											LYPD5_ENST00000377950,colon,carcinoma,0,1	LYPD5	22	.	0			c.G13A						.						64.0	73.0	70.0					19																	44306520		692	1591	2283	SO:0001583	missense	284348	exon1			TGGGGACCCCCAT	AK055031	CCDS12631.1, CCDS46096.1	19q13.31	2008-02-05				ENSG00000159871			26397	protein-coding gene	gene with protein product						12477932	Standard	NM_182573		Approved	FLJ30469	uc002oxm.4	Q6UWN5		ENST00000377950.3:c.13G>A	chr19.hg19:g.44306520C>T	ENSP00000367185:p.Val5Ile	59.0	0.0		92.0	4.0	NM_001031749	Q6PEX9|Q96DR2	Missense_Mutation	SNP	ENST00000377950.3	hg19	CCDS46096.1	.	.	.	.	.	.	.	.	.	.	C	5.781	0.328509	0.10956	.	.	ENSG00000159871	ENST00000377950	T	0.06608	3.28	3.73	-5.05	0.02955	.	1.632970	0.04862	N	0.444244	T	0.03390	0.0098	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42378	-0.9455	10	0.37606	T	0.19	-0.2188	0.3171	0.00297	0.3761:0.2004:0.1378:0.2857	.	5	Q6UWN5	LYPD5_HUMAN	I	5	ENSP00000367185:V5I	ENSP00000367185:V5I	V	-	1	0	LYPD5	48998360	0.000000	0.05858	0.000000	0.03702	0.514000	0.34195	-0.539000	0.06113	-0.894000	0.03925	0.585000	0.79938	GTC	.	.		0.602	LYPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463611.1	NM_182573	
HRC	3270	hgsc.bcm.edu	37	19	49657916	49657916	+	Silent	SNP	T	T	C	rs7409255		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:49657916T>C	ENST00000252825.4	-	1	765	c.579A>G	c.(577-579)gaA>gaG	p.E193E	HRC_ENST00000595625.1_Silent_p.E193E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	193	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		cctcctcctcttcTCCTTCAT	0.557																																					p.E193E	Melanoma(37;75 1097 24567 25669 30645)	Atlas-SNP	.											.	HRC	85	.	0			c.A579G						.						119.0	95.0	103.0					19																	49657916		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			CTCCTCTTCTCCT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.579A>G	chr19.hg19:g.49657916T>C		88.0	0.0		157.0	12.0	NM_002152	Q504Y6	Silent	SNP	ENST00000252825.4	hg19	CCDS12759.1																																																																																			.	.		0.557	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
PRR12	57479	hgsc.bcm.edu	37	19	50100971	50100971	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:50100971A>T	ENST00000418929.2	+	4	3391	c.3379A>T	c.(3379-3381)Agc>Tgc	p.S1127C		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCTGGTCTCCAGCTGCCGCTC	0.706																																					p.S1127C		Atlas-SNP	.											.	PRR12	157	.	0			c.A3379T						.						8.0	12.0	11.0					19																	50100971		1960	4078	6038	SO:0001583	missense	57479	exon4			GTCTCCAGCTGCC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.3379A>T	chr19.hg19:g.50100971A>T	ENSP00000394510:p.Ser1127Cys	58.0	0.0		109.0	43.0	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	hg19	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216213	0.39201	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.58	4.58	0.56647	.	0.000000	0.53938	D	0.000052	T	0.74696	0.3750	L	0.60455	1.87	0.52501	D	0.999954	D	0.89917	1.0	D	0.85130	0.997	T	0.77645	-0.2510	9	0.87932	D	0	-23.8701	13.0387	0.58887	1.0:0.0:0.0:0.0	.	1127	Q9ULL5-3	.	C	1127;307;307	.	ENSP00000246798:S307C	S	+	1	0	PRR12	54792783	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.411000	0.80078	1.917000	0.55516	0.402000	0.26972	AGC	.	.		0.706	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
SIGLEC5	8778	hgsc.bcm.edu	37	19	52130941	52130941	+	Silent	SNP	T	T	C	rs533765364		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:52130941T>C	ENST00000534261.2	-	7	1455	c.1056A>G	c.(1054-1056)agA>agG	p.R352R	SIGLEC5_ENST00000222107.4_Silent_p.R352R|SIGLEC5_ENST00000570106.2_Silent_p.R352R|SIGLEC5_ENST00000429354.3_Silent_p.R352R|SIGLEC5_ENST00000599649.1_Silent_p.R352R			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	352					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GAAAGGAGCATCTGCAGTGCA	0.662													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15181	0.0		0.0	False		,,,				2504	0.0				p.R352R		Atlas-SNP	.											.	SIGLEC5	67	.	0			c.A1056G						.						11.0	14.0	13.0					19																	52130941		2189	4285	6474	SO:0001819	synonymous_variant	8778	exon6			GGAGCATCTGCAG	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1056A>G	chr19.hg19:g.52130941T>C		29.0	0.0		34.0	13.0	NM_003830		Silent	SNP	ENST00000534261.2	hg19	CCDS33088.1																																																																																			.	.		0.662	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
ZNF665	79788	hgsc.bcm.edu	37	19	53668046	53668046	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:53668046C>T	ENST00000600412.1	-	2	1617	c.1502G>A	c.(1501-1503)gGt>gAt	p.G501D	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Missense_Mutation_p.G566D			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G501V(1)|p.G566V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		AGGTTTCTCACCAGTGTGAAT	0.393																																					p.G566D		Atlas-SNP	.											ZNF665,NS,carcinoma,0,1	ZNF665	136	.	2	Substitution - Missense(2)	lung(2)	c.G1697A						.						118.0	124.0	122.0					19																	53668046		2202	4300	6502	SO:0001583	missense	79788	exon4			TTCTCACCAGTGT		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1502G>A	chr19.hg19:g.53668046C>T	ENSP00000469154:p.Gly501Asp	77.0	0.0		71.0	3.0	NM_024733	A8K5T8	Missense_Mutation	SNP	ENST00000600412.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.17	2.753190	0.49362	.	.	ENSG00000197497	ENST00000396424	T	0.26660	1.72	2.44	1.32	0.21799	.	.	.	.	.	T	0.36386	0.0965	L	0.36672	1.1	0.26375	N	0.976824	D	0.89917	1.0	D	0.97110	1.0	T	0.13176	-1.0519	9	0.87932	D	0	.	7.5654	0.27876	0.0:0.849:0.0:0.151	.	566	Q9H7R5-2	.	D	566	ENSP00000379702:G566D	ENSP00000379702:G566D	G	-	2	0	ZNF665	58359858	0.029000	0.19370	0.014000	0.15608	0.020000	0.10135	2.365000	0.44196	0.290000	0.22444	0.543000	0.68304	GGT	.	.		0.393	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
VN1R2	317701	hgsc.bcm.edu	37	19	53762214	53762214	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:53762214T>C	ENST00000341702.3	+	1	670	c.586T>C	c.(586-588)Tcc>Ccc	p.S196P		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	196					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		CCCTAGGAACTCCAGGTGGGC	0.488																																					p.S196P		Atlas-SNP	.											.	VN1R2	71	.	0			c.T586C						.						44.0	45.0	45.0					19																	53762214		2203	4300	6503	SO:0001583	missense	317701	exon1			AGGAACTCCAGGT	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.586T>C	chr19.hg19:g.53762214T>C	ENSP00000351244:p.Ser196Pro	66.0	0.0		112.0	6.0	NM_173856	A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	hg19	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	T	10.04	1.241976	0.22796	.	.	ENSG00000196131	ENST00000341702	T	0.15017	2.46	2.94	2.94	0.34122	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.24851	0.0603	M	0.71296	2.17	0.26533	N	0.974211	B	0.24483	0.104	B	0.35688	0.208	T	0.17379	-1.0371	9	0.46703	T	0.11	.	9.7653	0.40557	0.0:0.0:0.0:1.0	.	196	Q8NFZ6	VN1R2_HUMAN	P	196	ENSP00000351244:S196P	ENSP00000351244:S196P	S	+	1	0	VN1R2	58454026	0.023000	0.18921	0.506000	0.27664	0.191000	0.23601	0.030000	0.13688	1.619000	0.50296	0.486000	0.48141	TCC	.	.		0.488	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
TMEM150B	284417	hgsc.bcm.edu	37	19	55832397	55832397	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:55832397C>A	ENST00000326652.4	-	3	190	c.8G>T	c.(7-9)gGc>gTc	p.G3V	TMEM150B_ENST00000438693.1_Missense_Mutation_p.G3V	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	3						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3						CGACAGGTAGCCCCACATGCC	0.602																																					p.G3V		Atlas-SNP	.											.	TMEM150B	19	.	0			c.G8T						.						50.0	52.0	51.0					19																	55832397		2084	4215	6299	SO:0001583	missense	284417	exon3			AGGTAGCCCCACA	BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.8G>T	chr19.hg19:g.55832397C>A	ENSP00000320757:p.Gly3Val	126.0	0.0		163.0	78.0	NM_001085488	B7ZW71	Missense_Mutation	SNP	ENST00000326652.4	hg19	CCDS42629.1	.	.	.	.	.	.	.	.	.	.	C	6.308	0.424854	0.11987	.	.	ENSG00000180061	ENST00000326652;ENST00000438693	T;T	0.45276	0.9;0.9	4.26	3.22	0.36961	.	0.819449	0.10486	N	0.668948	T	0.33498	0.0865	L	0.50333	1.59	0.37809	D	0.927986	B	0.33694	0.421	B	0.32393	0.145	T	0.10382	-1.0632	10	0.16896	T	0.51	-9.8093	7.6425	0.28303	0.0:0.8748:0.0:0.1252	.	3	A6NC51	T150B_HUMAN	V	3	ENSP00000320757:G3V;ENSP00000412658:G3V	ENSP00000320757:G3V	G	-	2	0	TMEM150B	60524209	0.977000	0.34250	0.998000	0.56505	0.055000	0.15305	0.634000	0.24614	0.906000	0.36621	0.456000	0.33151	GGC	.	.		0.602	TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452685.1	NM_001085488	
ZNF446	55663	hgsc.bcm.edu	37	19	58991708	58991708	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:58991708A>G	ENST00000594369.1	+	7	1349	c.968A>G	c.(967-969)gAg>gGg	p.E323G	ZNF446_ENST00000335841.4_Missense_Mutation_p.S295G|ZNF446_ENST00000596341.1_Missense_Mutation_p.E272G	NM_017908.2	NP_060378.1	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	323	Pro-rich.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		ACGAGACTGGAGCCGGCTGCC	0.672																																					p.E323G		Atlas-SNP	.											.	ZNF446	22	.	0			c.A968G						.						17.0	15.0	15.0					19																	58991708		2191	4291	6482	SO:0001583	missense	55663	exon7			GACTGGAGCCGGC		CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product							Standard	NM_017908		Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.968A>G	chr19.hg19:g.58991708A>G	ENSP00000472802:p.Glu323Gly	80.0	0.0		58.0	4.0	NM_017908		Missense_Mutation	SNP	ENST00000594369.1	hg19	CCDS12982.1	.	.	.	.	.	.	.	.	.	.	A	13.92	2.381940	0.42207	.	.	ENSG00000083838	ENST00000335841;ENST00000540481;ENST00000391694	.	.	.	2.22	1.19	0.21007	.	0.500759	0.14845	N	0.295056	T	0.14874	0.0359	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.09377	0.004	T	0.15093	-1.0449	9	0.34782	T	0.22	-0.016	2.6516	0.05001	0.5531:0.2805:0.1663:0.0	.	323	Q9NWS9	ZN446_HUMAN	G	323;323;220	.	ENSP00000336565:E323G	E	+	2	0	ZNF446	63683520	0.000000	0.05858	0.003000	0.11579	0.021000	0.10359	0.171000	0.16685	0.296000	0.22592	0.454000	0.30748	GAG	.	.		0.672	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467052.1	NM_017908	
TRIM28	10155	hgsc.bcm.edu	37	19	59061183	59061183	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:59061183G>T	ENST00000253024.5	+	14	2351	c.2062G>T	c.(2062-2064)Gac>Tac	p.D688Y	TRIM28_ENST00000341753.6_Missense_Mutation_p.D606Y	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	688					convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GGATGGTGCAGACAGCACTGG	0.602																																					p.D688Y		Atlas-SNP	.											.	TRIM28	46	.	0			c.G2062T						.						86.0	79.0	81.0					19																	59061183		2203	4300	6503	SO:0001583	missense	10155	exon14			GGTGCAGACAGCA		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.2062G>T	chr19.hg19:g.59061183G>T	ENSP00000253024:p.Asp688Tyr	75.0	0.0		39.0	33.0	NM_005762	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	hg19	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658806	0.47467	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.68624	-0.14;-0.34	4.75	1.25	0.21368	.	0.657402	0.14773	N	0.299295	T	0.48660	0.1512	N	0.08118	0	0.09310	N	1	P;P;P	0.47545	0.897;0.478;0.834	P;B;B	0.50192	0.634;0.092;0.334	T	0.34750	-0.9816	10	0.54805	T	0.06	-27.267	3.7431	0.08537	0.2032:0.0:0.6035:0.1934	.	606;688;688	Q13263-2;B2R8R5;Q13263	.;.;TIF1B_HUMAN	Y	688;606	ENSP00000253024:D688Y;ENSP00000342232:D606Y	ENSP00000253024:D688Y	D	+	1	0	TRIM28	63752995	0.765000	0.28485	0.034000	0.17996	0.916000	0.54674	2.107000	0.41844	0.730000	0.32425	0.443000	0.29094	GAC	.	.		0.602	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	NM_005762	
NSFL1C	55968	hgsc.bcm.edu	37	20	1434946	1434946	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:1434946A>G	ENST00000216879.4	-	5	1316	c.449T>C	c.(448-450)tTt>tCt	p.F150S	NSFL1C_ENST00000476071.1_Missense_Mutation_p.F152S|NSFL1C_ENST00000461211.1_5'UTR|NSFL1C_ENST00000350991.4_Missense_Mutation_p.F152S|NSFL1C_ENST00000381658.4_Missense_Mutation_p.F39S|NSFL1C_ENST00000353088.2_Intron	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	150						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						ACCTCCTGCAAATGGCTATAA	0.473																																					p.F150S		Atlas-SNP	.											.	NSFL1C	38	.	0			c.T449C						.						77.0	68.0	71.0					20																	1434946		2203	4300	6503	SO:0001583	missense	55968	exon5			CCTGCAAATGGCT	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.449T>C	chr20.hg19:g.1434946A>G	ENSP00000216879:p.Phe150Ser	56.0	0.0		79.0	5.0	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	ENST00000216879.4	hg19	CCDS13015.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.712239	0.89112	.	.	ENSG00000088833	ENST00000476071;ENST00000216879;ENST00000381658;ENST00000350991	T;T;T;T	0.68479	-0.33;-0.33;0.13;-0.3	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.83751	0.5322	M	0.88775	2.98	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.75484	0.986;0.979	D	0.86937	0.2077	10	0.87932	D	0	-8.4678	14.1151	0.65149	1.0:0.0:0.0:0.0	.	39;150	Q9UNZ2-6;Q9UNZ2	.;NSF1C_HUMAN	S	152;150;39;152	ENSP00000418529:F152S;ENSP00000216879:F150S;ENSP00000371074:F39S;ENSP00000202584:F152S	ENSP00000216879:F150S	F	-	2	0	NSFL1C	1382946	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.180000	0.89694	2.317000	0.78254	0.460000	0.39030	TTT	.	.		0.473	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	
PTPRA	5786	hgsc.bcm.edu	37	20	3007357	3007357	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:3007357A>T	ENST00000216877.6	+	17	2012	c.1612A>T	c.(1612-1614)Aat>Tat	p.N538Y	PTPRA_ENST00000380393.3_Missense_Mutation_p.N547Y|PTPRA_ENST00000399903.2_Missense_Mutation_p.N547Y|PTPRA_ENST00000318266.5_Missense_Mutation_p.N538Y|PTPRA_ENST00000425918.2_Missense_Mutation_p.N558Y|PTPRA_ENST00000358719.4_Missense_Mutation_p.N403Y|PTPRA_ENST00000356147.3_Missense_Mutation_p.N538Y	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	547	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CAAAATCCAGAATGACAAGAT	0.458																																					p.N547Y		Atlas-SNP	.											.	PTPRA	75	.	0			c.A1639T						.						92.0	72.0	79.0					20																	3007357		2203	4300	6503	SO:0001583	missense	5786	exon22			ATCCAGAATGACA		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1612A>T	chr20.hg19:g.3007357A>T	ENSP00000216877:p.Asn538Tyr	68.0	0.0		107.0	49.0	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	ENST00000216877.6	hg19	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	A	15.58	2.874915	0.51695	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T	0.03772	3.85;3.85;3.85;3.81;3.84;3.85;3.85	5.28	4.15	0.48705	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	U	0.000000	T	0.09335	0.0230	L	0.28504	0.86	0.80722	D	1	D;D;D	0.76494	0.977;0.999;0.993	P;D;D	0.85130	0.755;0.997;0.935	T	0.13282	-1.0515	10	0.05351	T	0.99	.	12.3806	0.55305	0.859:0.141:0.0:0.0	.	558;547;538	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	Y	547;538;547;403;157;558;538;538	ENSP00000369756:N547Y;ENSP00000216877:N538Y;ENSP00000382787:N547Y;ENSP00000351559:N403Y;ENSP00000393553:N558Y;ENSP00000314568:N538Y;ENSP00000348468:N538Y	ENSP00000216877:N538Y	N	+	1	0	PTPRA	2955357	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	9.287000	0.95975	0.909000	0.36697	0.459000	0.35465	AAT	.	.		0.458	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
ABHD12	26090	hgsc.bcm.edu	37	20	25300910	25300910	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:25300910T>C	ENST00000339157.5	-	4	739	c.467A>G	c.(466-468)gAc>gGc	p.D156G	ABHD12_ENST00000376542.3_Missense_Mutation_p.D156G	NM_001042472.2	NP_001035937.1	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12	156					adult walking behavior (GO:0007628)|phosphatidylserine catabolic process (GO:0006660)|response to auditory stimulus (GO:0010996)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)	acylglycerol lipase activity (GO:0047372)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	12						CCACATCTGGTCTTTGCCTTG	0.567																																					p.D156G		Atlas-SNP	.											.	ABHD12	46	.	0			c.A467G						.						151.0	105.0	120.0					20																	25300910		2203	4300	6503	SO:0001583	missense	26090	exon4			ATCTGGTCTTTGC	AL117442	CCDS13172.1, CCDS42857.1	20p11.21	2007-04-24	2006-03-10	2006-03-10	ENSG00000100997	ENSG00000100997		"""Abhydrolase domain containing"""	15868	protein-coding gene	gene with protein product		613599	"""chromosome 20 open reading frame 22"""	C20orf22			Standard	NM_015600		Approved	DKFZP434P106, dJ965G21.2, BEM46L2, ABHD12A	uc002wuq.3	Q8N2K0	OTTHUMG00000032121	ENST00000339157.5:c.467A>G	chr20.hg19:g.25300910T>C	ENSP00000341408:p.Asp156Gly	64.0	0.0		81.0	4.0	NM_001042472	A6NED4|A6NJ90|A8K450|B4DE71|Q5T710|Q5T711|Q96CR1|Q9BX05|Q9NPX7|Q9UFV6	Missense_Mutation	SNP	ENST00000339157.5	hg19	CCDS42857.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261354	0.59431	.	.	ENSG00000100997	ENST00000376542;ENST00000339157;ENST00000526543;ENST00000450393	T;T;T	0.56444	0.46;0.46;0.46	5.75	4.66	0.58398	.	0.393509	0.32785	N	0.005660	T	0.47097	0.1427	L	0.55743	1.74	0.58432	D	0.999996	B;P;P	0.43287	0.024;0.688;0.802	B;B;B	0.40477	0.03;0.095;0.33	T	0.36939	-0.9727	10	0.30854	T	0.27	-0.0022	11.0318	0.47779	0.0:0.0728:0.0:0.9272	.	111;156;156	Q5T712;Q8N2K0;Q8N2K0-2	.;ABD12_HUMAN;.	G	156;156;118;111	ENSP00000365725:D156G;ENSP00000341408:D156G;ENSP00000413311:D111G	ENSP00000341408:D156G	D	-	2	0	ABHD12	25248910	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.899000	0.56288	1.030000	0.39839	0.533000	0.62120	GAC	.	.		0.567	ABHD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078423.2	NM_015600	
MYH7B	57644	hgsc.bcm.edu	37	20	33575459	33575459	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:33575459A>T	ENST00000262873.7	+	15	1465	c.1373A>T	c.(1372-1374)aAg>aTg	p.K458M	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	416	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TACGTGACCAAGGGCCAGAGT	0.662																																					p.K458M		Atlas-SNP	.											.	MYH7B	145	.	0			c.A1373T						.						97.0	106.0	103.0					20																	33575459		2071	4202	6273	SO:0001583	missense	57644	exon17			TGACCAAGGGCCA	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1373A>T	chr20.hg19:g.33575459A>T	ENSP00000262873:p.Lys458Met	70.0	0.0		141.0	32.0	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	hg19	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221462	0.79464	.	.	ENSG00000078814	ENST00000262873	D	0.88741	-2.42	3.53	3.53	0.40419	Myosin head, motor domain (2);	0.000000	0.37623	N	0.002007	D	0.95755	0.8619	H	0.96633	3.855	0.58432	D	0.999994	D	0.58268	0.982	D	0.65233	0.933	D	0.96837	0.9615	10	0.87932	D	0	.	13.1334	0.59395	1.0:0.0:0.0:0.0	.	416	A7E2Y1	MYH7B_HUMAN	M	458	ENSP00000262873:K458M	ENSP00000262873:K458M	K	+	2	0	MYH7B	33039120	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.109000	0.94291	1.849000	0.53698	0.459000	0.35465	AAG	.	.		0.662	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
RBM12	10137	hgsc.bcm.edu	37	20	34240764	34240764	+	Silent	SNP	A	A	G	rs201125389		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:34240764A>G	ENST00000374114.3	-	3	2744	c.2481T>C	c.(2479-2481)ccT>ccC	p.P827P	CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000359646.1_Silent_p.P827P|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317677.5_Intron|RP1-309K20.6_ENST00000541176.2_Intron|RBM12_ENST00000374104.3_Silent_p.P827P|CPNE1_ENST00000397442.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	827	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			ggccggggccaggCCCAAAAG	0.627																																					p.P827P		Atlas-SNP	.											RBM12,rectum,NS,0,2	RBM12	93	.	0			c.T2481C						.						12.0	14.0	13.0					20																	34240764		2147	4263	6410	SO:0001819	synonymous_variant	10137	exon2			GGGGCCAGGCCCA	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2481T>C	chr20.hg19:g.34240764A>G		43.0	0.0		83.0	4.0	NM_001198840	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Silent	SNP	ENST00000374114.3	hg19	CCDS13261.1																																																																																			.	A|0.996;G|0.004		0.627	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
CNBD2	140894	hgsc.bcm.edu	37	20	34611572	34611572	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:34611572T>C	ENST00000373973.3	+	11	1491	c.1318T>C	c.(1318-1320)Ttg>Ctg	p.L440L	CNBD2_ENST00000349339.1_Silent_p.L436L|CNBD2_ENST00000538900.1_Intron			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	440																	CACACGACCCTTGATCCTGAT	0.463																																					p.L436L		Atlas-SNP	.											.	.	.	.	0			c.T1306C						.						108.0	104.0	105.0					20																	34611572		2203	4300	6503	SO:0001819	synonymous_variant	140894	exon11			CGACCCTTGATCC	AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.1318T>C	chr20.hg19:g.34611572T>C		71.0	0.0		95.0	4.0	NM_080834	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Silent	SNP	ENST00000373973.3	hg19																																																																																				.	.		0.463	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2	NM_080834	
WFDC13	164237	hgsc.bcm.edu	37	20	44334544	44334544	+	Nonstop_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:44334544A>G	ENST00000305479.2	+	3	390	c.282A>G	c.(280-282)tgA>tgG	p.*94W	WFDC10B_ENST00000330523.5_5'Flank|MIR3617_ENST00000577518.1_RNA|WFDC10B_ENST00000335769.2_5'Flank	NM_172005.1	NP_742002.1	Q8IUB5	WFD13_HUMAN	WAP four-disulfide core domain 13	0						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			skin(1)|upper_aerodigestive_tract(1)	2		Myeloproliferative disorder(115;0.0122)				CTGCCAACTGAGGCATATTTC	0.393																																					p.X94W		Atlas-SNP	.											.	WFDC13	6	.	0			c.A282G						.						110.0	101.0	104.0					20																	44334544		2203	4300	6503	SO:0001578	stop_lost	164237	exon3			CAACTGAGGCATA	AF454505	CCDS13367.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000168634	ENSG00000168634		"""WAP four-disulfide core domain containing"""	16131	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 138"""	C20orf138		12206714	Standard	NM_172005		Approved	dJ601O1.3, WAP13	uc002xpd.3	Q8IUB5	OTTHUMG00000046333	ENST00000305479.2:c.282A>G	chr20.hg19:g.44334544A>G	ENSP00000302938:p.*94Trpext*48	58.0	0.0		96.0	4.0	NM_172005	Q5TEU7|Q8WWK7	Missense_Mutation	SNP	ENST00000305479.2	hg19	CCDS13367.1	.	.	.	.	.	.	.	.	.	.	A	1.236	-0.622688	0.03636	.	.	ENSG00000168634	ENST00000305479	.	.	.	2.97	1.82	0.25136	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3021	0.15783	0.7455:0.0:0.0:0.2545	.	.	.	.	W	94	.	.	X	+	3	0	WFDC13	43767958	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.501000	0.22578	0.519000	0.28406	0.402000	0.26972	TGA	.	.		0.393	WFDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106946.1		
USP25	29761	hgsc.bcm.edu	37	21	17163836	17163836	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:17163836C>T	ENST00000285679.6	+	5	777	c.408C>T	c.(406-408)agC>agT	p.S136S	USP25_ENST00000547201.1_3'UTR|USP25_ENST00000285681.2_Silent_p.S136S|USP25_ENST00000400183.2_Silent_p.S136S|USP25_ENST00000351097.5_Silent_p.S136S	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	136					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TTGAAGCCAGCATAGCAGAGA	0.378																																					p.S136S		Atlas-SNP	.											USP25,colon,carcinoma,0,1	USP25	156	.	0			c.C408T						.						113.0	115.0	114.0					21																	17163836		2202	4300	6502	SO:0001819	synonymous_variant	29761	exon5			AGCCAGCATAGCA	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.408C>T	chr21.hg19:g.17163836C>T		62.0	0.0		60.0	4.0	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	ENST00000285679.6	hg19	CCDS33515.1																																																																																			.	.		0.378	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
LTN1	26046	hgsc.bcm.edu	37	21	30329699	30329699	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:30329699C>T	ENST00000361371.5	-	15	2926	c.2847G>A	c.(2845-2847)ccG>ccA	p.P949P	LTN1_ENST00000389194.2_Silent_p.P995P			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	949					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						CACTGTCGTTCGGCATTACAC	0.383																																					p.P995P		Atlas-SNP	.											.	LTN1	141	.	0			c.G2985A						.						97.0	86.0	90.0					21																	30329699		2203	4300	6503	SO:0001819	synonymous_variant	26046	exon15			GTCGTTCGGCATT	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.2847G>A	chr21.hg19:g.30329699C>T		64.0	0.0		68.0	4.0	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Silent	SNP	ENST00000361371.5	hg19																																																																																				.	.		0.383	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
CLIC6	54102	hgsc.bcm.edu	37	21	36081737	36081737	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:36081737C>T	ENST00000360731.3	+	6	1854	c.1854C>T	c.(1852-1854)taC>taT	p.Y618Y	CLIC6_ENST00000349499.2_Silent_p.Y600Y			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	618	GST C-terminal.					chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TAGATGCCTACAGCACCGAGG	0.473																																					p.Y600Y		Atlas-SNP	.											.	CLIC6	49	.	0			c.C1800T						.						118.0	109.0	112.0					21																	36081737		2203	4300	6503	SO:0001819	synonymous_variant	54102	exon5			TGCCTACAGCACC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.1854C>T	chr21.hg19:g.36081737C>T		52.0	0.0		61.0	4.0	NM_053277	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	hg19																																																																																				.	.		0.473	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
PRDM15	63977	hgsc.bcm.edu	37	21	43223051	43223051	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:43223051C>T	ENST00000269844.3	-	30	3972	c.3862G>A	c.(3862-3864)Gcc>Acc	p.A1288T	PRDM15_ENST00000538201.1_Missense_Mutation_p.A942T|PRDM15_ENST00000422911.1_Missense_Mutation_p.A979T|PRDM15_ENST00000398548.1_Missense_Mutation_p.A959T|PRDM15_ENST00000447207.2_Missense_Mutation_p.A922T|PRDM15_ENST00000470586.1_5'UTR	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1288					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TTCCCTTCGGCCAAATCCTCC	0.612																																					p.A1288T		Atlas-SNP	.											.	PRDM15	110	.	0			c.G3862A						.						125.0	137.0	133.0					21																	43223051		2203	4300	6503	SO:0001583	missense	63977	exon30			CTTCGGCCAAATC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.3862G>A	chr21.hg19:g.43223051C>T	ENSP00000269844:p.Ala1288Thr	29.0	0.0		58.0	4.0	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	hg19	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	c	13.76	2.334408	0.41297	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.08102	3.18;3.19;3.19;3.18;3.13	4.9	2.94	0.34122	.	.	.	.	.	T	0.04634	0.0126	N	0.08118	0	0.09310	N	1	B;B;B	0.27229	0.031;0.001;0.172	B;B;B	0.22386	0.009;0.003;0.039	T	0.41662	-0.9496	9	0.19147	T	0.46	-19.0707	12.8528	0.57867	0.0:0.3899:0.6101:0.0	.	1288;979;959	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	T	979;959;942;922;1288	ENSP00000408592:A979T;ENSP00000381556:A959T;ENSP00000444044:A942T;ENSP00000390245:A922T;ENSP00000269844:A1288T	ENSP00000269844:A1288T	A	-	1	0	PRDM15	42096120	0.998000	0.40836	0.187000	0.23214	0.863000	0.49368	1.353000	0.34045	1.000000	0.39049	0.479000	0.44913	GCC	.	.		0.612	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
PCNT	5116	hgsc.bcm.edu	37	21	47783761	47783761	+	Missense_Mutation	SNP	C	C	T	rs578233518		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:47783761C>T	ENST00000359568.5	+	14	2628	c.2521C>T	c.(2521-2523)Cgg>Tgg	p.R841W	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	841					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CCAGTGTGGGCGGGAGCCGCC	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17809	0.0		0.0	False		,,,				2504	0.001				p.R841W		Atlas-SNP	.											.	PCNT	283	.	0			c.C2521T						.						70.0	82.0	78.0					21																	47783761		2200	4285	6485	SO:0001583	missense	5116	exon14			TGTGGGCGGGAGC	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2521C>T	chr21.hg19:g.47783761C>T	ENSP00000352572:p.Arg841Trp	74.0	0.0		82.0	41.0	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	hg19	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851286	0.51270	.	.	ENSG00000160299	ENST00000359568	T	0.26223	1.75	4.43	1.47	0.22746	.	1.622470	0.04257	N	0.339623	T	0.37210	0.0995	L	0.44542	1.39	0.25862	N	0.983816	D;D	0.76494	0.999;0.999	P;P	0.59546	0.859;0.824	T	0.12967	-1.0527	10	0.56958	D	0.05	.	5.1827	0.15169	0.1601:0.6588:0.0:0.1811	.	723;841	O95613-2;O95613	.;PCNT_HUMAN	W	841	ENSP00000352572:R841W	ENSP00000352572:R841W	R	+	1	2	PCNT	46608189	0.271000	0.24162	0.896000	0.35187	0.274000	0.26718	0.285000	0.18883	0.301000	0.22738	0.491000	0.48974	CGG	.	.		0.667	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
SERPIND1	3053	hgsc.bcm.edu	37	22	21138492	21138492	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:21138492A>G	ENST00000215727.5	+	3	1405	c.1122A>G	c.(1120-1122)acA>acG	p.T374T	SERPIND1_ENST00000406799.1_Silent_p.T374T|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron|PI4KA_ENST00000572273.1_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	374					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	CGCAACTGACACCCCGGGTGG	0.522											OREG0026325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T374T		Atlas-SNP	.											.	SERPIND1	92	.	0			c.A1122G						.						77.0	69.0	72.0					22																	21138492		2203	4300	6503	SO:0001819	synonymous_variant	3053	exon3			ACTGACACCCCGG	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.1122A>G	chr22.hg19:g.21138492A>G		57.0	0.0	746	78.0	4.0	NM_000185	B2RAI1|D3DX34|Q6IBZ5	Silent	SNP	ENST00000215727.5	hg19	CCDS13783.1																																																																																			.	.		0.522	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319961.1	NM_000185	
THAP7	80764	hgsc.bcm.edu	37	22	21354195	21354195	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:21354195T>C	ENST00000215742.4	-	4	1078	c.904A>G	c.(904-906)Atg>Gtg	p.M302V	THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000429962.1_RNA|THAP7_ENST00000399133.2_Missense_Mutation_p.M302V|THAP7-AS1_ENST00000436079.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	302					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTCAGCTGCATGGCAAAGTCC	0.642																																					p.M302V		Atlas-SNP	.											.	THAP7	15	.	0			c.A904G						.						30.0	31.0	31.0					22																	21354195		2202	4298	6500	SO:0001583	missense	80764	exon4			GCTGCATGGCAAA	BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.904A>G	chr22.hg19:g.21354195T>C	ENSP00000215742:p.Met302Val	67.0	0.0		88.0	4.0	NM_030573	B2RD97|D3DX40	Missense_Mutation	SNP	ENST00000215742.4	hg19	CCDS13787.1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.226125	0.39300	.	.	ENSG00000184436	ENST00000215742;ENST00000399133	D;D	0.95756	-3.8;-3.8	4.83	2.57	0.30868	.	0.071376	0.53938	D	0.000049	D	0.86426	0.5930	N	0.08118	0	0.28818	N	0.897874	B	0.06786	0.001	B	0.01281	0.0	T	0.79040	-0.1966	10	0.51188	T	0.08	-9.8685	5.1657	0.15084	0.0:0.0975:0.2829:0.6196	.	302	Q9BT49	THAP7_HUMAN	V	302	ENSP00000215742:M302V;ENSP00000382084:M302V	ENSP00000215742:M302V	M	-	1	0	THAP7	19684195	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.322000	0.33689	0.979000	0.38497	0.533000	0.62120	ATG	.	.		0.642	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320405.1	NM_030573	
UBE2L3	7332	hgsc.bcm.edu	37	22	21922044	21922044	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:21922044G>T	ENST00000342192.4	+	1	209	c.11G>T	c.(10-12)aGc>aTc	p.S4I	UBE2L3_ENST00000545681.1_Missense_Mutation_p.S4I|UBE2L3_ENST00000458578.2_Intron	NM_003347.3	NP_003338.1	P68036	UB2L3_HUMAN	ubiquitin-conjugating enzyme E2L 3	4					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein K11-linked ubiquitination (GO:0070979)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)|ubiquitin-protein transferase activity (GO:0004842)		UBE2L3/KRAS(2)	large_intestine(4)	4	Colorectal(54;0.105)					ATGGCGGCCAGCAGGAGGCTG	0.706																																					p.S4I		Atlas-SNP	.											.	UBE2L3	11	.	0			c.G11T						.						16.0	18.0	17.0					22																	21922044		2173	4259	6432	SO:0001583	missense	7332	exon1			CGGCCAGCAGGAG	AJ000519	CCDS13790.1, CCDS58795.1, CCDS58796.1	22q11.2	2007-02-05			ENSG00000185651	ENSG00000185651		"""Ubiquitin-conjugating enzymes E2"""	12488	protein-coding gene	gene with protein product		603721				8672131, 9693040	Standard	NM_001256356		Approved	UBCH7	uc031rxe.1	P68036	OTTHUMG00000150823	ENST00000342192.4:c.11G>T	chr22.hg19:g.21922044G>T	ENSP00000344259:p.Ser4Ile	141.0	0.0		153.0	57.0	NM_003347	B2R4A7|B4DDG1|B4DSZ4|E7EWS7|P51966|P70653|Q9HAV1	Missense_Mutation	SNP	ENST00000342192.4	hg19	CCDS13790.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879892	0.51801	.	.	ENSG00000185651	ENST00000342192;ENST00000545681	T;T	0.71579	-0.58;1.52	4.53	3.48	0.39840	Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	L	0.60904	1.88	0.22199	N	0.999299	B;B;B	0.19817	0.013;0.039;0.039	B;B;B	0.29598	0.015;0.104;0.104	T	0.55153	-0.8185	10	0.37606	T	0.19	.	8.7098	0.34376	0.1084:0.0:0.8916:0.0	.	4;4;4	B4DDG1;P68036;A8K4W8	.;UB2L3_HUMAN;.	I	4	ENSP00000344259:S4I;ENSP00000445931:S4I	ENSP00000344259:S4I	S	+	2	0	UBE2L3	20252044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.180000	0.58296	2.344000	0.79699	0.558000	0.71614	AGC	.	.		0.706	UBE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320219.1	NM_198157	
PLA2G3	50487	hgsc.bcm.edu	37	22	31531911	31531911	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:31531911T>C	ENST00000215885.3	-	7	1580	c.1328A>G	c.(1327-1329)gAc>gGc	p.D443G		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	443					acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						GGCCCTAGGGTCTCTGGAACA	0.592																																					p.D443G		Atlas-SNP	.											.	PLA2G3	85	.	0			c.A1328G						.						38.0	40.0	40.0					22																	31531911		2203	4300	6503	SO:0001583	missense	50487	exon7			CTAGGGTCTCTGG	AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.1328A>G	chr22.hg19:g.31531911T>C	ENSP00000215885:p.Asp443Gly	38.0	0.0		72.0	4.0	NM_015715	O95768	Missense_Mutation	SNP	ENST00000215885.3	hg19	CCDS13889.1	.	.	.	.	.	.	.	.	.	.	T	4.324	0.059549	0.08339	.	.	ENSG00000100078	ENST00000215885	T	0.31769	1.48	5.27	0.165	0.14995	Phospholipase A2 (2);	0.512740	0.20560	N	0.089936	T	0.22589	0.0545	L	0.55103	1.725	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.18618	-1.0331	10	0.54805	T	0.06	-10.0515	3.1596	0.06516	0.1883:0.3471:0.0:0.4645	.	443	Q9NZ20	PA2G3_HUMAN	G	443	ENSP00000215885:D443G	ENSP00000215885:D443G	D	-	2	0	PLA2G3	29861911	0.002000	0.14202	0.039000	0.18376	0.298000	0.27526	0.408000	0.21065	0.075000	0.16796	0.533000	0.62120	GAC	.	.		0.592	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321938.1	NM_015715	
SEPT3	55964	hgsc.bcm.edu	37	22	42392914	42392914	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:42392914C>T	ENST00000396426.3	+	11	1275	c.1020C>T	c.(1018-1020)ggC>ggT	p.G340G	SEPT3_ENST00000396425.3_3'UTR|WBP2NL_ENST00000328823.9_5'Flank|SEPT3_ENST00000406029.1_Silent_p.G276G|SEPT3_ENST00000328414.8_3'UTR	NM_145733.2	NP_663786.2	Q9UH03	SEPT3_HUMAN	septin 3	340					cell cycle (GO:0007049)|cell division (GO:0051301)	cell junction (GO:0030054)|septin complex (GO:0031105)|synapse (GO:0045202)	GTP binding (GO:0005525)			breast(1)|kidney(3)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	17						AGGGAGAAGGCCTCCTGGGCA	0.582																																					p.G340G		Atlas-SNP	.											.	SEPT3	53	.	0			c.C1020T						.						170.0	152.0	158.0					22																	42392914		2203	4300	6503	SO:0001819	synonymous_variant	55964	exon11			AGAAGGCCTCCTG	AF285107	CCDS14026.2, CCDS14027.2	22q13.2	2013-01-21			ENSG00000100167	ENSG00000100167		"""Septins"""	10750	protein-coding gene	gene with protein product		608314		SEP3			Standard	NM_019106		Approved		uc003bbr.4	Q9UH03	OTTHUMG00000030494	ENST00000396426.3:c.1020C>T	chr22.hg19:g.42392914C>T		90.0	0.0		88.0	4.0	NM_145733	B1AHR0|Q2NKJ7|Q59GF7|Q6IBZ6|Q8N3P3|Q9HD35	Silent	SNP	ENST00000396426.3	hg19	CCDS14026.2																																																																																			.	.		0.582	SEPT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322051.1	NM_145734	
TCF20	6942	hgsc.bcm.edu	37	22	42610352	42610352	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:42610352T>C	ENST00000359486.3	-	1	1096	c.960A>G	c.(958-960)caA>caG	p.Q320Q	TCF20_ENST00000335626.4_Silent_p.Q320Q	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	320	Poly-Gln.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GGtgttgttgttgctgcggtt	0.512																																					p.Q320Q		Atlas-SNP	.											.	TCF20	164	.	0			c.A960G						.						83.0	82.0	82.0					22																	42610352		2203	4300	6503	SO:0001819	synonymous_variant	6942	exon1			TTGTTGTTGCTGC	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.960A>G	chr22.hg19:g.42610352T>C		128.0	0.0		193.0	9.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	ENST00000359486.3	hg19	CCDS14033.1																																																																																			.	.		0.512	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
LDOC1L	84247	hgsc.bcm.edu	37	22	44892949	44892949	+	Missense_Mutation	SNP	C	C	T	rs374819770		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:44892949C>T	ENST00000341255.3	-	2	997	c.488G>A	c.(487-489)cGc>cAc	p.R163H		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	163										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		ATAGTTGTTGCGCAAGGGGCT	0.607																																					p.R163H		Atlas-SNP	.											.	LDOC1L	24	.	0			c.G488A						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	42.0	44.0	43.0		488	3.1	1.0	22		43	0,8600		0,0,4300	no	missense	LDOC1L	NM_032287.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	163/240	44892949	1,13005	2203	4300	6503	SO:0001583	missense	84247	exon2			TTGTTGCGCAAGG	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.488G>A	chr22.hg19:g.44892949C>T	ENSP00000340434:p.Arg163His	78.0	0.0		98.0	36.0	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	hg19	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587931	0.46110	2.27E-4	0.0	ENSG00000188636	ENST00000341255	T	0.18338	2.22	3.1	3.1	0.35709	.	0.187151	0.24070	N	0.041823	T	0.06142	0.0159	N	0.08118	0	0.30172	N	0.801228	P	0.37997	0.614	B	0.25987	0.065	T	0.17561	-1.0365	10	0.19147	T	0.46	-5.6274	9.9334	0.41537	0.0:1.0:0.0:0.0	.	163	Q6ICC9	LDOCL_HUMAN	H	163	ENSP00000340434:R163H	ENSP00000340434:R163H	R	-	2	0	LDOC1L	43271613	0.923000	0.31300	1.000000	0.80357	0.994000	0.84299	3.073000	0.50057	2.054000	0.61138	0.591000	0.81541	CGC	.	.		0.607	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
TYMP	1890	hgsc.bcm.edu	37	22	50967939	50967939	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:50967939T>C	ENST00000252029.3	-	2	362	c.200A>G	c.(199-201)cAg>cGg	p.Q67R	TYMP_ENST00000395681.1_Missense_Mutation_p.Q67R|TYMP_ENST00000395680.1_Missense_Mutation_p.Q67R|TYMP_ENST00000395678.3_Missense_Mutation_p.Q67R	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	67					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	CTGTGCGCCCTGCGCGCTCCC	0.687																																					p.Q67R		Atlas-SNP	.											.	TYMP	25	.	0			c.A200G						.						41.0	45.0	44.0					22																	50967939		2202	4298	6500	SO:0001583	missense	1890	exon2			GCGCCCTGCGCGC	M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.200A>G	chr22.hg19:g.50967939T>C	ENSP00000252029:p.Gln67Arg	103.0	0.0		96.0	4.0	NM_001257989	A8MW15|H9KVA0|Q13390|Q8WVB7	Missense_Mutation	SNP	ENST00000252029.3	hg19	CCDS14096.1	.	.	.	.	.	.	.	.	.	.	T	15.64	2.894293	0.52121	.	.	ENSG00000025708	ENST00000395680;ENST00000395681;ENST00000252029;ENST00000395678;ENST00000425169	D;D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0;-3.0	4.77	4.77	0.60923	Glycosyl transferase, family 3, N-terminal (2);Glycosyl transferase, family 3, subgroup, N-terminal (1);	0.134858	0.51477	D	0.000095	D	0.84902	0.5575	N	0.17723	0.515	0.38071	D	0.936369	B;B;B;B	0.23891	0.043;0.093;0.093;0.093	B;B;B;B	0.17098	0.017;0.016;0.016;0.016	D	0.83923	0.0302	10	0.87932	D	0	-1.9173	10.6743	0.45776	0.0:0.0:0.0:1.0	.	67;67;67;67	B4DVR2;B2RBL3;E5KRG5;P19971	.;.;.;TYPH_HUMAN	R	67	ENSP00000379037:Q67R;ENSP00000379038:Q67R;ENSP00000252029:Q67R;ENSP00000379036:Q67R;ENSP00000395875:Q67R	ENSP00000252029:Q67R	Q	-	2	0	TYMP	49314805	1.000000	0.71417	0.292000	0.24919	0.494000	0.33585	2.886000	0.48578	1.784000	0.52394	0.368000	0.22195	CAG	.	.		0.687	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317081.1	NM_001953	
ASMTL	8623	hgsc.bcm.edu	37	X	1522164	1522164	+	Nonstop_Mutation	SNP	A	A	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:1522164A>C	ENST00000381317.3	-	13	1896	c.1864T>G	c.(1864-1866)Tga>Gga	p.*622G	ASMTL_ENST00000534940.1_Nonstop_Mutation_p.*564G|ASMTL-AS1_ENST00000419737.2_RNA|ASMTL-AS1_ENST00000602357.1_RNA|ASMTL-AS1_ENST00000443929.1_RNA|ASMTL-AS1_ENST00000420411.2_RNA|ASMTL-AS1_ENST00000425740.2_RNA|ASMTL_ENST00000416733.2_Nonstop_Mutation_p.*546G|ASMTL_ENST00000381333.4_Nonstop_Mutation_p.*606G	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	0						cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCTGGGCTTCAGGGGGCCACT	0.607																																					p.X622G		Atlas-SNP	.											.	ASMTL	56	.	0			c.T1864G						.						47.0	49.0	49.0					X																	1522164		1952	4068	6020	SO:0001578	stop_lost	8623	exon13			GGCTTCAGGGGGC	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1864T>G	chrX.hg19:g.1522164A>C	ENSP00000370718:p.*622Argext*30	66.0	0.0		81.0	8.0	NM_004192	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	hg19	CCDS43917.1	.	.	.	.	.	.	.	.	.	.	a	0.022	-1.412479	0.01145	.	.	ENSG00000169093	ENST00000416733;ENST00000534940;ENST00000381333;ENST00000381317	.	.	.	0.752	0.752	0.18398	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	G	546;564;606;622	.	.	X	-	1	0	ASMTL	1482164	0.914000	0.31030	0.007000	0.13788	0.157000	0.22087	0.652000	0.24888	0.572000	0.29383	0.097000	0.15509	TGA	.	.		0.607	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192	
PRKX	5613	hgsc.bcm.edu	37	X	3631158	3631158	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:3631158A>G	ENST00000262848.5	-	1	491	c.137T>C	c.(136-138)cTg>cCg	p.L46P		NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	46					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				AAAGTCCTGCAGGCTGTACAC	0.721																																					p.L46P		Atlas-SNP	.											.	PRKX	29	.	0			c.T137C						.						7.0	6.0	6.0					X																	3631158		2100	4114	6214	SO:0001583	missense	5613	exon1			TCCTGCAGGCTGT		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.137T>C	chrX.hg19:g.3631158A>G	ENSP00000262848:p.Leu46Pro	38.0	0.0		74.0	4.0	NM_005044		Missense_Mutation	SNP	ENST00000262848.5	hg19	CCDS14125.1	.	.	.	.	.	.	.	.	.	.	A	15.68	2.906548	0.52333	.	.	ENSG00000183943	ENST00000262848	T	0.08896	3.04	1.08	1.08	0.20341	Protein kinase-like domain (1);	0.152029	0.27193	U	0.020484	T	0.10594	0.0259	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	T	0.21008	-1.0258	10	0.87932	D	0	.	4.161	0.10284	1.0:0.0:0.0:0.0	.	46	P51817	PRKX_HUMAN	P	46	ENSP00000262848:L46P	ENSP00000262848:L46P	L	-	2	0	PRKX	3641158	0.876000	0.30132	0.010000	0.14722	0.167000	0.22549	0.403000	0.20982	0.400000	0.25396	0.242000	0.17961	CTG	.	.		0.721	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
RBBP7	5931	hgsc.bcm.edu	37	X	16876930	16876930	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:16876930T>C	ENST00000380087.2	-	4	710	c.350A>G	c.(349-351)gAa>gGa	p.E117G	RBBP7_ENST00000404022.1_Missense_Mutation_p.E108G|RBBP7_ENST00000380084.4_Missense_Mutation_p.E161G			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	117					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					GATTTTAATTTCACATTCAAT	0.378																																					p.E161G		Atlas-SNP	.											.	RBBP7	58	.	0			c.A482G						.						178.0	142.0	154.0					X																	16876930		2203	4300	6503	SO:0001583	missense	5931	exon4			TTAATTTCACATT	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.350A>G	chrX.hg19:g.16876930T>C	ENSP00000369427:p.Glu117Gly	87.0	0.0		91.0	4.0	NM_001198719	Q5JP00	Missense_Mutation	SNP	ENST00000380087.2	hg19	CCDS14179.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.442351	0.63067	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000416035	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.11	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64193	0.2576	M	0.67953	2.075	0.58432	D	0.999993	P;P;P	0.48834	0.462;0.916;0.581	B;B;B	0.40199	0.078;0.322;0.111	T	0.69117	-0.5230	10	0.51188	T	0.08	-18.6204	13.4083	0.60926	0.0:0.0:0.0:1.0	.	108;117;161	E9PC52;Q16576;Q5JP00	.;RBBP7_HUMAN;.	G	117;161;108;37	ENSP00000369427:E117G;ENSP00000369424:E161G;ENSP00000386068:E108G;ENSP00000392714:E37G	ENSP00000369424:E161G	E	-	2	0	RBBP7	16786851	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.993000	0.88291	1.829000	0.53265	0.481000	0.45027	GAA	.	.		0.378	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893	
YY2	404281	hgsc.bcm.edu	37	X	21875262	21875262	+	Silent	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:21875262T>A	ENST00000429584.2	+	1	1158	c.660T>A	c.(658-660)ccT>ccA	p.P220P	MBTPS2_ENST00000379484.5_Intron|MBTPS2_ENST00000365779.2_Intron|MBTPS2_ENST00000465888.1_3'UTR	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						AGAAACTTCCTCCTGGGGGGT	0.488																																					p.P220P		Atlas-SNP	.											.	YY2	43	.	0			c.T660A						.						130.0	144.0	139.0					X																	21875262		2203	4300	6503	SO:0001819	synonymous_variant	404281	exon1			ACTTCCTCCTGGG	AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.660T>A	chrX.hg19:g.21875262T>A		87.0	0.0		110.0	46.0	NM_206923	B2RP10|Q6Q1S4	Silent	SNP	ENST00000429584.2	hg19	CCDS14202.1																																																																																			.	.		0.488	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923	
RLIM	51132	hgsc.bcm.edu	37	X	73814206	73814206	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:73814206T>A	ENST00000332687.6	-	3	406	c.188A>T	c.(187-189)gAg>gTg	p.E63V	RLIM_ENST00000349225.2_Missense_Mutation_p.E63V	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	63					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCTCAGCAACTCTTCCTCAGT	0.423																																					p.E63V	Esophageal Squamous(169;1899 1923 14997 18818 32118)	Atlas-SNP	.											.	RLIM	90	.	0			c.A188T						.						137.0	112.0	120.0					X																	73814206		2203	4300	6503	SO:0001583	missense	51132	exon4			AGCAACTCTTCCT	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.188A>T	chrX.hg19:g.73814206T>A	ENSP00000328059:p.Glu63Val	94.0	0.0		108.0	34.0	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	hg19	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	T	19.02	3.746403	0.69418	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.09073	3.02;3.02	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.79123	2.44	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.03597	-1.1021	10	0.87932	D	0	-5.8686	15.3627	0.74492	0.0:0.0:0.0:1.0	.	63	Q9NVW2	RNF12_HUMAN	V	63	ENSP00000328059:E63V;ENSP00000253571:E63V	ENSP00000328059:E63V	E	-	2	0	RLIM	73730931	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.499000	0.81566	2.011000	0.59026	0.481000	0.45027	GAG	.	.		0.423	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
ATRX	546	hgsc.bcm.edu	37	X	76812950	76812950	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:76812950T>C	ENST00000373344.5	-	30	6885	c.6671A>G	c.(6670-6672)aAg>aGg	p.K2224R	ATRX_ENST00000395603.3_Missense_Mutation_p.K2186R|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2224	Interaction with MECP2.|Poly-Lys.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATCCCTCTTCTTCTTCTTTTC	0.363			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.K2224R		Atlas-SNP	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	1	Unknown(1)	bone(1)	c.A6671G						.						111.0	111.0	111.0					X																	76812950		2203	4294	6497	SO:0001583	missense	546	exon30			CTCTTCTTCTTCT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6671A>G	chrX.hg19:g.76812950T>C	ENSP00000362441:p.Lys2224Arg	80.0	0.0		98.0	4.0	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	hg19	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	T	12.57	1.977387	0.34848	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92647	-3.07;-3.08	5.67	4.51	0.55191	.	0.145185	0.49916	D	0.000127	D	0.87091	0.6091	L	0.41415	1.275	0.80722	D	1	B;B	0.31968	0.058;0.349	B;B	0.29942	0.022;0.109	T	0.82764	-0.0296	10	0.41790	T	0.15	-11.6655	10.6901	0.45867	0.0:0.0754:0.0:0.9246	.	2186;2224	P46100-4;P46100	.;ATRX_HUMAN	R	2224;2186	ENSP00000362441:K2224R;ENSP00000378967:K2186R	ENSP00000362441:K2224R	K	-	2	0	ATRX	76699606	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.449000	0.66619	0.782000	0.33613	0.481000	0.45027	AAG	.	.		0.363	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
ATRX	546	hgsc.bcm.edu	37	X	76856034	76856034	+	Splice_Site	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:76856034C>T	ENST00000373344.5	-	23	5781		c.e23-1		ATRX_ENST00000395603.3_Splice_Site|ATRX_ENST00000480283.1_Splice_Site	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTGCCCACACCTGATCAAAAG	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														.		Atlas-SNP	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	1	Unknown(1)	bone(1)	c.5567-1G>A						.						162.0	143.0	149.0					X																	76856034		2203	4296	6499	SO:0001630	splice_region_variant	546	exon24			CCACACCTGATCA	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5567-1G>A	chrX.hg19:g.76856034C>T		92.0	0.0		104.0	47.0	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Splice_Site	SNP	ENST00000373344.5	hg19	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.413158	0.25465	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	.	.	.	5.05	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1957	0.59736	0.0:0.7029:0.2971:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATRX	76742690	1.000000	0.71417	0.975000	0.42487	0.424000	0.31475	5.696000	0.68287	0.878000	0.35920	-0.347000	0.07816	.	.	.		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	Intron
GPR119	139760	hgsc.bcm.edu	37	X	129518585	129518585	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:129518585A>G	ENST00000276218.2	-	1	926	c.837T>C	c.(835-837)taT>taC	p.Y279Y		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	279					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						GCCAATAGGCATAGATGAGTG	0.572																																					p.Y279Y		Atlas-SNP	.											.	GPR119	34	.	0			c.T837C						.						77.0	70.0	73.0					X																	129518585		2203	4300	6503	SO:0001819	synonymous_variant	139760	exon1			ATAGGCATAGATG	AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.837T>C	chrX.hg19:g.129518585A>G		133.0	0.0		95.0	6.0	NM_178471	Q495H7|Q4VBN3	Silent	SNP	ENST00000276218.2	hg19	CCDS14625.1																																																																																			.	.		0.572	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058270.1	NM_178471	
MT-ND6	4541	hgsc.bcm.edu	37	M	14604	14604	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrM:14604A>T	ENST00000361681.2	-	1	69	c.70T>A	c.(70-72)Tct>Act	p.S24T	MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TP_ENST00000387461.2_RNA			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	24					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						ATAAATAGGAGAAGGCTTAGA	0.403																																					p.S24T		Atlas-SNP	.											.	.	.	.	0			c.T70A						.																																			SO:0001583	missense	0	exon1			TAGGAGAAGGCTT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.70T>A	chrM.hg19:g.14604A>T	ENSP00000354665:p.Ser24Thr	27.0	0.0		18.0	10.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.403	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
SLITRK6	84189	hgsc.bcm.edu	37	13	86369191	86369191	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:86369191delT	ENST00000400286.2	-	2	2051	c.1453delA	c.(1453-1455)actfs	p.T485fs		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	485					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TTTACCTTAGTTAGAGGAACC	0.368																																					p.T485fs		Atlas-Indel,Pindel	.											.	SLITRK6	150	.	0			c.1454delC						.						80.0	80.0	80.0					13																	86369191		1807	4066	5873	SO:0001589	frameshift_variant	84189	exon2			.	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1453delA	chr13.hg19:g.86369191delT	ENSP00000383143:p.Thr485fs	60.0	0.0		62.0	53.0	NM_032229	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Frame_Shift_Del	DEL	ENST00000400286.2	hg19	CCDS41903.1																																																																																			.	.		0.368	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229	
INPP5A	3632	hgsc.bcm.edu	37	10	134523851	134523851	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:134523851delT	ENST00000368594.3	+	8	815	c.538delT	c.(538-540)ttgfs	p.L180fs	INPP5A_ENST00000368593.3_Frame_Shift_Del_p.L180fs|INPP5A_ENST00000487614.1_3'UTR	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	180					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)			cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		TGCCTTTGACTTGGTGAATAT	0.542																																					p.D179fs	Pancreas(63;823 1267 11107 20380 51626)	Atlas-Indel,Pindel	.											.	INPP5A	77	.	0			c.537delC						.						97.0	77.0	84.0					10																	134523851		2203	4300	6503	SO:0001589	frameshift_variant	3632	exon8			.	X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.538delT	chr10.hg19:g.134523851delT	ENSP00000357583:p.Leu180fs	99.0	0.0		137.0	55.0	NM_005539	D3DXI3|Q14640|Q5JSF1	Frame_Shift_Del	DEL	ENST00000368594.3	hg19	CCDS7669.2																																																																																			.	.		0.542	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051085.1	NM_005539	
HNF4G	3174	hgsc.bcm.edu	37	8	76456117	76456118	+	Frame_Shift_Ins	INS	-	-	ACAGAGC			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:76456117_76456118insACAGAGC	ENST00000354370.1	+	3	319_320	c.49_50insACAGAGC	c.(49-51)gacfs	p.-19fs	HNF4G_ENST00000396423.2_Frame_Shift_Ins_p.-56fs			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma						endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			TATCTGTGGGGACAGAGCAACA	0.455																																					p.D54fs		Pindel	.											.	HNF4G	111	.	0			c.160_161insACAGAGC						.																																			SO:0001589	frameshift_variant	3174	exon2			.		CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.50_56dupACAGAGC	chr8.hg19:g.76456118_76456124dupACAGAGC	ENSP00000346339:p.Ala19fs	0.0	0.0		130.0	12.0	NM_004133	Q7Z2V9|Q9UH81|Q9UIS6	Frame_Shift_Ins	INS	ENST00000354370.1	hg19																																																																																				.	.		0.455	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000313914.2	NM_004133	
