#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AURKAIP1	54998	hgsc.bcm.edu	37	1	1309702	1309702	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:1309702T>C	ENST00000338370.3	-	2	576	c.176A>G	c.(175-177)gAg>gGg	p.E59G	AURKAIP1_ENST00000378853.3_Missense_Mutation_p.E59G|AURKAIP1_ENST00000489799.1_5'UTR|AURKAIP1_ENST00000338338.5_Missense_Mutation_p.E59G|AURKAIP1_ENST00000321751.5_Missense_Mutation_p.E59G			Q9NWT8	AKIP_HUMAN	aurora kinase A interacting protein 1	59					negative regulation of mitosis (GO:0045839)|positive regulation of proteolysis (GO:0045862)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|lung(2)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.82e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CTCCTCCAGCTCCAGCTGGGC	0.697																																					p.E59G		Atlas-SNP	.											.	AURKAIP1	12	.	0			c.A176G						.						19.0	23.0	22.0					1																	1309702		2198	4291	6489	SO:0001583	missense	54998	exon3			TCCAGCTCCAGCT		CCDS25.1	1p36.33	2014-02-12			ENSG00000175756	ENSG00000175756			24114	protein-coding gene	gene with protein product		609183				12244051	Standard	NM_017900		Approved	AKIP, AIP, FLJ20608	uc009vkb.1	Q9NWT8	OTTHUMG00000001413	ENST00000338370.3:c.176A>G	chr1.hg19:g.1309702T>C	ENSP00000342676:p.Glu59Gly	33.0	0.0		47.0	4.0	NM_001127230	Q5TA36|Q8TBD3	Missense_Mutation	SNP	ENST00000338370.3	hg19	CCDS25.1	.	.	.	.	.	.	.	.	.	.	t	17.56	3.420883	0.62622	.	.	ENSG00000175756	ENST00000338338;ENST00000338370;ENST00000321751;ENST00000378853	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	4.82	2.36	0.29203	.	0.228388	0.36167	N	0.002754	T	0.46658	0.1404	M	0.66297	2.02	0.36460	D	0.866637	P	0.49635	0.926	P	0.44597	0.454	T	0.55114	-0.8191	10	0.51188	T	0.08	-15.2419	9.8135	0.40838	0.0:0.0:0.3345:0.6655	.	59	Q9NWT8	AKIP_HUMAN	G	59	ENSP00000340656:E59G;ENSP00000342676:E59G;ENSP00000319778:E59G;ENSP00000368130:E59G	ENSP00000319778:E59G	E	-	2	0	AURKAIP1	1299565	1.000000	0.71417	0.073000	0.20177	0.981000	0.71138	3.361000	0.52306	0.289000	0.22422	0.533000	0.62120	GAG	.	.		0.697	AURKAIP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008273.1	NM_017900	
PRKCZ	5590	hgsc.bcm.edu	37	1	2116024	2116024	+	Silent	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:2116024G>A	ENST00000400921.2	+	14	1712	c.1029G>A	c.(1027-1029)ctG>ctA	p.L343L	RP11-181G12.2_ENST00000444529.1_RNA|RP11-181G12.2_ENST00000333854.2_RNA|PRKCZ_ENST00000400920.1_Silent_p.L343L|RP11-181G12.2_ENST00000536678.1_RNA|PRKCZ_ENST00000479263.1_3'UTR|C1orf86_ENST00000400919.3_3'UTR	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	526	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	TTTCCAAGCTGGAGAAGAAGC	0.522																																					p.L526L		Atlas-SNP	.											.	PRKCZ	84	.	0			c.G1578A						.						40.0	36.0	37.0					1																	2116024		2203	4300	6503	SO:0001819	synonymous_variant	5590	exon17			CAAGCTGGAGAAG	BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.1029G>A	chr1.hg19:g.2116024G>A		104.0	0.0		90.0	4.0	NM_002744	A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Silent	SNP	ENST00000400921.2	hg19	CCDS41229.1																																																																																			.	.		0.522	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000098533.3	NM_002744	
NOL9	79707	hgsc.bcm.edu	37	1	6592674	6592674	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:6592674T>C	ENST00000377705.5	-	8	1416	c.1384A>G	c.(1384-1386)Acc>Gcc	p.T462A		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	462					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		CTCATCTTGGTCTTGCTTTTT	0.448																																					p.T462A		Atlas-SNP	.											.	NOL9	49	.	0			c.A1384G						.						209.0	206.0	207.0					1																	6592674		2203	4300	6503	SO:0001583	missense	79707	exon8			TCTTGGTCTTGCT	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.1384A>G	chr1.hg19:g.6592674T>C	ENSP00000366934:p.Thr462Ala	190.0	0.0		196.0	8.0	NM_024654	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	hg19	CCDS80.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.251157	0.39797	.	.	ENSG00000162408	ENST00000377705	T	0.16597	2.33	6.04	-9.52	0.00578	Pre-mRNA cleavage complex II Clp1 (1);	1.229220	0.05457	N	0.550536	T	0.06416	0.0165	N	0.19112	0.55	0.22127	N	0.999345	B	0.09022	0.002	B	0.06405	0.002	T	0.31641	-0.9936	10	0.11182	T	0.66	-3.7002	2.233	0.04001	0.1945:0.2208:0.0938:0.491	.	462	Q5SY16	NOL9_HUMAN	A	462	ENSP00000366934:T462A	ENSP00000366934:T462A	T	-	1	0	NOL9	6515261	0.058000	0.20735	0.251000	0.24312	0.894000	0.52154	-1.209000	0.03002	-1.367000	0.02152	-0.527000	0.04329	ACC	.	.		0.448	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
PRDM2	7799	hgsc.bcm.edu	37	1	14057576	14057576	+	Missense_Mutation	SNP	A	A	G	rs542897882		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:14057576A>G	ENST00000235372.7	+	3	947	c.91A>G	c.(91-93)Agg>Ggg	p.R31G	PRDM2_ENST00000376048.5_Missense_Mutation_p.R31G|PRDM2_ENST00000311066.5_Missense_Mutation_p.R31G	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	31	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GGAGGAAGTGAGGCTTTTCCC	0.567																																					p.R31G		Atlas-SNP	.											.	PRDM2	147	.	0			c.A91G						.						131.0	115.0	120.0					1																	14057576		2203	4300	6503	SO:0001583	missense	7799	exon3			GAAGTGAGGCTTT	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.91A>G	chr1.hg19:g.14057576A>G	ENSP00000235372:p.Arg31Gly	103.0	0.0		104.0	5.0	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	ENST00000235372.7	hg19	CCDS150.1	.	.	.	.	.	.	.	.	.	.	A	31	5.088303	0.94100	.	.	ENSG00000116731	ENST00000484063;ENST00000376048;ENST00000235372;ENST00000311066;ENST00000400800	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	5.91	5.91	0.95273	SET domain (2);	0.214556	0.51477	D	0.000092	T	0.81004	0.4733	M	0.62723	1.935	0.45676	D	0.998596	D;D;P	0.60160	0.978;0.987;0.564	P;P;B	0.57679	0.673;0.825;0.177	T	0.82581	-0.0386	10	0.62326	D	0.03	.	12.7354	0.57220	1.0:0.0:0.0:0.0	.	31;31;31	Q13029;Q13029-2;B1AJZ4	PRDM2_HUMAN;.;.	G	31	ENSP00000423010:R31G;ENSP00000365216:R31G;ENSP00000235372:R31G;ENSP00000312352:R31G	ENSP00000235372:R31G	R	+	1	2	PRDM2	13930163	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.760000	0.62235	2.269000	0.75478	0.533000	0.62120	AGG	.	.		0.567	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
CELA2B	51032	hgsc.bcm.edu	37	1	15802955	15802955	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:15802955T>C	ENST00000375910.3	+	2	69	c.44T>C	c.(43-45)cTc>cCc	p.L15P	CELA2B_ENST00000494280.1_3'UTR	NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	15						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						TTCACAGCCCTCAGTTGTGGG	0.522																																					p.L15P		Atlas-SNP	.											.	CELA2B	37	.	0			c.T44C						.						115.0	110.0	112.0					1																	15802955		2203	4300	6503	SO:0001583	missense	51032	exon2			CAGCCCTCAGTTG		CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.44T>C	chr1.hg19:g.15802955T>C	ENSP00000365075:p.Leu15Pro	161.0	0.0		149.0	10.0	NM_015849	Q14D16|Q6ISM5|Q96QV5	Missense_Mutation	SNP	ENST00000375910.3	hg19	CCDS30605.1	.	.	.	.	.	.	.	.	.	.	T	10.36	1.328974	0.24167	.	.	ENSG00000215704	ENST00000375910	D	0.92805	-3.11	4.39	4.39	0.52855	.	0.831288	0.09945	U	0.735425	D	0.90689	0.7079	L	0.35723	1.085	0.39019	D	0.9597	D	0.54047	0.964	P	0.50791	0.65	D	0.86931	0.2073	10	0.44086	T	0.13	.	10.0215	0.42046	0.0:0.0:0.0:1.0	.	15	P08218	CEL2B_HUMAN	P	15	ENSP00000365075:L15P	ENSP00000365075:L15P	L	+	2	0	CELA2B	15675542	0.985000	0.35326	0.221000	0.23827	0.089000	0.18198	1.786000	0.38694	1.631000	0.50456	0.172000	0.16884	CTC	.	.		0.522	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006448.1	NM_015849	
SPEN	23013	hgsc.bcm.edu	37	1	16255127	16255127	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:16255127G>C	ENST00000375759.3	+	11	2596	c.2392G>C	c.(2392-2394)Gat>Cat	p.D798H		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	798	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACGAACTTTTGATCCGGAGAG	0.438																																					p.D798H		Atlas-SNP	.											.	SPEN	374	.	0			c.G2392C						.						77.0	83.0	81.0					1																	16255127		2203	4300	6503	SO:0001583	missense	23013	exon11			ACTTTTGATCCGG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2392G>C	chr1.hg19:g.16255127G>C	ENSP00000364912:p.Asp798His	45.0	0.0		43.0	16.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695394	0.48202	.	.	ENSG00000065526	ENST00000375759	T	0.10763	2.84	4.89	4.89	0.63831	.	.	.	.	.	T	0.22399	0.0540	L	0.51422	1.61	0.46061	D	0.998847	D	0.60160	0.987	P	0.54460	0.753	T	0.00380	-1.1776	9	0.51188	T	0.08	-0.8309	18.2394	0.89961	0.0:0.0:1.0:0.0	.	798	Q96T58	MINT_HUMAN	H	798	ENSP00000364912:D798H	ENSP00000364912:D798H	D	+	1	0	SPEN	16127714	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	8.647000	0.91057	2.525000	0.85131	0.563000	0.77884	GAT	.	.		0.438	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
HSPG2	3339	hgsc.bcm.edu	37	1	22183660	22183660	+	Missense_Mutation	SNP	C	C	T	rs561392976	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:22183660C>T	ENST00000374695.3	-	44	5502	c.5423G>A	c.(5422-5424)cGc>cAc	p.R1808H	HSPG2_ENST00000430507.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1808	Ig-like C2-type 3.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTTGTGCAGGCGGGTCCACAC	0.607													C|||	3	0.000599042	0.0	0.0	5008	,	,		17559	0.002		0.0	False		,,,				2504	0.001				p.R1808H		Atlas-SNP	.											.	HSPG2	311	.	0			c.G5423A						.						108.0	116.0	113.0					1																	22183660		2203	4300	6503	SO:0001583	missense	3339	exon44			TGCAGGCGGGTCC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5423G>A	chr1.hg19:g.22183660C>T	ENSP00000363827:p.Arg1808His	235.0	0.0		202.0	90.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974153	0.92919	.	.	ENSG00000142798	ENST00000374695	T	0.13420	2.59	4.85	4.85	0.62838	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37348	N	0.002122	T	0.32071	0.0817	L	0.49640	1.575	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01476	-1.1345	10	0.54805	T	0.06	.	15.8147	0.78592	0.0:1.0:0.0:0.0	.	1808	P98160	PGBM_HUMAN	H	1808	ENSP00000363827:R1808H	ENSP00000363827:R1808H	R	-	2	0	HSPG2	22056247	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.047000	0.76599	2.424000	0.82194	0.655000	0.94253	CGC	.	.		0.607	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
FGR	2268	hgsc.bcm.edu	37	1	27950421	27950421	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:27950421A>G	ENST00000374005.3	-	3	295	c.7T>C	c.(7-9)Tgt>Cgt	p.C3R	FGR_ENST00000468038.1_5'UTR|FGR_ENST00000545953.1_Missense_Mutation_p.C3R|FGR_ENST00000374004.1_Missense_Mutation_p.C3R|FGR_ENST00000399173.1_Missense_Mutation_p.C3R	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	3					blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CAGAACACACAGCCCATTCCA	0.602																																					p.C3R		Atlas-SNP	.											.	FGR	39	.	0			c.T7C						.						58.0	55.0	56.0					1																	27950421		2203	4300	6503	SO:0001583	missense	2268	exon3			ACACACAGCCCAT	BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.7T>C	chr1.hg19:g.27950421A>G	ENSP00000363117:p.Cys3Arg	84.0	0.0		86.0	4.0	NM_001042729	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	ENST00000374005.3	hg19	CCDS305.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.202503	0.79127	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003;ENST00000457296	T;D;T;T;T;D	0.86694	-1.02;-2.16;-1.02;-1.02;-1.02;-1.67	4.92	4.92	0.64577	.	0.000000	0.64402	D	0.000007	D	0.87724	0.6249	L	0.46157	1.445	0.58432	D	0.999998	P	0.51449	0.945	P	0.52627	0.704	D	0.88920	0.3365	10	0.87932	D	0	.	12.6197	0.56595	1.0:0.0:0.0:0.0	.	3	P09769	FGR_HUMAN	R	3	ENSP00000363117:C3R;ENSP00000445302:C3R;ENSP00000382126:C3R;ENSP00000363116:C3R;ENSP00000363115:C3R;ENSP00000407670:C3R	ENSP00000363115:C3R	C	-	1	0	FGR	27823008	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.301000	0.72782	2.139000	0.66308	0.533000	0.62120	TGT	.	.		0.602	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009772.1	NM_005248	
ZSCAN20	7579	hgsc.bcm.edu	37	1	33960764	33960764	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:33960764C>T	ENST00000361328.3	+	8	2973	c.2820C>T	c.(2818-2820)ttC>ttT	p.F940F		NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	940					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GGAAGTGCTTCAGTGAGCGCT	0.522																																					p.F940F		Atlas-SNP	.											.	ZSCAN20	107	.	0			c.C2820T						.						80.0	91.0	87.0					1																	33960764		2170	4285	6455	SO:0001819	synonymous_variant	7579	exon8			GTGCTTCAGTGAG	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.2820C>T	chr1.hg19:g.33960764C>T		53.0	0.0		78.0	4.0	NM_145238	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Silent	SNP	ENST00000361328.3	hg19	CCDS41300.1																																																																																			.	.		0.522	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277003.2	NM_145238	
GJB4	127534	hgsc.bcm.edu	37	1	35227120	35227120	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:35227120C>A	ENST00000339480.1	+	2	635	c.265C>A	c.(265-267)Ctg>Atg	p.L89M	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	89					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GTGCCCCTCACTGCTCGTGGT	0.642																																					p.L89M		Atlas-SNP	.											.	GJB4	51	.	0			c.C265A						.						109.0	83.0	92.0					1																	35227120		2203	4300	6503	SO:0001583	missense	127534	exon2			CCCTCACTGCTCG		CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.265C>A	chr1.hg19:g.35227120C>A	ENSP00000345868:p.Leu89Met	122.0	0.0		105.0	50.0	NM_153212	B3KQ82	Missense_Mutation	SNP	ENST00000339480.1	hg19	CCDS383.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005993	0.74932	.	.	ENSG00000189433	ENST00000339480	D	0.99277	-5.67	5.73	4.82	0.62117	Connexin, N-terminal (1);	0.081359	0.51477	D	0.000084	D	0.99378	0.9781	M	0.89414	3.03	0.32657	N	0.518609	D	0.60575	0.988	P	0.62740	0.906	D	0.99804	1.1037	10	0.72032	D	0.01	.	14.4153	0.67145	0.0:0.9285:0.0:0.0715	.	89	Q9NTQ9	CXB4_HUMAN	M	89	ENSP00000345868:L89M	ENSP00000345868:L89M	L	+	1	2	GJB4	34999707	0.990000	0.36364	0.954000	0.39281	0.978000	0.69477	2.982000	0.49337	1.440000	0.47531	0.655000	0.94253	CTG	.	.		0.642	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011560.1	NM_153212	
ZMYM1	79830	hgsc.bcm.edu	37	1	35570358	35570358	+	Silent	SNP	A	A	G	rs573224051	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:35570358A>G	ENST00000373330.1	+	7	969	c.795A>G	c.(793-795)acA>acG	p.T265T	ZMYM1_ENST00000359858.4_Silent_p.T265T|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	265						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGAGTATTACAGCATATAAGC	0.388													A|||	2	0.000399361	0.0	0.0	5008	,	,		18353	0.002		0.0	False		,,,				2504	0.0				p.T265T		Atlas-SNP	.											.	ZMYM1	86	.	0			c.A795G						.						69.0	62.0	64.0					1																	35570358		1866	4117	5983	SO:0001819	synonymous_variant	79830	exon6			TATTACAGCATAT	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.795A>G	chr1.hg19:g.35570358A>G		103.0	0.0		96.0	5.0	NM_024772	D3DPR7|Q7Z3Q4	Silent	SNP	ENST00000373330.1	hg19	CCDS41302.1																																																																																			.	.		0.388	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772	
ZNF691	51058	hgsc.bcm.edu	37	1	43316759	43316759	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:43316759A>G	ENST00000372506.1	+	4	470	c.130A>G	c.(130-132)Agc>Ggc	p.S44G	ZNF691_ENST00000397044.3_Missense_Mutation_p.S75G|ZNF691_ENST00000372502.1_Missense_Mutation_p.S66G|ZNF691_ENST00000372508.3_Missense_Mutation_p.S44G|ZNF691_ENST00000372504.1_Missense_Mutation_p.S66G|ZNF691_ENST00000372507.1_Missense_Mutation_p.S44G	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	75						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGGGCAAGAGAGCCTGTCGGA	0.562																																					p.S75G		Atlas-SNP	.											.	ZNF691	30	.	0			c.A223G						.						96.0	98.0	97.0					1																	43316759		2203	4300	6503	SO:0001583	missense	51058	exon4			CAAGAGAGCCTGT		CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.130A>G	chr1.hg19:g.43316759A>G	ENSP00000361584:p.Ser44Gly	98.0	0.0		94.0	5.0	NM_001242739	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	ENST00000372506.1	hg19	CCDS476.1	.	.	.	.	.	.	.	.	.	.	A	10.18	1.279112	0.23307	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000397034;ENST00000372503;ENST00000372502	T;T;T;T;T;T;T	0.09445	3.01;3.01;3.01;2.98;2.98;4.31;2.98	5.21	5.21	0.72293	.	0.185558	0.39407	N	0.001371	T	0.08133	0.0203	N	0.14661	0.345	0.29673	N	0.842309	B;B	0.20887	0.049;0.049	B;B	0.22386	0.039;0.039	T	0.08806	-1.0704	10	0.62326	D	0.03	-11.1885	13.6769	0.62460	1.0:0.0:0.0:0.0	.	75;75	B4DJR7;Q5VV52	.;ZN691_HUMAN	G	44;44;44;75;66;75;75;66	ENSP00000361586:S44G;ENSP00000361585:S44G;ENSP00000361584:S44G;ENSP00000380237:S75G;ENSP00000361582:S66G;ENSP00000380228:S75G;ENSP00000361580:S66G	ENSP00000361580:S66G	S	+	1	0	ZNF691	43089346	0.007000	0.16637	0.994000	0.49952	0.656000	0.38851	0.484000	0.22308	2.281000	0.76405	0.533000	0.62120	AGC	.	.		0.562	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020192.1	NM_015911	
TTC22	55001	hgsc.bcm.edu	37	1	55248004	55248004	+	Silent	SNP	G	G	A	rs576430473		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:55248004G>A	ENST00000371276.4	-	6	1270	c.1167C>T	c.(1165-1167)atC>atT	p.I389I		NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22	389										kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						TTACCTGGCCGATGTCCAGGT	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21591	0.0		0.0	False		,,,				2504	0.0				p.I389I		Atlas-SNP	.											.	TTC22	40	.	0			c.C1167T						.						54.0	52.0	53.0					1																	55248004		692	1591	2283	SO:0001819	synonymous_variant	55001	exon6			CTGGCCGATGTCC	AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.1167C>T	chr1.hg19:g.55248004G>A		42.0	0.0		68.0	24.0	NM_001114108	Q9NWT4	Silent	SNP	ENST00000371276.4	hg19	CCDS44152.1																																																																																			.	.		0.572	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027438.1	NM_017904	
NEGR1	257194	hgsc.bcm.edu	37	1	72058553	72058553	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:72058553G>A	ENST00000357731.5	-	6	1126	c.887C>T	c.(886-888)aCc>aTc	p.T296I	NEGR1_ENST00000306821.3_Missense_Mutation_p.T168I|NEGR1_ENST00000434200.1_Missense_Mutation_p.T250I	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	296	Ig-like C2-type 3.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		AGCCACACAGGTATAATTGCC	0.473																																					p.T296I		Atlas-SNP	.											NEGR1,ampulla_of_Vater,carcinoma,0,1	NEGR1	60	.	0			c.C887T						.						134.0	128.0	130.0					1																	72058553		2203	4300	6503	SO:0001583	missense	257194	exon6			ACACAGGTATAAT	AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.887C>T	chr1.hg19:g.72058553G>A	ENSP00000350364:p.Thr296Ile	216.0	0.0		209.0	0.0	NM_173808	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	ENST00000357731.5	hg19	CCDS661.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.939870	0.92526	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.74947	-0.89;-0.89;-0.89	5.83	5.83	0.93111	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83667	0.5304	M	0.67569	2.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82078	-0.0635	10	0.48119	T	0.1	-15.3455	20.1162	0.97934	0.0:0.0:1.0:0.0	.	250;296	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	I	296;168;250	ENSP00000350364:T296I;ENSP00000305938:T168I;ENSP00000413294:T250I	ENSP00000305938:T168I	T	-	2	0	NEGR1	71831141	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.414000	0.97362	2.756000	0.94617	0.655000	0.94253	ACC	.	.		0.473	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026722.4	NM_173808	
USP33	23032	hgsc.bcm.edu	37	1	78183652	78183652	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:78183652T>C	ENST00000370793.1	-	18	2257	c.1911A>G	c.(1909-1911)ctA>ctG	p.L637L	USP33_ENST00000370794.3_Silent_p.L606L|USP33_ENST00000370792.3_Silent_p.L629L|USP33_ENST00000357428.1_Silent_p.L637L	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	637	USP.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						CCAAGCCTTCTAGCGGAAATG	0.368																																					p.L637L	Melanoma(152;72 1870 11110 26780 42647)	Atlas-SNP	.											.	USP33	87	.	0			c.A1911G						.						124.0	130.0	128.0					1																	78183652		2203	4300	6503	SO:0001819	synonymous_variant	23032	exon18			GCCTTCTAGCGGA	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.1911A>G	chr1.hg19:g.78183652T>C		193.0	0.0		175.0	84.0	NM_015017	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Silent	SNP	ENST00000370793.1	hg19	CCDS678.1	.	.	.	.	.	.	.	.	.	.	T	2.483	-0.319298	0.05386	.	.	ENSG00000077254	ENST00000481579	.	.	.	4.7	-3.18	0.05186	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9442	0.35749	0.103:0.7222:0.0:0.1748	.	.	.	.	W	242	.	.	X	-	2	0	USP33	77956240	0.994000	0.37717	0.361000	0.25849	0.375000	0.29983	0.369000	0.20416	-0.751000	0.04734	-1.553000	0.00894	TAG	.	.		0.368	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017	
CYR61	3491	hgsc.bcm.edu	37	1	86048133	86048133	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:86048133T>C	ENST00000451137.2	+	4	893	c.669T>C	c.(667-669)ccT>ccC	p.P223P		NM_001554.4	NP_001545.2	O00622	CYR61_HUMAN	cysteine-rich, angiogenic inducer, 61	223					anatomical structure morphogenesis (GO:0009653)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|chondroblast differentiation (GO:0060591)|chorio-allantoic fusion (GO:0060710)|extracellular matrix organization (GO:0030198)|intussusceptive angiogenesis (GO:0002041)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of apoptotic process (GO:0043066)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of ERK1 and ERK2 cascade (GO:0070372)|ventricular septum development (GO:0003281)|wound healing, spreading of cells (GO:0044319)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|prostate(1)	5				all cancers(265;0.0216)|Epithelial(280;0.0441)		TATACAACCCTTTACAAGGCC	0.453											OREG0013583	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P223P		Atlas-SNP	.											.	CYR61	18	.	0			c.T669C						.						89.0	84.0	86.0					1																	86048133		2203	4300	6503	SO:0001819	synonymous_variant	3491	exon4			CAACCCTTTACAA	AF031385	CCDS706.1	1p22.3	2008-02-05			ENSG00000142871	ENSG00000142871			2654	protein-coding gene	gene with protein product		602369		IGFBP10		9135077	Standard	NM_001554		Approved	GIG1, CCN1	uc001dle.3	O00622	OTTHUMG00000010577	ENST00000451137.2:c.669T>C	chr1.hg19:g.86048133T>C		100.0	0.0	1241	100.0	4.0	NM_001554	O14934|O43775|Q9BZL7	Silent	SNP	ENST00000451137.2	hg19	CCDS706.1																																																																																			.	.		0.453	CYR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029187.1	NM_001554	
CLCA2	9635	hgsc.bcm.edu	37	1	86913417	86913417	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:86913417A>G	ENST00000370565.4	+	11	2102	c.1940A>G	c.(1939-1941)gAg>gGg	p.E647G		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	647					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		GTTGAGCCAGAGACTGGAGAT	0.433																																					p.E647G	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Atlas-SNP	.											.	CLCA2	102	.	0			c.A1940G						.						83.0	80.0	81.0					1																	86913417		2203	4300	6503	SO:0001583	missense	9635	exon11			AGCCAGAGACTGG		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1940A>G	chr1.hg19:g.86913417A>G	ENSP00000359596:p.Glu647Gly	75.0	0.0		74.0	6.0	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	hg19	CCDS708.1	.	.	.	.	.	.	.	.	.	.	A	6.383	0.438750	0.12104	.	.	ENSG00000137975	ENST00000370565	T	0.33216	1.42	5.72	4.6	0.57074	Domain of unknown function DUF1973 (1);	0.252260	0.37623	N	0.002012	T	0.15392	0.0371	M	0.80422	2.495	0.09310	N	1	B	0.11235	0.004	B	0.17433	0.018	T	0.33214	-0.9877	10	0.52906	T	0.07	-9.1903	3.3521	0.07156	0.6491:0.1413:0.0739:0.1358	.	647	Q9UQC9	CLCA2_HUMAN	G	647	ENSP00000359596:E647G	ENSP00000359596:E647G	E	+	2	0	CLCA2	86686005	0.993000	0.37304	0.657000	0.29651	0.017000	0.09413	2.602000	0.46257	1.018000	0.39521	0.533000	0.62120	GAG	.	.		0.433	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
HFM1	164045	hgsc.bcm.edu	37	1	91788716	91788716	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:91788716T>C	ENST00000370425.3	-	22	2566	c.2468A>G	c.(2467-2469)cAg>cGg	p.Q823R	HFM1_ENST00000370424.3_Missense_Mutation_p.Q502R|HFM1_ENST00000462405.1_5'UTR|HFM1_ENST00000294696.5_Missense_Mutation_p.Q55R	NM_001017975.3	NP_001017975.3	A2PYH4	HFM1_HUMAN	HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae)	823	SEC63.				resolution of meiotic recombination intermediates (GO:0000712)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(33)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	75		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TATCCTTAACTGTATATCTAG	0.284																																					p.Q823R		Atlas-SNP	.											.	HFM1	188	.	0			c.A2468G						.						64.0	69.0	67.0					1																	91788716		2203	4278	6481	SO:0001583	missense	164045	exon22			CTTAACTGTATAT	AB204867	CCDS30769.2	1p22.2	2008-03-26			ENSG00000162669	ENSG00000162669			20193	protein-coding gene	gene with protein product		615684	"""SEC63 domain containing 1"""	SEC63D1		14702039, 17286053	Standard	XM_006710395		Approved	MER3, FLJ39011, FLJ36760	uc001doa.4	A2PYH4	OTTHUMG00000010093	ENST00000370425.3:c.2468A>G	chr1.hg19:g.91788716T>C	ENSP00000359454:p.Gln823Arg	107.0	0.0		118.0	5.0	NM_001017975	B1B0B6|Q8N9Q0	Missense_Mutation	SNP	ENST00000370425.3	hg19	CCDS30769.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.258|5.258	0.233136|0.233136	0.09969|0.09969	.|.	.|.	ENSG00000162669|ENSG00000162669	ENST00000370425;ENST00000294696;ENST00000370424;ENST00000370421|ENST00000430465	T;T;T|.	0.59906|.	0.23;0.23;0.23|.	5.18|5.18	4.05|4.05	0.47172|0.47172	Sec63 domain (2);|.	0.064498|.	0.64402|.	D|.	0.000006|.	T|T	0.30479|0.30479	0.0766|0.0766	L|L	0.33293|0.33293	1|1	0.34702|0.34702	D|D	0.726858|0.726858	B;B;B|.	0.33448|.	0.021;0.412;0.116|.	B;B;B|.	0.37387|.	0.012;0.248;0.037|.	T|T	0.11227|0.11227	-1.0596|-1.0596	10|5	0.28530|.	T|.	0.3|.	.|.	10.8879|10.8879	0.46978|0.46978	0.0:0.074:0.0:0.926|0.0:0.074:0.0:0.926	.|.	502;78;823|.	A6NGI5;B1B0B5;A2PYH4|.	.;.;HFM1_HUMAN|.	R|G	823;55;502;507|79	ENSP00000359454:Q823R;ENSP00000294696:Q55R;ENSP00000359453:Q502R|.	ENSP00000294696:Q55R|.	Q|S	-|-	2|1	0|0	HFM1|HFM1	91561304|91561304	1.000000|1.000000	0.71417|0.71417	0.900000|0.900000	0.35374|0.35374	0.812000|0.812000	0.45895|0.45895	4.874000|4.874000	0.63064|0.63064	0.811000|0.811000	0.34303|0.34303	0.533000|0.533000	0.62120|0.62120	CAG|AGT	.	.		0.284	HFM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316716.2	NM_001017975	
MTF2	22823	hgsc.bcm.edu	37	1	93545089	93545089	+	Splice_Site	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:93545089G>T	ENST00000370298.4	+	1	294		c.e1+1		MTF2_ENST00000545708.1_Splice_Site|MTF2_ENST00000370303.4_Splice_Site|MTF2_ENST00000471953.1_Splice_Site|MTF2_ENST00000540243.1_Splice_Site	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2						chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		ACCGAATGAGGTGAGAGACCT	0.557																																					.		Atlas-SNP	.											.	MTF2	51	.	0			c.5+1G>T						.						98.0	96.0	97.0					1																	93545089		2203	4300	6503	SO:0001630	splice_region_variant	22823	exon1			AATGAGGTGAGAG	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.5+1G>T	chr1.hg19:g.93545089G>T		124.0	0.0		104.0	53.0	NM_001164392	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Splice_Site	SNP	ENST00000370298.4	hg19	CCDS742.1	.	.	.	.	.	.	.	.	.	.	g	14.22	2.470170	0.43839	.	.	ENSG00000143033	ENST00000370298;ENST00000370303	.	.	.	3.9	2.02	0.26589	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.2582	0.26189	0.0959:0.1707:0.7334:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTF2	93317677	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.299000	0.65716	0.625000	0.30304	-0.372000	0.07161	.	.	.		0.557	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358	Intron
STXBP3	6814	hgsc.bcm.edu	37	1	109342913	109342913	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:109342913T>C	ENST00000370008.3	+	17	1571	c.1521T>C	c.(1519-1521)ggT>ggC	p.G507G		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	507					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TATGGAATGGTTCAGGAGCTG	0.338																																					p.G507G		Atlas-SNP	.											.	STXBP3	44	.	0			c.T1521C						.						82.0	83.0	82.0					1																	109342913		2203	4300	6503	SO:0001819	synonymous_variant	6814	exon17			GAATGGTTCAGGA	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1521T>C	chr1.hg19:g.109342913T>C		60.0	0.0		84.0	4.0	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Silent	SNP	ENST00000370008.3	hg19	CCDS790.1																																																																																			.	.		0.338	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
KCNC4	3749	hgsc.bcm.edu	37	1	110775556	110775556	+	3'UTR	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:110775556T>C	ENST00000369787.3	+	0	2560				KCNC4_ENST00000413138.3_3'UTR|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Missense_Mutation_p.S615P	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CGCCCTCTCGTCCAACTATGC	0.557																																					p.S615P		Atlas-SNP	.											.	KCNC4	113	.	0			c.T1843C						.						60.0	63.0	62.0					1																	110775556		1991	4158	6149	SO:0001624	3_prime_UTR_variant	3749	exon4			CTCTCGTCCAACT	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.*625T>C	chr1.hg19:g.110775556T>C		117.0	0.0		120.0	5.0	NM_001039574	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	ENST00000369787.3	hg19	CCDS821.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.652584	0.29336	.	.	ENSG00000116396	ENST00000438661	D	0.97378	-4.36	5.32	4.18	0.49190	.	.	.	.	.	D	0.86619	0.5976	.	.	.	0.24935	N	0.991897	B	0.02656	0.0	B	0.01281	0.0	T	0.78059	-0.2352	8	0.29301	T	0.29	.	4.2265	0.10582	0.1744:0.0972:0.0:0.7284	.	615	Q03721-3	.	P	615	ENSP00000393655:S615P	ENSP00000393655:S615P	S	+	1	0	KCNC4	110577079	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.502000	0.22594	1.026000	0.39733	0.533000	0.62120	TCC	.	.		0.557	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
DENND2C	163259	hgsc.bcm.edu	37	1	115168554	115168554	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:115168554A>G	ENST00000393274.1	-	4	677	c.52T>C	c.(52-54)Tgc>Cgc	p.C18R	DENND2C_ENST00000393276.3_Missense_Mutation_p.C18R|DENND2C_ENST00000393277.1_Missense_Mutation_p.C18R|DENND2C_ENST00000481894.1_5'Flank	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	18					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTTTTTGCAGTGGCTTCTT	0.388																																					p.C18R		Atlas-SNP	.											.	DENND2C	105	.	0			c.T52C						.						108.0	110.0	110.0					1																	115168554		2203	4300	6503	SO:0001583	missense	163259	exon4			TTTTGCAGTGGCT		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.52T>C	chr1.hg19:g.115168554A>G	ENSP00000376955:p.Cys18Arg	93.0	0.0		60.0	5.0	NM_001256404	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	hg19	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.194974	0.78902	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.14766	2.48;3.09;2.87	5.71	5.71	0.89125	.	0.061327	0.64402	D	0.000002	T	0.24005	0.0581	L	0.56769	1.78	0.80722	D	1	D;P	0.76494	0.999;0.866	D;P	0.68621	0.959;0.576	T	0.00768	-1.1574	10	0.49607	T	0.09	.	16.0314	0.80579	1.0:0.0:0.0:0.0	.	18;18	Q68D51;Q68D51-3	DEN2C_HUMAN;.	R	18	ENSP00000376957:C18R;ENSP00000376955:C18R;ENSP00000376958:C18R	ENSP00000358553:C18R	C	-	1	0	DENND2C	114970077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.311000	0.72835	2.187000	0.69744	0.524000	0.50904	TGC	.	.		0.388	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
SYCP1	6847	hgsc.bcm.edu	37	1	115537378	115537378	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:115537378T>C	ENST00000369522.3	+	31	3003	c.2763T>C	c.(2761-2763)gcT>gcC	p.A921A	SYCP1_ENST00000477590.1_3'UTR|SYCP1_ENST00000369518.1_Silent_p.A921A	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	921					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATCCACCAGCTTCTCATCTTT	0.294																																					p.A921A		Atlas-SNP	.											.	SYCP1	149	.	0			c.T2763C						.						34.0	37.0	36.0					1																	115537378		2199	4289	6488	SO:0001819	synonymous_variant	6847	exon31			ACCAGCTTCTCAT	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2763T>C	chr1.hg19:g.115537378T>C		162.0	0.0		98.0	4.0	NM_003176	O14963|Q5VXJ6	Silent	SNP	ENST00000369522.3	hg19	CCDS879.1																																																																																			.	.		0.294	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
CD101	9398	hgsc.bcm.edu	37	1	117556295	117556295	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:117556295A>G	ENST00000256652.4	+	4	1167	c.1109A>G	c.(1108-1110)gAg>gGg	p.E370G	CD101_ENST00000369470.1_Missense_Mutation_p.E370G	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	370	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTGGGCCCAGAGGATGAAGGC	0.517																																					p.E370G		Atlas-SNP	.											.	CD101	95	.	0			c.A1109G						.						70.0	71.0	70.0					1																	117556295		2203	4300	6503	SO:0001583	missense	9398	exon4			GCCCAGAGGATGA	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1109A>G	chr1.hg19:g.117556295A>G	ENSP00000256652:p.Glu370Gly	208.0	0.0		89.0	4.0	NM_001256109	Q15856	Missense_Mutation	SNP	ENST00000256652.4	hg19	CCDS891.1	.	.	.	.	.	.	.	.	.	.	A	15.44	2.834369	0.50951	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.03181	4.02;4.02	5.85	4.72	0.59763	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.099909	0.43579	D	0.000548	T	0.06050	0.0157	L	0.60845	1.875	0.35926	D	0.832159	D	0.76494	0.999	D	0.68943	0.961	T	0.21552	-1.0242	10	0.44086	T	0.13	-14.7109	8.8907	0.35432	0.9156:0.0:0.0844:0.0	.	370	Q93033	IGSF2_HUMAN	G	370	ENSP00000256652:E370G;ENSP00000358482:E370G	ENSP00000256652:E370G	E	+	2	0	CD101	117357818	0.984000	0.35163	0.913000	0.36048	0.222000	0.24845	2.690000	0.47001	1.036000	0.39998	0.533000	0.62120	GAG	.	.		0.517	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
ZNF697	90874	hgsc.bcm.edu	37	1	120168499	120168499	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:120168499T>C	ENST00000421812.2	-	2	344	c.225A>G	c.(223-225)acA>acG	p.T75T		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	75					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		TCTCCTCACCTGTGCAGATGT	0.507																																					p.T75T		Atlas-SNP	.											.	ZNF697	26	.	0			c.A225G						.						80.0	82.0	81.0					1																	120168499		1972	4140	6112	SO:0001630	splice_region_variant	90874	exon2			CTCACCTGTGCAG	AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.226+1A>G	chr1.hg19:g.120168499T>C		125.0	0.0		80.0	4.0	NM_001080470	Q96IT2	Silent	SNP	ENST00000421812.2	hg19	CCDS44202.1																																																																																			.	.		0.507	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036349.3	XM_371286	Silent
KLHDC9	126823	hgsc.bcm.edu	37	1	161068355	161068355	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:161068355C>T	ENST00000368011.4	+	1	172	c.30C>T	c.(28-30)gcC>gcT	p.A10A	PFDN2_ENST00000468311.1_5'Flank|KLHDC9_ENST00000392192.2_Silent_p.A10A|KLHDC9_ENST00000490724.2_Intron	NM_152366.4	NP_689579.3	Q8NEP7	KLDC9_HUMAN	kelch domain containing 9	10										lung(5)|upper_aerodigestive_tract(1)	6	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CGGGTCGGGCCGCAGGCTCAG	0.701																																					p.A10A		Atlas-SNP	.											.	KLHDC9	16	.	0			c.C30T						.						9.0	10.0	9.0					1																	161068355		2181	4250	6431	SO:0001819	synonymous_variant	126823	exon1			TCGGGCCGCAGGC	BC022077	CCDS30919.1, CCDS41425.1	1q23.3	2008-02-05			ENSG00000162755	ENSG00000162755			28489	protein-coding gene	gene with protein product	"""kelch/ankyrin repeat containing cyclin A1 interacting protein"""					15159402	Standard	NM_152366		Approved	KARCA1	uc001fxr.3	Q8NEP7	OTTHUMG00000031479	ENST00000368011.4:c.30C>T	chr1.hg19:g.161068355C>T		36.0	0.0		87.0	4.0	NM_001007255	Q5SY56|Q6NXT9|Q6PKN4|Q8N5E1|Q8NA16	Silent	SNP	ENST00000368011.4	hg19	CCDS30919.1																																																																																			.	.		0.701	KLHDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077092.1	NM_152366	
NIT1	4817	hgsc.bcm.edu	37	1	161088600	161088600	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:161088600T>C	ENST00000368009.2	+	2	103	c.27T>C	c.(25-27)ccT>ccC	p.P9P	NIT1_ENST00000368007.4_Intron|DEDD_ENST00000489249.1_5'Flank|PFDN2_ENST00000368010.3_5'Flank|PFDN2_ENST00000468311.1_5'Flank|NIT1_ENST00000368008.1_Silent_p.P9P|NIT1_ENST00000496861.1_3'UTR|NIT1_ENST00000392190.5_5'UTR	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	9					nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CCAGGCCTCCTCACAGATTCC	0.498																																					p.P9P		Atlas-SNP	.											.	NIT1	41	.	0			c.T27C						.						161.0	136.0	144.0					1																	161088600		2203	4300	6503	SO:0001819	synonymous_variant	4817	exon2			GCCTCCTCACAGA	AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.27T>C	chr1.hg19:g.161088600T>C		94.0	0.0		147.0	6.0	NM_001185092	B1AQP3|D3DVF4|O76091	Silent	SNP	ENST00000368009.2	hg19	CCDS1218.1																																																																																			.	.		0.498	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077060.1		
NCF2	4688	hgsc.bcm.edu	37	1	183532683	183532683	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:183532683T>G	ENST00000367535.3	-	12	1315	c.1064A>C	c.(1063-1065)aAg>aCg	p.K355T	NCF2_ENST00000413720.1_Missense_Mutation_p.K310T|NCF2_ENST00000418089.1_Missense_Mutation_p.K274T|NCF2_ENST00000367536.1_Missense_Mutation_p.K355T|NCF2_ENST00000469280.1_5'UTR	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	355	OPR.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	GTAGTGCACCTTGAGTGTGTA	0.542																																					p.K355T		Atlas-SNP	.											.	NCF2	69	.	0			c.A1064C						.						124.0	106.0	112.0					1																	183532683		2203	4300	6503	SO:0001583	missense	4688	exon13			TGCACCTTGAGTG	BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.1064A>C	chr1.hg19:g.183532683T>G	ENSP00000356505:p.Lys355Thr	135.0	0.0		301.0	57.0	NM_001127651	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	ENST00000367535.3	hg19	CCDS1356.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.218117	0.79464	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535;ENST00000420553;ENST00000419402	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.74	4.61	0.57282	Phox/Bem1p (2);	0.000000	0.85682	D	0.000000	T	0.68137	0.2968	M	0.83483	2.645	0.52501	D	0.999954	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;0.999;1.0	T	0.69412	-0.5152	10	0.49607	T	0.09	-55.1311	10.1685	0.42895	0.0:0.0752:0.0:0.9248	.	274;310;355	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	T	355;427;310;274;355;6;94	ENSP00000356506:K355T;ENSP00000399294:K310T;ENSP00000407217:K274T;ENSP00000356505:K355T;ENSP00000397228:K6T;ENSP00000406198:K94T	ENSP00000356505:K355T	K	-	2	0	NCF2	181799306	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.266000	0.65525	1.020000	0.39573	0.529000	0.55759	AAG	.	.		0.542	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085483.1	NM_000433	
LRRN2	10446	hgsc.bcm.edu	37	1	204589102	204589102	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:204589102G>A	ENST00000367175.1	-	1	2231	c.19C>T	c.(19-21)Cca>Tca	p.P7S	LRRN2_ENST00000367177.3_Missense_Mutation_p.P7S|LRRN2_ENST00000367176.3_Missense_Mutation_p.P7S|LRRN2_ENST00000496057.1_5'UTR			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	7			P -> L (in dbSNP:rs3789044).		cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			AGCAAGAGTGGGGCCACGAGA	0.617																																					p.P7S		Atlas-SNP	.											LRRN2,brain,primitive_neuroectodermal_tumour-medulloblastoma,+2,1	LRRN2	81	.	0			c.C19T						.						14.0	16.0	15.0					1																	204589102		2186	4293	6479	SO:0001583	missense	10446	exon3			AGAGTGGGGCCAC	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.19C>T	chr1.hg19:g.204589102G>A	ENSP00000356143:p.Pro7Ser	126.0	0.0		274.0	0.0	NM_006338	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	ENST00000367175.1	hg19	CCDS1448.1	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.513003	0.00975	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.16597	2.33;2.33;2.33	5.79	1.74	0.24563	.	0.360808	0.20218	N	0.096750	T	0.03915	0.0110	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42344	-0.9457	10	0.07644	T	0.81	.	4.6551	0.12613	0.2809:0.1776:0.5416:0.0	.	7	O75325	LRRN2_HUMAN	S	7	ENSP00000356144:P7S;ENSP00000356145:P7S;ENSP00000356143:P7S	ENSP00000356143:P7S	P	-	1	0	LRRN2	202855725	0.496000	0.26059	0.963000	0.40424	0.292000	0.27327	1.078000	0.30754	0.765000	0.33221	0.650000	0.86243	CCA	.	.		0.617	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338	
C1orf116	79098	hgsc.bcm.edu	37	1	207196403	207196403	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:207196403A>G	ENST00000359470.5	-	4	955	c.706T>C	c.(706-708)Tcc>Ccc	p.S236P	C1orf116_ENST00000461135.2_5'UTR	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	236						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.S236P(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					CTTTCCTGGGAGCTGGATGGT	0.602																																					p.S236P		Atlas-SNP	.											C1orf116,caecum,carcinoma,+2,2	C1orf116	64	.	1	Substitution - Missense(1)	ovary(1)	c.T706C						.						182.0	183.0	183.0					1																	207196403		2203	4300	6503	SO:0001583	missense	79098	exon4			CCTGGGAGCTGGA		CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.706T>C	chr1.hg19:g.207196403A>G	ENSP00000352447:p.Ser236Pro	95.0	1.0		170.0	7.0	NM_023938	C9JV41|Q658X3	Missense_Mutation	SNP	ENST00000359470.5	hg19	CCDS1475.1	.	.	.	.	.	.	.	.	.	.	A	8.930	0.963133	0.18583	.	.	ENSG00000182795	ENST00000359470	T	0.08984	3.03	5.03	-6.82	0.01698	.	1.195680	0.06276	N	0.696552	T	0.04048	0.0113	N	0.19112	0.55	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.43097	-0.9412	10	0.30854	T	0.27	2.6199	3.0472	0.06158	0.4839:0.1058:0.2938:0.1166	.	236	Q9BW04	SARG_HUMAN	P	236	ENSP00000352447:S236P	ENSP00000352447:S236P	S	-	1	0	C1orf116	205263026	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	-0.444000	0.06854	-0.988000	0.03489	-0.912000	0.02778	TCC	.	.		0.602	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1	NM_024115	
PARP1	142	hgsc.bcm.edu	37	1	226570841	226570841	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:226570841T>C	ENST00000366794.5	-	8	1198	c.1055A>G	c.(1054-1056)aAa>aGa	p.K352R		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	352					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		ACGGTCCTGTTTTTTAACCTT	0.502								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.K352R		Atlas-SNP	.											PARP1,NS,carcinoma,0,1	PARP1	100	.	0			c.A1055G						.						115.0	143.0	134.0					1																	226570841		2203	4300	6503	SO:0001583	missense	142	exon8			TCCTGTTTTTTAA	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1055A>G	chr1.hg19:g.226570841T>C	ENSP00000355759:p.Lys352Arg	86.0	0.0		251.0	0.0	NM_001618	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	hg19	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	T	8.952	0.968513	0.18659	.	.	ENSG00000143799	ENST00000366794	T	0.10192	2.9	5.27	2.95	0.34219	.	0.147960	0.64402	N	0.000015	T	0.04724	0.0128	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42258	-0.9462	10	0.15952	T	0.53	-10.5467	7.8417	0.29402	0.0:0.2327:0.0:0.7673	.	352	P09874	PARP1_HUMAN	R	352	ENSP00000355759:K352R	ENSP00000355759:K352R	K	-	2	0	PARP1	224637464	0.897000	0.30589	0.987000	0.45799	0.573000	0.36030	0.922000	0.28734	0.323000	0.23307	0.459000	0.35465	AAA	.	.		0.502	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
OR2C3	81472	hgsc.bcm.edu	37	1	247695757	247695757	+	Silent	SNP	G	G	C	rs61746303|rs386641879	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:247695757G>C	ENST00000366487.3	-	2	418	c.57C>G	c.(55-57)tcC>tcG	p.S19S	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366489.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S19S(1)|p.S18S(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			AGGGTCGTGTGGAGAAGCCCA	0.488																																					p.S19S		Atlas-SNP	.											OR2C3,NS,carcinoma,0,2	OR2C3	92	.	2	Substitution - coding silent(2)	prostate(2)	c.C57G						.						78.0	73.0	74.0					1																	247695757		2203	4300	6503	SO:0001819	synonymous_variant	81472	exon2			TCGTGTGGAGAAG	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.57C>G	chr1.hg19:g.247695757G>C		149.0	0.0		446.0	0.0	NM_198074	Q5JQS4|Q6IEZ1|Q8NGW7	Silent	SNP	ENST00000366487.3	hg19	CCDS1634.2																																																																																			.	G|0.996;A|0.004		0.488	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074	
CEBPZ	10153	hgsc.bcm.edu	37	2	37455073	37455073	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:37455073A>G	ENST00000234170.5	-	2	1408	c.1263T>C	c.(1261-1263)tcT>tcC	p.S421S		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	421					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				CTACTTCACCAGACACAACTC	0.378																																					p.S421S		Atlas-SNP	.											.	CEBPZ	68	.	0			c.T1263C						.						118.0	120.0	119.0					2																	37455073		2202	4300	6502	SO:0001819	synonymous_variant	10153	exon2			TTCACCAGACACA	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.1263T>C	chr2.hg19:g.37455073A>G		128.0	0.0		135.0	6.0	NM_005760	Q8NE75	Silent	SNP	ENST00000234170.5	hg19	CCDS1787.1																																																																																			.	.		0.378	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
UGP2	7360	hgsc.bcm.edu	37	2	64112780	64112780	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:64112780A>G	ENST00000337130.5	+	6	1109	c.633A>G	c.(631-633)tcA>tcG	p.S211S	UGP2_ENST00000394417.2_Silent_p.S200S|UGP2_ENST00000487469.1_3'UTR|UGP2_ENST00000445915.2_Silent_p.S220S|UGP2_ENST00000467648.2_Silent_p.S200S|ACA59_ENST00000515966.1_RNA	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	211					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						TGTCTTACTCAGGGGAAAATA	0.383																																					p.S211S		Atlas-SNP	.											.	UGP2	38	.	0			c.A633G						.						146.0	159.0	154.0					2																	64112780		2203	4300	6503	SO:0001819	synonymous_variant	7360	exon6			TTACTCAGGGGAA		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.633A>G	chr2.hg19:g.64112780A>G		69.0	0.0		70.0	5.0	NM_006759	Q07131|Q0P6K2|Q86Y81|Q9BU15	Silent	SNP	ENST00000337130.5	hg19	CCDS1875.1																																																																																			.	.		0.383	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251688.1	NM_006759	
C2orf68	388969	hgsc.bcm.edu	37	2	85836675	85836675	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:85836675T>C	ENST00000306336.5	-	3	305	c.261A>G	c.(259-261)gaA>gaG	p.E87E	USP39_ENST00000450066.2_5'Flank|C2orf68_ENST00000478626.1_5'Flank|USP39_ENST00000459775.1_Intron	NM_001013649.3	NP_001013671.2	Q2NKX9	CB068_HUMAN	chromosome 2 open reading frame 68	87										breast(1)|central_nervous_system(1)|endometrium(1)	3						CACCGGACTCTTCATAGTCTG	0.542																																					p.E87E		Atlas-SNP	.											.	C2orf68	5	.	0			c.A261G						.						123.0	125.0	124.0					2																	85836675		1964	4158	6122	SO:0001819	synonymous_variant	388969	exon3			GGACTCTTCATAG		CCDS42704.1	2p11.2	2008-07-18			ENSG00000168887	ENSG00000168887			34353	protein-coding gene	gene with protein product							Standard	NM_001013649		Approved		uc002sqc.2	Q2NKX9	OTTHUMG00000153088	ENST00000306336.5:c.261A>G	chr2.hg19:g.85836675T>C		95.0	0.0		75.0	4.0	NM_001013649	B4DT10|Q4G0J7|Q6ZVA6	Silent	SNP	ENST00000306336.5	hg19	CCDS42704.1																																																																																			.	.		0.542	C2orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329451.1	NM_001013649	
KDM3A	55818	hgsc.bcm.edu	37	2	86693761	86693761	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:86693761A>G	ENST00000409556.1	+	11	1639	c.1274A>G	c.(1273-1275)aAg>aGg	p.K425R	KDM3A_ENST00000542128.1_Missense_Mutation_p.K373R|KDM3A_ENST00000312912.5_Missense_Mutation_p.K425R|KDM3A_ENST00000409064.1_Missense_Mutation_p.K425R|KDM3A_ENST00000485171.1_3'UTR			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	425					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						GCTTCTTCTAAGGCAGAATTG	0.463																																					p.K425R	NSCLC(96;1150 1523 6936 46253 49736)	Atlas-SNP	.											.	KDM3A	179	.	0			c.A1274G						.						141.0	135.0	137.0					2																	86693761		2203	4300	6503	SO:0001583	missense	55818	exon10			CTTCTAAGGCAGA	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.1274A>G	chr2.hg19:g.86693761A>G	ENSP00000386660:p.Lys425Arg	137.0	0.0		146.0	6.0	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	hg19	CCDS1990.1	.	.	.	.	.	.	.	.	.	.	A	0.613	-0.824114	0.02755	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	5.81	-2.25	0.06888	.	1.344860	0.04482	N	0.377894	T	0.31734	0.0806	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.05852	-1.0860	10	0.13470	T	0.59	.	0.628	0.00789	0.3337:0.1076:0.2202:0.3384	.	373;425	F5H070;Q9Y4C1	.;KDM3A_HUMAN	R	425;425;425;425;373	ENSP00000386660:K425R;ENSP00000323659:K425R;ENSP00000386516:K425R;ENSP00000438324:K373R	ENSP00000323659:K425R	K	+	2	0	KDM3A	86547272	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.578000	0.05841	-0.735000	0.04837	-1.450000	0.01041	AAG	.	.		0.463	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
CCDC93	54520	hgsc.bcm.edu	37	2	118677924	118677924	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:118677924A>G	ENST00000376300.2	-	24	2028	c.1891T>C	c.(1891-1893)Tcc>Ccc	p.S631P	CCDC93_ENST00000319432.5_Missense_Mutation_p.S630P|HTR5BP_ENST00000434708.1_RNA	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	631										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						GATGTTCAGGAGGCCTTCGCT	0.483																																					p.S631P		Atlas-SNP	.											.	CCDC93	70	.	0			c.T1891C						.						98.0	92.0	94.0					2																	118677924		2203	4300	6503	SO:0001583	missense	54520	exon24			TTCAGGAGGCCTT	BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.1891T>C	chr2.hg19:g.118677924A>G	ENSP00000365477:p.Ser631Pro	51.0	0.0		56.0	5.0	NM_019044	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Missense_Mutation	SNP	ENST00000376300.2	hg19	CCDS2121.2	.	.	.	.	.	.	.	.	.	.	A	20.6	4.015326	0.75161	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	T;T	0.20332	2.08;2.08	4.83	4.83	0.62350	.	0.061141	0.64402	D	0.000002	T	0.16981	0.0408	N	0.16478	0.41	0.34455	D	0.701096	D	0.54397	0.966	P	0.47299	0.543	T	0.21109	-1.0255	10	0.66056	D	0.02	.	10.6937	0.45886	1.0:0.0:0.0:0.0	.	631	Q567U6	CCD93_HUMAN	P	631;630	ENSP00000365477:S631P;ENSP00000324135:S630P	ENSP00000324135:S630P	S	-	1	0	CCDC93	118394394	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.756000	0.62205	2.021000	0.59480	0.482000	0.46254	TCC	.	.		0.483	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1	NM_019044	
UPP2	151531	hgsc.bcm.edu	37	2	158958553	158958553	+	5'UTR	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:158958553T>C	ENST00000005756.4	+	0	172				UPP2_ENST00000460456.1_3'UTR|UPP2_ENST00000409859.4_Splice_Site_p.V50A|UPP2_ENST00000605860.1_Splice_Site_p.V50A	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2						nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	CAATTTAAGGTGACTTTTCAC	0.353																																					p.V50A		Atlas-SNP	.											.	UPP2	60	.	0			c.T149C						.						122.0	130.0	128.0					2																	158958553		2203	4300	6503	SO:0001623	5_prime_UTR_variant	151531	exon3			TTAAGGTGACTTT	AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.-23T>C	chr2.hg19:g.158958553T>C		140.0	0.0		146.0	6.0	NM_001135098	B3KV87	Missense_Mutation	SNP	ENST00000005756.4	hg19	CCDS2207.1	.	.	.	.	.	.	.	.	.	.	T	5.147	0.212677	0.09757	.	.	ENSG00000007001	ENST00000409859	T	0.35605	1.3	4.42	-3.51	0.04696	.	.	.	.	.	T	0.16128	0.0388	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.25398	-1.0133	6	0.24483	T	0.36	.	0.0738	0.00025	0.3194:0.1998:0.1637:0.3171	.	.	.	.	A	50	ENSP00000387230:V50A	ENSP00000387230:V50A	V	+	2	0	UPP2	158666799	0.624000	0.27102	0.000000	0.03702	0.001000	0.01503	-0.108000	0.10857	-0.533000	0.06323	-0.256000	0.11100	GTG	.	.		0.353	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254929.2	NM_173355	
TANC1	85461	hgsc.bcm.edu	37	2	159954261	159954261	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:159954261A>G	ENST00000263635.6	+	4	411	c.174A>G	c.(172-174)aaA>aaG	p.K58K	TANC1_ENST00000454300.1_Silent_p.K58K	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	58					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						GCTTGGCCAAAGGTGTCTCGA	0.522																																					p.K58K		Atlas-SNP	.											.	TANC1	157	.	0			c.A174G						.						171.0	162.0	165.0					2																	159954261		2029	4174	6203	SO:0001819	synonymous_variant	85461	exon4			GGCCAAAGGTGTC	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.174A>G	chr2.hg19:g.159954261A>G		104.0	0.0		95.0	4.0	NM_033394	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	hg19	CCDS42766.1																																																																																			.	.		0.522	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
GRB14	2888	hgsc.bcm.edu	37	2	165350955	165350955	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:165350955A>G	ENST00000263915.3	-	13	2000	c.1462T>C	c.(1462-1464)Ttt>Ctt	p.F488L	GRB14_ENST00000543549.1_Missense_Mutation_p.F401L|GRB14_ENST00000497306.1_Intron	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	488	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						ATAATTTGAAAGTGCTTTATT	0.333																																					p.F488L		Atlas-SNP	.											.	GRB14	73	.	0			c.T1462C						.						140.0	145.0	143.0					2																	165350955		2203	4300	6503	SO:0001583	missense	2888	exon13			TTTGAAAGTGCTT		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1462T>C	chr2.hg19:g.165350955A>G	ENSP00000263915:p.Phe488Leu	152.0	0.0		164.0	7.0	NM_004490	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	ENST00000263915.3	hg19	CCDS2222.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.253284	0.80135	.	.	ENSG00000115290	ENST00000263915;ENST00000543549	D;D	0.89050	-2.46;-2.46	5.38	5.38	0.77491	SH2 motif (5);	0.045758	0.85682	D	0.000000	D	0.88804	0.6536	L	0.60845	1.875	0.58432	D	0.999998	B;P	0.36909	0.133;0.573	B;B	0.40982	0.117;0.345	D	0.89569	0.3812	10	0.66056	D	0.02	-11.0512	15.6864	0.77415	1.0:0.0:0.0:0.0	.	401;488	B7Z7F9;Q14449	.;GRB14_HUMAN	L	488;401	ENSP00000263915:F488L;ENSP00000443699:F401L	ENSP00000263915:F488L	F	-	1	0	GRB14	165059201	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.295000	0.78780	2.175000	0.68902	0.533000	0.62120	TTT	.	.		0.333	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2		
SCN1A	6323	hgsc.bcm.edu	37	2	166854614	166854614	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:166854614C>T	ENST00000303395.4	-	23	4409	c.4410G>A	c.(4408-4410)ggG>ggA	p.G1470G	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Silent_p.G1459G|SCN1A_ENST00000409050.1_Silent_p.G1442G|SCN1A_ENST00000423058.2_Silent_p.G1470G			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1470			G -> W (in EIEE6; dbSNP:rs121917924). {ECO:0000269|PubMed:17561957}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGAAGAAGGACCCAAAGATGA	0.338																																					p.G1470G		Atlas-SNP	.											.	SCN1A	641	.	0			c.G4410A						.						90.0	81.0	84.0					2																	166854614		2203	4292	6495	SO:0001819	synonymous_variant	6323	exon23			GAAGGACCCAAAG	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4410G>A	chr2.hg19:g.166854614C>T		254.0	0.0		227.0	105.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	hg19	CCDS54413.1																																																																																			.	.		0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SCN7A	6332	hgsc.bcm.edu	37	2	167318900	167318900	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:167318900T>C	ENST00000409855.1	-	9	1208	c.1082A>G	c.(1081-1083)cAg>cGg	p.Q361R		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	361				Q -> L (in Ref. 1; AAA59899). {ECO:0000305}.	membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TGTTCTTACCTGGTGATAAAG	0.368																																					p.Q361R		Atlas-SNP	.											.	SCN7A	410	.	0			c.A1082G						.						52.0	47.0	49.0					2																	167318900		1839	4099	5938	SO:0001630	splice_region_variant	6332	exon9			CTTACCTGGTGAT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1083+1A>G	chr2.hg19:g.167318900T>C		116.0	0.0		120.0	5.0	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	hg19	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	T	16.68	3.191161	0.58017	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.97328	-4.34;-4.34;-4.34	4.14	4.14	0.48551	Ion transport (1);	0.000000	0.45361	D	0.000368	D	0.97670	0.9236	M	0.76170	2.325	0.31735	N	0.636589	D	0.64830	0.994	D	0.76575	0.988	D	0.96468	0.9346	10	0.66056	D	0.02	.	7.2748	0.26277	0.313:0.0:0.0:0.687	.	361	Q01118	SCN7A_HUMAN	R	361	ENSP00000386796:Q361R;ENSP00000413699:Q361R;ENSP00000403846:Q361R	ENSP00000259060:Q361R	Q	-	2	0	SCN7A	167027146	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	1.352000	0.34033	1.626000	0.50381	0.397000	0.26171	CAG	.	.		0.368	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		Missense_Mutation
KLHL23	151230	hgsc.bcm.edu	37	2	170592618	170592618	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:170592618T>C	ENST00000392647.2	+	2	1338	c.1094T>C	c.(1093-1095)gTc>gCc	p.V365A	KLHL23_ENST00000602521.1_Intron|KLHL23_ENST00000272797.4_Missense_Mutation_p.V365A	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	365										breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						CACTGTGCAGTCACCTTGGGT	0.443																																					p.V365A		Atlas-SNP	.											.	KLHL23	52	.	0			c.T1094C						.						191.0	185.0	187.0					2																	170592618		2203	4300	6503	SO:0001583	missense	151230	exon2			GTGCAGTCACCTT	BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.1094T>C	chr2.hg19:g.170592618T>C	ENSP00000376419:p.Val365Ala	111.0	0.0		108.0	5.0	NM_144711	Q8N9B9|Q96FT8	Missense_Mutation	SNP	ENST00000392647.2	hg19	CCDS2236.1	.	.	.	.	.	.	.	.	.	.	T	14.56	2.572641	0.45798	.	.	ENSG00000213160	ENST00000272797;ENST00000392647;ENST00000437875	T;T;T	0.78126	-1.15;-1.15;-1.15	5.8	5.8	0.92144	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.62295	0.2416	N	0.11724	0.165	0.30790	N	0.7410129999999999	B	0.20052	0.041	B	0.31101	0.124	T	0.59894	-0.7368	9	0.02654	T	1	.	16.1508	0.81622	0.0:0.0:0.0:1.0	.	365	Q8NBE8	KLH23_HUMAN	A	365;365;186	ENSP00000272797:V365A;ENSP00000376419:V365A;ENSP00000394732:V186A	ENSP00000272797:V365A	V	+	2	0	KLHL23	170300864	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.264000	0.72527	2.207000	0.71202	0.528000	0.53228	GTC	.	.		0.443	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255271.2	NM_144711	
TTN	7273	hgsc.bcm.edu	37	2	179454987	179454987	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:179454987T>C	ENST00000591111.1	-	254	56766	c.56542A>G	c.(56542-56544)Aga>Gga	p.R18848G	TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R11549G|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R11616G|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R20489G|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R17921G|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R11424G|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18848	Ig-like 107.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCCTACTCTCACGGTAATA	0.443																																					p.R20489G		Atlas-SNP	.											.	TTN	18412	.	0			c.A61465G						.						199.0	181.0	187.0					2																	179454987		1958	4145	6103	SO:0001583	missense	7273	exon304			CTACTCTCACGGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.56542A>G	chr2.hg19:g.179454987T>C	ENSP00000465570:p.Arg18848Gly	174.0	0.0		158.0	7.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	7.630	0.678731	0.14841	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.96	1.93	0.25924	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80747	0.4682	M	0.78916	2.43	0.50171	D	0.999851	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.82957	-0.0199	9	0.87932	D	0	.	14.5767	0.68252	0.0:0.0:0.483:0.517	.	11424;11549;11616;18848	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	17921;11424;11616;11549;11422	ENSP00000343764:R17921G;ENSP00000434586:R11424G;ENSP00000340554:R11616G;ENSP00000352154:R11549G	ENSP00000340554:R11616G	R	-	1	2	TTN	179163233	0.987000	0.35691	0.651000	0.29564	0.872000	0.50106	1.935000	0.40173	0.454000	0.26884	0.533000	0.62120	AGA	.	.		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179596303	179596303	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:179596303T>C	ENST00000591111.1	-	57	16463	c.16239A>G	c.(16237-16239)ccA>ccG	p.P5413P	TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.P5730P|TTN_ENST00000342992.6_Silent_p.P4486P|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12231	Ig-like 35.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTATGAAGGATGGGGGTTCTA	0.468																																					p.P5730P		Atlas-SNP	.											.	TTN	18412	.	0			c.A17190G						.						36.0	36.0	36.0					2																	179596303		1854	4092	5946	SO:0001819	synonymous_variant	7273	exon59			GAAGGATGGGGGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16239A>G	chr2.hg19:g.179596303T>C		66.0	0.0		62.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179632568	179632568	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:179632568A>G	ENST00000591111.1	-	40	9613	c.9389T>C	c.(9388-9390)gTg>gCg	p.V3130A	TTN_ENST00000359218.5_Missense_Mutation_p.V3084A|TTN_ENST00000360870.5_Missense_Mutation_p.V3130A|TTN_ENST00000342175.6_Missense_Mutation_p.V3084A|TTN_ENST00000589042.1_Missense_Mutation_p.V3130A|TTN_ENST00000342992.6_Missense_Mutation_p.V3130A|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V3084A|TTN-AS1_ENST00000610005.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13462	Ig-like 18.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCTCCTGCCACCACTGTGTA	0.443																																					p.V3130A		Atlas-SNP	.											.	TTN	18412	.	0			c.T9389C						.						105.0	107.0	106.0					2																	179632568		2203	4300	6503	SO:0001583	missense	7273	exon40			CCTGCCACCACTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9389T>C	chr2.hg19:g.179632568A>G	ENSP00000465570:p.Val3130Ala	107.0	0.0		117.0	5.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.20	3.329921	0.60743	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82522	0.5055	M	0.79614	2.46	0.40108	D	0.976456	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.83275	0.994;0.994;0.994;0.994;0.996	D	0.85171	0.0998	9	0.87932	D	0	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	3084;3084;3084;3130;3130	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	A	3130;3084;3084;3084;3084;3130	ENSP00000343764:V3130A;ENSP00000434586:V3084A;ENSP00000340554:V3084A;ENSP00000352154:V3084A;ENSP00000354117:V3130A	ENSP00000340554:V3084A	V	-	2	0	TTN	179340813	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	8.962000	0.93254	2.302000	0.77476	0.533000	0.62120	GTG	.	.		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179642440	179642440	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:179642440A>G	ENST00000591111.1	-	25	4695	c.4471T>C	c.(4471-4473)Ttt>Ctt	p.F1491L	TTN_ENST00000359218.5_Missense_Mutation_p.F1445L|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.F1491L|TTN_ENST00000342175.6_Missense_Mutation_p.F1445L|TTN_ENST00000589042.1_Missense_Mutation_p.F1491L|TTN_ENST00000342992.6_Missense_Mutation_p.F1491L|TTN_ENST00000460472.2_Missense_Mutation_p.F1445L			Q8WZ42	TITIN_HUMAN	titin	12357	Ig-like 6.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCATCATGAAACCAGAACGTC	0.323																																					p.F1491L		Atlas-SNP	.											.	TTN	18412	.	0			c.T4471C						.						80.0	77.0	78.0					2																	179642440		2203	4300	6503	SO:0001583	missense	7273	exon25			CATGAAACCAGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4471T>C	chr2.hg19:g.179642440A>G	ENSP00000465570:p.Phe1491Leu	59.0	0.0		77.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.40	3.380327	0.61845	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75946	0.3919	N	0.21373	0.66	0.40716	D	0.982619	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.85130	0.992;0.992;0.992;0.992;0.997	T	0.80221	-0.1472	9	0.87932	D	0	.	16.1547	0.81649	1.0:0.0:0.0:0.0	.	1445;1445;1445;1491;1491	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	L	1491;1445;1445;1445;1445;1491	ENSP00000343764:F1491L;ENSP00000434586:F1445L;ENSP00000340554:F1445L;ENSP00000352154:F1445L;ENSP00000354117:F1491L	ENSP00000340554:F1445L	F	-	1	0	TTN	179350685	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.307000	0.96226	2.221000	0.72209	0.528000	0.53228	TTT	.	.		0.323	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179645980	179645980	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:179645980T>C	ENST00000591111.1	-	21	3615	c.3391A>G	c.(3391-3393)Agt>Ggt	p.S1131G	TTN_ENST00000359218.5_Missense_Mutation_p.S1085G|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.S1131G|TTN_ENST00000342175.6_Missense_Mutation_p.S1085G|TTN_ENST00000589042.1_Missense_Mutation_p.S1131G|TTN_ENST00000342992.6_Missense_Mutation_p.S1131G|TTN_ENST00000460472.2_Missense_Mutation_p.S1085G			Q8WZ42	TITIN_HUMAN	titin	33348	Ig-like 4.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGTTGTAACTCACTTTGTAT	0.353																																					p.S1131G		Atlas-SNP	.											.	TTN	18412	.	0			c.A3391G						.						200.0	176.0	184.0					2																	179645980		2203	4300	6503	SO:0001583	missense	7273	exon21			TGTAACTCACTTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3391A>G	chr2.hg19:g.179645980T>C	ENSP00000465570:p.Ser1131Gly	135.0	0.0		143.0	8.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.58	1.389902	0.25118	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64305	0.2586	L	0.56769	1.78	0.20489	N	0.999893	B;B;B;B;P	0.38504	0.101;0.101;0.101;0.183;0.634	B;B;B;B;B	0.36845	0.138;0.138;0.138;0.096;0.234	T	0.64063	-0.6495	9	0.87932	D	0	.	12.8053	0.57610	0.0:0.0:0.1363:0.8637	.	1085;1085;1085;1131;1131	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	G	1131;1085;1085;1085;1085;1131	ENSP00000343764:S1131G;ENSP00000434586:S1085G;ENSP00000340554:S1085G;ENSP00000352154:S1085G;ENSP00000354117:S1131G	ENSP00000340554:S1085G	S	-	1	0	TTN	179354225	0.998000	0.40836	1.000000	0.80357	0.743000	0.42351	2.551000	0.45820	2.252000	0.74401	0.528000	0.53228	AGT	.	.		0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ASNSD1	54529	hgsc.bcm.edu	37	2	190531152	190531152	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:190531152T>C	ENST00000260952.4	+	4	707	c.294T>C	c.(292-294)taT>taC	p.Y98Y	ASNSD1_ENST00000607062.1_Intron|ASNSD1_ENST00000607535.1_3'UTR	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	98	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			TGTTTAATTATCTTTCCTCCT	0.328																																					p.Y98Y		Atlas-SNP	.											.	ASNSD1	63	.	0			c.T294C						.						122.0	129.0	126.0					2																	190531152		2203	4300	6503	SO:0001819	synonymous_variant	54529	exon4			TAATTATCTTTCC	AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.294T>C	chr2.hg19:g.190531152T>C		49.0	0.0		52.0	4.0	NM_019048	D3DPH6|Q3LIC3|Q4ZG45	Silent	SNP	ENST00000260952.4	hg19	CCDS2300.1																																																																																			.	.		0.328	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255919.3	NM_019048	
ORMDL1	94101	hgsc.bcm.edu	37	2	190636521	190636521	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:190636521A>G	ENST00000325795.3	-	3	1220	c.434T>C	c.(433-435)gTt>gCt	p.V145A	ORMDL1_ENST00000496543.1_5'UTR|ORMDL1_ENST00000392350.3_Missense_Mutation_p.V145A|ORMDL1_ENST00000392349.4_Missense_Mutation_p.V145A			Q9P0S3	ORML1_HUMAN	ORMDL sphingolipid biosynthesis regulator 1	145					ceramide metabolic process (GO:0006672)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(1)|urinary_tract(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00177)|Epithelial(96;0.0317)|all cancers(119;0.0889)			AAAGATCCGAACACCATGTAG	0.353																																					p.V145A		Atlas-SNP	.											.	ORMDL1	8	.	0			c.T434C						.						80.0	82.0	81.0					2																	190636521		2203	4300	6503	SO:0001583	missense	94101	exon5			ATCCGAACACCAT		CCDS2301.1	2q32	2014-06-16	2014-06-16		ENSG00000128699	ENSG00000128699			16036	protein-coding gene	gene with protein product		610073	"""ORM1 (S. cerevisiae)-like 1"", ""ORM1-like 1 (S. cerevisiae)"""			12093374, 23066021	Standard	NM_016467		Approved		uc002ure.4	Q9P0S3	OTTHUMG00000132661	ENST00000325795.3:c.434T>C	chr2.hg19:g.190636521A>G	ENSP00000326869:p.Val145Ala	90.0	0.0		89.0	4.0	NM_016467	B2R8W3|D3DPH9	Missense_Mutation	SNP	ENST00000325795.3	hg19	CCDS2301.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279823	0.80692	.	.	ENSG00000128699	ENST00000392350;ENST00000325795;ENST00000392349	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.80899	0.4712	M	0.85710	2.77	0.80722	D	1	D	0.59357	0.985	D	0.73708	0.981	D	0.84384	0.0551	9	0.87932	D	0	-13.5471	15.2365	0.73436	1.0:0.0:0.0:0.0	.	145	Q9P0S3	ORML1_HUMAN	A	145	.	ENSP00000326869:V145A	V	-	2	0	ORMDL1	190344766	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.224000	0.78042	2.184000	0.69523	0.533000	0.62120	GTT	.	.		0.353	ORMDL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335275.1	NM_016467	
GLS	2744	hgsc.bcm.edu	37	2	191796332	191796332	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:191796332T>C	ENST00000320717.3	+	14	1877	c.1619T>C	c.(1618-1620)cTt>cCt	p.L540P	GLS_ENST00000409428.1_Missense_Mutation_p.L45P|GLS_ENST00000338435.4_Missense_Mutation_p.L540P|GLS_ENST00000409215.1_Missense_Mutation_p.L45P|GLS_ENST00000409626.1_Missense_Mutation_p.L111P|GLS_ENST00000471443.1_3'UTR	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	540					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	GCAAAAAAACTTGATCCTCGA	0.313																																					p.L540P		Atlas-SNP	.											.	GLS	47	.	0			c.T1619C						.						74.0	75.0	74.0					2																	191796332		2203	4296	6499	SO:0001583	missense	2744	exon14			AAAAACTTGATCC	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1619T>C	chr2.hg19:g.191796332T>C	ENSP00000317379:p.Leu540Pro	96.0	0.0		78.0	4.0	NM_014905	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	ENST00000320717.3	hg19	CCDS2308.1	.	.	.	.	.	.	.	.	.	.	T	15.40	2.822874	0.50739	.	.	ENSG00000115419	ENST00000320717;ENST00000338435;ENST00000409626;ENST00000457316;ENST00000409428;ENST00000409215;ENST00000412247	T;T;T	0.55413	0.8;0.73;0.52	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.62282	0.2415	L	0.61218	1.895	0.80722	D	1	P;P;P;P;D	0.63046	0.825;0.921;0.81;0.921;0.992	B;B;B;B;P	0.52109	0.273;0.357;0.203;0.357;0.69	T	0.64723	-0.6340	10	0.51188	T	0.08	-18.7187	16.0417	0.80687	0.0:0.0:0.0:1.0	.	111;540;194;540;540	B7Z2P1;A8K132;Q68D38;O94925;O94925-3	.;.;.;GLSK_HUMAN;.	P	540;540;111;111;45;45;61	ENSP00000317379:L540P;ENSP00000340689:L540P;ENSP00000387177:L45P	ENSP00000317379:L540P	L	+	2	0	GLS	191504577	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.963000	0.56773	2.198000	0.70561	0.482000	0.46254	CTT	.	.		0.313	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255999.2		
SGOL2	151246	hgsc.bcm.edu	37	2	201400866	201400866	+	Splice_Site	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:201400866G>A	ENST00000357799.4	+	4	485		c.e4+1		SGOL2_ENST00000409203.3_Splice_Site|SGOL2_ENST00000469840.1_Splice_Site	NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)						meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						TCTTTCTGAGGTAAGTAGAAT	0.308																																					.		Atlas-SNP	.											.	SGOL2	126	.	0			c.387+1G>A						.						119.0	119.0	119.0					2																	201400866		1815	4064	5879	SO:0001630	splice_region_variant	151246	exon4			TCTGAGGTAAGTA	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.387+1G>A	chr2.hg19:g.201400866G>A		84.0	0.0		84.0	4.0	NM_001160033	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Splice_Site	SNP	ENST00000357799.4	hg19	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544565	0.65198	.	.	ENSG00000163535	ENST00000357799;ENST00000409203	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7126	0.85389	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SGOL2	201109111	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	5.379000	0.66196	2.716000	0.92895	0.563000	0.77884	.	.	.		0.308	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	Intron
CASP10	843	hgsc.bcm.edu	37	2	202074279	202074279	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:202074279T>C	ENST00000272879.5	+	9	1593	c.1409T>C	c.(1408-1410)gTc>gCc	p.V470A	CASP10_ENST00000313728.7_Missense_Mutation_p.V403A|CASP10_ENST00000360132.3_3'UTR|CASP10_ENST00000346817.5_Missense_Mutation_p.V427A|CASP10_ENST00000492363.1_3'UTR|CASP10_ENST00000448480.1_Missense_Mutation_p.V427A|CASP10_ENST00000286186.6_Missense_Mutation_p.V470A	NM_032974.4	NP_116756.2	Q92851	CASPA_HUMAN	caspase 10, apoptosis-related cysteine peptidase	470					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|innate immune response (GO:0045087)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|death effector domain binding (GO:0035877)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27						AAGAAATTGGTCCCAAGGTGA	0.388																																					p.V470A		Atlas-SNP	.											.	CASP10	95	.	0			c.T1409C						.						63.0	65.0	65.0					2																	202074279		2203	4298	6501	SO:0001583	missense	843	exon9			AATTGGTCCCAAG	U60519	CCDS2338.1, CCDS2339.1, CCDS2340.1, CCDS56159.1, CCDS56160.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000003400	ENSG00000003400	3.4.22.63	"""Caspases"""	1500	protein-coding gene	gene with protein product		601762	"""caspase 10, apoptosis-related cysteine protease"""			8755496	Standard	NM_032974		Approved	MCH4	uc002uxj.1	Q92851	OTTHUMG00000132818	ENST00000272879.5:c.1409T>C	chr2.hg19:g.202074279T>C	ENSP00000272879:p.Val470Ala	103.0	0.0		92.0	6.0	NM_032977	Q68HC0|Q6KF62|Q6KF63|Q8IUP5|Q8WYQ8|Q99845|Q9Y2U6|Q9Y2U7	Missense_Mutation	SNP	ENST00000272879.5	hg19	CCDS2338.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.161981	0.38217	.	.	ENSG00000003400	ENST00000286186;ENST00000272879;ENST00000346817;ENST00000313728;ENST00000448480	T;T;T;T;T	0.19938	2.11;4.26;2.11;2.11;4.26	4.82	3.62	0.41486	Peptidase C14, caspase precursor p45, core (1);	0.212741	0.39407	N	0.001366	T	0.22322	0.0538	N	0.11131	0.1	0.52099	D	0.999949	P;D;D;D;D	0.89917	0.725;1.0;1.0;0.996;0.997	P;D;D;P;D	0.91635	0.493;0.998;0.999;0.881;0.992	T	0.04242	-1.0966	10	0.11794	T	0.64	.	11.3339	0.49492	0.0:0.0:0.1526:0.8474	.	403;427;470;427;470	Q92851-6;Q92851-5;Q92851;Q92851-2;Q92851-4	.;.;CASPA_HUMAN;.;.	A	470;470;427;403;427	ENSP00000286186:V470A;ENSP00000272879:V470A;ENSP00000237865:V427A;ENSP00000314599:V403A;ENSP00000396835:V427A	ENSP00000272879:V470A	V	+	2	0	CASP10	201782524	1.000000	0.71417	0.845000	0.33349	0.504000	0.33889	7.267000	0.78462	0.659000	0.30945	0.528000	0.53228	GTC	.	.		0.388	CASP10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256273.1	NM_032977	
CARF	79800	hgsc.bcm.edu	37	2	203848290	203848290	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:203848290A>G	ENST00000402905.3	+	16	2442	c.2121A>G	c.(2119-2121)ccA>ccG	p.P707P	WDR12_ENST00000477723.1_Intron|CARF_ENST00000428585.1_Silent_p.P631P|CARF_ENST00000438828.2_Silent_p.P707P|CARF_ENST00000414439.1_Silent_p.P605P|CARF_ENST00000545253.1_Silent_p.P619P|CARF_ENST00000320443.8_Silent_p.P707P|CARF_ENST00000545262.1_Silent_p.P631P	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	707					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCAAAGAACCAGCATTGTCTA	0.313																																					p.P707P		Atlas-SNP	.											.	ALS2CR8	56	.	0			c.A2121G						.						87.0	85.0	86.0					2																	203848290		1802	4072	5874	SO:0001819	synonymous_variant	79800	exon17			AGAACCAGCATTG	AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.2121A>G	chr2.hg19:g.203848290A>G		53.0	0.0		79.0	5.0	NM_024744	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Silent	SNP	ENST00000402905.3	hg19	CCDS42801.1																																																																																			.	.		0.313	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
NBEAL1	65065	hgsc.bcm.edu	37	2	203881127	203881127	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:203881127T>C	ENST00000449802.1	+	2	353	c.20T>C	c.(19-21)cTc>cCc	p.L7P	WDR12_ENST00000477723.1_5'Flank|NBEAL1_ENST00000478884.1_3'UTR	NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	7										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AGAGAGAGGCTCTTTGAACTT	0.313																																					p.L7P		Atlas-SNP	.											.	NBEAL1	266	.	0			c.T20C						.						97.0	98.0	97.0					2																	203881127		692	1591	2283	SO:0001583	missense	65065	exon2			AGAGGCTCTTTGA	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.20T>C	chr2.hg19:g.203881127T>C	ENSP00000399903:p.Leu7Pro	76.0	0.0		74.0	4.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.495795	0.64186	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.61510	0.1	4.83	4.83	0.62350	.	.	.	.	.	T	0.66137	0.2759	L	0.41824	1.3	0.80722	D	1	D;D	0.69078	0.989;0.997	P;D	0.80764	0.726;0.994	T	0.69000	-0.5261	9	0.87932	D	0	.	11.1321	0.48354	0.0:0.0:0.0:1.0	.	7;7	Q6ZS30;A2RUL1	NBEL1_HUMAN;.	P	7	ENSP00000399903:L7P	ENSP00000344985:L7P	L	+	2	0	NBEAL1	203589372	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.894000	0.56250	1.937000	0.56155	0.533000	0.62120	CTC	.	.		0.313	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
VWC2L	402117	hgsc.bcm.edu	37	2	215301371	215301371	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:215301371T>C	ENST00000312504.5	+	3	1211	c.409T>C	c.(409-411)Tgt>Cgt	p.C137R	VWC2L_ENST00000427124.1_Intron|AC107218.3_ENST00000412896.1_RNA|AC107218.3_ENST00000437883.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	137	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						ATGTGAATGGTGTCGCTGTGA	0.443																																					p.C137R		Atlas-SNP	.											.	VWC2L	40	.	0			c.T409C						.						108.0	106.0	106.0					2																	215301371		2006	4157	6163	SO:0001583	missense	402117	exon3			GAATGGTGTCGCT	AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.409T>C	chr2.hg19:g.215301371T>C	ENSP00000308976:p.Cys137Arg	119.0	0.0		154.0	7.0	NM_001080500	A6NC69|B2RUW7|B7X8X1	Missense_Mutation	SNP	ENST00000312504.5	hg19	CCDS46509.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.214110	0.79352	.	.	ENSG00000174453	ENST00000312504	D	0.82984	-1.67	5.87	5.87	0.94306	von Willebrand factor, type C (3);	.	.	.	.	D	0.93671	0.7978	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95246	0.8355	9	0.87932	D	0	-1.9073	16.2713	0.82622	0.0:0.0:0.0:1.0	.	137	B2RUY7	VWC2L_HUMAN	R	137	ENSP00000308976:C137R	ENSP00000308976:C137R	C	+	1	0	VWC2L	215009616	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.036000	0.88901	2.232000	0.73038	0.528000	0.53228	TGT	.	.		0.443	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500	
ABCA12	26154	hgsc.bcm.edu	37	2	215884303	215884303	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:215884303A>G	ENST00000272895.7	-	12	1724	c.1505T>C	c.(1504-1506)cTg>cCg	p.L502P	AC072062.3_ENST00000602182.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.L184P|AC072062.3_ENST00000437897.3_RNA|AC072062.3_ENST00000419251.1_RNA|AC072062.3_ENST00000595058.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	502					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATCTCCAGTCAGCAAATCTCT	0.378																																					p.L502P	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.T1505C						.						67.0	69.0	68.0					2																	215884303		2203	4300	6503	SO:0001583	missense	26154	exon12			CCAGTCAGCAAAT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1505T>C	chr2.hg19:g.215884303A>G	ENSP00000272895:p.Leu502Pro	140.0	0.0		115.0	5.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.770406	0.49680	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.67698	-0.28;-0.28	5.9	4.72	0.59763	.	0.125547	0.36167	N	0.002759	T	0.69913	0.3164	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69654	0.957;0.965	T	0.72507	-0.4272	10	0.87932	D	0	.	11.6442	0.51250	0.8516:0.1484:0.0:0.0	.	502;184	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	P	502;184	ENSP00000272895:L502P;ENSP00000374312:L184P	ENSP00000272895:L502P	L	-	2	0	ABCA12	215592548	1.000000	0.71417	0.998000	0.56505	0.839000	0.47603	5.683000	0.68189	1.017000	0.39495	0.519000	0.50382	CTG	.	.		0.378	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
MRPL44	65080	hgsc.bcm.edu	37	2	224824697	224824697	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:224824697A>G	ENST00000258383.3	+	2	695	c.626A>G	c.(625-627)gAg>gGg	p.E209G		NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	209	RNase III.				mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		AGTGGACCTGAGAGGACTGCA	0.418																																					p.E209G		Atlas-SNP	.											.	MRPL44	31	.	0			c.A626G						.						70.0	69.0	69.0					2																	224824697		2203	4300	6503	SO:0001583	missense	65080	exon2			GACCTGAGAGGAC	AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.626A>G	chr2.hg19:g.224824697A>G	ENSP00000258383:p.Glu209Gly	82.0	0.0		94.0	4.0	NM_022915	Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	ENST00000258383.3	hg19	CCDS2459.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.391985	0.42410	.	.	ENSG00000135900	ENST00000258383	T	0.51574	0.7	5.7	0.475	0.16774	Ribonuclease III (3);	0.523903	0.22034	N	0.065555	T	0.35278	0.0926	L	0.51422	1.61	0.42515	D	0.992989	B	0.06786	0.001	B	0.09377	0.004	T	0.13575	-1.0504	10	0.54805	T	0.06	-11.752	4.6655	0.12664	0.6434:0.0:0.226:0.1306	.	209	Q9H9J2	RM44_HUMAN	G	209	ENSP00000258383:E209G	ENSP00000258383:E209G	E	+	2	0	MRPL44	224532941	1.000000	0.71417	0.973000	0.42090	0.936000	0.57629	3.197000	0.51028	0.120000	0.18254	0.528000	0.53228	GAG	.	.		0.418	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256866.2	NM_022915	
COL4A4	1286	hgsc.bcm.edu	37	2	227942736	227942736	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:227942736G>A	ENST00000396625.3	-	25	2068	c.1861C>T	c.(1861-1863)Cca>Tca	p.P621S	COL4A4_ENST00000329662.7_Missense_Mutation_p.P621S	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	621	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GCTTTGCCTGGGGGGCCCAGA	0.592																																					p.P621S		Atlas-SNP	.											.	COL4A4	215	.	0			c.C1861T						.						29.0	32.0	31.0					2																	227942736		1813	4077	5890	SO:0001583	missense	1286	exon25			TGCCTGGGGGGCC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1861C>T	chr2.hg19:g.227942736G>A	ENSP00000379866:p.Pro621Ser	76.0	0.0		84.0	4.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	hg19	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535342	0.45176	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.96587	-4.06;-4.06	5.82	5.82	0.92795	.	.	.	.	.	D	0.97654	0.9231	M	0.66560	2.04	0.23260	N	0.998021	D	0.71674	0.998	D	0.66847	0.947	D	0.93741	0.7050	9	0.44086	T	0.13	.	17.8873	0.88861	0.0:0.0:1.0:0.0	.	621	P53420	CO4A4_HUMAN	S	621	ENSP00000379866:P621S;ENSP00000328553:P621S	ENSP00000328553:P621S	P	-	1	0	COL4A4	227650980	1.000000	0.71417	0.059000	0.19551	0.016000	0.09150	6.389000	0.73199	2.765000	0.95021	0.650000	0.86243	CCA	.	.		0.592	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
SPHKAP	80309	hgsc.bcm.edu	37	2	228881536	228881536	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:228881536T>C	ENST00000392056.3	-	7	4080	c.4034A>G	c.(4033-4035)gAg>gGg	p.E1345G	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E1345G	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1345						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TGCACACTTCTCTGCTTGCGA	0.512																																					p.E1345G		Atlas-SNP	.											.	SPHKAP	750	.	0			c.A4034G						.						92.0	81.0	85.0					2																	228881536		2203	4300	6503	SO:0001583	missense	80309	exon7			CACTTCTCTGCTT		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4034A>G	chr2.hg19:g.228881536T>C	ENSP00000375909:p.Glu1345Gly	163.0	0.0		173.0	7.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	hg19	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	12.11	1.839466	0.32513	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12774	2.65;2.65	5.92	3.52	0.40303	.	0.582699	0.20019	N	0.100942	T	0.11580	0.0282	L	0.50919	1.6	0.09310	N	1	B;B;B	0.29862	0.004;0.006;0.259	B;B;B	0.22753	0.004;0.007;0.041	T	0.17623	-1.0363	10	0.38643	T	0.18	-6.5395	7.6833	0.28526	0.0:0.0722:0.1418:0.786	.	376;1345;1345	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	G	1345	ENSP00000375909:E1345G;ENSP00000339886:E1345G	ENSP00000339886:E1345G	E	-	2	0	SPHKAP	228589780	0.873000	0.30073	0.010000	0.14722	0.004000	0.04260	3.522000	0.53480	1.015000	0.39444	0.533000	0.62120	GAG	.	.		0.512	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
SAG	6295	hgsc.bcm.edu	37	2	234237222	234237222	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:234237222A>G	ENST00000409110.1	+	8	841	c.611A>G	c.(610-612)gAc>gGc	p.D204G	SAG_ENST00000449594.2_Missense_Mutation_p.D70G	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	204					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		TTCATGTCTGACAAGCCCCTG	0.612																																					p.D204G		Atlas-SNP	.											.	SAG	77	.	0			c.A611G						.						94.0	93.0	93.0					2																	234237222		1995	4169	6164	SO:0001583	missense	6295	exon8			TGTCTGACAAGCC		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.611A>G	chr2.hg19:g.234237222A>G	ENSP00000386444:p.Asp204Gly	109.0	0.0		97.0	5.0	NM_000541	A0FDN6|Q53SV3|Q99858	Missense_Mutation	SNP	ENST00000409110.1	hg19	CCDS46545.1	.	.	.	.	.	.	.	.	.	.	A	18.43	3.622767	0.66787	.	.	ENSG00000130561	ENST00000252857;ENST00000409110;ENST00000449594	T;T	0.06449	3.3;3.3	4.19	4.19	0.49359	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.095533	0.64402	D	0.000001	T	0.13756	0.0333	M	0.86097	2.795	0.54753	D	0.999983	B;B	0.28178	0.113;0.202	B;B	0.30782	0.071;0.12	T	0.02037	-1.1225	10	0.52906	T	0.07	-23.8596	13.7339	0.62807	1.0:0.0:0.0:0.0	.	70;204	B7Z7L5;P10523	.;ARRS_HUMAN	G	204;204;70	ENSP00000386444:D204G;ENSP00000392889:D70G	ENSP00000252857:D204G	D	+	2	0	SAG	233901961	1.000000	0.71417	0.992000	0.48379	0.965000	0.64279	6.010000	0.70753	1.898000	0.54952	0.533000	0.62120	GAC	.	.		0.612	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330126.1	NM_000541	
ACKR3	57007	hgsc.bcm.edu	37	2	237489341	237489341	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:237489341A>T	ENST00000272928.3	+	2	543	c.233A>T	c.(232-234)gAc>gTc	p.D78V		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	78					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)										ACAGGCTATGACACGCACTGC	0.542																																					p.D78V		Atlas-SNP	.											.	CXCR7	72	.	0			c.A233T						.						179.0	143.0	155.0					2																	237489341		2203	4300	6503	SO:0001583	missense	57007	exon2			GCTATGACACGCA	BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.233A>T	chr2.hg19:g.237489341A>T	ENSP00000272928:p.Asp78Val	171.0	0.0		159.0	79.0	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	hg19	CCDS2516.1	.	.	.	.	.	.	.	.	.	.	A	18.77	3.695508	0.68386	.	.	ENSG00000144476	ENST00000447924;ENST00000272928	T;T	0.34072	1.38;1.38	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.051051	0.85682	D	0.000000	T	0.12347	0.0300	N	0.00060	-2.335	0.80722	D	1	P	0.47484	0.896	P	0.46049	0.502	T	0.58549	-0.7617	10	0.54805	T	0.06	.	15.7428	0.77914	1.0:0.0:0.0:0.0	.	78	P25106	CXCR7_HUMAN	V	78	ENSP00000405945:D78V;ENSP00000272928:D78V	ENSP00000272928:D78V	D	+	2	0	CXCR7	237154080	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.283000	0.78640	2.117000	0.64856	0.460000	0.39030	GAC	.	.		0.542	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
IRAK2	3656	hgsc.bcm.edu	37	3	10251316	10251316	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:10251316T>C	ENST00000256458.4	+	4	558	c.468T>C	c.(466-468)ccT>ccC	p.P156P		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	156					activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						TTCTCCAGCCTCCTGAAGAAG	0.597																																					p.P156P		Atlas-SNP	.											.	IRAK2	113	.	0			c.T468C						.						155.0	164.0	161.0					3																	10251316		2203	4300	6503	SO:0001819	synonymous_variant	3656	exon4			CCAGCCTCCTGAA	AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.468T>C	chr3.hg19:g.10251316T>C		85.0	0.0		87.0	7.0	NM_001570	B4DQZ6|Q08AG6|Q5K546	Silent	SNP	ENST00000256458.4	hg19	CCDS33697.1																																																																																			.	.		0.597	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339623.1		
FBLN2	2199	hgsc.bcm.edu	37	3	13611908	13611908	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:13611908T>C	ENST00000295760.7	+	2	122	c.53T>C	c.(52-54)cTg>cCg	p.L18P	FBLN2_ENST00000492059.1_Missense_Mutation_p.L18P|FBLN2_ENST00000535798.1_Missense_Mutation_p.L44P|FBLN2_ENST00000404922.3_Missense_Mutation_p.L18P	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	18					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GGCCTGGCCCTGGCCCTGGGC	0.721																																					p.L18P		Atlas-SNP	.											.	FBLN2	137	.	0			c.T53C						.						6.0	8.0	7.0					3																	13611908		1969	4108	6077	SO:0001583	missense	2199	exon2			TGGCCCTGGCCCT	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.53T>C	chr3.hg19:g.13611908T>C	ENSP00000295760:p.Leu18Pro	51.0	0.0		73.0	4.0	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	hg19	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	T	6.594	0.477886	0.12521	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000465610;ENST00000492059	T;T;T;T;T	0.80566	-1.39;-1.34;-1.3;1.43;-1.34	4.39	2.01	0.26516	.	0.985869	0.08229	N	0.977959	T	0.71970	0.3403	L	0.40543	1.245	0.09310	N	1	B;B;B	0.12013	0.003;0.002;0.005	B;B;B	0.12156	0.003;0.003;0.007	T	0.61686	-0.7012	10	0.72032	D	0.01	.	5.9413	0.19194	0.0:0.2271:0.0:0.7729	.	18;18;44	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	P	44;18;18;18;18	ENSP00000445705:L44P;ENSP00000384169:L18P;ENSP00000295760:L18P;ENSP00000420164:L18P;ENSP00000420042:L18P	ENSP00000295760:L18P	L	+	2	0	FBLN2	13586908	0.375000	0.25089	0.054000	0.19295	0.171000	0.22731	2.307000	0.43682	0.678000	0.31325	0.456000	0.33151	CTG	.	.		0.721	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
FBLN2	2199	hgsc.bcm.edu	37	3	13612069	13612069	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:13612069G>C	ENST00000295760.7	+	2	283	c.214G>C	c.(214-216)Gac>Cac	p.D72H	FBLN2_ENST00000492059.1_Missense_Mutation_p.D72H|FBLN2_ENST00000535798.1_Missense_Mutation_p.D98H|FBLN2_ENST00000404922.3_Missense_Mutation_p.D72H	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	72	N.|Subdomain NA (Cys-rich).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCAGTACTATGACTGCCTACA	0.677																																					p.D72H		Atlas-SNP	.											.	FBLN2	137	.	0			c.G214C						.						8.0	12.0	11.0					3																	13612069		2094	4210	6304	SO:0001583	missense	2199	exon2			TACTATGACTGCC	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.214G>C	chr3.hg19:g.13612069G>C	ENSP00000295760:p.Asp72His	227.0	0.0		412.0	255.0	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	hg19	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.554172	0.65425	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000465610;ENST00000492059	T;T;T;T;T	0.04275	3.66;3.66;3.66;3.66;3.66	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	L	0.58101	1.795	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.00290	-1.1843	10	0.87932	D	0	.	18.4591	0.90732	0.0:0.0:1.0:0.0	.	72;72;98	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	H	98;72;72;72;72	ENSP00000445705:D98H;ENSP00000384169:D72H;ENSP00000295760:D72H;ENSP00000420164:D72H;ENSP00000420042:D72H	ENSP00000295760:D72H	D	+	1	0	FBLN2	13587069	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	7.746000	0.85057	2.357000	0.79964	0.558000	0.71614	GAC	.	.		0.677	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
LRRFIP2	9209	hgsc.bcm.edu	37	3	37170627	37170627	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:37170627A>G	ENST00000336686.4	-	3	184	c.104T>C	c.(103-105)cTg>cCg	p.L35P	LRRFIP2_ENST00000396428.2_Missense_Mutation_p.L35P|LRRFIP2_ENST00000421276.2_Missense_Mutation_p.L35P|LRRFIP2_ENST00000440230.1_Missense_Mutation_p.L35P|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.L35P|LRRFIP2_ENST00000354379.4_Missense_Mutation_p.L35P			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	35	DVL3-binding.				Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TTTTGCTGCCAGCCTTGCCTC	0.403																																					p.L35P		Atlas-SNP	.											.	LRRFIP2	71	.	1	Whole gene deletion(1)	ovary(1)	c.T104C						.						120.0	122.0	121.0					3																	37170627		2203	4300	6503	SO:0001583	missense	9209	exon4			GCTGCCAGCCTTG	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.104T>C	chr3.hg19:g.37170627A>G	ENSP00000338727:p.Leu35Pro	90.0	0.0		90.0	4.0	NM_001134369	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	ENST00000336686.4	hg19	CCDS2664.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.785562	0.90282	.	.	ENSG00000093167	ENST00000421307;ENST00000354379;ENST00000336686;ENST00000421276;ENST00000396428;ENST00000440230;ENST00000416425;ENST00000438374;ENST00000434749;ENST00000436858;ENST00000452742	T;T;T;T;T;T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44;0.44	5.37	5.37	0.77165	.	0.101878	0.53938	D	0.000042	T	0.70850	0.3271	M	0.67700	2.07	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;1.0	T	0.74432	-0.3667	10	0.87932	D	0	-0.0963	15.321	0.74120	1.0:0.0:0.0:0.0	.	35;35;35;35	A8MXR0;Q9Y608-2;Q9Y608-4;Q9Y608	.;.;.;LRRF2_HUMAN	P	35	ENSP00000392217:L35P;ENSP00000346349:L35P;ENSP00000338727:L35P;ENSP00000416364:L35P;ENSP00000379705:L35P;ENSP00000405480:L35P;ENSP00000409574:L35P;ENSP00000412206:L35P;ENSP00000416907:L35P;ENSP00000416013:L35P;ENSP00000391360:L35P	ENSP00000338727:L35P	L	-	2	0	LRRFIP2	37145631	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.878000	0.92393	2.157000	0.67596	0.533000	0.62120	CTG	.	.		0.403	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253335.3	NM_006309	
GOLGA4	2803	hgsc.bcm.edu	37	3	37365457	37365457	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:37365457T>C	ENST00000361924.2	+	14	2454	c.2080T>C	c.(2080-2082)Tca>Cca	p.S694P	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.S716P	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	694	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTCTGAACTGTCAGAAGTATT	0.363																																					p.S716P		Atlas-SNP	.											.	GOLGA4	173	.	0			c.T2146C						.						32.0	36.0	34.0					3																	37365457		2196	4270	6466	SO:0001583	missense	2803	exon15			GAACTGTCAGAAG	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.2080T>C	chr3.hg19:g.37365457T>C	ENSP00000354486:p.Ser694Pro	115.0	0.0		115.0	5.0	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	hg19	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	T	17.01	3.280162	0.59758	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000429018;ENST00000437131	T;T;T	0.28666	1.65;1.65;1.6	5.22	0.9	0.19278	.	0.295030	0.18662	N	0.134692	T	0.47002	0.1422	M	0.72894	2.215	0.32918	D	0.515446	D;D;D;D	0.67145	0.996;0.989;0.989;0.985	D;P;P;P	0.64410	0.925;0.885;0.885;0.756	T	0.58031	-0.7708	10	0.59425	D	0.04	.	8.8404	0.35137	0.1101:0.0:0.3072:0.5827	.	694;694;716;694	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	P	694;716;255;565	ENSP00000354486:S694P;ENSP00000349305:S716P;ENSP00000405842:S565P	ENSP00000349305:S716P	S	+	1	0	GOLGA4	37340461	0.995000	0.38212	0.880000	0.34516	0.901000	0.52897	1.818000	0.39012	0.355000	0.24131	0.533000	0.62120	TCA	.	.		0.363	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
ZNF197	10168	hgsc.bcm.edu	37	3	44684620	44684620	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:44684620T>C	ENST00000396058.1	+	5	2165	c.1998T>C	c.(1996-1998)atT>atC	p.I666I	ZNF197_ENST00000344387.4_Silent_p.I666I|ZNF197_ENST00000383745.2_Intron|ZNF197_ENST00000383744.4_Intron|RP11-944L7.4_ENST00000457331.1_RNA			O14709	ZN197_HUMAN	zinc finger protein 197	666					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I666M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AGAGCCTCATTTTACATCAAA	0.408																																					p.I666I		Atlas-SNP	.											ZNF197,NS,carcinoma,0,1	ZNF197	81	.	1	Substitution - Missense(1)	ovary(1)	c.T1998C						.						60.0	62.0	61.0					3																	44684620		2203	4300	6503	SO:0001819	synonymous_variant	10168	exon6			CCTCATTTTACAT	AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.1998T>C	chr3.hg19:g.44684620T>C		85.0	0.0		88.0	4.0	NM_006991	B2RAH8|Q86VG0	Silent	SNP	ENST00000396058.1	hg19	CCDS2717.1																																																																																			.	.		0.408	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991	
CCR5	1234	hgsc.bcm.edu	37	3	46414949	46414949	+	Missense_Mutation	SNP	C	C	A	rs333|rs562091107|rs113869679	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:46414949C>A	ENST00000292303.4	+	2	702	c.556C>A	c.(556-558)Cag>Aag	p.Q186K	RP11-24F11.2_ENST00000451485.1_RNA|CCR5_ENST00000445772.1_Missense_Mutation_p.Q186K|CCR5_ENST00000343801.4_Missense_Mutation_p.Q186K	NM_001100168.1	NP_001093638.1	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5 (gene/pseudogene)	186					calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|signaling (GO:0023052)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)|phosphatidylinositol phospholipase C activity (GO:0004435)			central_nervous_system(1)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	TCCATACAGTCAGTATCAATT	0.453																																					p.Q186K		Atlas-SNP	.											CCR5,colon,carcinoma,0,1	CCR5	128	.	0			c.C556A						.						136.0	138.0	137.0					3																	46414949		2203	4271	6474	SO:0001583	missense	1234	exon3			TACAGTCAGTATC		CCDS2739.1	3p21	2012-08-08	2012-01-23		ENSG00000160791	ENSG00000160791		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1606	protein-coding gene	gene with protein product		601373	"""chemokine (C-C motif) receptor 5"""	CMKBR5		8639485	Standard	NM_001100168		Approved	CKR-5, CC-CKR-5, CKR5, CD195, IDDM22	uc003cpo.4	P51681	OTTHUMG00000133481	ENST00000292303.4:c.556C>A	chr3.hg19:g.46414949C>A	ENSP00000292303:p.Gln186Lys	83.0	2.0		87.0	4.0	NM_000579	O14692|O14693|O14695|O14696|O14697|O14698|O14699|O14700|O14701|O14702|O14703|O14704|O14705|O14706|O14707|O14708|O15538|Q9UPA4	Missense_Mutation	SNP	ENST00000292303.4	hg19	CCDS2739.1	.	.	.	.	.	.	.	.	.	.	C	9.584	1.124440	0.20959	.	.	ENSG00000160791	ENST00000343801;ENST00000400886;ENST00000292303;ENST00000445772	T;T;T	0.36699	1.24;1.24;1.24	5.31	5.31	0.75309	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39341	U	0.001383	T	0.32971	0.0847	L	0.45285	1.41	0.27965	N	0.936637	B	0.16166	0.016	B	0.22152	0.038	T	0.23332	-1.0191	10	0.51188	T	0.08	.	13.0639	0.59022	0.1602:0.8398:0.0:0.0	.	186	P51681	CCR5_HUMAN	K	186;166;186;186	ENSP00000343985:Q186K;ENSP00000292303:Q186K;ENSP00000404881:Q186K	ENSP00000292303:Q186K	Q	+	1	0	CCR5	46389953	0.000000	0.05858	0.065000	0.19835	0.019000	0.09904	0.810000	0.27183	2.470000	0.83445	0.561000	0.74099	CAG	.	.		0.453	CCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257377.2	NM_000579	
RBM6	10180	hgsc.bcm.edu	37	3	50005375	50005375	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:50005375T>C	ENST00000266022.4	+	3	776	c.517T>C	c.(517-519)Tct>Cct	p.S173P	RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_Missense_Mutation_p.S41P|RBM6_ENST00000441115.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000539992.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	173					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		TGCTCCTCCATCTGACTTCAG	0.473																																					p.S173P		Atlas-SNP	.											.	RBM6	85	.	0			c.T517C						.						59.0	62.0	61.0					3																	50005375		2203	4300	6503	SO:0001583	missense	10180	exon3			CCTCCATCTGACT	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.517T>C	chr3.hg19:g.50005375T>C	ENSP00000266022:p.Ser173Pro	117.0	0.0		94.0	5.0	NM_005777	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	hg19	CCDS2809.1	.	.	.	.	.	.	.	.	.	.	T	8.024	0.760258	0.15914	.	.	ENSG00000004534	ENST00000266022;ENST00000443081	T;T	0.32272	1.48;1.46	5.88	-3.95	0.04118	.	0.437866	0.21957	N	0.066654	T	0.10852	0.0265	N	0.17082	0.46	0.58432	D	0.99999	B	0.02656	0.0	B	0.01281	0.0	T	0.17961	-1.0352	9	.	.	.	-0.6504	0.8832	0.01239	0.2603:0.2736:0.1116:0.3545	.	173	P78332	RBM6_HUMAN	P	173;41	ENSP00000266022:S173P;ENSP00000396466:S41P	.	S	+	1	0	RBM6	49980379	0.001000	0.12720	0.890000	0.34922	0.996000	0.88848	-0.515000	0.06290	-0.508000	0.06540	0.459000	0.35465	TCT	.	.		0.473	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
NEK4	6787	hgsc.bcm.edu	37	3	52797562	52797562	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:52797562T>C	ENST00000233027.5	-	5	947	c.745A>G	c.(745-747)Agg>Ggg	p.R249G	NEK4_ENST00000383721.4_Missense_Mutation_p.R249G|NEK4_ENST00000535191.1_Missense_Mutation_p.R160G	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		ACAGACGGCCTTTCTTCAGGC	0.438																																					p.R249G		Atlas-SNP	.											.	NEK4	51	.	0			c.A745G						.						181.0	185.0	184.0					3																	52797562		2203	4300	6503	SO:0001583	missense	6787	exon5			ACGGCCTTTCTTC	L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.745A>G	chr3.hg19:g.52797562T>C	ENSP00000233027:p.Arg249Gly	92.0	0.0		91.0	4.0	NM_003157	A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	ENST00000233027.5	hg19	CCDS2863.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082841	0.76642	.	.	ENSG00000114904	ENST00000233027;ENST00000535191;ENST00000383721;ENST00000461689	T;T;T;T	0.72051	-0.62;-0.58;-0.62;-0.58	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.057791	0.64402	D	0.000003	D	0.90882	0.7135	H	0.99689	4.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93735	0.7045	10	0.87932	D	0	.	11.6712	0.51401	0.0:0.0:0.148:0.852	.	160;249;249	B7Z200;P51957-2;P51957	.;.;NEK4_HUMAN	G	249;160;249;160	ENSP00000233027:R249G;ENSP00000437703:R160G;ENSP00000373227:R249G;ENSP00000419666:R160G	ENSP00000233027:R249G	R	-	1	2	NEK4	52772602	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.564000	0.45931	2.114000	0.64651	0.533000	0.62120	AGG	.	.		0.438	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352386.2	NM_003157	
FRMD4B	23150	hgsc.bcm.edu	37	3	69225784	69225784	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:69225784T>C	ENST00000398540.3	-	22	2958	c.2875A>G	c.(2875-2877)Aac>Gac	p.N959D	FRMD4B_ENST00000478263.1_Missense_Mutation_p.N611D|FRMD4B_ENST00000542259.1_Missense_Mutation_p.N905D	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	959					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		GTCCTCCAGTTCCCAGAAGCA	0.383																																					p.N959D		Atlas-SNP	.											.	FRMD4B	90	.	0			c.A2875G						.						95.0	91.0	92.0					3																	69225784		1885	4117	6002	SO:0001583	missense	23150	exon22			TCCAGTTCCCAGA	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2875A>G	chr3.hg19:g.69225784T>C	ENSP00000381549:p.Asn959Asp	78.0	0.0		69.0	4.0	NM_015123	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	hg19	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.823104	0.71143	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.84298	-1.83;-1.81	5.69	5.69	0.88448	.	0.257041	0.41396	D	0.000882	T	0.81489	0.4833	M	0.66939	2.045	0.34642	D	0.72072	B;P	0.39665	0.115;0.682	B;B	0.30401	0.056;0.115	D	0.86266	0.1658	10	0.33940	T	0.23	-19.7622	14.5303	0.67920	0.0:0.0:0.0:1.0	.	803;959	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	D	959;905;611	ENSP00000381549:N959D;ENSP00000437658:N905D	ENSP00000381549:N959D	N	-	1	0	FRMD4B	69308474	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.829000	0.62737	2.180000	0.69256	0.482000	0.46254	AAC	.	.		0.383	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
EPHA3	2042	hgsc.bcm.edu	37	3	89156972	89156972	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:89156972A>G	ENST00000336596.2	+	1	299	c.74A>G	c.(73-75)cAg>cGg	p.Q25R	EPHA3_ENST00000452448.2_Missense_Mutation_p.Q25R|EPHA3_ENST00000494014.1_Missense_Mutation_p.Q25R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	25					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CTGATTCCGCAGCCTTCCAAT	0.597										TSP Lung(6;0.00050)																											p.Q25R		Atlas-SNP	.											.	EPHA3	501	.	0			c.A74G						.						125.0	99.0	108.0					3																	89156972		2203	4300	6503	SO:0001583	missense	2042	exon1			TTCCGCAGCCTTC	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.74A>G	chr3.hg19:g.89156972A>G	ENSP00000337451:p.Gln25Arg	139.0	0.0		136.0	6.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	hg19	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	1.632	-0.518856	0.04171	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.71934	-0.59;2.85;-0.61	5.46	3.0	0.34707	.	0.608349	0.16348	N	0.218354	T	0.51568	0.1682	N	0.14661	0.345	0.30642	N	0.756385	B;B	0.14012	0.009;0.009	B;B	0.17098	0.003;0.017	T	0.43877	-0.9364	9	.	.	.	.	11.6203	0.51113	0.7183:0.2817:0.0:0.0	.	25;25	P29320;P29320-2	EPHA3_HUMAN;.	R	25	ENSP00000337451:Q25R;ENSP00000399926:Q25R;ENSP00000419190:Q25R	.	Q	+	2	0	EPHA3	89239662	0.999000	0.42202	0.433000	0.26760	0.306000	0.27790	3.012000	0.49575	0.337000	0.23665	0.379000	0.24179	CAG	.	.		0.597	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
CBLB	868	hgsc.bcm.edu	37	3	105464838	105464838	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:105464838T>C	ENST00000264122.4	-	6	1089	c.768A>G	c.(766-768)acA>acG	p.T256T	CBLB_ENST00000405772.1_Silent_p.T256T|CBLB_ENST00000545639.1_3'UTR|CBLB_ENST00000394027.3_Silent_p.T278T|CBLB_ENST00000403724.1_Silent_p.T256T	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	256	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						AACCTGGATGTGTCACAGCTA	0.333			Mis S		AML																																p.T256T	GBM(93;588 1337 9788 29341 43499)	Atlas-SNP	.		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	CBLB	118	.	0			c.A768G						.						119.0	125.0	123.0					3																	105464838		2203	4300	6503	SO:0001819	synonymous_variant	868	exon6			TGGATGTGTCACA	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.768A>G	chr3.hg19:g.105464838T>C		84.0	0.0		91.0	4.0	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Silent	SNP	ENST00000264122.4	hg19	CCDS2948.1																																																																																			.	.		0.333	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
MORC1	27136	hgsc.bcm.edu	37	3	108705728	108705728	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:108705728T>C	ENST00000483760.1	-	21	2236	c.2193A>G	c.(2191-2193)caA>caG	p.Q731Q	MORC1_ENST00000232603.5_Splice_Site_p.Q752Q					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TTTTTTTACCTTGGTTTAAAA	0.284																																					p.Q752Q		Atlas-SNP	.											.	MORC1	211	.	0			c.A2256G						.						23.0	22.0	22.0					3																	108705728		2174	4263	6437	SO:0001630	splice_region_variant	27136	exon22			TTTACCTTGGTTT	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2194+1A>G	chr3.hg19:g.108705728T>C		69.0	0.0		79.0	6.0	NM_014429		Silent	SNP	ENST00000483760.1	hg19																																																																																				.	.		0.284	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		Silent
CASR	846	hgsc.bcm.edu	37	3	121980428	121980428	+	Silent	SNP	T	T	C	rs200545177		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:121980428T>C	ENST00000490131.1	+	4	918	c.546T>C	c.(544-546)tcT>tcC	p.S182S	CASR_ENST00000296154.5_Silent_p.S182S|CASR_ENST00000498619.1_Silent_p.S182S	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	182					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	AATTCAAGTCTTTCCTCCGAA	0.507																																					p.S182S		Atlas-SNP	.											.	CASR	190	.	0			c.T546C						.						129.0	136.0	133.0					3																	121980428		2203	4300	6503	SO:0001819	synonymous_variant	846	exon4			CAAGTCTTTCCTC	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.546T>C	chr3.hg19:g.121980428T>C		106.0	0.0		98.0	5.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	ENST00000490131.1	hg19	CCDS3010.1																																																																																			.	.		0.507	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
PARP14	54625	hgsc.bcm.edu	37	3	122418450	122418450	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:122418450G>A	ENST00000474629.2	+	6	1315	c.1049G>A	c.(1048-1050)cGt>cAt	p.R350H		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GAAATGAGGCGTTGTCACTGT	0.453																																					p.R350H		Atlas-SNP	.											.	PARP14	242	.	0			c.G1049A						.						125.0	119.0	121.0					3																	122418450		2007	4183	6190	SO:0001583	missense	54625	exon6			TGAGGCGTTGTCA	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1049G>A	chr3.hg19:g.122418450G>A	ENSP00000418194:p.Arg350His	140.0	0.0		141.0	59.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	hg19	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	G	3.512	-0.099552	0.07010	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.72615	-0.67	5.32	-7.96	0.01144	.	1.152660	0.06396	N	0.717941	T	0.49440	0.1557	L	0.27053	0.805	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.04013	0.0;0.001	T	0.34750	-0.9816	10	0.14656	T	0.56	.	9.3574	0.38175	0.3934:0.0:0.5036:0.103	.	350;350	Q460N5-4;Q460N5	.;PAR14_HUMAN	H	350;269	ENSP00000418194:R350H	ENSP00000381228:R269H	R	+	2	0	PARP14	123901140	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.098000	0.01347	-1.718000	0.01383	-0.302000	0.09304	CGT	.	.		0.453	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
PIK3R4	30849	hgsc.bcm.edu	37	3	130463932	130463932	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:130463932T>C	ENST00000356763.3	-	2	688	c.131A>G	c.(130-132)aAg>aGg	p.K44R		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	44	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TTCTCGGTGCTTGGCTCGAGC	0.423																																					p.K44R		Atlas-SNP	.											.	PIK3R4	145	.	0			c.A131G						.						60.0	62.0	61.0					3																	130463932		2203	4299	6502	SO:0001583	missense	30849	exon2			CGGTGCTTGGCTC	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.131A>G	chr3.hg19:g.130463932T>C	ENSP00000349205:p.Lys44Arg	82.0	0.0		105.0	5.0	NM_014602	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	hg19	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.069380	0.36470	.	.	ENSG00000196455	ENST00000356763	T	0.10763	2.84	5.0	5.0	0.66597	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.07863	0.0197	N	0.16790	0.44	0.80722	D	1	B	0.28439	0.212	B	0.32677	0.15	T	0.26258	-1.0108	10	0.09843	T	0.71	-23.2301	15.0074	0.71524	0.0:0.0:0.0:1.0	.	44	Q99570	PI3R4_HUMAN	R	44	ENSP00000349205:K44R	ENSP00000349205:K44R	K	-	2	0	PIK3R4	131946622	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	6.222000	0.72249	2.014000	0.59158	0.459000	0.35465	AAG	.	.		0.423	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
ATP2C1	27032	hgsc.bcm.edu	37	3	130716555	130716555	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:130716555A>G	ENST00000510168.1	+	25	2899	c.2349A>G	c.(2347-2349)tcA>tcG	p.S783S	ATP2C1_ENST00000504381.1_Silent_p.S728S|ATP2C1_ENST00000507488.2_Silent_p.S767S|ATP2C1_ENST00000428331.2_Silent_p.S783S|ATP2C1_ENST00000504948.1_Silent_p.S767S|ATP2C1_ENST00000508532.1_Silent_p.S783S|ATP2C1_ENST00000328560.8_Silent_p.S783S|ATP2C1_ENST00000359644.3_Silent_p.S783S|ATP2C1_ENST00000422190.2_Silent_p.S783S|ATP2C1_ENST00000513801.1_Silent_p.S767S|ATP2C1_ENST00000393221.4_Silent_p.S817S|ATP2C1_ENST00000505330.1_Silent_p.S767S|ATP2C1_ENST00000533801.2_Silent_p.S778S			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	783					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TTGTTTCATCAATAATCATTG	0.363									Hailey-Hailey disease																												p.S817S	Esophageal Squamous(99;456 1443 27647 34099 42636)	Atlas-SNP	.											.	ATP2C1	94	.	0			c.A2451G						.						169.0	176.0	174.0					3																	130716555		2203	4300	6503	SO:0001819	synonymous_variant	27032	exon24	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	TTCATCAATAATC	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.2349A>G	chr3.hg19:g.130716555A>G		118.0	0.0		97.0	4.0	NM_001199181	B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Silent	SNP	ENST00000510168.1	hg19	CCDS46914.1	.	.	.	.	.	.	.	.	.	.	A	9.760	1.169801	0.21621	.	.	ENSG00000017260	ENST00000504612;ENST00000508660	.	.	.	5.73	-3.52	0.04682	.	.	.	.	.	T	0.38585	0.1046	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35076	-0.9803	4	.	.	.	.	1.8669	0.03200	0.2513:0.384:0.178:0.1867	.	.	.	.	R	737;301	.	.	Q	+	2	0	ATP2C1	132199245	0.736000	0.28164	0.982000	0.44146	0.969000	0.65631	-0.002000	0.12924	-0.428000	0.07339	-1.271000	0.01417	CAA	.	.		0.363	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356648.2	NM_001001486	
SLC25A36	55186	hgsc.bcm.edu	37	3	140692752	140692752	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:140692752A>G	ENST00000324194.6	+	6	815	c.647A>G	c.(646-648)gAt>gGt	p.D216G	SLC25A36_ENST00000446041.2_Missense_Mutation_p.D216G|SLC25A36_ENST00000453248.2_Missense_Mutation_p.D190G|RP11-231L11.3_ENST00000513802.1_RNA			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	216				D -> G (in Ref. 1; BAA91715). {ECO:0000305}.	response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						ATGGAAAATGATGAAGAGTCT	0.358																																					p.D216G		Atlas-SNP	.											.	SLC25A36	24	.	0			c.A647G						.						68.0	69.0	68.0					3																	140692752		2203	4300	6503	SO:0001583	missense	55186	exon6			AAAATGATGAAGA	AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.647A>G	chr3.hg19:g.140692752A>G	ENSP00000320688:p.Asp216Gly	65.0	0.0		84.0	4.0	NM_018155	A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	Missense_Mutation	SNP	ENST00000324194.6	hg19	CCDS46927.1	.	.	.	.	.	.	.	.	.	.	A	10.50	1.366807	0.24771	.	.	ENSG00000114120	ENST00000446041;ENST00000324194;ENST00000453248	T;T;T	0.80393	-1.34;-1.35;-1.37	6.01	3.65	0.41850	Mitochondrial carrier domain (2);	0.327981	0.39407	N	0.001374	T	0.59059	0.2166	N	0.11284	0.12	0.47214	D	0.999355	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.002	T	0.43065	-0.9414	10	0.13853	T	0.58	-11.1626	7.8468	0.29431	0.8516:0.0:0.1484:0.0	.	190;216;216	B4DL01;Q96CQ1-3;Q96CQ1	.;.;S2536_HUMAN	G	216;216;190	ENSP00000401938:D216G;ENSP00000320688:D216G;ENSP00000391521:D190G	ENSP00000320688:D216G	D	+	2	0	SLC25A36	142175442	1.000000	0.71417	0.730000	0.30809	0.917000	0.54804	3.237000	0.51344	0.533000	0.28675	0.528000	0.53228	GAT	.	.		0.358	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359929.1	NM_018155	
MME	4311	hgsc.bcm.edu	37	3	154802054	154802054	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:154802054T>C	ENST00000460393.1	+	2	218	c.98T>C	c.(97-99)gTc>gCc	p.V33A	MME_ENST00000492661.1_Missense_Mutation_p.V33A|MME_ENST00000493237.1_Missense_Mutation_p.V33A|MME_ENST00000382989.3_Missense_Mutation_p.V33A|MME_ENST00000360490.2_Missense_Mutation_p.V33A|MME_ENST00000462745.1_Missense_Mutation_p.V33A	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	33					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	AGCCTCTCGGTCCTTGTCCTG	0.478																																					p.V33A		Atlas-SNP	.											.	MME	133	.	0			c.T98C						.						186.0	174.0	178.0					3																	154802054		2203	4300	6503	SO:0001583	missense	4311	exon2			TCTCGGTCCTTGT		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.98T>C	chr3.hg19:g.154802054T>C	ENSP00000418525:p.Val33Ala	225.0	0.0		198.0	8.0	NM_007287	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	hg19	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.025968	0.75390	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000481828;ENST00000382989;ENST00000462745;ENST00000493237;ENST00000360490;ENST00000491026;ENST00000473730;ENST00000462837	D;D;D;D;D;D;D;D;D	0.93366	-1.71;-1.71;-2.11;-1.71;-1.71;-1.71;-3.21;-3.16;-2.78	5.27	5.27	0.74061	.	0.147680	0.48767	D	0.000162	D	0.91600	0.7346	M	0.62723	1.935	0.40833	D	0.9836	P	0.41450	0.75	B	0.38683	0.279	D	0.92499	0.6007	10	0.59425	D	0.04	-20.1127	13.7325	0.62797	0.0:0.0:0.0:1.0	.	33	P08473	NEP_HUMAN	A	33	ENSP00000420389:V33A;ENSP00000418525:V33A;ENSP00000420101:V33A;ENSP00000419653:V33A;ENSP00000417079:V33A;ENSP00000353679:V33A;ENSP00000418791:V33A;ENSP00000420542:V33A;ENSP00000417595:V33A	ENSP00000353679:V33A	V	+	2	0	MME	156284748	1.000000	0.71417	0.939000	0.37840	0.899000	0.52679	3.796000	0.55507	2.126000	0.65437	0.482000	0.46254	GTC	.	.		0.478	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
MCCC1	56922	hgsc.bcm.edu	37	3	182751790	182751790	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:182751790T>C	ENST00000265594.4	-	14	1816	c.1670A>G	c.(1669-1671)gAt>gGt	p.D557G	MCCC1_ENST00000492597.1_Missense_Mutation_p.D448G|MCCC1_ENST00000489909.1_5'UTR|MCCC1_ENST00000539926.1_Missense_Mutation_p.D422G	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	557					biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	GTTTTTACCATCTTTAAGAGT	0.323																																					p.D557G		Atlas-SNP	.											.	MCCC1	87	.	0			c.A1670G						.						82.0	85.0	84.0					3																	182751790		2203	4300	6503	SO:0001583	missense	56922	exon14			TTACCATCTTTAA	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1670A>G	chr3.hg19:g.182751790T>C	ENSP00000265594:p.Asp557Gly	98.0	0.0		89.0	6.0	NM_020166	Q59ES4|Q9H959|Q9NS97	Missense_Mutation	SNP	ENST00000265594.4	hg19	CCDS3241.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.561956	0.27915	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616;ENST00000539926;ENST00000476176	D;D;D;D	0.95656	-3.77;-3.71;-3.57;-3.48	5.39	4.24	0.50183	.	0.285828	0.39083	N	0.001476	D	0.92227	0.7535	L	0.56769	1.78	0.38053	D	0.93582	P;B;B	0.37122	0.583;0.164;0.001	B;B;B	0.33750	0.169;0.118;0.002	D	0.89555	0.3802	10	0.25751	T	0.34	.	10.4088	0.44280	0.0:0.078:0.0:0.922	.	510;448;557	E9PG35;E9PHF7;Q96RQ3	.;.;MCCA_HUMAN	G	557;448;407;422;510	ENSP00000265594:D557G;ENSP00000419898:D448G;ENSP00000441253:D422G;ENSP00000420433:D510G	ENSP00000265594:D557G	D	-	2	0	MCCC1	184234484	1.000000	0.71417	0.942000	0.38095	0.630000	0.37929	3.451000	0.52964	0.892000	0.36259	0.482000	0.46254	GAT	.	.		0.323	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	
PIGZ	80235	hgsc.bcm.edu	37	3	196674726	196674726	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:196674726A>G	ENST00000412723.1	-	3	1188	c.1042T>C	c.(1042-1044)Tct>Cct	p.S348P		NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	348					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		ATTTGTGCAGAGGCCTGGAGG	0.652																																					p.S348P		Atlas-SNP	.											.	PIGZ	34	.	0			c.T1042C						.						48.0	57.0	54.0					3																	196674726		2203	4299	6502	SO:0001583	missense	80235	exon3			GTGCAGAGGCCTG	BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.1042T>C	chr3.hg19:g.196674726A>G	ENSP00000413405:p.Ser348Pro	104.0	0.0		86.0	4.0	NM_025163	Q9H9G6	Missense_Mutation	SNP	ENST00000412723.1	hg19	CCDS3324.1	.	.	.	.	.	.	.	.	.	.	A	4.739	0.137419	0.09032	.	.	ENSG00000119227	ENST00000412723	T	0.12255	2.7	4.65	2.18	0.27775	.	1.037100	0.07610	N	0.925248	T	0.10252	0.0251	N	0.21194	0.64	0.09310	N	0.999999	P	0.38677	0.642	B	0.42163	0.378	T	0.30119	-0.9989	10	0.37606	T	0.19	-0.0476	1.6041	0.02680	0.5587:0.1646:0.0942:0.1825	.	348	Q86VD9	PIGZ_HUMAN	P	348	ENSP00000413405:S348P	ENSP00000413405:S348P	S	-	1	0	PIGZ	198159123	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.185000	0.09684	0.359000	0.24239	0.459000	0.35465	TCT	.	.		0.652	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163	
NELFA	7469	hgsc.bcm.edu	37	4	1993397	1993397	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:1993397A>C	ENST00000411638.2	-	2	271	c.256T>G	c.(256-258)Tcg>Gcg	p.S86A	NELFA_ENST00000382882.3_Missense_Mutation_p.S97A|NELFA_ENST00000542778.1_Intron	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	86					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										CAGGGGTCCGAGTCGAGGCTG	0.602																																					p.S97A		Atlas-SNP	.											.	.	.	.	0			c.T289G						.						111.0	120.0	117.0					4																	1993397		2203	4300	6503	SO:0001583	missense	7469	exon2			GGTCCGAGTCGAG	AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.256T>G	chr4.hg19:g.1993397A>C	ENSP00000399165:p.Ser86Ala	121.0	0.0		133.0	45.0	NM_005663	A2A2T1|O95392	Missense_Mutation	SNP	ENST00000411638.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.29	3.351947	0.61183	.	.	ENSG00000185049	ENST00000382882;ENST00000416258;ENST00000411638;ENST00000431323;ENST00000455762	T;T;T;T	0.49432	1.52;0.78;1.52;1.52	5.18	5.18	0.71444	.	0.061993	0.64402	D	0.000002	T	0.40694	0.1127	L	0.52126	1.63	0.80722	D	1	B	0.31817	0.341	B	0.28305	0.088	T	0.41502	-0.9505	10	0.62326	D	0.03	-23.6281	10.2797	0.43532	0.9223:0.0:0.0777:0.0	.	86	Q9H3P2	NELFA_HUMAN	A	97;90;86;102;16	ENSP00000372335:S97A;ENSP00000387647:S90A;ENSP00000399165:S86A;ENSP00000395761:S102A	ENSP00000372335:S97A	S	-	1	0	WHSC2	1963195	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.180000	0.65048	1.955000	0.56771	0.379000	0.24179	TCG	.	.		0.602	NELFA-015	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000473007.1	NM_005663	
ZFYVE28	57732	hgsc.bcm.edu	37	4	2306482	2306482	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:2306482A>G	ENST00000290974.2	-	8	1924	c.1585T>C	c.(1585-1587)Tct>Cct	p.S529P	ZFYVE28_ENST00000515312.1_Missense_Mutation_p.S459P|ZFYVE28_ENST00000511071.1_Missense_Mutation_p.S499P|RP11-478C1.7_ENST00000510632.1_RNA	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	529					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GCGACCGCAGAGTCCAGGGAA	0.657																																					p.S529P		Atlas-SNP	.											.	ZFYVE28	79	.	0			c.T1585C						.						36.0	40.0	39.0					4																	2306482		2200	4284	6484	SO:0001583	missense	57732	exon8			CCGCAGAGTCCAG	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.1585T>C	chr4.hg19:g.2306482A>G	ENSP00000290974:p.Ser529Pro	93.0	0.0		87.0	4.0	NM_020972	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	ENST00000290974.2	hg19	CCDS33942.1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.791366	0.50102	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	T;T;T	0.60040	0.24;0.22;0.24	3.81	-4.14	0.03892	.	1.410490	0.04189	N	0.327910	T	0.54631	0.1870	M	0.64997	1.995	0.09310	N	1	B;P	0.51351	0.002;0.944	B;P	0.47346	0.002;0.544	T	0.53129	-0.8482	10	0.44086	T	0.13	.	3.346	0.07136	0.3769:0.4099:0.0808:0.1324	.	499;529	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	P	529;499;459	ENSP00000290974:S529P;ENSP00000425706:S499P;ENSP00000426299:S459P	ENSP00000290974:S529P	S	-	1	0	ZFYVE28	2276280	0.484000	0.25964	0.000000	0.03702	0.018000	0.09664	0.394000	0.20834	-1.030000	0.03312	0.254000	0.18369	TCT	.	.		0.657	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
MSX1	4487	hgsc.bcm.edu	37	4	4864457	4864457	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:4864457C>T	ENST00000382723.4	+	2	733	c.499C>T	c.(499-501)Cgc>Tgc	p.R167C	MSX1_ENST00000468421.1_3'UTR	NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	167					activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CTGCACCCTCCGCAAACACAA	0.597																																					p.R167C		Atlas-SNP	.											.	MSX1	19	.	0			c.C499T						.						61.0	78.0	72.0					4																	4864457		2191	4269	6460	SO:0001583	missense	4487	exon2			ACCCTCCGCAAAC	M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.499C>T	chr4.hg19:g.4864457C>T	ENSP00000372170:p.Arg167Cys	83.0	0.0		88.0	36.0	NM_002448	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	ENST00000382723.4	hg19	CCDS3378.2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129346	0.77549	.	.	ENSG00000163132	ENST00000382723	D	0.95171	-3.63	4.96	4.96	0.65561	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97129	0.9062	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.97515	1.0069	10	0.87932	D	0	-10.6849	13.2139	0.59844	0.1593:0.8407:0.0:0.0	.	161	P28360	MSX1_HUMAN	C	167	ENSP00000372170:R167C	ENSP00000372170:R167C	R	+	1	0	MSX1	4915358	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	1.396000	0.34531	2.456000	0.83038	0.462000	0.41574	CGC	.	.		0.597	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206700.3		
CPEB2	132864	hgsc.bcm.edu	37	4	15060074	15060074	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:15060074A>G	ENST00000507071.1	+	8	1243	c.1156A>G	c.(1156-1158)Agc>Ggc	p.S386G	CPEB2_ENST00000541112.1_Missense_Mutation_p.S823G|CPEB2_ENST00000538197.1_Missense_Mutation_p.S831G|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000259997.5_Missense_Mutation_p.S394G|CPEB2_ENST00000345451.3_Missense_Mutation_p.S356G|CPEB2_ENST00000382401.3_Missense_Mutation_p.S359G|CPEB2_ENST00000382395.3_Missense_Mutation_p.S364G|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000442003.2_Missense_Mutation_p.S804G			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	386	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						TCAAGAAGAGAGCTCAGTTCA	0.363																																					p.S831G		Atlas-SNP	.											.	CPEB2	77	.	0			c.A2491G						.						143.0	145.0	144.0					4																	15060074		2203	4300	6503	SO:0001583	missense	132864	exon9			GAAGAGAGCTCAG	AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.1156A>G	chr4.hg19:g.15060074A>G	ENSP00000424084:p.Ser386Gly	126.0	0.0		129.0	6.0	NM_001177382	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Missense_Mutation	SNP	ENST00000507071.1	hg19		.	.	.	.	.	.	.	.	.	.	A	18.61	3.660210	0.67586	.	.	ENSG00000137449	ENST00000538197;ENST00000541112;ENST00000442003;ENST00000507071;ENST00000345451;ENST00000382395;ENST00000382401;ENST00000259997;ENST00000382391;ENST00000509684	T;T;T;T;T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32	5.76	5.76	0.90799	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.227041	0.56097	D	0.000039	T	0.09291	0.0229	N	0.25789	0.76	0.54753	D	0.999982	B;B;B;B;B;B	0.32245	0.164;0.001;0.01;0.028;0.001;0.361	B;B;B;B;B;B	0.41374	0.134;0.001;0.018;0.04;0.001;0.355	T	0.23691	-1.0181	10	0.62326	D	0.03	-10.5656	16.0607	0.80836	1.0:0.0:0.0:0.0	.	359;364;804;831;356;386	Q7Z5Q1-4;Q7Z5Q1-6;E7EPM3;F5H160;Q7Z5Q1-5;Q7Z5Q1	.;.;.;.;.;CPEB2_HUMAN	G	831;823;804;386;356;364;359;394;373;39	ENSP00000443985:S831G;ENSP00000437884:S823G;ENSP00000414270:S804G;ENSP00000424084:S386G;ENSP00000334058:S356G;ENSP00000371832:S364G;ENSP00000371838:S359G;ENSP00000259997:S394G;ENSP00000423890:S39G	ENSP00000259997:S394G	S	+	1	0	CPEB2	14669172	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.200000	0.70718	0.477000	0.44152	AGC	.	.		0.363	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000207349.2	XM_059607	
STIM2	57620	hgsc.bcm.edu	37	4	27000885	27000885	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:27000885T>C	ENST00000467011.1	+	5	966	c.541T>C	c.(541-543)Tcc>Ccc	p.S181P	STIM2_ENST00000382009.3_Missense_Mutation_p.S268P|STIM2_ENST00000467087.1_Missense_Mutation_p.S181P|STIM2_ENST00000465503.1_Missense_Mutation_p.S181P|STIM2_ENST00000412829.2_Missense_Mutation_p.S268P|STIM2_ENST00000237364.5_Missense_Mutation_p.S268P	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	181	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				ATTTATGATCTCCCAGTTGAA	0.343																																					p.S181P		Atlas-SNP	.											.	STIM2	77	.	0			c.T541C						.						114.0	104.0	108.0					4																	27000885		2203	4300	6503	SO:0001583	missense	57620	exon5			ATGATCTCCCAGT	AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.541T>C	chr4.hg19:g.27000885T>C	ENSP00000419383:p.Ser181Pro	83.0	0.0		96.0	4.0	NM_001169118	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	ENST00000467011.1	hg19	CCDS54752.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.480216	0.63849	.	.	ENSG00000109689	ENST00000467087;ENST00000382009;ENST00000237364;ENST00000467011;ENST00000412829;ENST00000465503	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.77	4.56	0.56223	.	0.386184	0.31370	N	0.007774	T	0.48114	0.1482	M	0.62723	1.935	0.25619	N	0.986428	P;P;P	0.45176	0.852;0.809;0.773	P;P;B	0.47134	0.539;0.539;0.404	T	0.46735	-0.9170	10	0.72032	D	0.01	.	12.3285	0.55024	0.1268:0.0:0.0:0.8732	.	268;268;268	A6H8L7;E9PGD0;F5GXJ4	.;.;.	P	181;268;268;181;268;181	ENSP00000419073:S181P;ENSP00000371439:S268P;ENSP00000237364:S268P;ENSP00000419383:S181P;ENSP00000404812:S268P;ENSP00000417569:S181P	ENSP00000237364:S268P	S	+	1	0	STIM2	26609983	0.000000	0.05858	0.888000	0.34837	0.981000	0.71138	0.295000	0.19065	1.076000	0.40961	0.533000	0.62120	TCC	.	.		0.343	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000356861.1	NM_020860	
GABRA2	2555	hgsc.bcm.edu	37	4	46312234	46312234	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:46312234T>C	ENST00000510861.1	-	6	688	c.515A>G	c.(514-516)gAt>gGt	p.D172G	GABRA2_ENST00000514090.1_Missense_Mutation_p.D172G|GABRA2_ENST00000381620.4_Missense_Mutation_p.D172G|GABRA2_ENST00000540012.1_Missense_Mutation_p.D117G|GABRA2_ENST00000507069.1_Missense_Mutation_p.D172G|GABRA2_ENST00000515082.1_Missense_Mutation_p.D172G|GABRA2_ENST00000356504.1_Missense_Mutation_p.D172G			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	172					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CATTGGGAAATCCTCCAAGTG	0.383																																					p.D172G		Atlas-SNP	.											.	GABRA2	134	.	0			c.A515G						.						136.0	133.0	134.0					4																	46312234		2203	4300	6503	SO:0001583	missense	2555	exon6			GGGAAATCCTCCA		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.515A>G	chr4.hg19:g.46312234T>C	ENSP00000421828:p.Asp172Gly	124.0	0.0		109.0	5.0	NM_000807	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	hg19	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.909925	0.92107	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12	5.9	5.9	0.94986	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.89487	0.6729	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	0.997;0.982;1.0	D;P;D	0.97110	0.976;0.879;1.0	D	0.91083	0.4901	10	0.72032	D	0.01	.	15.5133	0.75802	0.0:0.0:0.0:1.0	.	117;172;172	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	G	172;172;172;172;117;172;172	ENSP00000421828:D172G;ENSP00000421300:D172G;ENSP00000371033:D172G;ENSP00000348897:D172G;ENSP00000444409:D117G;ENSP00000427603:D172G;ENSP00000423840:D172G	ENSP00000348897:D172G	D	-	2	0	GABRA2	46006991	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.021000	0.88750	2.251000	0.74343	0.528000	0.53228	GAT	.	.		0.383	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		
ATP10D	57205	hgsc.bcm.edu	37	4	47559792	47559792	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:47559792A>G	ENST00000273859.3	+	12	2205	c.1936A>G	c.(1936-1938)Aaa>Gaa	p.K646E	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	646					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TAACAGTGGGAAAGAGCCATC	0.483																																					p.K646E		Atlas-SNP	.											.	ATP10D	168	.	0			c.A1936G						.						72.0	77.0	76.0					4																	47559792		2203	4300	6503	SO:0001583	missense	57205	exon12			AGTGGGAAAGAGC	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1936A>G	chr4.hg19:g.47559792A>G	ENSP00000273859:p.Lys646Glu	83.0	0.0		72.0	4.0	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	hg19	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	A	11.15	1.555392	0.27739	.	.	ENSG00000145246	ENST00000273859	T	0.38722	1.12	5.48	5.48	0.80851	HAD-like domain (1);	0.361702	0.31041	N	0.008375	T	0.40297	0.1111	L	0.59436	1.845	0.80722	D	1	B	0.25904	0.137	B	0.30401	0.115	T	0.23904	-1.0175	10	0.09843	T	0.71	-17.6818	14.7444	0.69480	1.0:0.0:0.0:0.0	.	646	Q9P241	AT10D_HUMAN	E	646	ENSP00000273859:K646E	ENSP00000273859:K646E	K	+	1	0	ATP10D	47254549	1.000000	0.71417	0.915000	0.36163	0.014000	0.08584	6.471000	0.73562	2.085000	0.62840	0.459000	0.35465	AAA	.	.		0.483	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
FRAS1	80144	hgsc.bcm.edu	37	4	79186220	79186220	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:79186220G>T	ENST00000325942.6	+	7	1085	c.645G>T	c.(643-645)caG>caT	p.Q215H	FRAS1_ENST00000264899.6_Missense_Mutation_p.Q215H|FRAS1_ENST00000264895.6_Missense_Mutation_p.Q215H	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	215	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GTTGCCCGCAGTGCTCTGCAA	0.478																																					p.Q215H		Atlas-SNP	.											.	FRAS1	779	.	0			c.G645T						.						92.0	96.0	95.0					4																	79186220		2040	4173	6213	SO:0001583	missense	80144	exon7			CCCGCAGTGCTCT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.645G>T	chr4.hg19:g.79186220G>T	ENSP00000326330:p.Gln215His	97.0	0.0		98.0	6.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.77|15.77|15.77	2.932689|2.932689|2.932689	0.52866|0.52866|0.52866	.|.|.	.|.|.	ENSG00000138759|ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000264899;ENST00000380674|ENST00000502446|ENST00000508900	T;T;T|.|.	0.72835|.|.	-0.69;-0.69;-0.69|.|.	5.14|5.14|5.14	4.3|4.3|4.3	0.51218|0.51218|0.51218	.|.|.	0.292426|.|.	0.34555|.|.	N|.|.	0.003874|.|.	T|T|T	0.47525|0.47525|0.47525	0.1450|0.1450|0.1450	L|L|L	0.38838|0.38838|0.38838	1.175|1.175|1.175	0.37974|0.37974|0.37974	D|D|D	0.933399|0.933399|0.933399	P;P|.|.	0.49961|.|.	0.93;0.93|.|.	P;P|.|.	0.59948|.|.	0.866;0.866|.|.	T|T|T	0.48822|0.48822|0.48822	-0.9001|-0.9001|-0.9001	10|5|5	0.72032|.|.	D|.|.	0.01|.|.	.|.|.	8.6603|8.6603|8.6603	0.34088|0.34088|0.34088	0.2143:0.0:0.7857:0.0|0.2143:0.0:0.7857:0.0|0.2143:0.0:0.7857:0.0	.|.|.	215;215|.|.	E9PHH6;A2RRR8|.|.	.;.|.|.	H|I|L	215|144|58	ENSP00000326330:Q215H;ENSP00000264895:Q215H;ENSP00000264899:Q215H|.|.	ENSP00000264895:Q215H|.|.	Q|S|V	+|+|+	3|2|1	2|0|0	FRAS1|FRAS1|FRAS1	79405244|79405244|79405244	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.365000|0.365000|0.365000	0.29674|0.29674|0.29674	2.956000|2.956000|2.956000	0.49129|0.49129|0.49129	1.540000|1.540000|1.540000	0.49301|0.49301|0.49301	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	CAG|AGT|GTG	.	.		0.478	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
ANXA3	306	hgsc.bcm.edu	37	4	79512700	79512700	+	Missense_Mutation	SNP	T	T	C	rs376948856		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:79512700T>C	ENST00000264908.6	+	7	785	c.406T>C	c.(406-408)Tac>Cac	p.Y136H	ANXA3_ENST00000512884.1_Missense_Mutation_p.Y97H|ANXA3_ENST00000503570.2_Missense_Mutation_p.Y97H	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	136					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						GGTTTCAGTATACAAGAAGAG	0.333																																					p.Y136H	GBM(2;126 157 27790 28920 42492)	Atlas-SNP	.											.	ANXA3	35	.	0			c.T406C						.	T	HIS/TYR	0,4406		0,0,2203	110.0	114.0	112.0		406	3.8	0.2	4		112	1,8599	1.2+/-3.3	0,1,4299	no	missense	ANXA3	NM_005139.2	83	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	136/324	79512700	1,13005	2203	4300	6503	SO:0001583	missense	306	exon7			TCAGTATACAAGA	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.406T>C	chr4.hg19:g.79512700T>C	ENSP00000264908:p.Tyr136His	101.0	0.0		84.0	4.0	NM_005139	B2R9W6|Q6LET2	Missense_Mutation	SNP	ENST00000264908.6	hg19	CCDS3584.1	.	.	.	.	.	.	.	.	.	.	T	17.45	3.392335	0.62066	0.0	1.16E-4	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570;ENST00000514171	T;T;T;T	0.04862	3.54;3.54;3.54;3.54	4.95	3.76	0.43208	Annexin repeat, conserved site (1);	0.282328	0.33916	N	0.004437	T	0.20170	0.0485	M	0.70595	2.14	0.40556	D	0.981166	D	0.55605	0.972	D	0.68192	0.956	T	0.00425	-1.1747	10	0.59425	D	0.04	.	9.6492	0.39886	0.0:0.0836:0.0:0.9164	.	136	P12429	ANXA3_HUMAN	H	136;97;97;136	ENSP00000264908:Y136H;ENSP00000423068:Y97H;ENSP00000421015:Y97H;ENSP00000421512:Y136H	ENSP00000264908:Y136H	Y	+	1	0	ANXA3	79731724	0.998000	0.40836	0.174000	0.22961	0.982000	0.71751	3.487000	0.53222	0.905000	0.36596	0.477000	0.44152	TAC	.	.		0.333	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139	
SEC31A	22872	hgsc.bcm.edu	37	4	83791555	83791555	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:83791555T>C	ENST00000395310.2	-	8	987	c.805A>G	c.(805-807)Agc>Ggc	p.S269G	SEC31A_ENST00000513858.1_Missense_Mutation_p.S269G|SEC31A_ENST00000326950.5_Missense_Mutation_p.S269G|SEC31A_ENST00000505472.1_Missense_Mutation_p.S269G|SEC31A_ENST00000508479.1_Missense_Mutation_p.S269G|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000505984.1_Missense_Mutation_p.S269G|SEC31A_ENST00000264405.5_Missense_Mutation_p.S41G|SEC31A_ENST00000311785.7_Missense_Mutation_p.S269G|SEC31A_ENST00000348405.4_Missense_Mutation_p.S269G|SEC31A_ENST00000500777.2_Missense_Mutation_p.S269G|SEC31A_ENST00000443462.2_Missense_Mutation_p.S264G|SEC31A_ENST00000448323.1_Missense_Mutation_p.S269G|SEC31A_ENST00000508502.1_Missense_Mutation_p.S269G|SEC31A_ENST00000509142.1_Missense_Mutation_p.S269G|SEC31A_ENST00000432794.1_Missense_Mutation_p.S269G|SEC31A_ENST00000355196.2_Missense_Mutation_p.S269G	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	269	Interaction with SEC13.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				TCTGCCATGCTCCAAGCAATT	0.393																																					p.S269G		Atlas-SNP	.											.	SEC31A	227	.	0			c.A805G						.						146.0	132.0	136.0					4																	83791555		2203	4300	6503	SO:0001583	missense	22872	exon8			CCATGCTCCAAGC	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.805A>G	chr4.hg19:g.83791555T>C	ENSP00000378721:p.Ser269Gly	70.0	0.0		77.0	4.0	NM_001077206	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	ENST00000395310.2	hg19	CCDS3596.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.073830	0.76415	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.72942	1.6;1.6;1.6;1.08;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;-0.7;1.6;1.6	5.08	5.08	0.68730	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84973	0.5591	M	0.84948	2.725	0.80722	D	1	D;D;D;D;D;D;D;D;D;B	0.71674	0.992;0.987;0.99;0.998;0.99;0.967;0.996;0.996;0.99;0.438	P;P;D;D;D;P;D;D;P;B	0.83275	0.897;0.869;0.979;0.996;0.921;0.839;0.937;0.99;0.897;0.358	D	0.86029	0.1512	10	0.42905	T	0.14	-14.2828	15.1495	0.72687	0.0:0.0:0.0:1.0	.	264;269;269;269;269;269;269;269;269;41	B4DIW6;B7ZL00;O94979-5;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7	.;.;.;.;.;.;.;.;SC31A_HUMAN;.	G	269;269;269;264;269;269;269;269;269;269;269;269;269;41;269;269	ENSP00000337602:S269G;ENSP00000426886:S269G;ENSP00000378721:S269G;ENSP00000408027:S264G;ENSP00000426569:S269G;ENSP00000407944:S269G;ENSP00000400926:S269G;ENSP00000325087:S269G;ENSP00000309070:S269G;ENSP00000421633:S269G;ENSP00000421464:S269G;ENSP00000424635:S269G;ENSP00000347329:S269G;ENSP00000264405:S41G;ENSP00000424451:S269G;ENSP00000425999:S269G	ENSP00000264405:S41G	S	-	1	0	SEC31A	84010579	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.943000	0.70211	2.027000	0.59764	0.454000	0.30748	AGC	.	.		0.393	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	
HELQ	113510	hgsc.bcm.edu	37	4	84368176	84368176	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:84368176A>G	ENST00000295488.3	-	4	1366	c.1204T>C	c.(1204-1206)Tca>Cca	p.S402P	HELQ_ENST00000510985.1_Intron	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	402	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						CCAAAACTTGACAAACCTGAA	0.388								Other identified genes with known or suspected DNA repair function																													p.S402P		Atlas-SNP	.											.	HELQ	95	.	0			c.T1204C						.						33.0	32.0	33.0					4																	84368176		2203	4300	6503	SO:0001583	missense	113510	exon4			AACTTGACAAACC	AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.1204T>C	chr4.hg19:g.84368176A>G	ENSP00000295488:p.Ser402Pro	95.0	0.0		95.0	4.0	NM_133636	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	ENST00000295488.3	hg19	CCDS3603.1	.	.	.	.	.	.	.	.	.	.	A	16.78	3.216941	0.58452	.	.	ENSG00000163312	ENST00000295488	T	0.15718	2.4	5.44	5.44	0.79542	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.266906	0.37577	N	0.002038	T	0.48537	0.1505	M	0.92268	3.29	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	T	0.57236	-0.7846	10	0.48119	T	0.1	-32.4597	11.7528	0.51857	0.853:0.147:0.0:0.0	.	402	Q8TDG4	HELQ_HUMAN	P	402	ENSP00000295488:S402P	ENSP00000295488:S402P	S	-	1	0	HELQ	84587200	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	3.985000	0.56930	2.187000	0.69744	0.477000	0.44152	TCA	.	.		0.388	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252810.1	NM_133636	
WDFY3	23001	hgsc.bcm.edu	37	4	85722810	85722810	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:85722810C>A	ENST00000295888.4	-	17	3222	c.2815G>T	c.(2815-2817)Gtg>Ttg	p.V939L	WDFY3_ENST00000322366.6_Missense_Mutation_p.V939L|WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000512267.1_5'Flank	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	939					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TACCTCAACACCATGGGTTCC	0.473																																					p.V939L		Atlas-SNP	.											WDFY3,NS,carcinoma,0,1	WDFY3	314	.	0			c.G2815T						.						116.0	119.0	118.0					4																	85722810		2203	4300	6503	SO:0001583	missense	23001	exon17			TCAACACCATGGG	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2815G>T	chr4.hg19:g.85722810C>A	ENSP00000295888:p.Val939Leu	45.0	0.0		47.0	2.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.421944	0.62622	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.44482	0.92;0.92	5.95	5.95	0.96441	.	0.109140	0.64402	D	0.000007	T	0.46249	0.1383	L	0.58101	1.795	0.58432	D	0.999996	B	0.19583	0.037	B	0.19391	0.025	T	0.31971	-0.9924	10	0.54805	T	0.06	.	20.4024	0.99000	0.0:1.0:0.0:0.0	.	939	Q8IZQ1	WDFY3_HUMAN	L	939	ENSP00000318466:V939L;ENSP00000295888:V939L	ENSP00000295888:V939L	V	-	1	0	WDFY3	85941834	1.000000	0.71417	1.000000	0.80357	0.664000	0.39144	7.487000	0.81328	2.827000	0.97445	0.650000	0.86243	GTG	.	.		0.473	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
MTTP	4547	hgsc.bcm.edu	37	4	100532580	100532580	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:100532580C>T	ENST00000265517.5	+	14	2162	c.1959C>T	c.(1957-1959)taC>taT	p.Y653Y	MTTP_ENST00000457717.1_Silent_p.Y653Y|MTTP_ENST00000511045.1_Silent_p.Y680Y|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	653	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TCTTTCAGTACATTGGGAAGG	0.428																																					p.Y653Y		Atlas-SNP	.											.	MTTP	127	.	0			c.C1959T						.						170.0	155.0	160.0					4																	100532580		2203	4300	6503	SO:0001819	synonymous_variant	4547	exon15			TCAGTACATTGGG		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1959C>T	chr4.hg19:g.100532580C>T		144.0	0.0		142.0	68.0	NM_000253	A8K428|Q08AM4|Q6P5T3	Silent	SNP	ENST00000265517.5	hg19	CCDS3651.1																																																																																			.	.		0.428	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
SGMS2	166929	hgsc.bcm.edu	37	4	108817100	108817100	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:108817100T>C	ENST00000394684.4	+	3	948	c.391T>C	c.(391-393)Tca>Cca	p.S131P	RP11-286E11.1_ENST00000513071.1_RNA|RP11-286E11.1_ENST00000499098.1_RNA|SGMS2_ENST00000394686.3_Missense_Mutation_p.S131P|SGMS2_ENST00000359079.4_Missense_Mutation_p.S131P	NM_001136258.1	NP_001129730.1	Q8NHU3	SMS2_HUMAN	sphingomyelin synthase 2	131					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	Golgi apparatus (GO:0005794)|integral component of cell outer membrane (GO:0045203)|integral component of Golgi membrane (GO:0030173)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|liver(2)|lung(6)|prostate(1)	20				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)		ATTTTCTGTATCAGAAATAAA	0.403																																					p.S131P		Atlas-SNP	.											.	SGMS2	39	.	0			c.T391C						.						83.0	90.0	88.0					4																	108817100		2203	4300	6503	SO:0001583	missense	166929	exon2			TCTGTATCAGAAA	BC041369	CCDS3677.1	4q25	2008-02-05			ENSG00000164023	ENSG00000164023	2.7.8.27		28395	protein-coding gene	gene with protein product		611574				14685263	Standard	NM_152621		Approved	MGC26963, SMS2	uc003hyl.4	Q8NHU3	OTTHUMG00000131811	ENST00000394684.4:c.391T>C	chr4.hg19:g.108817100T>C	ENSP00000378176:p.Ser131Pro	109.0	0.0		121.0	5.0	NM_001136257	A8K2S9|B2RA61	Missense_Mutation	SNP	ENST00000394684.4	hg19	CCDS3677.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.145026	0.77888	.	.	ENSG00000164023	ENST00000394684;ENST00000359079;ENST00000394686	T;T;T	0.49432	0.78;0.78;0.78	5.49	5.49	0.81192	.	0.056268	0.64402	D	0.000001	T	0.44871	0.1314	L	0.52905	1.665	0.58432	D	0.999997	P	0.43477	0.808	B	0.39027	0.288	T	0.41484	-0.9506	9	.	.	.	-26.5589	15.887	0.79258	0.0:0.0:0.0:1.0	.	131	Q8NHU3	SMS2_HUMAN	P	131	ENSP00000378176:S131P;ENSP00000351981:S131P;ENSP00000378178:S131P	.	S	+	1	0	SGMS2	109036549	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.093000	0.71422	2.208000	0.71279	0.533000	0.62120	TCA	.	.		0.403	SGMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254752.1	NM_152621	
HADH	3033	hgsc.bcm.edu	37	4	108940796	108940796	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:108940796C>T	ENST00000309522.3	+	4	669	c.520C>T	c.(520-522)Cca>Tca	p.P174S	HADH_ENST00000403312.1_Missense_Mutation_p.P233S|HADH_ENST00000454409.2_Missense_Mutation_p.P178S|HADH_ENST00000505878.1_Missense_Mutation_p.P178S|HADH_ENST00000603302.1_Missense_Mutation_p.P174S	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase	502					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		TTTCTTCAACCCAGTGCCTGT	0.507																																					p.P174S		Atlas-SNP	.											.	HADH	40	.	0			c.C520T						.						155.0	145.0	148.0					4																	108940796		2203	4300	6503	SO:0001583	missense	3033	exon4			TTCAACCCAGTGC	X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.520C>T	chr4.hg19:g.108940796C>T	ENSP00000312288:p.Pro174Ser	121.0	0.0		111.0	55.0	NM_005327	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000309522.3	hg19	CCDS3678.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090892	0.94149	.	.	ENSG00000138796	ENST00000403312;ENST00000309522;ENST00000505878;ENST00000454409	D;D;D	0.93604	-3.25;-3.25;-3.25	5.37	5.37	0.77165	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98488	0.9496	H	0.99475	4.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.99785	1.1029	10	0.87932	D	0	-12.7194	19.1228	0.93371	0.0:1.0:0.0:0.0	.	233;178;174	Q16836-2;E9PF18;Q16836	.;.;HCDH_HUMAN	S	174;174;178;178	ENSP00000312288:P174S;ENSP00000425952:P178S;ENSP00000395167:P178S	ENSP00000312288:P174S	P	+	1	0	HADH	109160245	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.818000	0.86416	2.505000	0.84491	0.655000	0.94253	CCA	.	.		0.507	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254750.2	NM_005327	
PDE5A	8654	hgsc.bcm.edu	37	4	120528278	120528278	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:120528278A>G	ENST00000354960.3	-	2	646	c.327T>C	c.(325-327)ccT>ccC	p.P109P	PDE5A_ENST00000264805.5_Silent_p.P67P|PDE5A_ENST00000394439.1_Silent_p.P57P	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	109					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	TGGGTCTAAGAGGCCGGTCAA	0.502																																					p.P109P		Atlas-SNP	.											.	PDE5A	83	.	0			c.T327C						.						86.0	85.0	85.0					4																	120528278		2203	4300	6503	SO:0001819	synonymous_variant	8654	exon2			TCTAAGAGGCCGG	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.327T>C	chr4.hg19:g.120528278A>G		75.0	0.0		76.0	4.0	NM_001083	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Silent	SNP	ENST00000354960.3	hg19	CCDS3713.1																																																																																			.	.		0.502	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	
FAT4	79633	hgsc.bcm.edu	37	4	126240400	126240400	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:126240400A>G	ENST00000394329.3	+	1	2847	c.2834A>G	c.(2833-2835)aAg>aGg	p.K945R		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	945	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATCAATGAAAAGAATGGCACT	0.478																																					p.K945R		Atlas-SNP	.											.	FAT4	1752	.	0			c.A2834G						.						62.0	65.0	64.0					4																	126240400		1940	4148	6088	SO:0001583	missense	79633	exon1			ATGAAAAGAATGG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.2834A>G	chr4.hg19:g.126240400A>G	ENSP00000377862:p.Lys945Arg	114.0	0.0		83.0	5.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	A	0.103	-1.149829	0.01714	.	.	ENSG00000196159	ENST00000394329	T	0.01767	4.65	5.1	2.57	0.30868	Cadherin (4);Cadherin-like (1);	0.830857	0.09651	N	0.773731	T	0.01523	0.0049	L	0.27975	0.815	0.80722	D	1	B	0.13594	0.008	B	0.16722	0.016	T	0.45498	-0.9257	10	0.15952	T	0.53	.	4.5503	0.12108	0.6999:0.0:0.1602:0.1399	.	945	Q6V0I7	FAT4_HUMAN	R	945	ENSP00000377862:K945R	ENSP00000377862:K945R	K	+	2	0	FAT4	126459850	1.000000	0.71417	0.993000	0.49108	0.040000	0.13550	3.401000	0.52601	0.372000	0.24591	0.533000	0.62120	AAG	.	.		0.478	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
SORBS2	8470	hgsc.bcm.edu	37	4	186567931	186567931	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:186567931T>C	ENST00000284776.7	-	10	1084	c.575A>G	c.(574-576)gAc>gGc	p.D192G	SORBS2_ENST00000418609.1_Missense_Mutation_p.D96G|SORBS2_ENST00000448662.2_Missense_Mutation_p.D261G|SORBS2_ENST00000431808.1_Missense_Mutation_p.D192G|SORBS2_ENST00000319471.9_Missense_Mutation_p.D278G|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000437304.2_Missense_Mutation_p.D371G|SORBS2_ENST00000355634.5_Missense_Mutation_p.D292G|SORBS2_ENST00000393528.3_Missense_Mutation_p.D238G|SORBS2_ENST00000449407.2_Missense_Mutation_p.D263G	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	192					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AGGATCCCAGTCATGCCTAGA	0.343																																					p.D371G	Esophageal Squamous(153;41 2433 9491 36028)	Atlas-SNP	.											.	SORBS2	300	.	0			c.A1112G						.						83.0	84.0	83.0					4																	186567931		2203	4300	6503	SO:0001583	missense	8470	exon11			TCCCAGTCATGCC		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.575A>G	chr4.hg19:g.186567931T>C	ENSP00000284776:p.Asp192Gly	75.0	0.0		69.0	4.0	NM_001145673	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	ENST00000284776.7	hg19	CCDS3845.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	21.2|21.2|21.2	4.118889|4.118889|4.118889	0.77323|0.77323|0.77323	.|.|.	.|.|.	ENSG00000154556|ENSG00000154556|ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454;ENST00000451974|ENST00000445625|ENST00000438278	T;T;T;T;T;T;T;T;T;T;T|.|.	0.34667|.|.	1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35;1.35|.|.	5.25|5.25|5.25	5.25|5.25|5.25	0.73442|0.73442|0.73442	.|.|.	0.048195|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.70193|0.70193|.	0.3196|0.3196|.	L|L|L	0.59436|0.59436|0.59436	1.845|1.845|1.845	0.46149|0.46149|0.46149	D|D|D	0.99889|0.99889|0.99889	P;D;D;P;D;D;D;D;D;P;D;D;P;P;D;D|.|.	0.76494|.|.	0.925;0.997;0.993;0.859;0.998;0.957;0.998;0.999;0.969;0.859;0.986;0.998;0.614;0.933;0.997;0.997|.|.	P;D;P;P;D;P;D;D;P;P;P;D;B;P;D;D|.|.	0.83275|.|.	0.665;0.942;0.9;0.665;0.991;0.709;0.978;0.996;0.818;0.665;0.872;0.987;0.347;0.461;0.96;0.942|.|.	T|T|.	0.69087|0.69087|.	-0.5238|-0.5238|.	10|5|.	0.59425|.|.	D|.|.	0.04|.|.	-34.503|-34.503|-34.503	15.324|15.324|15.324	0.74144|0.74144|0.74144	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	255;238;261;96;111;111;96;238;292;192;263;371;261;238;192;238|.|.	B7Z3D7;G3XAI0;C9JKV9;B7Z3X6;B7Z997;O94875-6;B3KPU4;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2|.|.	.;.;.;.;.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.|.|.	G|A|W	192;261;192;96;371;278;263;292;238;238;49|90|135	ENSP00000284776:D192G;ENSP00000409158:D261G;ENSP00000411764:D192G;ENSP00000397482:D96G;ENSP00000396008:D371G;ENSP00000322182:D278G;ENSP00000397262:D263G;ENSP00000347852:D292G;ENSP00000377162:D238G;ENSP00000321983:D238G;ENSP00000401818:D49G|.|.	ENSP00000284776:D192G|.|.	D|T|X	-|-|-	2|1|3	0|0|0	SORBS2|SORBS2|SORBS2	186804925|186804925|186804925	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	7.428000|7.428000|7.428000	0.80296|0.80296|0.80296	2.197000|2.197000|2.197000	0.70478|0.70478|0.70478	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAC|ACT|TGA	.	.		0.343	SORBS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347944.3	NM_003603	
FAT1	2195	hgsc.bcm.edu	37	4	187538165	187538165	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:187538165A>G	ENST00000441802.2	-	11	9278	c.9069T>C	c.(9067-9069)tgT>tgC	p.C3023C		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3023	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTACCTTTTCACAAACTGGAC	0.388										HNSCC(5;0.00058)																											p.C3023C	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.T9069C						.						200.0	176.0	184.0					4																	187538165		1928	4122	6050	SO:0001819	synonymous_variant	2195	exon11			CTTTTCACAAACT	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.9069T>C	chr4.hg19:g.187538165A>G		190.0	0.0		131.0	6.0	NM_005245		Silent	SNP	ENST00000441802.2	hg19	CCDS47177.1																																																																																			.	.		0.388	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
PDZD2	23037	hgsc.bcm.edu	37	5	32089623	32089623	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:32089623A>G	ENST00000438447.1	+	20	6457	c.6069A>G	c.(6067-6069)agA>agG	p.R2023R	PDZD2_ENST00000282493.3_Silent_p.R2023R			O15018	PDZD2_HUMAN	PDZ domain containing 2	2023					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CTAAGTGTAGAGCAGAGGGCA	0.627																																					p.R2023R		Atlas-SNP	.											.	PDZD2	306	.	0			c.A6069G						.						135.0	147.0	143.0					5																	32089623		2203	4300	6503	SO:0001819	synonymous_variant	23037	exon19			GTGTAGAGCAGAG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.6069A>G	chr5.hg19:g.32089623A>G		36.0	0.0		57.0	4.0	NM_178140	Q9BXD4	Silent	SNP	ENST00000438447.1	hg19	CCDS34137.1																																																																																			.	.		0.627	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
DHX29	54505	hgsc.bcm.edu	37	5	54563641	54563641	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:54563641C>T	ENST00000251636.5	-	22	3452	c.3304G>A	c.(3304-3306)Gct>Act	p.A1102T	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	1102						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				ATAACTGCAGCTAGTGTTGCC	0.353																																					p.A1102T		Atlas-SNP	.											.	DHX29	116	.	0			c.G3304A						.						103.0	88.0	93.0					5																	54563641		2203	4300	6503	SO:0001583	missense	54505	exon22			CTGCAGCTAGTGT	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.3304G>A	chr5.hg19:g.54563641C>T	ENSP00000251636:p.Ala1102Thr	66.0	0.0		68.0	32.0	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	hg19	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	C	32	5.125601	0.94429	.	.	ENSG00000067248	ENST00000251636	T	0.02709	4.19	5.55	5.55	0.83447	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.17534	0.0421	M	0.81614	2.55	0.58432	D	0.999999	D	0.60575	0.988	D	0.68192	0.956	T	0.00074	-1.2123	10	0.87932	D	0	.	19.5112	0.95142	0.0:1.0:0.0:0.0	.	1102	Q7Z478	DHX29_HUMAN	T	1102	ENSP00000251636:A1102T	ENSP00000251636:A1102T	A	-	1	0	DHX29	54599398	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.456000	0.80751	2.626000	0.88956	0.557000	0.71058	GCT	.	.		0.353	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
IL31RA	133396	hgsc.bcm.edu	37	5	55212851	55212851	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:55212851A>G	ENST00000447346.2	+	15	2263	c.2198A>G	c.(2197-2199)gAg>gGg	p.E733G	IL31RA_ENST00000490985.1_Missense_Mutation_p.E591G|IL31RA_ENST00000396834.1_Intron|IL31RA_ENST00000354961.4_Intron|IL31RA_ENST00000359040.5_Intron	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	701					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				CATCTGTGTGAGGAAGGAGCC	0.468																																					p.E733G		Atlas-SNP	.											.	IL31RA	84	.	0			c.A2198G						.						54.0	60.0	58.0					5																	55212851		2203	4300	6503	SO:0001583	missense	133396	exon15			TGTGTGAGGAAGG	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.2198A>G	chr5.hg19:g.55212851A>G	ENSP00000415900:p.Glu733Gly	108.0	0.0		100.0	4.0	NM_139017	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	hg19	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	A	10.68	1.419540	0.25552	.	.	ENSG00000164509	ENST00000447346;ENST00000490985	T;T	0.52754	0.86;0.65	5.65	1.95	0.26073	.	0.581254	0.17930	N	0.157211	T	0.33000	0.0848	L	0.38531	1.155	0.09310	N	0.999999	B	0.11235	0.004	B	0.12156	0.007	T	0.19516	-1.0303	9	.	.	.	0.6464	7.5383	0.27723	0.7519:0.0:0.248:0.0	.	733	Q8NI17-2	.	G	733;591	ENSP00000415900:E733G;ENSP00000427533:E591G	.	E	+	2	0	IL31RA	55248608	0.978000	0.34361	0.002000	0.10522	0.001000	0.01503	1.024000	0.30077	0.159000	0.19401	-0.400000	0.06385	GAG	.	.		0.468	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017	
ARHGEF28	64283	hgsc.bcm.edu	37	5	73076546	73076546	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:73076546T>C	ENST00000426542.2	+	6	906	c.886T>C	c.(886-888)Tcc>Ccc	p.S296P	ARHGEF28_ENST00000287898.5_Missense_Mutation_p.S296P|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.S296P|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.S296P|CTC-575I10.1_ENST00000506717.1_RNA|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.S296P|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.S296P			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	296					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										AGCTATGCCCTCCAGCGGTGC	0.478																																					p.S296P		Atlas-SNP	.											NP_001073948_1,NS,carcinoma,0,2	.	.	.	0			c.T886C						.						37.0	42.0	41.0					5																	73076546		1994	4150	6144	SO:0001583	missense	64283	exon7			ATGCCCTCCAGCG		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.886T>C	chr5.hg19:g.73076546T>C	ENSP00000412175:p.Ser296Pro	56.0	0.0		60.0	3.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	hg19	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	T	9.119	1.008623	0.19199	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542	T;T;T;T;T;T	0.11063	3.06;3.05;3.05;2.81;3.05;3.05	5.47	2.85	0.33270	.	.	.	.	.	T	0.18341	0.0440	M	0.65975	2.015	0.09310	N	1	P;P;D;P	0.59767	0.627;0.855;0.986;0.911	B;B;P;P	0.51016	0.184;0.36;0.656;0.466	T	0.08452	-1.0721	9	0.59425	D	0.04	.	6.9073	0.24315	0.1493:0.0:0.156:0.6947	.	296;296;296;296	Q8N1W1;E9PC75;Q8N1W1-2;Q8N1W1-4	RGNEF_HUMAN;.;.;.	P	296	ENSP00000296794:S296P;ENSP00000441913:S296P;ENSP00000441436:S296P;ENSP00000287898:S296P;ENSP00000411459:S296P;ENSP00000412175:S296P	ENSP00000287898:S296P	S	+	1	0	RP11-428C6.1	73112302	0.010000	0.17322	0.120000	0.21714	0.038000	0.13279	1.303000	0.33470	0.976000	0.38417	0.533000	0.62120	TCC	.	.		0.478	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
SLCO6A1	133482	hgsc.bcm.edu	37	5	101794140	101794140	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:101794140T>C	ENST00000506729.1	-	6	1248	c.1077A>G	c.(1075-1077)agA>agG	p.R359R	SLCO6A1_ENST00000514551.1_5'UTR|SLCO6A1_ENST00000379810.1_Intron|SLCO6A1_ENST00000379807.3_Silent_p.R359R|SLCO6A1_ENST00000389019.3_Silent_p.R297R|SLCO6A1_ENST00000513675.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	359						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GATCTTTAAGTCTGCTGTCAA	0.303																																					p.R359R		Atlas-SNP	.											.	SLCO6A1	153	.	0			c.A1077G						.						141.0	141.0	141.0					5																	101794140		2202	4298	6500	SO:0001819	synonymous_variant	133482	exon6			TTTAAGTCTGCTG	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1077A>G	chr5.hg19:g.101794140T>C		108.0	0.0		109.0	5.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	ENST00000506729.1	hg19	CCDS34206.1																																																																																			.	.		0.303	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
ACSL6	23305	hgsc.bcm.edu	37	5	131296298	131296298	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:131296298A>G	ENST00000379240.1	-	19	1952	c.1799T>C	c.(1798-1800)aTt>aCt	p.I600T	AC034228.4_ENST00000446275.1_RNA|ACSL6_ENST00000431707.1_Missense_Mutation_p.I580T|ACSL6_ENST00000379264.2_Missense_Mutation_p.I625T|ACSL6_ENST00000543479.1_Missense_Mutation_p.I600T|ACSL6_ENST00000379272.2_Missense_Mutation_p.I615T|ACSL6_ENST00000379249.3_Missense_Mutation_p.I600T|ACSL6_ENST00000379255.1_Missense_Mutation_p.I525T|ACSL6_ENST00000379244.1_Missense_Mutation_p.I600T|ACSL6_ENST00000296869.4_Missense_Mutation_p.I625T|ACSL6_ENST00000544770.1_Missense_Mutation_p.I509T|ACSL6_ENST00000357096.1_Missense_Mutation_p.I525T|ACSL6_ENST00000379246.1_Missense_Mutation_p.I611T			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	600					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGCACAACAATGCCTACCAA	0.453																																					p.I625T		Atlas-SNP	.											.	ACSL6	169	.	0			c.T1874C						.						119.0	108.0	112.0					5																	131296298		2203	4300	6503	SO:0001583	missense	23305	exon19			ACAACAATGCCTA	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1799T>C	chr5.hg19:g.131296298A>G	ENSP00000368542:p.Ile600Thr	107.0	0.0		92.0	4.0	NM_001009185	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	hg19		.	.	.	.	.	.	.	.	.	.	A	19.74	3.883552	0.72410	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.20881	2.04;2.85;2.85;2.85;2.85;2.85;2.85;2.85;2.85;2.85;2.85;2.85	5.81	4.64	0.57946	.	0.132929	0.64402	D	0.000002	T	0.55752	0.1940	H	0.97023	3.925	0.80722	D	1	P;P;P;B;P;P;P	0.48911	0.661;0.917;0.865;0.238;0.754;0.754;0.917	P;P;P;B;P;P;P	0.58721	0.571;0.844;0.659;0.367;0.799;0.764;0.764	T	0.68819	-0.5308	10	0.87932	D	0	.	12.3476	0.55130	0.8733:0.0:0.0:0.1266	.	600;615;590;600;525;625;625	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	T	600;625;615;525;525;625;611;600;509;600;580;600	ENSP00000368551:I600T;ENSP00000368566:I625T;ENSP00000368574:I615T;ENSP00000349608:I525T;ENSP00000368557:I525T;ENSP00000296869:I625T;ENSP00000368548:I611T;ENSP00000368546:I600T;ENSP00000445154:I509T;ENSP00000368542:I600T;ENSP00000413329:I580T;ENSP00000442124:I600T	ENSP00000296869:I625T	I	-	2	0	ACSL6	131324197	1.000000	0.71417	0.964000	0.40570	0.777000	0.43975	9.339000	0.96797	1.004000	0.39156	0.533000	0.62120	ATT	.	.		0.453	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
PSD2	84249	hgsc.bcm.edu	37	5	139216497	139216497	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:139216497T>C	ENST00000274710.3	+	10	1710	c.1505T>C	c.(1504-1506)tTc>tCc	p.F502S		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	502					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAACCCCTTCCTGGATGTC	0.587																																					p.F502S		Atlas-SNP	.											.	PSD2	88	.	0			c.T1505C						.						172.0	152.0	159.0					5																	139216497		2203	4300	6503	SO:0001583	missense	84249	exon10			ACCCCTTCCTGGA	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1505T>C	chr5.hg19:g.139216497T>C	ENSP00000274710:p.Phe502Ser	108.0	0.0		106.0	6.0	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	hg19	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.661535	0.67700	.	.	ENSG00000146005	ENST00000274710	T	0.15487	2.42	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.24812	0.0602	M	0.73962	2.25	0.80722	D	1	B	0.19706	0.038	B	0.18561	0.022	T	0.03000	-1.1084	10	0.59425	D	0.04	.	15.3435	0.74317	0.0:0.0:0.0:1.0	.	502	Q9BQI7	PSD2_HUMAN	S	502	ENSP00000274710:F502S	ENSP00000274710:F502S	F	+	2	0	PSD2	139196681	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.629000	0.83207	2.041000	0.60428	0.454000	0.30748	TTC	.	.		0.587	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDHB10	56126	hgsc.bcm.edu	37	5	140574361	140574361	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:140574361A>G	ENST00000239446.4	+	1	2420	c.2236A>G	c.(2236-2238)Acc>Gcc	p.T746A		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	746					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCGCTGAGACCCTGTCCCA	0.617																																					p.T746A		Atlas-SNP	.											.	PCDHB10	177	.	0			c.A2236G						.						78.0	87.0	84.0					5																	140574361		2203	4300	6503	SO:0001583	missense	56126	exon1			GCTGAGACCCTGT	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2236A>G	chr5.hg19:g.140574361A>G	ENSP00000239446:p.Thr746Ala	107.0	0.0		111.0	5.0	NM_018930	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	hg19	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	a	14.42	2.531183	0.45073	.	.	ENSG00000120324	ENST00000239446	T	0.48201	0.82	3.28	3.28	0.37604	.	.	.	.	.	T	0.62295	0.2416	M	0.78916	2.43	0.34060	D	0.657162	D	0.89917	1.0	D	0.87578	0.998	T	0.66964	-0.5790	9	0.19147	T	0.46	.	7.3849	0.26876	0.8048:0.0:0.0:0.1952	.	746	Q9UN67	PCDBA_HUMAN	A	746	ENSP00000239446:T746A	ENSP00000239446:T746A	T	+	1	0	PCDHB10	140554545	0.003000	0.15002	0.850000	0.33497	0.105000	0.19272	1.201000	0.32259	1.508000	0.48769	0.248000	0.18094	ACC	.	.		0.617	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHGA2	56113	hgsc.bcm.edu	37	5	140718779	140718779	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:140718779A>G	ENST00000394576.2	+	1	241	c.241A>G	c.(241-243)Agc>Ggc	p.S81G	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	81	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACCCGCGAAGCGGCAGCTT	0.572																																					p.S81G		Atlas-SNP	.											.	PCDHGA2	205	.	0			c.A241G						.						59.0	64.0	62.0					5																	140718779		2203	4300	6503	SO:0001583	missense	56113	exon1			CCGCGAAGCGGCA	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.241A>G	chr5.hg19:g.140718779A>G	ENSP00000378077:p.Ser81Gly	160.0	0.0		158.0	7.0	NM_018915	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	hg19	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	9.349	1.065053	0.20067	.	.	ENSG00000081853	ENST00000394576	T	0.17370	2.28	5.08	2.67	0.31697	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.49305	U	0.000145	T	0.24928	0.0605	M	0.85859	2.78	0.09310	N	1	B;B	0.17465	0.016;0.022	B;B	0.26770	0.073;0.068	T	0.21655	-1.0239	10	0.49607	T	0.09	.	9.2827	0.37737	0.8498:0.0:0.1502:0.0	.	81;81	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	G	81	ENSP00000378077:S81G	ENSP00000378077:S81G	S	+	1	0	PCDHGA2	140698963	0.024000	0.19004	0.411000	0.26484	0.390000	0.30446	3.093000	0.50217	0.358000	0.24211	-0.353000	0.07706	AGC	.	.		0.572	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
DIAPH1	1729	hgsc.bcm.edu	37	5	140896440	140896440	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:140896440T>C	ENST00000398557.4	-	28	3937	c.3797A>G	c.(3796-3798)gAg>gGg	p.E1266G	DIAPH1_ENST00000389057.5_Missense_Mutation_p.E1257G|DIAPH1_ENST00000520569.1_Missense_Mutation_p.E1209G|DIAPH1_ENST00000253811.6_Missense_Mutation_p.E1267G|DIAPH1_ENST00000389054.3_Missense_Mutation_p.E1263G|DIAPH1_ENST00000398566.3_Missense_Mutation_p.E1258G|DIAPH1_ENST00000398562.2_Missense_Mutation_p.E1242G|DIAPH1_ENST00000518047.1_Missense_Mutation_p.E1254G	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	1266					actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCAACCAACTCCTTGGCTTC	0.577																																					p.E1266G		Atlas-SNP	.											.	DIAPH1	64	.	0			c.A3797G						.						97.0	99.0	98.0					5																	140896440		2101	4213	6314	SO:0001583	missense	1729	exon28			ACCAACTCCTTGG	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.3797A>G	chr5.hg19:g.140896440T>C	ENSP00000381565:p.Glu1266Gly	94.0	0.0		107.0	5.0	NM_005219	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	ENST00000398557.4	hg19	CCDS43374.1	.	.	.	.	.	.	.	.	.	.	T	15.66	2.900139	0.52227	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047	D;D;T;D;D;D;D;D	0.82526	-1.6;-1.6;-1.49;-1.62;-1.62;-1.6;-1.61;-1.62	5.19	5.19	0.71726	.	0.161191	0.42420	D	0.000720	T	0.71375	0.3332	L	0.29908	0.895	0.30512	N	0.769288	P;P	0.37781	0.608;0.608	B;B	0.32980	0.156;0.156	T	0.75291	-0.3369	10	0.72032	D	0.01	.	9.2136	0.37333	0.0:0.0847:0.0:0.9153	.	1257;1266	E9PEZ2;O60610	.;DIAP1_HUMAN	G	1263;1209;1242;1257;1258;1266;1267;1254	ENSP00000373706:E1263G;ENSP00000429282:E1209G;ENSP00000381570:E1242G;ENSP00000373709:E1257G;ENSP00000381572:E1258G;ENSP00000381565:E1266G;ENSP00000253811:E1267G;ENSP00000428268:E1254G	ENSP00000253811:E1267G	E	-	2	0	DIAPH1	140876624	0.998000	0.40836	0.999000	0.59377	0.940000	0.58332	4.248000	0.58760	2.180000	0.69256	0.460000	0.39030	GAG	.	.		0.577	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_005219	
FBXO38	81545	hgsc.bcm.edu	37	5	147807148	147807148	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:147807148A>G	ENST00000340253.5	+	15	2459	c.2291A>G	c.(2290-2292)gAg>gGg	p.E764G	CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000513826.1_Intron|FBXO38_ENST00000394370.3_Missense_Mutation_p.E764G|FBXO38_ENST00000296701.6_Intron			Q6PIJ6	FBX38_HUMAN	F-box protein 38	764					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGCCATGGAGGAGGGAGAT	0.597																																					p.E764G		Atlas-SNP	.											.	FBXO38	115	.	0			c.A2291G						.						52.0	49.0	50.0					5																	147807148		2203	4300	6503	SO:0001583	missense	81545	exon15			CCATGGAGGAGGG	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2291A>G	chr5.hg19:g.147807148A>G	ENSP00000342023:p.Glu764Gly	87.0	0.0		99.0	6.0	NM_030793	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	hg19		.	.	.	.	.	.	.	.	.	.	A	12.37	1.919021	0.33908	.	.	ENSG00000145868	ENST00000340253;ENST00000394370	T;T	0.33654	1.4;1.4	5.45	4.31	0.51392	.	0.543655	0.20710	N	0.087119	T	0.21022	0.0506	N	0.19112	0.55	0.80722	D	1	B;B	0.27732	0.187;0.0	B;B	0.30495	0.116;0.002	T	0.13791	-1.0496	10	0.49607	T	0.09	-11.7282	3.1944	0.06628	0.6712:0.0:0.1363:0.1925	.	764;764	Q6PIJ6-2;Q6PIJ6	.;FBX38_HUMAN	G	764	ENSP00000342023:E764G;ENSP00000377895:E764G	ENSP00000342023:E764G	E	+	2	0	FBXO38	147787341	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.570000	0.36439	2.371000	0.80710	0.533000	0.62120	GAG	.	.		0.597	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
PDGFRB	5159	hgsc.bcm.edu	37	5	149500490	149500490	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:149500490T>C	ENST00000261799.4	-	18	3016	c.2547A>G	c.(2545-2547)cgA>cgG	p.R849R		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	849	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCATGATGTCTCGAGCCAGGC	0.577			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.R849R		Atlas-SNP	.		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	PDGFRB,colon,carcinoma,0,1	PDGFRB	142	.	0			c.A2547G						.						137.0	118.0	124.0					5																	149500490		2203	4300	6503	SO:0001819	synonymous_variant	5159	exon18			GATGTCTCGAGCC	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2547A>G	chr5.hg19:g.149500490T>C		226.0	2.0		212.0	9.0	NM_002609	B5A957|Q8N5L4	Silent	SNP	ENST00000261799.4	hg19	CCDS4303.1																																																																																			.	.		0.577	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
CAMK2A	815	hgsc.bcm.edu	37	5	149652691	149652691	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:149652691T>C	ENST00000348628.6	-	2	759	c.94A>G	c.(94-96)Aag>Gag	p.K32E	CAMK2A_ENST00000398376.3_Missense_Mutation_p.K32E	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	32	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCCAGCACCTTCACACACCTT	0.582																																					p.K32E		Atlas-SNP	.											.	CAMK2A	42	.	0			c.A94G						.						109.0	115.0	113.0					5																	149652691		2203	4300	6503	SO:0001583	missense	815	exon2			GCACCTTCACACA	AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.94A>G	chr5.hg19:g.149652691T>C	ENSP00000261793:p.Lys32Glu	157.0	0.0		149.0	6.0	NM_171825	Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	ENST00000348628.6	hg19	CCDS43386.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243867	0.79912	.	.	ENSG00000070808	ENST00000348628;ENST00000398376;ENST00000510347	T;T;T	0.64803	-0.12;-0.12;-0.12	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.65176	0.2666	N	0.20807	0.61	0.80722	D	1	B;D;B	0.61080	0.366;0.989;0.419	B;D;P	0.74674	0.361;0.984;0.494	T	0.61700	-0.7009	10	0.19147	T	0.46	.	15.3777	0.74625	0.0:0.0:0.0:1.0	.	32;32;32	Q9UQM7-2;Q9UQM7;A8K161	.;KCC2A_HUMAN;.	E	32	ENSP00000261793:K32E;ENSP00000381412:K32E;ENSP00000426607:K32E	ENSP00000261793:K32E	K	-	1	0	CAMK2A	149632884	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.654000	0.83653	2.272000	0.75746	0.460000	0.39030	AAG	.	.		0.582	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981	
HNRNPH1	3187	hgsc.bcm.edu	37	5	179041962	179041962	+	Splice_Site	SNP	T	T	C	rs113642265		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:179041962T>C	ENST00000356731.5	-	13	2886		c.e13-2		HNRNPH1_ENST00000511300.2_Splice_Site|HNRNPH1_ENST00000329433.6_Splice_Site|HNRNPH1_ENST00000442819.2_Splice_Site|HNRNPH1_ENST00000393432.4_Splice_Site|HNRNPH1_ENST00000510411.1_Splice_Site			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						CTTGGTTACCTGCAAAGAGAT	0.398																																					.		Atlas-SNP	.											.	HNRNPH1	62	.	0			c.1351-2A>G						.																																			SO:0001630	splice_region_variant	3187	exon15			GTTACCTGCAAAG	BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.1348-2A>G	chr5.hg19:g.179041962T>C		119.0	0.0		120.0	5.0	NM_005520	B3KW86|D3DWQ2|Q6IBM4	Splice_Site	SNP	ENST00000356731.5	hg19	CCDS4446.1	.	.	.	.	.	.	.	.	.	.	T	10.83	1.462414	0.26248	.	.	ENSG00000169045	ENST00000329433	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3418	0.60549	0.0:0.0:0.1311:0.8689	.	.	.	.	.	-1	.	.	.	-	.	.	HNRNPH1	178974568	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	3.817000	0.55668	2.255000	0.74692	0.533000	0.62120	.	.	A|1.000		0.398	HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253497.3	NM_005520	Intron
TBC1D9B	23061	hgsc.bcm.edu	37	5	179331759	179331760	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:179331759_179331760GG>AA	ENST00000356834.3	-	2	208_209	c.171_172CC>TT	c.(169-174)gcCCct>gcTTct	p.P58S	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.P58S	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	58						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGCGGTAAGGGGCCACGCGGG	0.668																																					p.P58S|p.A57A		Atlas-SNP	.											.	TBC1D9B	157	.	0			c.C172T|c.C171T						.																																			SO:0001583	missense	23061	exon2			GGTAAGGGGCCAC|GTAAGGGGCCACG	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.171_172delinsAA	chr5.hg19:g.179331759_179331760delinsAA	ENSP00000349291:p.Pro58Ser	182.0|187.0	0.0		133.0	64.0	NM_198868	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation|Silent	SNP	ENST00000356834.3	hg19	CCDS43408.1																																																																																			.	.		0.668	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
FAM50B	26240	hgsc.bcm.edu	37	6	3850605	3850605	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:3850605T>C	ENST00000380274.1	+	1	986	c.560T>C	c.(559-561)gTc>gCc	p.V187A	FAM50B_ENST00000380272.3_Missense_Mutation_p.V187A			Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	187						nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(3)|urinary_tract(3)	17	Ovarian(93;0.0925)	all_hematologic(90;0.108)				GAGATGGAGGTCACCTTCAGC	0.677																																					p.V187A		Atlas-SNP	.											.	FAM50B	44	.	0			c.T560C						.						46.0	46.0	46.0					6																	3850605		2203	4300	6503	SO:0001583	missense	26240	exon2			TGGAGGTCACCTT	Y18504	CCDS4487.1	6p25.2	2008-05-15			ENSG00000145945	ENSG00000145945			18789	protein-coding gene	gene with protein product		614686				10534398	Standard	NM_012135		Approved	D6S2654E, X5L	uc003mvu.3	Q9Y247	OTTHUMG00000014147	ENST00000380274.1:c.560T>C	chr6.hg19:g.3850605T>C	ENSP00000369627:p.Val187Ala	58.0	0.0		121.0	5.0	NM_012135	Q5T2L6	Missense_Mutation	SNP	ENST00000380274.1	hg19	CCDS4487.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259721	0.80246	.	.	ENSG00000145945	ENST00000380274;ENST00000380272	.	.	.	4.25	4.25	0.50352	.	0.126918	0.50627	D	0.000120	T	0.44850	0.1313	L	0.55213	1.73	0.34403	D	0.695472	P	0.43412	0.806	P	0.48921	0.595	T	0.55042	-0.8202	9	0.87932	D	0	-31.4034	11.6884	0.51501	0.0:0.0:0.0:1.0	.	187	Q9Y247	FA50B_HUMAN	A	187	.	ENSP00000369625:V187A	V	+	2	0	FAM50B	3795604	0.942000	0.31987	0.515000	0.27774	0.957000	0.61999	2.624000	0.46444	1.930000	0.55929	0.397000	0.26171	GTC	.	.		0.677	FAM50B-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039693.1	NM_012135	
SYCP2L	221711	hgsc.bcm.edu	37	6	10928640	10928640	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:10928640A>G	ENST00000283141.6	+	18	1741	c.1445A>G	c.(1444-1446)cAg>cGg	p.Q482R	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	482						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			ccatagcttcagccggtccct	0.453																																					p.Q482R		Atlas-SNP	.											SYCP2L,right_lower_lobe,carcinoma,0,1	SYCP2L	101	.	0			c.A1445G						.						59.0	61.0	61.0					6																	10928640		1858	4090	5948	SO:0001583	missense	221711	exon18			AGCTTCAGCCGGT	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1445A>G	chr6.hg19:g.10928640A>G	ENSP00000283141:p.Gln482Arg	38.0	0.0		68.0	3.0	NM_001040274	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	ENST00000283141.6	hg19	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	A	0.633	-0.816257	0.02776	.	.	ENSG00000153157	ENST00000283141	T	0.18174	2.23	0.0465	0.0465	0.14256	.	5.812810	0.01010	U	0.003811	T	0.02267	0.0070	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34304	-0.9834	9	0.20519	T	0.43	.	.	.	.	.	482	Q5T4T6	SYC2L_HUMAN	R	482	ENSP00000283141:Q482R	ENSP00000283141:Q482R	Q	+	2	0	SYCP2L	11036626	0.172000	0.23043	0.120000	0.21714	0.123000	0.20343	0.164000	0.16542	0.115000	0.18071	0.113000	0.15668	CAG	.	.		0.453	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
OR2W1	26692	hgsc.bcm.edu	37	6	29012812	29012812	+	Silent	SNP	A	A	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:29012812A>C	ENST00000377175.1	-	1	205	c.141T>G	c.(139-141)ctT>ctG	p.L47L		NM_030903.3	NP_112165.1	Q9Y3N9	OR2W1_HUMAN	olfactory receptor, family 2, subfamily W, member 1	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|skin(1)	23						GGAGAGATGCAAGAATGATGG	0.418																																					p.L47L		Atlas-SNP	.											.	OR2W1	36	.	0			c.T141G						.						114.0	121.0	119.0					6																	29012812		1508	2708	4216	SO:0001819	synonymous_variant	26692	exon1			AGATGCAAGAATG	AL035402	CCDS4656.1	6p22.1	2012-08-09			ENSG00000204704	ENSG00000204704		"""GPCR / Class A : Olfactory receptors"""	8281	protein-coding gene	gene with protein product							Standard	NM_030903		Approved	hs6M1-15	uc003nlw.2	Q9Y3N9	OTTHUMG00000031048	ENST00000377175.1:c.141T>G	chr6.hg19:g.29012812A>C		244.0	0.0		408.0	37.0	NM_030903	B0S7Y5|Q5JNZ1|Q6IEU0|Q96R17|Q9GZL0|Q9GZL1	Silent	SNP	ENST00000377175.1	hg19	CCDS4656.1																																																																																			.	.		0.418	OR2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076053.2		
SKIV2L	6499	hgsc.bcm.edu	37	6	31933561	31933561	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:31933561T>C	ENST00000375394.2	+	18	2086	c.1973T>C	c.(1972-1974)gTc>gCc	p.V658A	SKIV2L_ENST00000544581.1_Splice_Site_p.V465A	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	658	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CTGTCCCAGGTCTTGTTTGCC	0.532																																					p.V658A		Atlas-SNP	.											.	SKIV2L	97	.	0			c.T1973C						.						140.0	107.0	119.0					6																	31933561		1511	2709	4220	SO:0001630	splice_region_variant	6499	exon18			CCCAGGTCTTGTT		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1972-1T>C	chr6.hg19:g.31933561T>C		119.0	0.0		144.0	7.0	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	hg19	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.352600	0.82132	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.79352	-1.26;-1.26	5.48	5.48	0.80851	Helicase, C-terminal (3);	0.060213	0.64402	D	0.000003	T	0.81828	0.4905	M	0.83118	2.625	0.50467	D	0.999874	D	0.54964	0.969	P	0.56434	0.798	T	0.81558	-0.0878	10	0.30078	T	0.28	-30.6061	14.5527	0.68078	0.0:0.0:0.0:1.0	.	658	Q15477	SKIV2_HUMAN	A	658;500;465	ENSP00000364543:V658A;ENSP00000442645:V465A	ENSP00000364543:V658A	V	+	2	0	SKIV2L	32041540	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.086000	0.57664	2.086000	0.62901	0.533000	0.62120	GTC	.	.		0.532	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		Missense_Mutation
DNAH8	1769	hgsc.bcm.edu	37	6	38825330	38825330	+	Missense_Mutation	SNP	G	G	T	rs267601015		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:38825330G>T	ENST00000359357.3	+	40	5373	c.5119G>T	c.(5119-5121)Gat>Tat	p.D1707Y	DNAH8_ENST00000441566.1_Missense_Mutation_p.D1707Y|DNAH8_ENST00000449981.2_Missense_Mutation_p.D1924Y			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1707					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GTGGACACACGATTCAGAAGA	0.343																																					p.D1924Y		Atlas-SNP	.											DNAH8_ENST00000359357,NS,carcinoma,0,2	DNAH8	1239	.	0			c.G5770T						.						100.0	99.0	99.0					6																	38825330		2203	4300	6503	SO:0001583	missense	1769	exon42			ACACACGATTCAG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5119G>T	chr6.hg19:g.38825330G>T	ENSP00000352312:p.Asp1707Tyr	220.0	0.0		363.0	0.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	G	20.7	4.042219	0.75732	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.27720	1.69;1.69;1.65	5.91	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.63426	0.2510	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78879	-0.2030	10	0.87932	D	0	.	17.0758	0.86586	0.0:0.1268:0.8731:0.0	.	1707	Q96JB1	DYH8_HUMAN	Y	1912;1912;1707;1707	ENSP00000333363:D1912Y;ENSP00000352312:D1707Y;ENSP00000402294:D1707Y	ENSP00000333363:D1912Y	D	+	1	0	DNAH8	38933308	1.000000	0.71417	0.993000	0.49108	0.964000	0.63967	9.551000	0.98112	1.478000	0.48253	0.655000	0.94253	GAT	.	.		0.343	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
DNAH8	1769	hgsc.bcm.edu	37	6	38851761	38851761	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:38851761A>G	ENST00000359357.3	+	54	7849	c.7595A>G	c.(7594-7596)gAg>gGg	p.E2532G	DNAH8_ENST00000441566.1_Missense_Mutation_p.E2496G|DNAH8_ENST00000449981.2_Missense_Mutation_p.E2749G			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2532	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GTGATTAATGAGTGGGGAGAT	0.323																																					p.E2749G		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A8246G						.						98.0	102.0	100.0					6																	38851761		2203	4300	6503	SO:0001583	missense	1769	exon56			TTAATGAGTGGGG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7595A>G	chr6.hg19:g.38851761A>G	ENSP00000352312:p.Glu2532Gly	54.0	0.0		92.0	4.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	A	24.2	4.507607	0.85282	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.17370	2.28;2.28;2.28	5.07	5.07	0.68467	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	H	0.97940	4.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67898	-0.5551	10	0.41790	T	0.15	.	15.1103	0.72351	1.0:0.0:0.0:0.0	.	2532	Q96JB1	DYH8_HUMAN	G	2737;2737;2532;2496	ENSP00000333363:E2737G;ENSP00000352312:E2532G;ENSP00000402294:E2496G	ENSP00000333363:E2737G	E	+	2	0	DNAH8	38959739	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.277000	0.95755	2.030000	0.59900	0.454000	0.30748	GAG	.	.		0.323	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
EFHC1	114327	hgsc.bcm.edu	37	6	52303151	52303151	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:52303151A>G	ENST00000371068.5	+	3	438	c.335A>G	c.(334-336)gAg>gGg	p.E112G	EFHC1_ENST00000433625.2_Missense_Mutation_p.E21G|EFHC1_ENST00000491749.1_3'UTR|EFHC1_ENST00000538167.1_Missense_Mutation_p.E93G	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	112	DM10 1. {ECO:0000255|PROSITE- ProRule:PRU00665}.					axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					ATGTCAACTGAGGAACAGTAT	0.373																																					p.E112G		Atlas-SNP	.											.	EFHC1	68	.	0			c.A335G						.						51.0	46.0	47.0					6																	52303151		2203	4300	6503	SO:0001583	missense	114327	exon3			CAACTGAGGAACA	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.335A>G	chr6.hg19:g.52303151A>G	ENSP00000360107:p.Glu112Gly	71.0	0.0		87.0	4.0	NM_018100	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	hg19	CCDS4942.1	.	.	.	.	.	.	.	.	.	.	A	17.68	3.449792	0.63290	.	.	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.69175	-0.13;-0.38;-0.33	5.78	4.57	0.56435	Uncharacterised domain DM10 (2);	0.254365	0.45361	D	0.000379	T	0.51873	0.1700	M	0.64404	1.975	0.54753	D	0.999988	P;B;B	0.37663	0.604;0.061;0.007	B;B;B	0.40066	0.318;0.018;0.027	T	0.53711	-0.8400	10	0.25751	T	0.34	-6.4266	12.2989	0.54864	0.8735:0.0:0.0:0.1265	.	93;21;112	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	G	112;21;93	ENSP00000360107:E112G;ENSP00000416492:E21G;ENSP00000444521:E93G	ENSP00000360107:E112G	E	+	2	0	EFHC1	52411110	1.000000	0.71417	0.996000	0.52242	0.943000	0.58893	5.069000	0.64370	2.205000	0.71048	0.533000	0.62120	GAG	.	.		0.373	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100	
TRAM2	9697	hgsc.bcm.edu	37	6	52370844	52370844	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:52370844T>C	ENST00000182527.3	-	8	716	c.717A>G	c.(715-717)gaA>gaG	p.E239E	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	239	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					TCTCGTTGTTTTCATCTGCAA	0.607																																					p.E239E		Atlas-SNP	.											.	TRAM2	27	.	0			c.A717G						.						85.0	88.0	87.0					6																	52370844		2203	4300	6503	SO:0001819	synonymous_variant	9697	exon8			GTTGTTTTCATCT	D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.717A>G	chr6.hg19:g.52370844T>C		95.0	0.0		96.0	4.0	NM_012288	A8K6T6	Silent	SNP	ENST00000182527.3	hg19	CCDS34477.1																																																																																			.	.		0.607	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040910.1	NM_012288	
DST	667	hgsc.bcm.edu	37	6	56497659	56497659	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:56497659T>C	ENST00000361203.3	-	24	3172	c.3165A>G	c.(3163-3165)gcA>gcG	p.A1055A	DST_ENST00000421834.2_Silent_p.A1055A|DST_ENST00000370765.6_Silent_p.A729A|DST_ENST00000312431.6_Silent_p.A1055A|DST_ENST00000370769.4_Silent_p.A1055A|DST_ENST00000446842.2_Silent_p.A729A|DST_ENST00000518935.1_Silent_p.A729A|DST_ENST00000370788.2_Silent_p.A1055A|DST_ENST00000370754.5_Silent_p.A1233A|DST_ENST00000244364.6_Silent_p.A729A			Q03001	DYST_HUMAN	dystonin	1055					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TACCTCTTTCTGCAGATTTAA	0.378																																					p.A729A		Atlas-SNP	.											.	DST	1427	.	0			c.A2187G						.						93.0	95.0	94.0					6																	56497659		2203	4300	6503	SO:0001819	synonymous_variant	667	exon14			TCTTTCTGCAGAT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3165A>G	chr6.hg19:g.56497659T>C		92.0	0.0		128.0	47.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	hg19																																																																																				.	.		0.378	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
COL9A1	1297	hgsc.bcm.edu	37	6	70991132	70991132	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:70991132A>G	ENST00000357250.6	-	8	995	c.837T>C	c.(835-837)ccT>ccC	p.P279P	COL9A1_ENST00000320755.7_Silent_p.P36P|COL9A1_ENST00000370499.4_Silent_p.P36P|COL9A1_ENST00000489611.1_5'Flank|COL9A1_ENST00000370496.3_Silent_p.P279P	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	279	Collagen-like 1.|Triple-helical region (COL3).			PP -> AS (in Ref. 1; CAA38276/CAA38277). {ECO:0000305}.	axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGGGGCCCGGAGGCCCGGGAG	0.597																																					p.P279P		Atlas-SNP	.											.	COL9A1	228	.	0			c.T837C						.						22.0	26.0	24.0					6																	70991132		2203	4300	6503	SO:0001819	synonymous_variant	1297	exon8			GCCCGGAGGCCCG		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.837T>C	chr6.hg19:g.70991132A>G		90.0	0.0		104.0	5.0	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Silent	SNP	ENST00000357250.6	hg19	CCDS4971.1																																																																																			.	.		0.597	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
COL12A1	1303	hgsc.bcm.edu	37	6	75801079	75801079	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:75801079C>T	ENST00000322507.8	-	62	9021	c.8712G>A	c.(8710-8712)atG>atA	p.M2904I	COL12A1_ENST00000483888.2_Missense_Mutation_p.M2900I|COL12A1_ENST00000511023.1_5'UTR|COL12A1_ENST00000345356.6_Missense_Mutation_p.M1740I|COL12A1_ENST00000416123.2_Missense_Mutation_p.M2828I	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2904	Nonhelical region (NC2).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAACTGCTCGCATCATGTTCT	0.308																																					p.M2904I		Atlas-SNP	.											.	COL12A1	385	.	0			c.G8712A						.						177.0	167.0	170.0					6																	75801079		1852	4113	5965	SO:0001583	missense	1303	exon62			TGCTCGCATCATG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8712G>A	chr6.hg19:g.75801079C>T	ENSP00000325146:p.Met2904Ile	72.0	0.0		79.0	4.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	32	5.152458	0.94645	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D;D	0.91945	-2.94;-2.94;-2.94;-2.94;-2.94	5.96	5.96	0.96718	.	0.039016	0.85682	D	0.000000	D	0.93654	0.7973	L	0.43152	1.355	0.53005	D	0.999961	D;D	0.71674	0.998;0.989	D;D	0.79784	0.993;0.958	D	0.91514	0.5229	10	0.33940	T	0.23	.	20.4082	0.99013	0.0:1.0:0.0:0.0	.	1740;2904	Q99715-2;Q99715	.;COCA1_HUMAN	I	2904;542;2828;1740;2828;2900	ENSP00000325146:M2904I;ENSP00000399812:M542I;ENSP00000305147:M1740I;ENSP00000412864:M2828I;ENSP00000421216:M2900I	ENSP00000325146:M2904I	M	-	3	0	COL12A1	75857799	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.484000	0.81180	2.814000	0.96858	0.655000	0.94253	ATG	.	.		0.308	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
NUS1	116150	hgsc.bcm.edu	37	6	118024821	118024821	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:118024821A>G	ENST00000368494.3	+	4	914	c.745A>G	c.(745-747)Agc>Ggc	p.S249G		NM_138459.3	NP_612468.1	Q96E22	NGBR_HUMAN	nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)	249					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|intracellular cholesterol transport (GO:0032367)|protein glycosylation (GO:0006486)|sterol homeostasis (GO:0055092)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|prostate(2)	8		all_cancers(87;0.0395)|all_epithelial(87;0.0301)		GBM - Glioblastoma multiforme(226;0.02)|OV - Ovarian serous cystadenocarcinoma(136;0.115)|all cancers(137;0.146)		TCCTGTGGACAGCACATTAGG	0.388																																					p.S249G		Atlas-SNP	.											.	NUS1	15	.	0			c.A745G						.						187.0	170.0	176.0					6																	118024821		2203	4298	6501	SO:0001583	missense	116150	exon4			GTGGACAGCACAT	BC013026	CCDS5118.1	6q22.1	2012-12-13	2006-11-24	2006-11-24	ENSG00000153989	ENSG00000153989			21042	protein-coding gene	gene with protein product	"""Nogo-B receptor"", ""transport and golgi organization 14 homolog (Drosophila)"""	610463	"""chromosome 6 open reading frame 68"""	C6orf68			Standard	NM_138459		Approved	MGC7199, NgBR, TANGO14	uc003pxw.3	Q96E22	OTTHUMG00000015458	ENST00000368494.3:c.745A>G	chr6.hg19:g.118024821A>G	ENSP00000357480:p.Ser249Gly	105.0	0.0		135.0	6.0	NM_138459	B2RWQ4|O00251	Missense_Mutation	SNP	ENST00000368494.3	hg19	CCDS5118.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.761177	0.89932	.	.	ENSG00000153989	ENST00000368494	T	0.54479	0.57	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.69735	0.3144	M	0.85542	2.76	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.74441	-0.3664	10	0.51188	T	0.08	-12.8437	15.6873	0.77421	1.0:0.0:0.0:0.0	.	249	Q96E22	NGBR_HUMAN	G	249	ENSP00000357480:S249G	ENSP00000357480:S249G	S	+	1	0	NUS1	118131514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.601000	0.90864	2.107000	0.64212	0.482000	0.46254	AGC	.	.		0.388	NUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041989.1	NM_138459	
TRDN	10345	hgsc.bcm.edu	37	6	123653052	123653052	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:123653052C>T	ENST00000398178.3	-	23	1464	c.1443G>A	c.(1441-1443)gaG>gaA	p.E481E	TRDN_ENST00000334268.4_Silent_p.E481E	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	481					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CTGGAACTTTCTCTTCTTTCC	0.333																																					p.E481E		Atlas-SNP	.											TRDN,colon,carcinoma,0,1	TRDN	88	.	0			c.G1443A						.						74.0	70.0	71.0					6																	123653052		1792	4045	5837	SO:0001819	synonymous_variant	10345	exon23			AACTTTCTCTTCT	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1443G>A	chr6.hg19:g.123653052C>T		58.0	0.0		68.0	3.0	NM_006073	A5D6W5|F5H2W7|Q6NSB8	Silent	SNP	ENST00000398178.3	hg19	CCDS55053.1																																																																																			.	.		0.333	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
LAMA2	3908	hgsc.bcm.edu	37	6	129465145	129465145	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:129465145A>G	ENST00000421865.2	+	5	788	c.739A>G	c.(739-741)Agg>Ggg	p.R247G		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	247	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.R247G(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GAGATTTCAGAGGATCCGCAC	0.433																																					p.R247G		Atlas-SNP	.											LAMA2,NS,carcinoma,-1,1	LAMA2	481	.	1	Substitution - Missense(1)	lung(1)	c.A739G						.						119.0	111.0	114.0					6																	129465145		2203	4300	6503	SO:0001583	missense	3908	exon5			TTTCAGAGGATCC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.739A>G	chr6.hg19:g.129465145A>G	ENSP00000400365:p.Arg247Gly	110.0	2.0		143.0	6.0	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	hg19	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.675569	0.67928	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.80393	-1.37	5.43	4.25	0.50352	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.81470	0.4829	M	0.71871	2.18	0.47308	D	0.999387	P;P	0.44281	0.698;0.831	P;P	0.54759	0.696;0.76	D	0.83652	0.0156	10	0.87932	D	0	.	11.7661	0.51930	0.7214:0.2786:0.0:0.0	.	247;247	A6NF00;P24043	.;LAMA2_HUMAN	G	247	ENSP00000400365:R247G	ENSP00000346769:R247G	R	+	1	2	LAMA2	129506838	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	1.475000	0.35409	0.967000	0.38186	0.383000	0.25322	AGG	.	.		0.433	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
MYB	4602	hgsc.bcm.edu	37	6	135517124	135517124	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:135517124T>C	ENST00000367814.4	+	9	1373	c.1187T>C	c.(1186-1188)cTc>cCc	p.L396P	MYB_ENST00000316528.8_Missense_Mutation_p.L396P|MYB_ENST00000534044.1_Missense_Mutation_p.L396P|MYB_ENST00000525369.1_Intron|MYB_ENST00000534121.1_Intron|MYB_ENST00000442647.2_Missense_Mutation_p.L393P|MYB_ENST00000528774.1_Missense_Mutation_p.L393P|MYB_ENST00000531845.1_3'UTR|MYB_ENST00000533624.1_Missense_Mutation_p.L361P|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000341911.5_Missense_Mutation_p.L396P|MYB_ENST00000527615.1_Missense_Mutation_p.L396P	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	396	Leucine-zipper.|Negative regulatory domain. {ECO:0000250}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		GCAGAAACACTCCAATTTATA	0.393			T	NFIB	adenoid cystic carcinoma																																p.L396P		Atlas-SNP	.		Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	.	MYB	137	.	0			c.T1187C						.						61.0	62.0	62.0					6																	135517124		2203	4300	6503	SO:0001583	missense	4602	exon9			AAACACTCCAATT		CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.1187T>C	chr6.hg19:g.135517124T>C	ENSP00000356788:p.Leu396Pro	69.0	0.0		83.0	5.0	NM_001161659	E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	ENST00000367814.4	hg19	CCDS5174.1	.	.	.	.	.	.	.	.	.	.	T	17.99	3.522969	0.64747	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000528774;ENST00000534044;ENST00000533624	T;T;T;T;T;T;T;T	0.52754	1.62;1.14;1.53;1.13;0.65;1.65;1.08;1.21	5.95	5.95	0.96441	.	0.123637	0.56097	D	0.000032	T	0.54935	0.1889	L	0.46157	1.445	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.996;0.991;0.995;0.999;1.0;0.999;0.996	P;P;P;D;D;D;P	0.91635	0.823;0.77;0.885;0.998;0.999;0.971;0.853	T	0.60291	-0.7292	10	0.87932	D	0	-10.9835	14.9948	0.71421	0.0:0.0:0.0:1.0	.	361;396;393;393;396;396;396	E9PI07;E9PLZ5;P10242-2;E9PNL6;P10242-4;P10242;Q708E1	.;.;.;.;.;MYB_HUMAN;.	P	396;393;396;396;396;396;393;396;361	ENSP00000339992:L396P;ENSP00000410825:L393P;ENSP00000326328:L396P;ENSP00000356788:L396P;ENSP00000433227:L396P;ENSP00000434723:L393P;ENSP00000435055:L396P;ENSP00000436605:L361P	ENSP00000237302:L396P	L	+	2	0	MYB	135558817	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.687000	0.74552	2.279000	0.76181	0.533000	0.62120	CTC	.	.		0.393	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042347.4		
IFNGR1	3459	hgsc.bcm.edu	37	6	137528138	137528138	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:137528138T>C	ENST00000367739.4	-	2	283	c.162A>G	c.(160-162)ccA>ccG	p.P54P	IFNGR1_ENST00000543628.1_Silent_p.P26P|IFNGR1_ENST00000367735.2_Silent_p.P44P|IFNGR1_ENST00000478333.1_5'UTR	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	54					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	CAGGGACCTGTGGCATGATCT	0.353																																					p.P54P		Atlas-SNP	.											.	IFNGR1	46	.	0			c.A162G						.						127.0	125.0	126.0					6																	137528138		2203	4300	6503	SO:0001819	synonymous_variant	3459	exon2			GACCTGTGGCATG		CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.162A>G	chr6.hg19:g.137528138T>C		86.0	0.0		93.0	4.0	NM_000416	B4DFT7|E1P587|Q53Y96	Silent	SNP	ENST00000367739.4	hg19	CCDS5185.1																																																																																			.	.		0.353	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042401.1		
TXLNB	167838	hgsc.bcm.edu	37	6	139576758	139576758	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:139576758T>C	ENST00000358430.3	-	7	1252	c.1020A>G	c.(1018-1020)gcA>gcG	p.A340A		NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta	340						cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		GTTTCCACTCTGCTGCCTGGT	0.488																																					p.A340A		Atlas-SNP	.											.	TXLNB	96	.	0			c.A1020G						.						100.0	82.0	88.0					6																	139576758		2203	4300	6503	SO:0001819	synonymous_variant	167838	exon7			CCACTCTGCTGCC		CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1020A>G	chr6.hg19:g.139576758T>C		103.0	0.0		98.0	4.0	NM_153235	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Silent	SNP	ENST00000358430.3	hg19	CCDS34545.1	.	.	.	.	.	.	.	.	.	.	T	10.88	1.476436	0.26511	.	.	ENSG00000164440	ENST00000367652	.	.	.	5.87	3.19	0.36642	.	.	.	.	.	T	0.41834	0.1176	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35992	-0.9766	4	.	.	.	-19.9312	6.8414	0.23965	0.2154:0.072:0.0:0.7125	.	.	.	.	G	53	.	.	R	-	1	2	TXLNB	139618451	0.999000	0.42202	1.000000	0.80357	0.963000	0.63663	0.374000	0.20501	1.166000	0.42689	0.533000	0.62120	AGA	.	.		0.488	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042458.1	NM_153235	
NMBR	4829	hgsc.bcm.edu	37	6	142400004	142400004	+	Silent	SNP	C	C	T	rs149123905		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:142400004C>T	ENST00000258042.1	-	2	599	c.459G>A	c.(457-459)acG>acA	p.T153T	NMBR_ENST00000480652.1_5'Flank	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	153					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		ATGCCCCTGACGTCTGCATGT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		17023	0.0		0.0	False		,,,				2504	0.001				p.T153T		Atlas-SNP	.											.	NMBR	62	.	0			c.G459A						.	C		1,4405	2.1+/-5.4	0,1,2202	71.0	59.0	63.0		459	-10.8	0.0	6	dbSNP_134	63	0,8600		0,0,4300	no	coding-synonymous	NMBR	NM_002511.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		153/391	142400004	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4829	exon2			CCCTGACGTCTGC		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.459G>A	chr6.hg19:g.142400004C>T		134.0	0.0		160.0	20.0	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	hg19	CCDS5196.1																																																																																			.	C|1.000;T|0.000		0.493	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152665262	152665262	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:152665262T>A	ENST00000367255.5	-	74	12780	c.12179A>T	c.(12178-12180)gAg>gTg	p.E4060V	SYNE1_ENST00000341594.5_Missense_Mutation_p.E3925V|SYNE1_ENST00000448038.1_Missense_Mutation_p.E3989V|SYNE1_ENST00000265368.4_Missense_Mutation_p.E4060V|SYNE1_ENST00000423061.1_Missense_Mutation_p.E3989V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4060			E -> D (in dbSNP:rs4645434).		cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGACTTGGCTCTAAATCCGG	0.493										HNSCC(10;0.0054)																											p.E4060V		Atlas-SNP	.											SYNE1_ENST00000423061,colon,carcinoma,-1,3	SYNE1	3227	.	0			c.A12179T						.						106.0	103.0	104.0					6																	152665262		2203	4300	6503	SO:0001583	missense	23345	exon74			CTTGGCTCTAAAT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12179A>T	chr6.hg19:g.152665262T>A	ENSP00000356224:p.Glu4060Val	130.0	0.0		149.0	0.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	8.654	0.898855	0.17686	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.76	5.76	0.90799	.	0.176957	0.39341	N	0.001392	T	0.12860	0.0312	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.32717	0.381;0.381;0.381;0.178	B;B;B;B	0.32342	0.085;0.085;0.085;0.144	T	0.08310	-1.0728	10	0.27785	T	0.31	.	16.3668	0.83335	0.0:0.0:0.0:1.0	.	4060;4060;4060;3989	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	V	4060;3989;4060;3989;3925	ENSP00000356224:E4060V;ENSP00000396024:E3989V;ENSP00000265368:E4060V;ENSP00000390975:E3989V;ENSP00000341887:E3925V	ENSP00000265368:E4060V	E	-	2	0	SYNE1	152706955	1.000000	0.71417	0.020000	0.16555	0.201000	0.24016	3.865000	0.56033	2.322000	0.78497	0.528000	0.53228	GAG	.	.		0.493	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE1	23345	hgsc.bcm.edu	37	6	152740820	152740820	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:152740820G>T	ENST00000367255.5	-	40	5906	c.5305C>A	c.(5305-5307)Caa>Aaa	p.Q1769K	SYNE1_ENST00000341594.5_Missense_Mutation_p.Q1806K|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q1776K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q1769K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q1776K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1769					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCATCAAATTGCTGGTGTTCA	0.353										HNSCC(10;0.0054)																											p.Q1776K		Atlas-SNP	.											.	SYNE1	3227	.	0			c.C5326A						.						79.0	78.0	79.0					6																	152740820		2203	4300	6503	SO:0001583	missense	23345	exon40			CAAATTGCTGGTG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5305C>A	chr6.hg19:g.152740820G>T	ENSP00000356224:p.Gln1769Lys	189.0	0.0		247.0	80.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175436	0.38413	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000018	T	0.17916	0.0430	L	0.52364	1.645	0.80722	D	1	B;B;B;B	0.27013	0.067;0.166;0.166;0.029	B;B;B;B	0.19391	0.017;0.025;0.025;0.019	T	0.02942	-1.1091	10	0.21014	T	0.42	.	14.0245	0.64577	0.0:0.0:0.8488:0.1512	.	1752;1769;1769;1776	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	1769;1776;1769;1776;1806	ENSP00000356224:Q1769K;ENSP00000396024:Q1776K;ENSP00000265368:Q1769K;ENSP00000390975:Q1776K;ENSP00000341887:Q1806K	ENSP00000265368:Q1769K	Q	-	1	0	SYNE1	152782513	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.505000	0.53356	2.594000	0.87642	0.650000	0.86243	CAA	.	.		0.353	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
ARID1B	57492	hgsc.bcm.edu	37	6	157099208	157099208	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:157099208T>C	ENST00000350026.5	+	1	146	c.145T>C	c.(145-147)Tct>Cct	p.S49P	ARID1B_ENST00000367148.1_Missense_Mutation_p.S49P|ARID1B_ENST00000346085.5_Missense_Mutation_p.S49P|RP11-230C9.2_ENST00000603191.1_lincRNA|MIR4466_ENST00000606121.1_RNA|RP11-230C9.3_ENST00000604792.1_RNA|ARID1B_ENST00000275248.4_5'UTR	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	49	Ser-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GGCGGCATCCTCTTCCTCCTC	0.731																																					p.S49P		Atlas-SNP	.											.	ARID1B	320	.	0			c.T145C						.						5.0	11.0	9.0					6																	157099208		1493	2707	4200	SO:0001583	missense	57492	exon1			GCATCCTCTTCCT	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.145T>C	chr6.hg19:g.157099208T>C	ENSP00000055163:p.Ser49Pro	70.0	0.0		84.0	6.0	NM_017519	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	hg19	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	t	6.920	0.539429	0.13250	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148	T;T;T	0.49720	0.77;0.77;0.77	2.26	2.26	0.28386	.	.	.	.	.	T	0.28896	0.0717	L	0.35542	1.07	0.80722	D	1	.	.	.	.	.	.	T	0.15867	-1.0422	7	0.87932	D	0	.	7.5154	0.27598	0.0:0.0:0.0:1.0	.	.	.	.	P	49	ENSP00000344546:S49P;ENSP00000055163:S49P;ENSP00000356116:S49P	ENSP00000344546:S49P	S	+	1	0	ARID1B	157140900	1.000000	0.71417	0.997000	0.53966	0.637000	0.38172	2.997000	0.49457	0.791000	0.33826	0.307000	0.20424	TCT	.	.		0.731	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
IGF2R	3482	hgsc.bcm.edu	37	6	160511067	160511067	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:160511067T>C	ENST00000356956.1	+	44	6735	c.6587T>C	c.(6586-6588)gTg>gCg	p.V2196A		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	2196					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	ATATGCCAGGTGAAGCCCAAC	0.502																																					p.V2196A		Atlas-SNP	.											.	IGF2R	251	.	0			c.T6587C						.						103.0	91.0	95.0					6																	160511067		2203	4300	6503	SO:0001583	missense	3482	exon44			GCCAGGTGAAGCC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.6587T>C	chr6.hg19:g.160511067T>C	ENSP00000349437:p.Val2196Ala	129.0	0.0		150.0	6.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	hg19	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.237888	0.58886	.	.	ENSG00000197081	ENST00000356956	T	0.03152	4.03	5.52	3.03	0.35002	Mannose-6-phosphate receptor, binding (1);	0.344338	0.29940	N	0.010817	T	0.03053	0.0090	M	0.80982	2.52	0.27535	N	0.950979	P	0.43938	0.822	B	0.40285	0.325	T	0.17471	-1.0368	10	0.62326	D	0.03	-9.6607	12.5508	0.56225	0.0:0.0:0.2632:0.7368	.	2196	P11717	MPRI_HUMAN	A	2196	ENSP00000349437:V2196A	ENSP00000349437:V2196A	V	+	2	0	IGF2R	160431057	0.998000	0.40836	0.010000	0.14722	0.369000	0.29798	2.935000	0.48963	0.427000	0.26145	0.454000	0.30748	GTG	.	.		0.502	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
LPA	4018	hgsc.bcm.edu	37	6	161027527	161027527	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:161027527C>T	ENST00000316300.5	-	17	2811	c.2767G>A	c.(2767-2769)Gag>Aag	p.E923K	LPA_ENST00000447678.1_Missense_Mutation_p.E923K			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3431	Kringle 8. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GAAGGAGCCTCTAGGCTTGGA	0.547																																					p.E923K		Atlas-SNP	.											.	LPA	237	.	0			c.G2767A						.						87.0	89.0	88.0					6																	161027527		1948	4196	6144	SO:0001583	missense	4018	exon18			GAGCCTCTAGGCT	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.2767G>A	chr6.hg19:g.161027527C>T	ENSP00000321334:p.Glu923Lys	111.0	0.0		112.0	5.0	NM_005577	Q5VTD7|Q9UD88	Missense_Mutation	SNP	ENST00000316300.5	hg19	CCDS43523.1	.	.	.	.	.	.	.	.	.	.	c	12.38	1.921269	0.33908	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	D;D	0.86627	-2.15;-2.15	2.1	-0.879	0.10613	Kringle (1);	.	.	.	.	T	0.78201	0.4246	L	0.60455	1.87	0.09310	N	1	P	0.45715	0.865	P	0.57620	0.824	T	0.70230	-0.4929	9	0.06625	T	0.88	.	8.3239	0.32145	0.0:0.4153:0.5846:0.0	.	3431	P08519	APOA_HUMAN	K	923	ENSP00000321334:E923K;ENSP00000395608:E923K	ENSP00000321334:E923K	E	-	1	0	LPA	160947517	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-1.884000	0.01622	-0.515000	0.06479	0.184000	0.17185	GAG	.	.		0.547	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
UNC93A	54346	hgsc.bcm.edu	37	6	167711454	167711454	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:167711454T>C	ENST00000230256.3	+	4	696	c.521T>C	c.(520-522)cTc>cCc	p.L174P	UNC93A_ENST00000366829.2_Intron	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GAAGAGCAGCTCACGTCCTGT	0.547																																					p.L174P		Atlas-SNP	.											.	UNC93A	66	.	0			c.T521C						.						136.0	116.0	123.0					6																	167711454		2203	4300	6503	SO:0001583	missense	54346	exon4			AGCAGCTCACGTC	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.521T>C	chr6.hg19:g.167711454T>C	ENSP00000230256:p.Leu174Pro	82.0	0.0		98.0	5.0	NM_018974	B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	ENST00000230256.3	hg19	CCDS5300.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490305	0.26686	.	.	ENSG00000112494	ENST00000230256	T	0.06142	3.34	5.21	5.21	0.72293	Major facilitator superfamily domain, general substrate transporter (1);	0.244021	0.34777	N	0.003697	T	0.06280	0.0162	M	0.85373	2.75	0.80722	D	1	B	0.23442	0.085	B	0.23716	0.048	T	0.03112	-1.1071	10	0.39692	T	0.17	-26.6477	12.8095	0.57631	0.0:0.0:0.0:1.0	.	174	Q86WB7	UN93A_HUMAN	P	174	ENSP00000230256:L174P	ENSP00000230256:L174P	L	+	2	0	UNC93A	167631444	0.996000	0.38824	0.143000	0.22291	0.018000	0.09664	5.536000	0.67180	1.948000	0.56530	0.533000	0.62120	CTC	.	.		0.547	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
ERMARD	55780	hgsc.bcm.edu	37	6	170176070	170176070	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:170176070T>C	ENST00000366773.3	+	15	1462	c.1429T>C	c.(1429-1431)Tct>Cct	p.S477P	ERMARD_ENST00000366772.2_Missense_Mutation_p.S477P|ERMARD_ENST00000588451.1_Missense_Mutation_p.S341P|ERMARD_ENST00000418781.3_Missense_Mutation_p.S477P|ERMARD_ENST00000392095.4_Missense_Mutation_p.S351P	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	477					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											TGCCTGCCACTCTTTGATTAC	0.383																																					p.S477P		Atlas-SNP	.											.	C6orf70	63	.	0			c.T1429C						.						110.0	99.0	102.0					6																	170176070		2203	4300	6503	SO:0001583	missense	55780	exon15			TGCCACTCTTTGA	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.1429T>C	chr6.hg19:g.170176070T>C	ENSP00000355735:p.Ser477Pro	105.0	0.0		125.0	5.0	NM_018341	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	ENST00000366773.3	hg19	CCDS34576.1	.	.	.	.	.	.	.	.	.	.	.	10.35	1.326875	0.24080	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781;ENST00000392095;ENST00000366771	T;T	0.46451	0.88;0.87	5.27	-0.153	0.13403	.	0.675743	0.14454	N	0.318575	T	0.15869	0.0382	M	0.70595	2.14	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12156	0.007;0.004;0.002	T	0.17715	-1.0360	10	0.35671	T	0.21	.	1.8222	0.03113	0.2696:0.0838:0.1383:0.5083	.	477;477;477	Q5T6L9-3;Q5T6L9-2;Q5T6L9	.;.;CF070_HUMAN	P	477;477;477;351;125	ENSP00000355735:S477P;ENSP00000375945:S351P	ENSP00000355733:S125P	S	+	1	0	C6orf70	169917995	0.001000	0.12720	0.016000	0.15963	0.016000	0.09150	-0.007000	0.12810	0.383000	0.24910	0.456000	0.33151	TCT	.	.		0.383	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043238.2	NM_018341	
IQCE	23288	hgsc.bcm.edu	37	7	2629557	2629557	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:2629557A>G	ENST00000402050.2	+	14	1245	c.1061A>G	c.(1060-1062)gAg>gGg	p.E354G	IQCE_ENST00000325979.7_Missense_Mutation_p.E289G|IQCE_ENST00000404984.1_Missense_Mutation_p.E303G|IQCE_ENST00000438376.2_Missense_Mutation_p.E338G	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	354						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		AGTGTGATGGAGAGCTCAAAA	0.507																																					p.E354G		Atlas-SNP	.											.	IQCE	66	.	0			c.A1061G						.						52.0	61.0	58.0					7																	2629557		2063	4216	6279	SO:0001583	missense	23288	exon14			TGATGGAGAGCTC	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1061A>G	chr7.hg19:g.2629557A>G	ENSP00000385597:p.Glu354Gly	110.0	0.0		100.0	5.0	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	ENST00000402050.2	hg19	CCDS43542.1	.	.	.	.	.	.	.	.	.	.	A	17.69	3.451979	0.63290	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000427817	T;T;T;T	0.17854	2.27;2.25;2.26;2.26	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.36580	0.0972	L	0.58669	1.825	0.20403	N	0.999903	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.76575	0.948;0.962;0.988;0.942;0.931;0.943	T	0.17228	-1.0376	10	0.66056	D	0.02	-31.5709	11.9375	0.52882	1.0:0.0:0.0:0.0	.	289;338;289;354;354;338	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	G	354;303;338;289;161	ENSP00000385597:E354G;ENSP00000385945:E303G;ENSP00000396178:E338G;ENSP00000313772:E289G	ENSP00000313772:E289G	E	+	2	0	IQCE	2596083	0.997000	0.39634	0.144000	0.22314	0.015000	0.08874	3.231000	0.51294	2.074000	0.62210	0.533000	0.62120	GAG	.	.		0.507	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
GLI3	2737	hgsc.bcm.edu	37	7	42005877	42005877	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:42005877T>A	ENST00000395925.3	-	15	2878	c.2794A>T	c.(2794-2796)Aag>Tag	p.K932*	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	932					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCCGCGTACTTGGCCTTGAGG	0.721									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.K932X		Atlas-SNP	.											.	GLI3	312	.	0			c.A2794T						.						15.0	20.0	18.0					7																	42005877		2189	4277	6466	SO:0001587	stop_gained	2737	exon15	Familial Cancer Database	;	CGTACTTGGCCTT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2794A>T	chr7.hg19:g.42005877T>A	ENSP00000379258:p.Lys932*	68.0	0.0		111.0	9.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Nonsense_Mutation	SNP	ENST00000395925.3	hg19	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	T	41	8.717418	0.98927	.	.	ENSG00000106571	ENST00000395925	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4522	0.67392	0.0:0.0:0.0:1.0	.	.	.	.	X	932	.	ENSP00000379258:K932X	K	-	1	0	GLI3	41972402	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.971000	0.88012	1.798000	0.52647	0.379000	0.24179	AAG	.	.		0.721	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
ABCA13	154664	hgsc.bcm.edu	37	7	48315670	48315670	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:48315670A>G	ENST00000435803.1	+	17	6431	c.6407A>G	c.(6406-6408)gAg>gGg	p.E2136G		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2136					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E2081V(1)|p.E2136V(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TATGCAAATGAGGATTACTCC	0.353																																					p.E2136G		Atlas-SNP	.											ABCA13_ENST00000435803,NS,lymphoid_neoplasm,0,2	ABCA13	1192	.	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.A6407G						.						37.0	32.0	34.0					7																	48315670		1818	4077	5895	SO:0001583	missense	154664	exon17			CAAATGAGGATTA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.6407A>G	chr7.hg19:g.48315670A>G	ENSP00000411096:p.Glu2136Gly	66.0	1.0		71.0	4.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.302426	0.23736	.	.	ENSG00000179869	ENST00000435803	T	0.16457	2.34	4.99	-2.42	0.06542	.	0.943144	0.08766	N	0.897032	T	0.09774	0.0240	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.39800	-0.9596	9	.	.	.	.	6.2881	0.21045	0.4624:0.1511:0.3865:0.0	.	2136	Q86UQ4	ABCAD_HUMAN	G	2136	ENSP00000411096:E2136G	.	E	+	2	0	ABCA13	48286216	0.138000	0.22547	0.000000	0.03702	0.420000	0.31355	0.681000	0.25320	-0.232000	0.09811	0.397000	0.26171	GAG	.	.		0.353	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
SUMF2	25870	hgsc.bcm.edu	37	7	56136261	56136261	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:56136261G>A	ENST00000413756.1	+	2	177	c.154G>A	c.(154-156)Ggg>Agg	p.G52R	SUMF2_ENST00000395436.2_Missense_Mutation_p.G71R|SUMF2_ENST00000434526.2_Missense_Mutation_p.G71R|SUMF2_ENST00000275607.9_Intron|SUMF2_ENST00000342190.6_Missense_Mutation_p.G71R|SUMF2_ENST00000437307.2_Missense_Mutation_p.G52R|SUMF2_ENST00000395435.2_Missense_Mutation_p.G71R			Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2	52					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	14	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AGATGGTGACGGGCCTGTGCG	0.493																																					p.G71R		Atlas-SNP	.											SUMF2_ENST00000342190,NS,carcinoma,0,4	SUMF2	56	.	0			c.G211A						.						69.0	62.0	64.0					7																	56136261		2203	4300	6503	SO:0001583	missense	25870	exon2			GGTGACGGGCCTG	AK075477	CCDS5524.2, CCDS43588.2, CCDS43589.2, CCDS47589.1, CCDS55111.1	7q11.1	2004-04-30			ENSG00000129103	ENSG00000129103			20415	protein-coding gene	gene with protein product		607940				12757706	Standard	NM_015411		Approved	DKFZp566I1024	uc003trv.3	Q8NBJ7	OTTHUMG00000129373	ENST00000413756.1:c.154G>A	chr7.hg19:g.56136261G>A	ENSP00000406445:p.Gly52Arg	98.0	0.0		112.0	0.0	NM_015411	B4DU41|B4DWQ0|Q14DW5|Q53ZE3|Q96BH2|Q9BRN3|Q9BWI1|Q9Y405	Missense_Mutation	SNP	ENST00000413756.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.99	2.102779	0.37145	.	.	ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000395435;ENST00000413952;ENST00000342190;ENST00000437307;ENST00000413756;ENST00000451338	D;D;D;D;D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38;-3.38;-3.38;-3.38;-3.38	5.01	4.13	0.48395	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.276505	0.41712	D	0.000834	D	0.93331	0.7874	L	0.31845	0.965	0.80722	D	1	P;D;D;D;D;D	0.89917	0.868;0.999;0.966;0.999;1.0;1.0	P;P;B;P;D;D	0.72075	0.483;0.887;0.308;0.87;0.96;0.976	D	0.92822	0.6273	10	0.66056	D	0.02	-15.0969	8.9043	0.35515	0.1732:0.0:0.8268:0.0	.	52;71;71;52;71;71	Q8NBJ7-5;A8MXB9;E7EMF9;Q8NBJ7;F8WA42;C9JL30	.;.;.;SUMF2_HUMAN;.;.	R	71;71;71;71;71;52;52;49	ENSP00000378824:G71R;ENSP00000400922:G71R;ENSP00000378823:G71R;ENSP00000414434:G71R;ENSP00000341938:G71R;ENSP00000415989:G52R;ENSP00000406445:G52R;ENSP00000410796:G49R	ENSP00000341938:G71R	G	+	1	0	SUMF2	56103755	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	2.971000	0.49248	1.248000	0.43934	0.484000	0.47621	GGG	.	.		0.493	SUMF2-013	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000341457.2	NM_015411	
GSAP	54103	hgsc.bcm.edu	37	7	76990177	76990177	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:76990177A>G	ENST00000257626.7	-	14	1069	c.991T>C	c.(991-993)Tca>Cca	p.S331P		NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	331					positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										GTCATGTGTGACCCAACATTC	0.458																																					p.S331P		Atlas-SNP	.											.	PION	74	.	0			c.T991C						.						228.0	188.0	201.0					7																	76990177		2203	4300	6503	SO:0001583	missense	54103	exon14			TGTGTGACCCAAC		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.991T>C	chr7.hg19:g.76990177A>G	ENSP00000257626:p.Ser331Pro	219.0	0.0		93.0	4.0	NM_017439	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	hg19	CCDS34672.2	.	.	.	.	.	.	.	.	.	.	A	11.76	1.734723	0.30774	.	.	ENSG00000186088	ENST00000257626	T	0.19669	2.13	5.98	2.25	0.28309	.	0.532611	0.17215	U	0.182580	T	0.14227	0.0344	L	0.41236	1.265	0.09310	N	1	B;B	0.14438	0.01;0.004	B;B	0.11329	0.006;0.006	T	0.15292	-1.0442	10	0.33141	T	0.24	.	4.4751	0.11731	0.6973:0.0:0.1576:0.1451	.	331;331	A4D1B5-3;A4D1B5	.;GSAP_HUMAN	P	331	ENSP00000257626:S331P	ENSP00000257626:S331P	S	-	1	0	PION	76828113	0.838000	0.29461	0.099000	0.21106	0.031000	0.12232	1.769000	0.38522	1.097000	0.41459	0.482000	0.46254	TCA	.	.		0.458	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
PCLO	27445	hgsc.bcm.edu	37	7	82476475	82476475	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:82476475T>G	ENST00000333891.9	-	11	14080	c.13743A>C	c.(13741-13743)gaA>gaC	p.E4581D	PCLO_ENST00000423517.2_Missense_Mutation_p.E4581D|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.E4581E(2)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATATTTCTGCTTCCCCACTTT	0.358																																					p.E4581D		Atlas-SNP	.											PCLO_ENST00000333891,NS,carcinoma,0,2	PCLO	1506	.	2	Substitution - coding silent(2)	endometrium(2)	c.A13743C						.						119.0	116.0	117.0					7																	82476475		1865	4095	5960	SO:0001583	missense	27445	exon11			TTCTGCTTCCCCA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13743A>C	chr7.hg19:g.82476475T>G	ENSP00000334319:p.Glu4581Asp	35.0	0.0		26.0	2.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	12.54	1.969477	0.34754	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.19806	2.14;2.12	5.6	5.6	0.85130	.	.	.	.	.	T	0.45458	0.1343	M	0.79258	2.445	0.80722	D	1	D;D;D	0.69078	0.988;0.988;0.997	D;D;D	0.79108	0.98;0.98;0.992	T	0.47799	-0.9089	9	0.87932	D	0	.	10.1804	0.42963	0.0:0.0745:0.0:0.9255	.	4581;4581;78	Q9Y6V0-5;Q9Y6V0-6;Q32P40	.;.;.	D	4581;4581;77	ENSP00000334319:E4581D;ENSP00000388393:E4581D	ENSP00000334319:E4581D	E	-	3	2	PCLO	82314411	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.937000	0.40193	2.134000	0.65973	0.383000	0.25322	GAA	.	.		0.358	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu	37	7	82578936	82578936	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:82578936T>C	ENST00000333891.9	-	6	11305	c.10968A>G	c.(10966-10968)gtA>gtG	p.V3656V	PCLO_ENST00000423517.2_Silent_p.V3656V|PCLO_ENST00000437081.1_Silent_p.V376V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTGGATGCAGTACTTTCTGTG	0.473																																					p.V3656V		Atlas-SNP	.											.	PCLO	1506	.	0			c.A10968G						.						192.0	187.0	189.0					7																	82578936		1925	4125	6050	SO:0001819	synonymous_variant	27445	exon6			ATGCAGTACTTTC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10968A>G	chr7.hg19:g.82578936T>C		175.0	0.0		90.0	4.0	NM_014510		Silent	SNP	ENST00000333891.9	hg19	CCDS47630.1																																																																																			.	.		0.473	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
SEMA3E	9723	hgsc.bcm.edu	37	7	83029465	83029465	+	Silent	SNP	T	T	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:83029465T>G	ENST00000307792.3	-	11	1712	c.1245A>C	c.(1243-1245)atA>atC	p.I415I	SEMA3E_ENST00000427262.1_Silent_p.I355I	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	415	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GGGCAGGTTTTATGGCCTGGT	0.423																																					p.I415I		Atlas-SNP	.											.	SEMA3E	125	.	0			c.A1245C						.						204.0	185.0	191.0					7																	83029465		2203	4300	6503	SO:0001819	synonymous_variant	9723	exon11			AGGTTTTATGGCC	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1245A>C	chr7.hg19:g.83029465T>G		403.0	0.0		178.0	157.0	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	hg19	CCDS34674.1																																																																																			.	.		0.423	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
RBM48	84060	hgsc.bcm.edu	37	7	92163807	92163807	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:92163807T>C	ENST00000265732.5	+	4	581	c.540T>C	c.(538-540)tgT>tgC	p.C180C	RBM48_ENST00000481551.1_Silent_p.C180C	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	180						nucleus (GO:0005634)	RNA binding (GO:0003723)										CTGGATTTTGTAAAGCTGCTT	0.363																																					p.C180C		Atlas-SNP	.											.	.	.	.	0			c.T540C						.						127.0	112.0	116.0					7																	92163807		1847	4096	5943	SO:0001819	synonymous_variant	84060	exon4			ATTTTGTAAAGCT	AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.540T>C	chr7.hg19:g.92163807T>C		114.0	0.0		65.0	4.0	NM_032120	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Silent	SNP	ENST00000265732.5	hg19	CCDS43615.1																																																																																			.	.		0.363	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356076.1	NM_032120	
TAF6	6878	hgsc.bcm.edu	37	7	99707891	99707891	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:99707891C>T	ENST00000344095.4	-	11	1615	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M	TAF6_ENST00000437822.2_Missense_Mutation_p.V401M|TAF6_ENST00000472509.1_Missense_Mutation_p.V421M|TAF6_ENST00000452041.1_Missense_Mutation_p.V364M|TAF6_ENST00000418432.2_Missense_Mutation_p.V288M|TAF6_ENST00000453269.2_Missense_Mutation_p.V364M|AP4M1_ENST00000421755.1_3'UTR	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	364					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCTCGTCCACCCAGCTCTGT	0.507																																					p.V401M		Atlas-SNP	.											.	TAF6	55	.	0			c.G1201A						.						153.0	154.0	153.0					7																	99707891		2203	4300	6503	SO:0001583	missense	6878	exon11			CGTCCACCCAGCT		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1090G>A	chr7.hg19:g.99707891C>T	ENSP00000344537:p.Val364Met	119.0	0.0		51.0	4.0	NM_001190415	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	ENST00000344095.4	hg19	CCDS5686.1	.	.	.	.	.	.	.	.	.	.	c	16.82	3.228220	0.58777	.	.	ENSG00000106290	ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822	T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.24	4.36	0.52297	Domain of unknown function DUF1546 (1);	0.207592	0.41396	D	0.000893	T	0.56108	0.1963	N	0.11064	0.09	0.35234	D	0.777172	D;P;P;P;D	0.54601	0.967;0.891;0.911;0.852;0.967	P;B;P;P;P	0.52909	0.646;0.376;0.51;0.51;0.713	T	0.64888	-0.6301	10	0.31617	T	0.26	-18.2586	11.8099	0.52177	0.0:0.9155:0.0:0.0845	.	401;364;354;364;288	B4DT11;P49848-2;A4D299;P49848;B3KUR4	.;.;.;TAF6_HUMAN;.	M	364;421;364;364;288;401	ENSP00000389575:V364M;ENSP00000419760:V421M;ENSP00000416396:V364M;ENSP00000344537:V364M;ENSP00000407980:V288M;ENSP00000399982:V401M	ENSP00000344537:V364M	V	-	1	0	TAF6	99545827	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.395000	0.44459	1.438000	0.47492	0.556000	0.70494	GTG	.	.		0.507	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
EPHB4	2050	hgsc.bcm.edu	37	7	100417891	100417891	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:100417891A>G	ENST00000358173.3	-	5	1304	c.836T>C	c.(835-837)cTg>cCg	p.L279P	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000477446.1_5'UTR|EPHB4_ENST00000360620.3_Missense_Mutation_p.L279P	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	279	Cys-rich.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					TTCTCCTGACAGGGGCTTGAA	0.587																																					p.L279P	GBM(200;2113 3072 25865 52728)	Atlas-SNP	.											.	EPHB4	106	.	0			c.T836C						.						106.0	121.0	116.0					7																	100417891		2203	4300	6503	SO:0001583	missense	2050	exon5			CCTGACAGGGGCT	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.836T>C	chr7.hg19:g.100417891A>G	ENSP00000350896:p.Leu279Pro	74.0	0.0		42.0	4.0	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	ENST00000358173.3	hg19	CCDS5706.1	.	.	.	.	.	.	.	.	.	.	A	10.15	1.270609	0.23221	.	.	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.15487	2.42;2.42	5.35	2.86	0.33363	Tyrosine-protein kinase ephrin type A/B receptor-like (1);	0.592988	0.13804	N	0.361588	T	0.14313	0.0346	L	0.41573	1.285	0.09310	N	0.999999	P;P;B;B	0.35821	0.523;0.523;0.202;0.355	B;B;B;B	0.35859	0.212;0.14;0.089;0.129	T	0.14727	-1.0462	10	0.37606	T	0.19	.	8.6553	0.34060	0.4441:0.0:0.0:0.5559	.	279;279;279;279	B5A972;B5A970;Q96L35;P54760	.;.;.;EPHB4_HUMAN	P	279	ENSP00000353833:L279P;ENSP00000350896:L279P	ENSP00000350896:L279P	L	-	2	0	EPHB4	100255827	0.003000	0.15002	0.220000	0.23810	0.983000	0.72400	1.087000	0.30865	0.290000	0.22444	0.533000	0.62120	CTG	.	.		0.587	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
CUX1	1523	hgsc.bcm.edu	37	7	101833103	101833103	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:101833103A>G	ENST00000292535.7	+	12	1066	c.1028A>G	c.(1027-1029)gAa>gGa	p.E343G	CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000550008.2_Missense_Mutation_p.E343G|CUX1_ENST00000556210.1_Missense_Mutation_p.E343G|CUX1_ENST00000546411.2_Missense_Mutation_p.E343G|CUX1_ENST00000425244.2_Missense_Mutation_p.E308G|CUX1_ENST00000547394.2_Missense_Mutation_p.E338G|CUX1_ENST00000292538.4_Missense_Mutation_p.E354G|CUX1_ENST00000437600.4_Missense_Mutation_p.E352G|CUX1_ENST00000549414.2_Missense_Mutation_p.E343G|CUX1_ENST00000360264.3_Missense_Mutation_p.E354G|CUX1_ENST00000393824.3_Missense_Mutation_p.E315G	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	343					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CAACTGGAAGAAAAACTCAAA	0.537																																					p.E354G		Atlas-SNP	.											.	CUX1	253	.	0			c.A1061G						.						101.0	99.0	100.0					7																	101833103		2203	4300	6503	SO:0001583	missense	1523	exon12			TGGAAGAAAAACT	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1028A>G	chr7.hg19:g.101833103A>G	ENSP00000292535:p.Glu343Gly	162.0	0.0		100.0	4.0	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	A	18.94	3.728807	0.69074	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.62232	1.39;1.39;0.04;1.42;1.39;0.06;0.06;0.08;0.13;0.13	4.94	4.94	0.65067	.	0.117279	0.56097	D	0.000023	T	0.67702	0.2921	L	0.43923	1.385	0.58432	D	0.999997	P;D;P;P;P;P;D	0.58268	0.932;0.97;0.953;0.864;0.949;0.932;0.982	B;P;P;P;B;P;P	0.58077	0.345;0.683;0.631;0.514;0.31;0.468;0.832	T	0.69347	-0.5169	10	0.51188	T	0.08	-26.8634	13.4706	0.61279	1.0:0.0:0.0:0.0	.	315;343;308;338;352;354;354	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	G	354;338;354;308;352;343;343;343;343;343	ENSP00000292538:E354G;ENSP00000449371:E338G;ENSP00000353401:E354G;ENSP00000409745:E308G;ENSP00000414091:E352G;ENSP00000292535:E343G;ENSP00000446630:E343G;ENSP00000447373:E343G;ENSP00000450125:E343G;ENSP00000451558:E343G	ENSP00000292535:E343G	E	+	2	0	CUX1	101619823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.967000	0.76079	1.967000	0.57214	0.459000	0.35465	GAA	.	.		0.537	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
CUX1	1523	hgsc.bcm.edu	37	7	101837150	101837150	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:101837150T>A	ENST00000292535.7	+	13	1143	c.1105T>A	c.(1105-1107)Tcc>Acc	p.S369T	CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000550008.2_Missense_Mutation_p.S369T|CUX1_ENST00000556210.1_Missense_Mutation_p.S369T|CUX1_ENST00000546411.2_Missense_Mutation_p.S369T|CUX1_ENST00000425244.2_Missense_Mutation_p.S334T|CUX1_ENST00000547394.2_Missense_Mutation_p.S364T|CUX1_ENST00000292538.4_Missense_Mutation_p.S380T|CUX1_ENST00000437600.4_Missense_Mutation_p.S378T|CUX1_ENST00000549414.2_Missense_Mutation_p.S369T|CUX1_ENST00000360264.3_Missense_Mutation_p.S380T|CUX1_ENST00000393824.3_Missense_Mutation_p.S341T|SNORA48_ENST00000517015.1_RNA	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	369					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GTTTGCACCGTCCGAGGGCGC	0.527																																					p.S380T		Atlas-SNP	.											CUX1_ENST00000292538,NS,carcinoma,0,2	CUX1	253	.	0			c.T1138A						.						82.0	68.0	73.0					7																	101837150		2203	4300	6503	SO:0001583	missense	1523	exon13			GCACCGTCCGAGG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1105T>A	chr7.hg19:g.101837150T>A	ENSP00000292535:p.Ser369Thr	94.0	0.0		58.0	0.0	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	T	1.936	-0.444817	0.04604	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.61510	1.47;1.46;0.1;1.49;1.48;0.11;0.11;0.13;0.2;0.19	5.71	1.86	0.25419	.	0.191530	0.46758	D	0.000274	T	0.46014	0.1371	L	0.42245	1.32	0.22446	N	0.999094	B;B;B;B;B;B;B	0.30361	0.112;0.044;0.094;0.006;0.277;0.006;0.073	B;B;B;B;B;B;B	0.30495	0.033;0.014;0.024;0.012;0.116;0.005;0.053	T	0.34453	-0.9828	10	0.46703	T	0.11	-6.7303	8.9888	0.36010	0.0:0.0646:0.3714:0.564	.	341;369;334;364;378;380;380	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	T	380;364;380;334;378;369;369;369;369;369	ENSP00000292538:S380T;ENSP00000449371:S364T;ENSP00000353401:S380T;ENSP00000409745:S334T;ENSP00000414091:S378T;ENSP00000292535:S369T;ENSP00000446630:S369T;ENSP00000447373:S369T;ENSP00000450125:S369T;ENSP00000451558:S369T	ENSP00000292535:S369T	S	+	1	0	CUX1	101623870	0.139000	0.22563	0.005000	0.12908	0.890000	0.51754	0.438000	0.21559	0.072000	0.16694	0.459000	0.35465	TCC	.	.		0.527	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
KMT2E	55904	hgsc.bcm.edu	37	7	104742347	104742347	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:104742347A>G	ENST00000311117.3	+	17	2447	c.1902A>G	c.(1900-1902)gaA>gaG	p.E634E	KMT2E_ENST00000334877.4_Silent_p.E634E|KMT2E_ENST00000257745.4_Silent_p.E634E|CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	634					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.E634E(1)									AAGCAAAAGAAGAAAATGCTA	0.353																																					p.E634E		Atlas-SNP	.											MLL5,NS,carcinoma,0,1	MLL5	173	.	1	Substitution - coding silent(1)	lung(1)	c.A1902G						.						35.0	38.0	37.0					7																	104742347		2201	4298	6499	SO:0001819	synonymous_variant	55904	exon16			AAAAGAAGAAAAT	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.1902A>G	chr7.hg19:g.104742347A>G		69.0	0.0		40.0	3.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	ENST00000311117.3	hg19	CCDS34723.1																																																																																			.	.		0.353	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
FOXP2	93986	hgsc.bcm.edu	37	7	114174697	114174697	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:114174697T>C	ENST00000393494.2	+	3	473	c.194T>C	c.(193-195)cTt>cCt	p.L65P	FOXP2_ENST00000390668.3_Missense_Mutation_p.L64P|FOXP2_ENST00000403559.4_Missense_Mutation_p.L65P|FOXP2_ENST00000350908.4_Missense_Mutation_p.L65P|FOXP2_ENST00000393489.3_5'UTR|FOXP2_ENST00000459666.1_3'UTR|FOXP2_ENST00000408937.3_Missense_Mutation_p.L65P|FOXP2_ENST00000378237.3_Missense_Mutation_p.L65P|FOXP2_ENST00000360232.4_Missense_Mutation_p.L65P|FOXP2_ENST00000393500.3_5'UTR|FOXP2_ENST00000393498.2_Missense_Mutation_p.L65P			O15409	FOXP2_HUMAN	forkhead box P2	65	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						AGACAACTTCTTTTACAGCAG	0.363																																					p.L65P		Atlas-SNP	.											.	FOXP2	133	.	0			c.T194C						.						125.0	130.0	128.0					7																	114174697		2203	4300	6503	SO:0001583	missense	93986	exon2			AACTTCTTTTACA	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.194T>C	chr7.hg19:g.114174697T>C	ENSP00000377132:p.Leu65Pro	174.0	0.0		99.0	4.0	NM_001172767	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	hg19	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.992796	0.54041	.	.	ENSG00000128573	ENST00000324462;ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000378237;ENST00000360232;ENST00000452963;ENST00000390668	T;D;T;T;T;T;T	0.94497	1.32;-3.44;1.56;1.32;1.32;1.32;-0.63	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000004	D	0.96617	0.8896	M	0.65498	2.005	0.80722	D	1	D;P;P;P;D;D;D	0.89917	1.0;0.662;0.535;0.925;1.0;1.0;0.99	D;B;P;P;D;D;P	0.91635	0.997;0.353;0.556;0.677;0.997;0.999;0.836	D	0.97237	0.9888	10	0.87932	D	0	.	15.0588	0.71936	0.0:0.0:0.0:1.0	.	65;65;65;64;65;65;65	B7ZLK5;B4DLD9;O15409-6;Q8N6B5;O15409;O15409-4;O15409-5	.;.;.;.;FOXP2_HUMAN;.;.	P	65;65;65;65;65;65;65;65;65;64	ENSP00000377132:L65P;ENSP00000386200:L65P;ENSP00000385069:L65P;ENSP00000265436:L65P;ENSP00000367482:L65P;ENSP00000353367:L65P;ENSP00000375084:L64P	ENSP00000319424:L65P	L	+	2	0	FOXP2	113961933	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.236000	0.78154	1.984000	0.57885	0.528000	0.53228	CTT	.	.		0.363	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
CAPZA2	830	hgsc.bcm.edu	37	7	116557794	116557794	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:116557794A>G	ENST00000361183.3	+	10	873	c.734A>G	c.(733-735)gAg>gGg	p.E245G	CAPZA2_ENST00000458284.2_3'UTR	NM_006136.2	NP_006127.1	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line, alpha 2	245					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|WASH complex (GO:0071203)				endometrium(2)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	13	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			GCCATCAGTGAGAATTATCAG	0.348																																					p.E245G		Atlas-SNP	.											.	CAPZA2	29	.	0			c.A734G						.						140.0	134.0	136.0					7																	116557794		2203	4300	6503	SO:0001583	missense	830	exon10			TCAGTGAGAATTA		CCDS5768.1	7q31.2-q31.3	2008-07-18			ENSG00000198898	ENSG00000198898			1490	protein-coding gene	gene with protein product	"""F-actin capping protein alpha-2 subunit"""	601571					Standard	NM_006136		Approved	CAPZ, CAPPA2	uc003vil.3	P47755	OTTHUMG00000023185	ENST00000361183.3:c.734A>G	chr7.hg19:g.116557794A>G	ENSP00000354947:p.Glu245Gly	161.0	0.0		94.0	5.0	NM_006136	B4DG50	Missense_Mutation	SNP	ENST00000361183.3	hg19	CCDS5768.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.000519	0.74818	.	.	ENSG00000198898	ENST00000361183	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.85017	0.5601	M	0.90977	3.165	0.80722	D	1	D	0.61080	0.989	D	0.68943	0.961	D	0.88577	0.3134	9	0.87932	D	0	-14.6346	15.8386	0.78824	1.0:0.0:0.0:0.0	.	245	P47755	CAZA2_HUMAN	G	245	.	ENSP00000354947:E245G	E	+	2	0	CAPZA2	116345030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.245000	0.95431	2.135000	0.66039	0.383000	0.25322	GAG	.	.		0.348	CAPZA2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059506.4	NM_006136	
KCND2	3751	hgsc.bcm.edu	37	7	119915322	119915322	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:119915322C>T	ENST00000331113.4	+	1	1601	c.636C>T	c.(634-636)agC>agT	p.S212S		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	212					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	GCGGATCAAGCCCAGGTCACA	0.532																																					p.S212S		Atlas-SNP	.											.	KCND2	194	.	0			c.C636T						.						118.0	108.0	112.0					7																	119915322		2203	4300	6503	SO:0001819	synonymous_variant	3751	exon1			ATCAAGCCCAGGT	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.636C>T	chr7.hg19:g.119915322C>T		225.0	0.0		98.0	4.0	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	ENST00000331113.4	hg19	CCDS5776.1																																																																																			.	.		0.532	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
CADPS2	93664	hgsc.bcm.edu	37	7	122255249	122255249	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:122255249T>C	ENST00000449022.2	-	6	1228	c.1209A>G	c.(1207-1209)gaA>gaG	p.E403E	CADPS2_ENST00000412584.2_Silent_p.E403E|CADPS2_ENST00000334010.7_Silent_p.E403E|CADPS2_ENST00000313070.7_Silent_p.E403E	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	403	C2.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						GCCTTGAGGCTTCGGCCTGGT	0.398																																					p.E403E		Atlas-SNP	.											.	CADPS2	116	.	0			c.A1209G						.						81.0	73.0	75.0					7																	122255249		1874	4092	5966	SO:0001819	synonymous_variant	93664	exon6			TGAGGCTTCGGCC		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1209A>G	chr7.hg19:g.122255249T>C		156.0	0.0		62.0	4.0	NM_001167940	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Silent	SNP	ENST00000449022.2	hg19	CCDS55158.1	.	.	.	.	.	.	.	.	.	.	T	9.230	1.035672	0.19590	.	.	ENSG00000081803	ENST00000397721	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	T	0.61553	0.2356	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60855	-0.7180	4	.	.	.	-21.3133	10.1681	0.42893	0.0:0.0746:0.0:0.9254	.	.	.	.	G	52	.	.	S	-	1	0	CADPS2	122042485	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.996000	0.40776	2.136000	0.66102	0.533000	0.62120	AGC	.	.		0.398	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
GRM8	2918	hgsc.bcm.edu	37	7	126409939	126409939	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:126409939A>G	ENST00000339582.2	-	7	2145	c.1337T>C	c.(1336-1338)aTt>aCt	p.I446T	GRM8_ENST00000358373.3_Missense_Mutation_p.I446T|GRM8_ENST00000405249.1_Missense_Mutation_p.I446T|GRM8_ENST00000444921.2_Missense_Mutation_p.I446T|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	446					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TACAGCCCGAATATAACCAAG	0.413										HNSCC(24;0.065)																											p.I446T		Atlas-SNP	.											.	GRM8	377	.	0			c.T1337C						.						119.0	110.0	113.0					7																	126409939		2203	4300	6503	SO:0001583	missense	2918	exon6			GCCCGAATATAAC		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1337T>C	chr7.hg19:g.126409939A>G	ENSP00000344173:p.Ile446Thr	128.0	0.0		61.0	4.0	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	hg19	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.320245	0.81469	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27	5.78	5.78	0.91487	Extracellular ligand-binding receptor (1);	0.054564	0.64402	D	0.000001	D	0.94079	0.8102	M	0.89095	3.005	0.80722	D	1	D;P;D	0.61080	0.989;0.763;0.98	D;B;P	0.67103	0.949;0.085;0.772	D	0.95024	0.8163	10	0.87932	D	0	.	15.287	0.73835	1.0:0.0:0.0:0.0	.	446;446;446	O00222-3;O00222-2;O00222	.;.;GRM8_HUMAN	T	446	ENSP00000344173:I446T;ENSP00000409790:I446T;ENSP00000351142:I446T;ENSP00000385731:I446T	ENSP00000344173:I446T	I	-	2	0	GRM8	126197175	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.335000	0.96500	2.190000	0.69967	0.533000	0.62120	ATT	.	.		0.413	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
CHRM2	1129	hgsc.bcm.edu	37	7	136699964	136699964	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:136699964A>G	ENST00000445907.2	+	3	880	c.352A>G	c.(352-354)Agc>Ggc	p.S118G	hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.S118G|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.S118G|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000453373.1_Missense_Mutation_p.S118G|CHRM2_ENST00000401861.1_Missense_Mutation_p.S118G|CHRM2_ENST00000402486.3_Missense_Mutation_p.S118G|hsa-mir-490_ENST00000439694.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	118					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GCTCATCATCAGCTTTGACAG	0.502																																					p.S118G		Atlas-SNP	.											.	CHRM2	167	.	0			c.A352G						.						139.0	131.0	133.0					7																	136699964		2203	4300	6503	SO:0001583	missense	1129	exon3			ATCATCAGCTTTG		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.352A>G	chr7.hg19:g.136699964A>G	ENSP00000399745:p.Ser118Gly	195.0	0.0		97.0	4.0	NM_001006632	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	hg19	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.759649	0.69763	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44	5.61	5.61	0.85477	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.90800	0.7111	M	0.90425	3.115	0.80722	D	1	D	0.65815	0.995	D	0.63877	0.919	D	0.92708	0.6180	10	0.87932	D	0	-12.7738	15.8611	0.79021	1.0:0.0:0.0:0.0	.	118	P08172	ACM2_HUMAN	G	118	ENSP00000399745:S118G;ENSP00000415386:S118G;ENSP00000319984:S118G;ENSP00000380733:S118G;ENSP00000384937:S118G;ENSP00000384401:S118G	ENSP00000319984:S118G	S	+	1	0	CHRM2	136350504	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.281000	0.95811	2.145000	0.66743	0.529000	0.55759	AGC	.	.		0.502	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
OR9A4	130075	hgsc.bcm.edu	37	7	141618691	141618691	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:141618691T>C	ENST00000548136.1	+	1	75	c.16T>C	c.(16-18)Tct>Cct	p.S6P	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					GATGAATTACTCTAGTGCCAC	0.358																																					p.S6P		Atlas-SNP	.											.	OR9A4	58	.	0			c.T16C						.						196.0	196.0	196.0					7																	141618691		2031	4193	6224	SO:0001583	missense	130075	exon1			AATTACTCTAGTG		CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.16T>C	chr7.hg19:g.141618691T>C	ENSP00000448789:p.Ser6Pro	138.0	0.0		85.0	4.0	NM_001001656	B9EGV6|Q6IFI4	Missense_Mutation	SNP	ENST00000548136.1	hg19	CCDS43661.1	.	.	.	.	.	.	.	.	.	.	.	14.49	2.552376	0.45487	.	.	ENSG00000258083	ENST00000548136	T	0.54479	0.57	3.88	1.28	0.21552	.	.	.	.	.	T	0.64283	0.2584	M	0.87038	2.855	0.09310	N	1	P	0.45634	0.863	P	0.52909	0.713	T	0.56220	-0.8015	9	0.87932	D	0	-7.2456	4.1593	0.10275	0.3796:0.0:0.1811:0.4393	.	6	Q8NGU2	OR9A4_HUMAN	P	6	ENSP00000448789:S6P	ENSP00000386148:S6P	S	+	1	0	OR9A4	141265160	0.000000	0.05858	0.072000	0.20136	0.853000	0.48598	0.127000	0.15790	0.136000	0.18733	0.523000	0.50628	TCT	.	.		0.358	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656	
PRKAG2	51422	hgsc.bcm.edu	37	7	151372542	151372542	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:151372542T>C	ENST00000287878.4	-	4	1152	c.648A>G	c.(646-648)ccA>ccG	p.P216P	PRKAG2_ENST00000492843.1_Silent_p.P92P|PRKAG2_ENST00000433631.2_Silent_p.P92P|PRKAG2_ENST00000392801.2_Silent_p.P172P|PRKAG2_ENST00000461529.1_5'Flank	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	216					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	GTGATGCCAGTGGAGGCCTGG	0.617																																					p.P216P		Atlas-SNP	.											.	PRKAG2	86	.	0			c.A648G						.						53.0	51.0	52.0					7																	151372542		2203	4300	6503	SO:0001819	synonymous_variant	51422	exon4			TGCCAGTGGAGGC	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.648A>G	chr7.hg19:g.151372542T>C		162.0	0.0		71.0	59.0	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Silent	SNP	ENST00000287878.4	hg19	CCDS5928.1																																																																																			.	.		0.617	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
CSMD1	64478	hgsc.bcm.edu	37	8	3216824	3216824	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:3216824C>A	ENST00000520002.1	-	22	3712	c.3157G>T	c.(3157-3159)Gcc>Tcc	p.A1053S	CSMD1_ENST00000602557.1_Missense_Mutation_p.A1053S|CSMD1_ENST00000539096.1_Missense_Mutation_p.A1052S|CSMD1_ENST00000400186.3_Missense_Mutation_p.A1053S|CSMD1_ENST00000537824.1_Missense_Mutation_p.A1052S|CSMD1_ENST00000542608.1_Missense_Mutation_p.A1052S|CSMD1_ENST00000602723.1_Missense_Mutation_p.A1053S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1053	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGGCTGAAGGCAGGGACTCCA	0.458																																					p.A1052S		Atlas-SNP	.											.	CSMD1	1469	.	0			c.G3154T						.						54.0	60.0	58.0					8																	3216824		2195	4299	6494	SO:0001583	missense	64478	exon21			TGAAGGCAGGGAC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3157G>T	chr8.hg19:g.3216824C>A	ENSP00000430733:p.Ala1053Ser	151.0	0.0		86.0	72.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	15.00|15.00	2.704479|2.704479	0.48412|0.48412	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.62788|.	0.0;0.0;0.0;0.0;0.0|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.64402|.	U|.	0.000001|.	T|T	0.55465|0.55465	0.1922|0.1922	N|N	0.25245|0.25245	0.725|0.725	0.47407|0.47407	D|D	0.999414|0.999414	P;B;P|.	0.40681|.	0.727;0.132;0.564|.	B;B;P|.	0.45753|.	0.214;0.223;0.492|.	T|T	0.51100|0.51100	-0.8748|-0.8748	10|5	0.15952|.	T|.	0.53|.	.|.	18.8469|18.8469	0.92210|0.92210	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1053;1053;1053|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	S|F	1053;1053;915;1052;1052;1052|532	ENSP00000383047:A1053S;ENSP00000430733:A1053S;ENSP00000441462:A1052S;ENSP00000446243:A1052S;ENSP00000441675:A1052S|.	ENSP00000320445:A915S|.	A|C	-|-	1|2	0|0	CSMD1|CSMD1	3204231|3204231	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	3.085000|3.085000	0.50151|0.50151	2.432000|2.432000	0.82394|0.82394	0.550000|0.550000	0.68814|0.68814	GCC|TGC	.	.		0.458	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
RP1L1	94137	hgsc.bcm.edu	37	8	10480616	10480616	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:10480616T>C	ENST00000382483.3	-	2	319	c.96A>G	c.(94-96)ccA>ccG	p.P32P	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	32					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCTTCTTGGCTGGCGTGACCT	0.642																																					p.P32P		Atlas-SNP	.											.	RP1L1	453	.	0			c.A96G						.						40.0	45.0	43.0					8																	10480616		2061	4180	6241	SO:0001819	synonymous_variant	94137	exon2			CTTGGCTGGCGTG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.96A>G	chr8.hg19:g.10480616T>C		134.0	0.0		71.0	4.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	hg19	CCDS43708.1																																																																																			.	.		0.642	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
MTUS1	57509	hgsc.bcm.edu	37	8	17611715	17611715	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:17611715A>G	ENST00000262102.6	-	2	1826	c.1602T>C	c.(1600-1602)ccT>ccC	p.P534P	MTUS1_ENST00000381869.3_Silent_p.P534P|MTUS1_ENST00000381862.3_Silent_p.P534P|MTUS1_ENST00000519263.1_Silent_p.P534P	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	534					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TGGTCTGCTGAGGTCTGGGCG	0.453																																					p.P534P		Atlas-SNP	.											.	MTUS1	144	.	0			c.T1602C						.						207.0	200.0	202.0					8																	17611715		2069	4201	6270	SO:0001819	synonymous_variant	57509	exon2			CTGCTGAGGTCTG	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.1602T>C	chr8.hg19:g.17611715A>G		176.0	0.0		94.0	4.0	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Silent	SNP	ENST00000262102.6	hg19	CCDS43717.1																																																																																			.	.		0.453	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
DPYSL2	1808	hgsc.bcm.edu	37	8	26435798	26435798	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:26435798C>T	ENST00000311151.5	+	1	440	c.28C>T	c.(28-30)Cca>Tca	p.P10S	DPYSL2_ENST00000523027.1_5'Flank|DPYSL2_ENST00000521913.1_Intron	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	10					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)			breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		GAAAAATATTCCACGCATCAC	0.458																																					p.P10S		Atlas-SNP	.											.	DPYSL2	49	.	0			c.C28T						.						77.0	81.0	80.0					8																	26435798		2203	4300	6503	SO:0001583	missense	1808	exon1			AATATTCCACGCA	D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.28C>T	chr8.hg19:g.26435798C>T	ENSP00000309539:p.Pro10Ser	60.0	0.0		25.0	4.0	NM_001386	A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	hg19	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	C	18.63	3.664595	0.67700	.	.	ENSG00000092964	ENST00000311151;ENST00000522745	D;D	0.85411	-1.98;-1.98	5.42	5.42	0.78866	.	0.059187	0.64402	D	0.000002	D	0.91520	0.7322	M	0.68593	2.085	0.80722	D	1	B;D	0.63880	0.177;0.993	B;D	0.70227	0.097;0.968	D	0.92189	0.5758	10	0.87932	D	0	-5.0952	18.0367	0.89305	0.0:1.0:0.0:0.0	.	10;10	Q53ET2;Q16555	.;DPYL2_HUMAN	S	10	ENSP00000309539:P10S;ENSP00000428909:P10S	ENSP00000309539:P10S	P	+	1	0	DPYSL2	26491715	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.183000	0.72002	2.562000	0.86427	0.549000	0.68633	CCA	.	.		0.458	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386	
SCARA5	286133	hgsc.bcm.edu	37	8	27823939	27823939	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:27823939A>G	ENST00000354914.3	-	3	718	c.233T>C	c.(232-234)aTc>aCc	p.I78T	SCARA5_ENST00000301906.4_Intron|SCARA5_ENST00000524352.1_Missense_Mutation_p.I78T|SCARA5_ENST00000380385.2_Missense_Mutation_p.I78T|SCARA5_ENST00000518030.1_Intron	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	78					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		ACCTGCTAAGATGAAGATGCC	0.542																																					p.I78T		Atlas-SNP	.											.	SCARA5	53	.	0			c.T233C						.						71.0	72.0	72.0					8																	27823939		2203	4300	6503	SO:0001583	missense	286133	exon3			GCTAAGATGAAGA	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.233T>C	chr8.hg19:g.27823939A>G	ENSP00000346990:p.Ile78Thr	172.0	0.0		113.0	5.0	NM_173833	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	ENST00000354914.3	hg19	CCDS6064.1	.	.	.	.	.	.	.	.	.	.	A	19.39	3.819373	0.71028	.	.	ENSG00000168079	ENST00000354914;ENST00000380385;ENST00000524352	D;D;D	0.94000	-2.61;-3.33;-3.03	5.82	5.82	0.92795	.	0.129012	0.49916	D	0.000125	D	0.95484	0.8533	M	0.68317	2.08	0.80722	D	1	D;D;D	0.61080	0.989;0.989;0.981	D;D;D	0.75020	0.985;0.985;0.966	D	0.94200	0.7449	10	0.29301	T	0.29	.	12.574	0.56354	1.0:0.0:0.0:0.0	.	78;78;78	Q6ZMJ2-4;Q6ZMJ2-2;Q6ZMJ2	.;.;SCAR5_HUMAN	T	78	ENSP00000346990:I78T;ENSP00000369746:I78T;ENSP00000428663:I78T	ENSP00000346990:I78T	I	-	2	0	SCARA5	27879858	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.110000	0.64622	2.225000	0.72522	0.460000	0.39030	ATC	.	.		0.542	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
ELP3	55140	hgsc.bcm.edu	37	8	27987036	27987036	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:27987036T>C	ENST00000256398.8	+	8	1012	c.635T>C	c.(634-636)cTc>cCc	p.L212P	ELP3_ENST00000524103.1_Missense_Mutation_p.L140P|ELP3_ENST00000542181.1_Missense_Mutation_p.L83P|ELP3_ENST00000537665.1_Missense_Mutation_p.L93P|ELP3_ENST00000380353.4_Missense_Mutation_p.L120P|ELP3_ENST00000521015.1_Missense_Mutation_p.L198P	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3	212					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		GAGAGAAGCCTCACAAAGTGT	0.393																																					p.L212P		Atlas-SNP	.											ELP3,NS,carcinoma,0,1	ELP3	36	.	0			c.T635C						.						134.0	132.0	133.0					8																	27987036		2203	4300	6503	SO:0001583	missense	55140	exon8			GAAGCCTCACAAA		CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.635T>C	chr8.hg19:g.27987036T>C	ENSP00000256398:p.Leu212Pro	130.0	1.0		72.0	3.0	NM_018091	B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Missense_Mutation	SNP	ENST00000256398.8	hg19	CCDS6065.1	.	.	.	.	.	.	.	.	.	.	T	11.85	1.761245	0.31137	.	.	ENSG00000134014	ENST00000521015;ENST00000256398;ENST00000542181;ENST00000524103;ENST00000524024;ENST00000537665;ENST00000380353	T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	4.53	3.34	0.38264	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.374738	0.26062	N	0.026562	T	0.73877	0.3643	L	0.38838	1.175	0.51233	D	0.999917	B;B	0.30542	0.284;0.162	B;B	0.40101	0.319;0.251	T	0.68047	-0.5512	10	0.39692	T	0.17	-3.4446	7.2576	0.26185	0.4027:0.0:0.0:0.5973	.	93;212	B4DE19;Q9H9T3	.;ELP3_HUMAN	P	198;212;83;140;155;93;120	ENSP00000428449:L198P;ENSP00000256398:L212P;ENSP00000439242:L83P;ENSP00000429180:L140P;ENSP00000445558:L93P;ENSP00000369711:L120P	ENSP00000256398:L212P	L	+	2	0	ELP3	28042955	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.299000	0.51826	0.850000	0.35239	0.533000	0.62120	CTC	.	.		0.393	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219963.2	NM_018091	
LEPROTL1	23484	hgsc.bcm.edu	37	8	29959445	29959445	+	Silent	SNP	C	C	T	rs372366525		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:29959445C>T	ENST00000321250.8	+	2	163	c.48C>T	c.(46-48)atC>atT	p.I16I	LEPROTL1_ENST00000518001.1_Intron|LEPROTL1_ENST00000442880.2_Silent_p.I16I|LEPROTL1_ENST00000523116.1_Silent_p.I16I|LEPROTL1_ENST00000518192.1_Silent_p.I39I	NM_015344.2	NP_056159.2	O95214	LERL1_HUMAN	leptin receptor overlapping transcript-like 1	16						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)	5				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		GAGGAGCAATCGGACTGATGT	0.299																																					p.I16I		Atlas-SNP	.											.	LEPROTL1	16	.	0			c.C48T						.	C	,	0,4406		0,0,2203	100.0	95.0	97.0		48,48	-2.4	0.4	8		97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	LEPROTL1	NM_001128208.1,NM_015344.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	16/170,16/132	29959445	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23484	exon2			AGCAATCGGACTG	AF063605	CCDS6075.1, CCDS47834.1	8p12	2014-09-11			ENSG00000104660	ENSG00000104660			6555	protein-coding gene	gene with protein product		607338				11342119	Standard	NM_015344		Approved	my047, Vps55	uc003xhx.2	O95214	OTTHUMG00000163820	ENST00000321250.8:c.48C>T	chr8.hg19:g.29959445C>T		91.0	0.0		35.0	4.0	NM_001128208	E9PHP8|Q9BW48	Silent	SNP	ENST00000321250.8	hg19	CCDS6075.1																																																																																			.	.		0.299	LEPROTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375771.2		
UNC5D	137970	hgsc.bcm.edu	37	8	35606082	35606082	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:35606082G>T	ENST00000404895.2	+	12	2132	c.1804G>T	c.(1804-1806)Gaa>Taa	p.E602*	UNC5D_ENST00000420357.1_Nonsense_Mutation_p.E535*|UNC5D_ENST00000449677.1_Nonsense_Mutation_p.E178*|UNC5D_ENST00000453357.2_Nonsense_Mutation_p.E597*|UNC5D_ENST00000416672.1_Nonsense_Mutation_p.E607*|UNC5D_ENST00000287272.2_Nonsense_Mutation_p.E533*	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	602	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCTGAGTCCTGAAGTCACCTG	0.483																																					p.E602X		Atlas-SNP	.											UNC5D_ENST00000404895,NS,carcinoma,0,2	UNC5D	393	.	0			c.G1804T						.						165.0	138.0	147.0					8																	35606082		2203	4300	6503	SO:0001587	stop_gained	137970	exon12			AGTCCTGAAGTCA	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1804G>T	chr8.hg19:g.35606082G>T	ENSP00000385143:p.Glu602*	141.0	0.0		72.0	3.0	NM_080872	Q8WYP7	Nonsense_Mutation	SNP	ENST00000404895.2	hg19	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	G	38	7.047981	0.98025	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	.	.	.	6.07	6.07	0.98685	.	0.085303	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-22.8037	20.6593	0.99626	0.0:0.0:1.0:0.0	.	.	.	.	X	602;535;533;607;597;178	.	ENSP00000287272:E533X	E	+	1	0	UNC5D	35725624	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.286000	0.95898	2.885000	0.99019	0.655000	0.94253	GAA	.	.		0.483	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
IDO1	3620	hgsc.bcm.edu	37	8	39785359	39785359	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:39785359T>C	ENST00000518237.1	+	10	1506	c.867T>C	c.(865-867)gcT>gcC	p.A289A	RP11-44K6.3_ENST00000517623.1_RNA|IDO1_ENST00000522495.1_Silent_p.A289A	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	289					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	GACATGCTGCTCAGTTCCTCC	0.488																																					p.A289A		Atlas-SNP	.											.	IDO1	43	.	0			c.T867C						.						30.0	28.0	29.0					8																	39785359		1975	4168	6143	SO:0001819	synonymous_variant	3620	exon10			TGCTGCTCAGTTC	M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.867T>C	chr8.hg19:g.39785359T>C		106.0	0.0		41.0	4.0	NM_002164	Q540B4	Silent	SNP	ENST00000518237.1	hg19	CCDS47847.1																																																																																			.	.		0.488	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376987.1	NM_002164	
AP3M2	10947	hgsc.bcm.edu	37	8	42026560	42026560	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:42026560A>G	ENST00000518421.1	+	10	1529	c.1238A>G	c.(1237-1239)aAg>aGg	p.K413R	AP3M2_ENST00000520685.1_3'UTR|AP3M2_ENST00000174653.3_Missense_Mutation_p.K413R|AP3M2_ENST00000396926.3_Missense_Mutation_p.K413R	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	413	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			AAAGCTGGGAAGTTCCAAGTT	0.393																																					p.K413R		Atlas-SNP	.											AP3M2,NS,carcinoma,0,1	AP3M2	41	.	0			c.A1238G						.						88.0	85.0	86.0					8																	42026560		2203	4300	6503	SO:0001583	missense	10947	exon10			CTGGGAAGTTCCA	D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.1238A>G	chr8.hg19:g.42026560A>G	ENSP00000428787:p.Lys413Arg	68.0	0.0		36.0	2.0	NM_001134296	B2RCR0|D3DSY2|Q7Z472	Missense_Mutation	SNP	ENST00000518421.1	hg19	CCDS6125.1	.	.	.	.	.	.	.	.	.	.	A	13.17	2.157304	0.38119	.	.	ENSG00000070718	ENST00000518421;ENST00000174653;ENST00000396926	T;T;T	0.19806	2.12;2.12;2.12	5.72	4.57	0.56435	Clathrin adaptor, mu subunit, C-terminal (3);	0.044909	0.85682	N	0.000000	T	0.13372	0.0324	N	0.16708	0.43	0.80722	D	1	B	0.17038	0.02	B	0.23150	0.044	T	0.09207	-1.0685	10	0.22706	T	0.39	-18.4385	11.5293	0.50599	0.9303:0.0:0.0697:0.0	.	413	P53677	AP3M2_HUMAN	R	413	ENSP00000428787:K413R;ENSP00000174653:K413R;ENSP00000380132:K413R	ENSP00000174653:K413R	K	+	2	0	AP3M2	42145717	1.000000	0.71417	0.994000	0.49952	0.783000	0.44284	7.174000	0.77620	1.000000	0.39049	-0.326000	0.08463	AAG	.	.		0.393	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376996.1		
HGSNAT	138050	hgsc.bcm.edu	37	8	43016586	43016586	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:43016586A>G	ENST00000458501.2	+	5	583	c.583A>G	c.(583-585)Agc>Ggc	p.S195G	HGSNAT_ENST00000379644.4_Missense_Mutation_p.S167G			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	195					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)	p.S195G(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TCTAGCTGTGAGCATTGCATT	0.393																																					p.S167G		Atlas-SNP	.											HGSNAT_ENST00000458501,NS,carcinoma,0,1	HGSNAT	85	.	1	Substitution - Missense(1)	kidney(1)	c.A499G						.						261.0	221.0	234.0					8																	43016586		1909	4129	6038	SO:0001583	missense	138050	exon5			GCTGTGAGCATTG		CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.583A>G	chr8.hg19:g.43016586A>G	ENSP00000389524:p.Ser195Gly	185.0	0.0		107.0	5.0	NM_152419	B4E2V0	Missense_Mutation	SNP	ENST00000458501.2	hg19		.	.	.	.	.	.	.	.	.	.	A	10.01	1.233725	0.22626	.	.	ENSG00000165102	ENST00000458501;ENST00000332689;ENST00000379644	D;D	0.92149	-2.98;-2.98	5.59	-5.0	0.03001	.	1.394720	0.04099	N	0.312656	T	0.81875	0.4915	N	0.25647	0.755	0.26532	N	0.974231	B	0.02656	0.0	B	0.04013	0.001	T	0.66264	-0.5967	10	0.25751	T	0.34	1.5796	0.4844	0.00553	0.2652:0.1275:0.2348:0.3725	.	195	Q68CP4	HGNAT_HUMAN	G	195;167;167	ENSP00000389524:S195G;ENSP00000368965:S167G	ENSP00000327833:S167G	S	+	1	0	HGSNAT	43135743	0.010000	0.17322	0.026000	0.17262	0.125000	0.20455	-0.106000	0.10890	-0.363000	0.08101	-0.256000	0.11100	AGC	.	.		0.393	HGSNAT-202	KNOWN	basic	protein_coding	protein_coding		XM_372038	
EFCAB1	79645	hgsc.bcm.edu	37	8	49643943	49643943	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:49643943T>C	ENST00000262103.3	-	2	258	c.178A>G	c.(178-180)Aca>Gca	p.T60A	EFCAB1_ENST00000521002.1_Intron|EFCAB1_ENST00000523092.1_Intron|EFCAB1_ENST00000433756.1_Intron	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	60							calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				ATTCCAAATGTCACATGCAGG	0.403																																					p.T60A		Atlas-SNP	.											.	EFCAB1	27	.	0			c.A178G						.						125.0	112.0	116.0					8																	49643943		2203	4300	6503	SO:0001583	missense	79645	exon2			CAAATGTCACATG		CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.178A>G	chr8.hg19:g.49643943T>C	ENSP00000262103:p.Thr60Ala	186.0	0.0		109.0	6.0	NM_024593	B4DSB4|E7EVN7	Missense_Mutation	SNP	ENST00000262103.3	hg19	CCDS6145.1	.	.	.	.	.	.	.	.	.	.	T	13.60	2.284472	0.40394	.	.	ENSG00000034239	ENST00000262103;ENST00000450553	T	0.67345	-0.26	4.67	4.67	0.58626	EF-hand-like domain (1);	0.338534	0.32578	N	0.005904	T	0.57902	0.2085	L	0.46885	1.475	0.53688	D	0.999977	B	0.17268	0.021	B	0.12156	0.007	T	0.54410	-0.8298	10	0.27785	T	0.31	.	12.3807	0.55305	0.0:0.0:0.0:1.0	.	60	Q9HAE3	EFCB1_HUMAN	A	60	ENSP00000262103:T60A	ENSP00000262103:T60A	T	-	1	0	EFCAB1	49806496	1.000000	0.71417	0.830000	0.32933	0.912000	0.54170	3.481000	0.53179	2.082000	0.62665	0.528000	0.53228	ACA	.	.		0.403	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377778.1	NM_024593	
NSMAF	8439	hgsc.bcm.edu	37	8	59514660	59514660	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:59514660T>C	ENST00000038176.3	-	14	1294	c.1082A>G	c.(1081-1083)aAg>aGg	p.K361R	NSMAF_ENST00000427130.2_Missense_Mutation_p.K392R|NSMAF_ENST00000519858.1_5'UTR	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	361	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				CCCTACTGGCTTACTGAGATC	0.408																																					p.K392R		Atlas-SNP	.											.	NSMAF	156	.	0			c.A1175G						.						112.0	113.0	113.0					8																	59514660		2203	4300	6503	SO:0001583	missense	8439	exon14			ACTGGCTTACTGA	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1082A>G	chr8.hg19:g.59514660T>C	ENSP00000038176:p.Lys361Arg	131.0	0.0		87.0	4.0	NM_001144772	B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	hg19	CCDS6173.1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.292177	0.59976	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	D;D	0.82433	-1.61;-1.61	5.96	3.62	0.41486	BEACH domain (4);	0.040345	0.85682	N	0.000000	T	0.79793	0.4507	L	0.61218	1.895	0.39776	D	0.97223	B;B;B	0.25772	0.036;0.134;0.016	B;B;B	0.31101	0.04;0.124;0.077	T	0.72456	-0.4288	9	.	.	.	.	10.3215	0.43769	0.0:0.127:0.0:0.873	.	392;361;361	Q92636-2;A8K9G4;Q92636	.;.;FAN_HUMAN	R	361;392	ENSP00000038176:K361R;ENSP00000411012:K392R	.	K	-	2	0	NSMAF	59677214	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	4.889000	0.63171	0.518000	0.28383	0.533000	0.62120	AAG	.	.		0.408	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
CSPP1	79848	hgsc.bcm.edu	37	8	68007674	68007674	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:68007674A>G	ENST00000262210.5	+	6	688	c.657A>G	c.(655-657)agA>agG	p.R219R	CSPP1_ENST00000412460.1_5'UTR	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	254					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TGAACCAAAGACGACTAGAGG	0.368																																					p.R219R		Atlas-SNP	.											.	CSPP1	129	.	0			c.A657G						.						107.0	99.0	101.0					8																	68007674		1830	4093	5923	SO:0001819	synonymous_variant	79848	exon6			CCAAAGACGACTA	AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.657A>G	chr8.hg19:g.68007674A>G		98.0	0.0		60.0	4.0	NM_024790	A6ND63|Q70F00|Q8TBC1	Silent	SNP	ENST00000262210.5	hg19	CCDS43744.1																																																																																			.	.		0.368	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379254.1	NM_024790	
ARFGEF1	10565	hgsc.bcm.edu	37	8	68178248	68178248	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:68178248T>C	ENST00000262215.3	-	14	2505	c.2116A>G	c.(2116-2118)Ata>Gta	p.I706V	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.I160V	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	706					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TACAAATCTATCCCTTGTTCT	0.388																																					p.I706V		Atlas-SNP	.											ARFGEF1,NS,carcinoma,0,1	ARFGEF1	196	.	0			c.A2116G						.						118.0	109.0	112.0					8																	68178248		2201	4300	6501	SO:0001583	missense	10565	exon14			AATCTATCCCTTG	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.2116A>G	chr8.hg19:g.68178248T>C	ENSP00000262215:p.Ile706Val	176.0	0.0		80.0	4.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	hg19	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433254	0.83776	.	.	ENSG00000066777	ENST00000520381;ENST00000262215	T;T	0.53423	0.62;0.62	5.49	5.49	0.81192	Armadillo-type fold (1);SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.67116	0.2859	M	0.66560	2.04	0.80722	D	1	D;D	0.64830	0.994;0.98	D;P	0.85130	0.997;0.881	T	0.68303	-0.5444	10	0.49607	T	0.09	.	15.583	0.76459	0.0:0.0:0.0:1.0	.	706;160	Q9Y6D6;E5RIF2	BIG1_HUMAN;.	V	160;706	ENSP00000428429:I160V;ENSP00000262215:I706V	ENSP00000262215:I706V	I	-	1	0	ARFGEF1	68340802	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.963000	0.87922	2.094000	0.63399	0.477000	0.44152	ATA	.	.		0.388	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
GDAP1	54332	hgsc.bcm.edu	37	8	75276266	75276266	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:75276266A>G	ENST00000220822.7	+	6	821	c.741A>G	c.(739-741)gcA>gcG	p.A247A	GDAP1_ENST00000521096.1_3'UTR|GDAP1_ENST00000434412.2_Silent_p.A179A	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	247	GST C-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			TCACCCTGGCAGACGTCTCAC	0.498																																					p.A247A		Atlas-SNP	.											.	GDAP1	36	.	0			c.A741G						.						64.0	63.0	63.0					8																	75276266		2203	4300	6503	SO:0001819	synonymous_variant	54332	exon6			CCTGGCAGACGTC		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.741A>G	chr8.hg19:g.75276266A>G		85.0	0.0		53.0	4.0	NM_018972	A8K957|E7FJF3|E7FJF4	Silent	SNP	ENST00000220822.7	hg19	CCDS34911.1																																																																																			.	.		0.498	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379061.1	NM_018972	
CRISPLD1	83690	hgsc.bcm.edu	37	8	75929308	75929308	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:75929308A>G	ENST00000262207.4	+	9	1424	c.956A>G	c.(955-957)gAt>gGt	p.D319G	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.D131G|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.D133G	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	319	LCCL 1. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			GGCTGTTTGGATAGTAAAGCT	0.279																																					p.D319G		Atlas-SNP	.											.	CRISPLD1	94	.	0			c.A956G						.						90.0	94.0	93.0					8																	75929308		2203	4295	6498	SO:0001583	missense	83690	exon9			GTTTGGATAGTAA	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.956A>G	chr8.hg19:g.75929308A>G	ENSP00000262207:p.Asp319Gly	102.0	0.0		45.0	4.0	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	hg19	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789317	0.49997	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.89746	-2.56;-2.56;-2.56	5.12	3.97	0.46021	LCCL (5);	0.103797	0.64402	N	0.000004	D	0.86723	0.6001	L	0.45470	1.425	0.52501	D	0.999954	B;B	0.33171	0.09;0.4	B;B	0.40410	0.171;0.328	D	0.84316	0.0513	10	0.44086	T	0.13	.	11.2695	0.49131	0.9281:0.0:0.0719:0.0	.	133;319	B7Z929;Q9H336	.;CRLD1_HUMAN	G	319;131;133	ENSP00000262207:D319G;ENSP00000430105:D131G;ENSP00000429746:D133G	ENSP00000262207:D319G	D	+	2	0	CRISPLD1	76091863	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.862000	0.75484	1.070000	0.40811	-0.280000	0.10049	GAT	.	.		0.279	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
ZFHX4	79776	hgsc.bcm.edu	37	8	77616580	77616580	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:77616580C>T	ENST00000521891.2	+	2	705	c.257C>T	c.(256-258)gCc>gTc	p.A86V	ZFHX4_ENST00000050961.6_Missense_Mutation_p.A86V|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A86V|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000455469.2_Missense_Mutation_p.A86V	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.A86V(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACGAATGTGCCACTTCTTTT	0.507										HNSCC(33;0.089)																											p.A86V		Atlas-SNP	.											ZFHX4,NS,carcinoma,0,1	ZFHX4	878	.	1	Substitution - Missense(1)	lung(1)	c.C257T						.						179.0	178.0	178.0					8																	77616580		2083	4210	6293	SO:0001583	missense	79776	exon2			AATGTGCCACTTC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.257C>T	chr8.hg19:g.77616580C>T	ENSP00000430497:p.Ala86Val	153.0	0.0		72.0	3.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384779	0.61956	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000520307;ENST00000523885;ENST00000517585;ENST00000523809;ENST00000518282	T;T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31;1.31	5.53	5.53	0.82687	Zinc finger, C2H2-like (1);	0.000000	0.44097	U	0.000482	T	0.42449	0.1203	N	0.14661	0.345	0.58432	D	0.999995	D;D;D;P	0.61697	0.982;0.972;0.99;0.822	P;P;P;B	0.59825	0.734;0.691;0.864;0.269	T	0.44345	-0.9334	10	0.66056	D	0.02	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	86;86;86;86	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	V	86	ENSP00000430497:A86V;ENSP00000399605:A86V;ENSP00000050961:A86V;ENSP00000428525:A86V;ENSP00000429495:A86V;ENSP00000427775:A86V;ENSP00000427739:A86V;ENSP00000430848:A86V	ENSP00000050961:A86V	A	+	2	0	ZFHX4	77779135	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.816000	0.69222	2.882000	0.98803	0.655000	0.94253	GCC	.	.		0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
IL7	3574	hgsc.bcm.edu	37	8	79652274	79652274	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:79652274A>G	ENST00000263851.4	-	3	791	c.191T>C	c.(190-192)tTt>tCt	p.F64S	IL7_ENST00000520269.1_Missense_Mutation_p.F64S|IL7_ENST00000541183.1_Missense_Mutation_p.F13S|IL7_ENST00000519833.1_5'UTR	NM_000880.3|NM_001199886.1|NM_001199887.1	NP_000871.1|NP_001186815.1|NP_001186816.1	P13232	IL7_HUMAN	interleukin 7	64					bone resorption (GO:0045453)|cell-cell signaling (GO:0007267)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|organ morphogenesis (GO:0009887)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell differentiation (GO:0045582)|regulation of gene expression (GO:0010468)|T cell lineage commitment (GO:0002360)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-7 receptor binding (GO:0005139)	p.F64C(1)		endometrium(2)|large_intestine(2)|lung(1)	5						AAAAAAGTTAAATTCATTATT	0.259																																					p.F64S		Atlas-SNP	.											IL7,colon,carcinoma,0,1	IL7	12	.	1	Substitution - Missense(1)	large_intestine(1)	c.T191C						.						45.0	47.0	46.0					8																	79652274		2196	4274	6470	SO:0001583	missense	3574	exon3			AAGTTAAATTCAT	J04156	CCDS6224.1, CCDS56541.1, CCDS75755.1, CCDS75756.1	8q12-q13	2008-07-03				ENSG00000104432		"""Interleukins and interleukin receptors"""	6023	protein-coding gene	gene with protein product		146660					Standard	NM_000880		Approved	IL-7	uc003ybg.3	P13232		ENST00000263851.4:c.191T>C	chr8.hg19:g.79652274A>G	ENSP00000263851:p.Phe64Ser	161.0	0.0		55.0	3.0	NM_000880	A0N0L3|Q5FBY5|Q5FBY9	Missense_Mutation	SNP	ENST00000263851.4	hg19	CCDS6224.1	.	.	.	.	.	.	.	.	.	.	A	5.531	0.282805	0.10458	.	.	ENSG00000104432	ENST00000263851;ENST00000520269;ENST00000379114;ENST00000541183	T;T;T	0.41400	1.0;1.0;1.0	5.02	2.04	0.26737	.	1.147940	0.06450	N	0.727483	T	0.20700	0.0498	N	0.08118	0	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.31888	-0.9927	9	.	.	.	.	3.7743	0.08654	0.2054:0.0:0.6037:0.1909	.	64;64	P13232;Q5FBY9	IL7_HUMAN;.	S	64;64;61;13	ENSP00000263851:F64S;ENSP00000427750:F64S;ENSP00000438922:F13S	.	F	-	2	0	IL7	79814829	1.000000	0.71417	0.987000	0.45799	0.866000	0.49608	0.679000	0.25291	0.800000	0.34041	-0.468000	0.05107	TTT	.	.		0.259	IL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379429.1		
VPS13B	157680	hgsc.bcm.edu	37	8	100790967	100790967	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:100790967A>G	ENST00000358544.2	+	42	7673	c.7562A>G	c.(7561-7563)gAa>gGa	p.E2521G	VPS13B_ENST00000357162.2_Missense_Mutation_p.E2496G|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2521					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCTGAACTAGAATACATGATT	0.418																																					p.E2521G	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.A7562G						.						112.0	109.0	110.0					8																	100790967		2203	4300	6503	SO:0001583	missense	157680	exon42			AACTAGAATACAT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7562A>G	chr8.hg19:g.100790967A>G	ENSP00000351346:p.Glu2521Gly	222.0	0.0		109.0	5.0	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.383631	0.61845	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.72167	-0.63;-0.63	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.82398	0.5028	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.84164	0.0430	10	0.72032	D	0.01	.	15.876	0.79162	1.0:0.0:0.0:0.0	.	2496;2521	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	G	2496;2521	ENSP00000349685:E2496G;ENSP00000351346:E2521G	ENSP00000349685:E2496G	E	+	2	0	VPS13B	100860143	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.664000	0.91139	2.143000	0.66587	0.528000	0.53228	GAA	.	.		0.418	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110539227	110539227	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:110539227T>C	ENST00000378402.5	+	77	12803	c.12699T>C	c.(12697-12699)gtT>gtC	p.V4233V		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	4233					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGGCTGCAGTTTCAACTTTGA	0.378										HNSCC(38;0.096)																											p.V4233V		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.T12699C						.						71.0	73.0	73.0					8																	110539227		1907	4141	6048	SO:0001819	synonymous_variant	93035	exon77			TGCAGTTTCAACT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.12699T>C	chr8.hg19:g.110539227T>C		164.0	0.0		98.0	4.0	NM_177531	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	hg19	CCDS47911.1																																																																																			.	.		0.378	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
CSMD3	114788	hgsc.bcm.edu	37	8	113317079	113317079	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:113317079A>G	ENST00000297405.5	-	52	8381	c.8137T>C	c.(8137-8139)Tcc>Ccc	p.S2713P	CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000343508.3_Missense_Mutation_p.S2673P|CSMD3_ENST00000352409.3_Missense_Mutation_p.S2643P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2713	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCATAATGGGAGCCATTCACA	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S2713P		Atlas-SNP	.											.	CSMD3	2325	.	0			c.T8137C						.						98.0	84.0	89.0					8																	113317079		2203	4300	6503	SO:0001583	missense	114788	exon52			AATGGGAGCCATT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8137T>C	chr8.hg19:g.113317079A>G	ENSP00000297405:p.Ser2713Pro	187.0	0.0		91.0	5.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.648658	0.87958	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000352409	T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09	5.18	5.18	0.71444	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000005	T	0.74831	0.3768	L	0.55213	1.73	0.58432	D	0.999995	D;D	0.76494	0.999;0.998	D;D	0.87578	0.998;0.947	T	0.75396	-0.3332	10	0.46703	T	0.11	.	15.3362	0.74255	1.0:0.0:0.0:0.0	.	2713;2673	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	P	2673;2713;1983;2643	ENSP00000345799:S2673P;ENSP00000297405:S2713P;ENSP00000341558:S1983P;ENSP00000343124:S2643P	ENSP00000297405:S2713P	S	-	1	0	CSMD3	113386255	1.000000	0.71417	0.939000	0.37840	0.998000	0.95712	9.255000	0.95524	2.060000	0.61445	0.533000	0.62120	TCC	.	.		0.403	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	hgsc.bcm.edu	37	8	113364738	113364738	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:113364738T>C	ENST00000297405.5	-	39	6406	c.6162A>G	c.(6160-6162)gaA>gaG	p.E2054E	CSMD3_ENST00000455883.2_Silent_p.E1950E|CSMD3_ENST00000343508.3_Silent_p.E2014E|CSMD3_ENST00000352409.3_Silent_p.E1984E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2054	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GAGTTTGTGGTTCAGGACAGG	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.E2054E		Atlas-SNP	.											.	CSMD3	2325	.	0			c.A6162G						.						109.0	104.0	106.0					8																	113364738		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon39			TTGTGGTTCAGGA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6162A>G	chr8.hg19:g.113364738T>C		168.0	0.0		86.0	4.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.		0.333	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ATAD2	29028	hgsc.bcm.edu	37	8	124371920	124371920	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:124371920A>G	ENST00000287394.5	-	10	1270	c.1163T>C	c.(1162-1164)cTc>cCc	p.L388P	ATAD2_ENST00000534257.1_5'UTR|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	388					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			ATTTAGTGGGAGGCACCTATT	0.328																																					p.L388P		Atlas-SNP	.											.	ATAD2	160	.	0			c.T1163C						.						61.0	56.0	58.0					8																	124371920		2203	4300	6503	SO:0001583	missense	29028	exon10			AGTGGGAGGCACC	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1163T>C	chr8.hg19:g.124371920A>G	ENSP00000287394:p.Leu388Pro	89.0	0.0		62.0	4.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	hg19	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.853696	0.71719	.	.	ENSG00000156802	ENST00000287394	D	0.94092	-3.35	5.18	5.18	0.71444	.	2.798200	0.02625	U	0.103685	D	0.97090	0.9049	M	0.71296	2.17	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88006	0.2759	10	0.72032	D	0.01	-7.6791	15.0201	0.71624	1.0:0.0:0.0:0.0	.	218;388	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	P	388	ENSP00000287394:L388P	ENSP00000287394:L388P	L	-	2	0	ATAD2	124441101	1.000000	0.71417	0.999000	0.59377	0.651000	0.38670	9.253000	0.95501	1.950000	0.56595	0.402000	0.26972	CTC	.	.		0.328	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
ZNF572	137209	hgsc.bcm.edu	37	8	125988660	125988660	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:125988660A>G	ENST00000319286.5	+	3	304	c.150A>G	c.(148-150)aaA>aaG	p.K50K		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TTAAAGAGAAACCTTCAGAAT	0.343										HNSCC(60;0.17)																											p.K50K		Atlas-SNP	.											ZNF572,NS,carcinoma,0,1	ZNF572	82	.	0			c.A150G						.						64.0	66.0	65.0					8																	125988660		2203	4300	6503	SO:0001819	synonymous_variant	137209	exon3			AGAGAAACCTTCA	BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.150A>G	chr8.hg19:g.125988660A>G		100.0	0.0		60.0	3.0	NM_152412	A1L4F1|Q8N1Q0	Silent	SNP	ENST00000319286.5	hg19	CCDS6354.1																																																																																			.	.		0.343	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412	
GSDMC	56169	hgsc.bcm.edu	37	8	130788517	130788517	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:130788517C>T	ENST00000276708.4	-	3	1116	c.235G>A	c.(235-237)Gga>Aga	p.G79R		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	79						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						TGGAACGGTCCTGTCACAACA	0.448																																					p.G79R		Atlas-SNP	.											.	GSDMC	71	.	0			c.G235A						.						164.0	130.0	142.0					8																	130788517		2203	4300	6503	SO:0001583	missense	56169	exon3			ACGGTCCTGTCAC	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.235G>A	chr8.hg19:g.130788517C>T	ENSP00000276708:p.Gly79Arg	127.0	0.0		78.0	4.0	NM_031415	Q5XKF3|Q6P494	Missense_Mutation	SNP	ENST00000276708.4	hg19	CCDS6360.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.065297	0.36470	.	.	ENSG00000147697	ENST00000276708	T	0.21734	1.99	3.97	-1.04	0.10068	.	2.568960	0.01164	N	0.006719	T	0.30510	0.0767	L	0.33339	1.005	0.09310	N	1	D	0.61080	0.989	P	0.59115	0.852	T	0.27054	-1.0085	10	0.62326	D	0.03	.	7.1891	0.25816	0.0:0.442:0.0:0.558	.	79	Q9BYG8	GSDMC_HUMAN	R	79	ENSP00000276708:G79R	ENSP00000276708:G79R	G	-	1	0	GSDMC	130857699	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.513000	0.06305	-0.104000	0.12154	0.585000	0.79938	GGA	.	.		0.448	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
EFR3A	23167	hgsc.bcm.edu	37	8	132991670	132991670	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:132991670T>C	ENST00000254624.5	+	14	1800		c.e14+2		EFR3A_ENST00000334503.4_Splice_Site|EFR3A_ENST00000519656.1_Splice_Site	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)							extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ATGAAAAAGGTAAGACATCTT	0.313																																					.		Atlas-SNP	.											.	EFR3A	96	.	0			c.1575+2T>C						.						30.0	27.0	28.0					8																	132991670		2192	4268	6460	SO:0001630	splice_region_variant	23167	exon14			AAAAGGTAAGACA	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.1575+2T>C	chr8.hg19:g.132991670T>C		143.0	0.0		52.0	4.0	NM_015137	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Splice_Site	SNP	ENST00000254624.5	hg19	CCDS34942.2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253666	0.80135	.	.	ENSG00000132294	ENST00000254624;ENST00000377917;ENST00000334503;ENST00000519656	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1795	0.65564	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	EFR3A	133060852	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.017000	0.76399	1.999000	0.58509	0.456000	0.33151	.	.	.		0.313	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137	Intron
KCNQ3	3786	hgsc.bcm.edu	37	8	133198356	133198356	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:133198356T>C	ENST00000388996.4	-	2	879	c.459A>G	c.(457-459)ggA>ggG	p.G153G	KCNQ3_ENST00000521134.1_Silent_p.G33G|KCNQ3_ENST00000519445.1_Silent_p.G153G	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	153					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GAAGCCAGTCTCCCGAGACAG	0.502																																					p.G153G		Atlas-SNP	.											.	KCNQ3	164	.	0			c.A459G						.						112.0	97.0	102.0					8																	133198356		2203	4300	6503	SO:0001819	synonymous_variant	3786	exon2			CCAGTCTCCCGAG	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.459A>G	chr8.hg19:g.133198356T>C		155.0	0.0		69.0	5.0	NM_004519	A2VCT8|B4DJY4|E7EQ89	Silent	SNP	ENST00000388996.4	hg19	CCDS34943.1																																																																																			.	.		0.502	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
TG	7038	hgsc.bcm.edu	37	8	133941385	133941385	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:133941385T>C	ENST00000220616.4	+	23	4804	c.4764T>C	c.(4762-4764)gcT>gcC	p.A1588A	TG_ENST00000377869.1_Silent_p.A1531A|TG_ENST00000542445.1_Silent_p.A22A	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1588					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CTCCTGTGGCTGTCAGATCCA	0.448																																					p.A1588A		Atlas-SNP	.											.	TG	416	.	0			c.T4764C						.						142.0	121.0	128.0					8																	133941385		2203	4300	6503	SO:0001819	synonymous_variant	7038	exon23			TGTGGCTGTCAGA	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4764T>C	chr8.hg19:g.133941385T>C		149.0	0.0		93.0	4.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	ENST00000220616.4	hg19	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	T	4.882	0.163842	0.09287	.	.	ENSG00000042832	ENST00000519178	.	.	.	5.5	-4.06	0.03986	.	.	.	.	.	T	0.20455	0.0492	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30297	-0.9983	4	.	.	.	.	4.0516	0.09798	0.4078:0.0:0.204:0.3882	.	.	.	.	R	108	.	.	C	+	1	0	TG	134010567	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.237000	0.02922	-0.659000	0.05359	-1.236000	0.01555	TGT	.	.		0.448	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
HSF1	3297	hgsc.bcm.edu	37	8	145535035	145535035	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:145535035A>G	ENST00000528838.1	+	6	753	c.593A>G	c.(592-594)cAg>cGg	p.Q198R	HSF1_ENST00000400780.4_Missense_Mutation_p.Q133R	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1	198	Hydrophobic repeat HR-A/B.				cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			TCACTGGTGCAGTCAAACCGG	0.637																																					p.Q198R		Atlas-SNP	.											.	HSF1	29	.	0			c.A593G						.						71.0	77.0	75.0					8																	145535035		2203	4296	6499	SO:0001583	missense	3297	exon6			TGGTGCAGTCAAA	M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604	ENST00000528838.1:c.593A>G	chr8.hg19:g.145535035A>G	ENSP00000431512:p.Gln198Arg	128.0	0.0		90.0	5.0	NM_005526	A8K4L0|A8MW26|Q53XT4	Missense_Mutation	SNP	ENST00000528838.1	hg19	CCDS6419.1	.	.	.	.	.	.	.	.	.	.	A	16.94	3.261756	0.59431	.	.	ENSG00000185122	ENST00000528838;ENST00000533240;ENST00000400780	.	.	.	5.5	5.5	0.81552	.	0.061939	0.64402	D	0.000003	T	0.56485	0.1988	L	0.47016	1.485	0.48975	D	0.999739	B	0.27732	0.187	B	0.28638	0.092	T	0.56426	-0.7981	9	0.46703	T	0.11	-21.8322	13.5661	0.61819	1.0:0.0:0.0:0.0	.	198	Q00613	HSF1_HUMAN	R	198;133;133	.	ENSP00000383590:Q133R	Q	+	2	0	HSF1	145505843	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.831000	0.55776	2.082000	0.62665	0.533000	0.62120	CAG	.	.		0.637	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382053.1	NM_005526	
TONSL	4796	hgsc.bcm.edu	37	8	145666353	145666353	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:145666353T>C	ENST00000409379.3	-	8	1036	c.1007A>G	c.(1006-1008)aAg>aGg	p.K336R	AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	336					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						ACACACCTGCTTCTGGTAAGC	0.662																																					p.K336R		Atlas-SNP	.											TONSL_ENST00000409379,NS,carcinoma,0,2	TONSL	128	.	0			c.A1007G						.						82.0	82.0	82.0					8																	145666353		2203	4300	6503	SO:0001583	missense	4796	exon8			ACCTGCTTCTGGT		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.1007A>G	chr8.hg19:g.145666353T>C	ENSP00000386239:p.Lys336Arg	187.0	0.0		81.0	4.0	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	hg19	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	T	12.71	2.018147	0.35606	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.78595	-1.19	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.415751	0.28382	N	0.015558	T	0.72486	0.3466	M	0.64997	1.995	0.28018	N	0.934636	B	0.20887	0.049	B	0.17433	0.018	T	0.64964	-0.6283	10	0.39692	T	0.17	-30.534	8.8792	0.35365	0.1667:0.0:0.0:0.8333	.	336	Q96HA7	TONSL_HUMAN	R	336	ENSP00000386239:K336R	ENSP00000386239:K336R	K	-	2	0	TONSL	145637161	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	1.875000	0.39578	2.077000	0.62373	0.459000	0.35465	AAG	.	.		0.662	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
DOCK8	81704	hgsc.bcm.edu	37	9	434865	434865	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:434865T>C	ENST00000453981.1	+	39	5081	c.4969T>C	c.(4969-4971)Tgc>Cgc	p.C1657R	DOCK8_ENST00000432829.2_Missense_Mutation_p.C1589R|DOCK8_ENST00000382329.1_Missense_Mutation_p.C1124R|DOCK8_ENST00000469391.1_Missense_Mutation_p.C1557R			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1657	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CAAGAAGAAGTGCTACACGGA	0.562																																					p.C1657R		Atlas-SNP	.											.	DOCK8	401	.	0			c.T4969C						.						105.0	91.0	96.0					9																	434865		2203	4300	6503	SO:0001583	missense	81704	exon39			AAGAAGTGCTACA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.4969T>C	chr9.hg19:g.434865T>C	ENSP00000408464:p.Cys1657Arg	109.0	0.0		80.0	4.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019077	0.54576	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.68479	2.7;-0.33;-0.33;-0.33	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.64125	0.2570	L	0.57536	1.79	0.80722	D	1	P;P;P	0.43633	0.786;0.471;0.813	B;B;B	0.39660	0.191;0.191;0.306	T	0.70745	-0.4788	10	0.72032	D	0.01	.	14.7381	0.69430	0.0:0.0:0.0:1.0	.	1557;1124;1657	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	R	1657;1625;1589;1557;1124	ENSP00000408464:C1657R;ENSP00000394888:C1589R;ENSP00000419438:C1557R;ENSP00000371766:C1124R	ENSP00000287364:C1625R	C	+	1	0	DOCK8	424865	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	2.592000	0.46171	2.067000	0.61834	0.496000	0.49642	TGC	.	.		0.562	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
ERMP1	79956	hgsc.bcm.edu	37	9	5832863	5832863	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:5832863C>T	ENST00000339450.5	-	1	254	c.165G>A	c.(163-165)ggG>ggA	p.G55G	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	55						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		CGCCGCTACCCCCGGGGCTCC	0.786																																					p.G55G		Atlas-SNP	.											.	ERMP1	63	.	0			c.G165A						.						2.0	3.0	3.0					9																	5832863		1220	2949	4169	SO:0001819	synonymous_variant	79956	exon1			GCTACCCCCGGGG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.165G>A	chr9.hg19:g.5832863C>T		0.0	0.0		5.0	5.0	NM_024896	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	hg19	CCDS34983.1																																																																																			.	.		0.786	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
CCDC171	203238	hgsc.bcm.edu	37	9	15777602	15777602	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:15777602A>G	ENST00000380701.3	+	19	3004	c.2676A>G	c.(2674-2676)ccA>ccG	p.P892P	RNU6-14P_ENST00000384630.1_RNA|CCDC171_ENST00000297641.3_Silent_p.P892P	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	892																	TTGAAGATCCAAATTCCAGAA	0.313																																					p.P892P		Atlas-SNP	.											.	.	.	.	0			c.A2676G						.						42.0	45.0	44.0					9																	15777602		2203	4300	6503	SO:0001819	synonymous_variant	203238	exon19			AGATCCAAATTCC	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2676A>G	chr9.hg19:g.15777602A>G		57.0	0.0		38.0	4.0	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Silent	SNP	ENST00000380701.3	hg19	CCDS6481.1	.	.	.	.	.	.	.	.	.	.	A	6.876	0.530993	0.13127	.	.	ENSG00000164989	ENST00000449575	.	.	.	5.72	-0.819	0.10829	.	.	.	.	.	T	0.51415	0.1673	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38394	-0.9663	4	.	.	.	-11.4078	6.7156	0.23302	0.5507:0.12:0.3292:0.0	.	.	.	.	R	132	.	.	Q	+	2	0	C9orf93	15767602	0.989000	0.36119	0.991000	0.47740	0.928000	0.56348	0.238000	0.18004	-0.387000	0.07809	-0.263000	0.10527	CAA	.	.		0.313	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
IFNB1	3456	hgsc.bcm.edu	37	9	21077802	21077802	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:21077802T>C	ENST00000380232.2	-	1	141	c.67A>G	c.(67-69)Agc>Ggc	p.S23G		NM_002176.2	NP_002167.1	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast	23					adaptive immune response (GO:0002250)|B cell activation involved in immune response (GO:0002312)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of viral genome replication (GO:0045071)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	12				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)		AAGTTGTAGCTCATGGAAAGA	0.468																																					p.S23G		Atlas-SNP	.											.	IFNB1	33	.	0			c.A67G						.						47.0	47.0	47.0					9																	21077802		2203	4300	6503	SO:0001583	missense	3456	exon1			TGTAGCTCATGGA		CCDS6495.1	9p22	2008-07-21			ENSG00000171855	ENSG00000171855		"""Interferons"""	5434	protein-coding gene	gene with protein product		147640		IFNB			Standard	NM_002176		Approved	IFB, IFF	uc003zok.3	P01574	OTTHUMG00000019652	ENST00000380232.2:c.67A>G	chr9.hg19:g.21077802T>C	ENSP00000369581:p.Ser23Gly	122.0	0.0		101.0	5.0	NM_002176	Q5VWC9	Missense_Mutation	SNP	ENST00000380232.2	hg19	CCDS6495.1	.	.	.	.	.	.	.	.	.	.	T	10.37	1.332228	0.24167	.	.	ENSG00000171855	ENST00000380232	T	0.17691	2.26	5.42	2.98	0.34508	Four-helical cytokine-like, core (1);	0.521400	0.20464	N	0.091829	T	0.10680	0.0261	L	0.41356	1.27	0.09310	N	1	B	0.21071	0.051	B	0.11329	0.006	T	0.37384	-0.9708	10	0.02654	T	1	-7.3599	8.4019	0.32592	0.0:0.1627:0.0:0.8373	.	23	P01574	IFNB_HUMAN	G	23	ENSP00000369581:S23G	ENSP00000369581:S23G	S	-	1	0	IFNB1	21067802	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.142000	0.16096	1.032000	0.39892	0.528000	0.53228	AGC	.	.		0.468	IFNB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051881.1	NM_002176	
ELAVL2	1993	hgsc.bcm.edu	37	9	23731087	23731087	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:23731087T>C	ENST00000397312.2	-	3	540	c.266A>G	c.(265-267)gAc>gGc	p.D89G	ELAVL2_ENST00000223951.6_Missense_Mutation_p.D89G|ELAVL2_ENST00000544538.1_Missense_Mutation_p.D89G|ELAVL2_ENST00000380110.4_Missense_Mutation_p.D118G|ELAVL2_ENST00000380117.1_Missense_Mutation_p.D89G	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	89	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		ATCCTTGGGGTCAATGTAGTT	0.373																																					p.D89G		Atlas-SNP	.											.	ELAVL2	80	.	0			c.A266G						.						138.0	117.0	124.0					9																	23731087		2203	4299	6502	SO:0001583	missense	1993	exon3			TTGGGGTCAATGT	BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.266A>G	chr9.hg19:g.23731087T>C	ENSP00000380479:p.Asp89Gly	108.0	0.0		89.0	4.0	NM_001171195	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	hg19	CCDS6515.1	.	.	.	.	.	.	.	.	.	.	T	17.33	3.363107	0.61513	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000440102	T;T;T;T;T	0.77098	3.14;-1.07;-1.07;-1.07;3.14	5.87	5.87	0.94306	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.130344	0.64402	D	0.000001	D	0.85513	0.5714	M	0.79805	2.47	0.80722	D	1	B;B	0.23937	0.094;0.006	P;B	0.46275	0.51;0.069	T	0.80422	-0.1389	10	0.14656	T	0.56	.	16.2377	0.82389	0.0:0.0:0.0:1.0	.	89;89	Q12926;Q12926-2	ELAV2_HUMAN;.	G	89;89;89;89;89;117;89	ENSP00000223951:D89G;ENSP00000380479:D89G;ENSP00000440998:D89G;ENSP00000369460:D89G;ENSP00000412602:D89G	ENSP00000223951:D89G	D	-	2	0	ELAVL2	23721087	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.782000	0.68973	2.371000	0.80710	0.533000	0.62120	GAC	.	.		0.373	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	NM_004432	
LINGO2	158038	hgsc.bcm.edu	37	9	27950199	27950199	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:27950199A>G	ENST00000379992.2	-	6	920	c.471T>C	c.(469-471)tcT>tcC	p.S157S	LINGO2_ENST00000308675.3_Silent_p.S157S	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	157						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CCACTTCTAGAGACTTCAGGT	0.418																																					p.S157S		Atlas-SNP	.											.	LINGO2	244	.	0			c.T471C						.						69.0	64.0	66.0					9																	27950199		2203	4300	6503	SO:0001819	synonymous_variant	158038	exon7			TTCTAGAGACTTC	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.471T>C	chr9.hg19:g.27950199A>G		106.0	0.0		94.0	5.0	NM_001258282	A8K4K7|B2RPM5|Q6ZMD0	Silent	SNP	ENST00000379992.2	hg19	CCDS6524.1																																																																																			.	.		0.418	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
NDUFB6	4712	hgsc.bcm.edu	37	9	32572964	32572964	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:32572964T>C	ENST00000379847.3	-	1	196	c.95A>G	c.(94-96)gAg>gGg	p.E32G	NDUFB6_ENST00000350021.2_Missense_Mutation_p.E32G	NM_002493.4	NP_002484.1	O95139	NDUB6_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa	32					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.E32V(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|urinary_tract(1)	8			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00199)		CAGCACCGGCTCCCGAGGGCT	0.557											OREG0019131	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E32G		Atlas-SNP	.											NDUFB6,caecum,carcinoma,0,1	NDUFB6	12	.	1	Substitution - Missense(1)	large_intestine(1)	c.A95G						.						36.0	40.0	39.0					9																	32572964		2203	4300	6503	SO:0001583	missense	4712	exon1			ACCGGCTCCCGAG	AF035840	CCDS6528.1, CCDS6529.1, CCDS75826.1	9p13.2	2011-07-04	2002-08-29		ENSG00000165264	ENSG00000165264		"""Mitochondrial respiratory chain complex / Complex I"""	7701	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase beta subunit, 6"", ""NADH-ubiquinone oxidoreductase B17 subunit"", ""complex I, mitochondrial respiratory chain, B17 subunit"""	603322	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 (17kD, B17)"""			9763677, 9760212	Standard	NM_002493		Approved	B17, CI	uc003zre.2	O95139	OTTHUMG00000019741	ENST00000379847.3:c.95A>G	chr9.hg19:g.32572964T>C	ENSP00000369176:p.Glu32Gly	39.0	1.0	833	35.0	2.0	NM_001199987	A8K0Y7|Q5VYT2|Q6IB84	Missense_Mutation	SNP	ENST00000379847.3	hg19	CCDS6528.1	.	.	.	.	.	.	.	.	.	.	T	31	5.095150	0.94197	.	.	ENSG00000165264	ENST00000379847;ENST00000350021	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.78291	0.4260	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.81161	-0.1059	9	0.87932	D	0	-18.6602	14.2949	0.66304	0.0:0.0:0.0:1.0	.	32;32	Q5VYT2;O95139	.;NDUB6_HUMAN	G	32	.	ENSP00000297983:E32G	E	-	2	0	NDUFB6	32562964	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.571000	0.74000	2.271000	0.75665	0.533000	0.62120	GAG	.	.		0.557	NDUFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052001.1	NM_002493	
TMEM215	401498	hgsc.bcm.edu	37	9	32784212	32784212	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:32784212G>T	ENST00000342743.5	+	2	396	c.31G>T	c.(31-33)Ggg>Tgg	p.G11W		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	11						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						CCCGAGGACTGGGCTGGTGGT	0.562																																					p.G11W		Atlas-SNP	.											.	TMEM215	38	.	0			c.G31T						.						119.0	114.0	115.0					9																	32784212		2203	4300	6503	SO:0001583	missense	401498	exon2			AGGACTGGGCTGG		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.31G>T	chr9.hg19:g.32784212G>T	ENSP00000345468:p.Gly11Trp	388.0	1.0		433.0	180.0	NM_212558	Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	hg19	CCDS6530.1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544356	0.45280	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000002	T	0.65954	0.2741	L	0.27053	0.805	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.69997	-0.4993	9	0.87932	D	0	-20.2017	16.4706	0.84111	0.0:0.0:1.0:0.0	.	11	Q68D42	TM215_HUMAN	W	11	.	ENSP00000345468:G11W	G	+	1	0	TMEM215	32774212	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.536000	0.82023	2.494000	0.84150	0.462000	0.41574	GGG	.	.		0.562	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	NM_212558	
PIGO	84720	hgsc.bcm.edu	37	9	35092757	35092757	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:35092757C>T	ENST00000378617.3	-	7	1521	c.1127G>A	c.(1126-1128)cGa>cAa	p.R376Q	PIGO_ENST00000341666.3_Missense_Mutation_p.R376Q|PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000298004.5_Missense_Mutation_p.R376Q|PIGO_ENST00000361778.2_Missense_Mutation_p.R376Q	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	376					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			ATGAAGAAATCGGGACACCTG	0.512																																					p.R376Q		Atlas-SNP	.											PIGO,NS,carcinoma,0,1	PIGO	86	.	0			c.G1127A						.						38.0	43.0	42.0					9																	35092757		2160	4183	6343	SO:0001583	missense	84720	exon8			AGAAATCGGGACA	AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.1127G>A	chr9.hg19:g.35092757C>T	ENSP00000367880:p.Arg376Gln	55.0	0.0		49.0	2.0	NM_001201484	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	ENST00000378617.3	hg19	CCDS6575.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100237	0.76983	.	.	ENSG00000165282	ENST00000298004;ENST00000378617;ENST00000341666;ENST00000361778	T;T;T;T	0.59638	0.36;0.25;0.25;0.36	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.76456	0.3990	M	0.73372	2.23	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.943	T	0.74699	-0.3577	10	0.46703	T	0.11	-14.9231	19.6982	0.96039	0.0:1.0:0.0:0.0	.	376;376	Q8TEQ8-2;Q8TEQ8	.;PIGO_HUMAN	Q	376	ENSP00000298004:R376Q;ENSP00000367880:R376Q;ENSP00000339382:R376Q;ENSP00000354678:R376Q	ENSP00000298004:R376Q	R	-	2	0	PIGO	35082757	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	5.473000	0.66774	2.894000	0.99253	0.655000	0.94253	CGA	.	.		0.512	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052284.1	NM_032634	
FRMPD1	22844	hgsc.bcm.edu	37	9	37745568	37745568	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:37745568A>G	ENST00000539465.1	+	16	4132	c.3539A>G	c.(3538-3540)gAc>gGc	p.D1180G	FRMPD1_ENST00000377765.3_Missense_Mutation_p.D1180G|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1180						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CCCCCTAGAGACCCTCAAGGA	0.488																																					p.D1180G		Atlas-SNP	.											.	FRMPD1	237	.	0			c.A3539G						.						55.0	58.0	57.0					9																	37745568		2203	4300	6503	SO:0001583	missense	22844	exon16			CTAGAGACCCTCA	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3539A>G	chr9.hg19:g.37745568A>G	ENSP00000444411:p.Asp1180Gly	68.0	0.0		89.0	4.0	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	hg19	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.340980	0.24339	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.07567	3.18;3.18	5.01	-5.66	0.02451	.	2.508960	0.01261	N	0.009189	T	0.04679	0.0127	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34750	-0.9816	10	0.30078	T	0.28	7.9247	6.5175	0.22256	0.3243:0.2688:0.4069:0.0	.	1180	Q5SYB0	FRPD1_HUMAN	G	1180	ENSP00000366995:D1180G;ENSP00000444411:D1180G	ENSP00000366995:D1180G	D	+	2	0	FRMPD1	37735568	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-1.437000	0.02419	-1.347000	0.02208	0.459000	0.35465	GAC	.	.		0.488	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
PRKACG	5568	hgsc.bcm.edu	37	9	71628966	71628966	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:71628966T>C	ENST00000377276.2	-	1	73	c.43A>G	c.(43-45)Agc>Ggc	p.S15G		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	15					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						TCGTTCACGCTCTCCTCCTGC	0.682																																					p.S15G	Esophageal Squamous(110;2236 2623 32146)	Atlas-SNP	.											.	PRKACG	65	.	0			c.A43G						.						48.0	49.0	48.0					9																	71628966		2203	4300	6503	SO:0001583	missense	5568	exon1			TCACGCTCTCCTC	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.43A>G	chr9.hg19:g.71628966T>C	ENSP00000366488:p.Ser15Gly	127.0	0.0		90.0	4.0	NM_002732	O60850|Q5VZ02|Q86YI1	Missense_Mutation	SNP	ENST00000377276.2	hg19	CCDS6625.1	.	.	.	.	.	.	.	.	.	.	T	10.17	1.275434	0.23307	.	.	ENSG00000165059	ENST00000377276	T	0.68025	-0.3	0.969	0.969	0.19686	Protein kinase-like domain (1);	.	.	.	.	T	0.58850	0.2151	L	0.60455	1.87	0.19575	N	0.999964	B	0.11235	0.004	B	0.16722	0.016	T	0.54708	-0.8253	9	0.66056	D	0.02	.	5.7336	0.18053	0.0:0.0:0.0:1.0	.	15	P22612	KAPCG_HUMAN	G	15	ENSP00000366488:S15G	ENSP00000366488:S15G	S	-	1	0	PRKACG	70818786	.	.	0.003000	0.11579	0.003000	0.03518	.	.	0.344000	0.23847	0.338000	0.21704	AGC	.	.		0.682	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1		
ANXA1	301	hgsc.bcm.edu	37	9	75775231	75775231	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:75775231T>C	ENST00000376911.1	+	4	1205	c.323T>C	c.(322-324)gTt>gCt	p.V108A	ANXA1_ENST00000257497.6_Missense_Mutation_p.V108A			P04083	ANXA1_HUMAN	annexin A1	108					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	GAGGAGGTTGTTTTAGCTCTG	0.423																																					p.V108A		Atlas-SNP	.											.	ANXA1	27	.	0			c.T323C						.						119.0	120.0	120.0					9																	75775231		2203	4300	6503	SO:0001583	missense	301	exon5			AGGTTGTTTTAGC	X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.323T>C	chr9.hg19:g.75775231T>C	ENSP00000366109:p.Val108Ala	98.0	0.0		93.0	4.0	NM_000700		Missense_Mutation	SNP	ENST00000376911.1	hg19	CCDS6645.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.626184	0.46840	.	.	ENSG00000135046	ENST00000257497;ENST00000456643;ENST00000415424;ENST00000376911	T;T;T;T	0.03635	3.86;3.86;3.86;3.86	5.92	-6.94	0.01633	Annexin repeat, conserved site (1);	0.357177	0.31760	N	0.007104	T	0.05318	0.0141	L	0.60012	1.86	0.33102	D	0.539362	B	0.12630	0.006	B	0.19148	0.024	T	0.02661	-1.1127	10	0.59425	D	0.04	.	20.448	0.99123	0.0:0.0998:0.0:0.9002	.	108	P04083	ANXA1_HUMAN	A	108;119;108;108	ENSP00000257497:V108A;ENSP00000412489:V119A;ENSP00000414013:V108A;ENSP00000366109:V108A	ENSP00000257497:V108A	V	+	2	0	ANXA1	74965051	0.001000	0.12720	0.011000	0.14972	0.925000	0.55904	-0.212000	0.09319	-1.470000	0.01888	-0.248000	0.11899	GTT	.	.		0.423	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052665.1	NM_000700	
ERCC6L2	375748	hgsc.bcm.edu	37	9	98691001	98691001	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:98691001T>C	ENST00000288985.7	+	11	1944	c.1639T>C	c.(1639-1641)Ttg>Ctg	p.L547L	ERCC6L2_ENST00000437817.1_Splice_Site_p.L358L|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	547	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										TCTCGTCTAGTTGCTTGACGT	0.393																																					p.L547L		Atlas-SNP	.											.	.	.	.	0			c.T1639C						.						130.0	115.0	120.0					9																	98691001		2203	4300	6503	SO:0001630	splice_region_variant	375748	exon11			GTCTAGTTGCTTG	BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1639-1T>C	chr9.hg19:g.98691001T>C		87.0	0.0		103.0	5.0	NM_001010895	A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Silent	SNP	ENST00000288985.7	hg19	CCDS35072.1																																																																																			.	.		0.393	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053247.2	NM_001010895	Silent
SVEP1	79987	hgsc.bcm.edu	37	9	113171160	113171160	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:113171160A>G	ENST00000401783.2	-	38	7056	c.6720T>C	c.(6718-6720)agT>agC	p.S2240S	SVEP1_ENST00000374469.1_Silent_p.S2217S|SVEP1_ENST00000297826.5_Silent_p.S166S	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2240	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CAAATACAGGACTTCCGACTG	0.507																																					p.S2240S		Atlas-SNP	.											.	SVEP1	326	.	0			c.T6720C						.						131.0	135.0	134.0					9																	113171160		2035	4203	6238	SO:0001819	synonymous_variant	79987	exon38			TACAGGACTTCCG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6720T>C	chr9.hg19:g.113171160A>G		42.0	0.0		74.0	4.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	hg19	CCDS48004.1																																																																																			.	.		0.507	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
KIAA1958	158405	hgsc.bcm.edu	37	9	115422320	115422320	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:115422320A>G	ENST00000337530.6	+	4	2418	c.2122A>G	c.(2122-2124)Agg>Ggg	p.R708G	KIAA1958_ENST00000536272.1_Missense_Mutation_p.R736G	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	708										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						GGTCTCCCGGAGGCTTGGCTC	0.617																																					p.R708G		Atlas-SNP	.											.	KIAA1958	52	.	0			c.A2122G						.						49.0	50.0	50.0					9																	115422320		2203	4300	6503	SO:0001583	missense	158405	exon4			TCCCGGAGGCTTG	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.2122A>G	chr9.hg19:g.115422320A>G	ENSP00000336940:p.Arg708Gly	74.0	0.0		78.0	4.0	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	ENST00000337530.6	hg19	CCDS35108.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.425989	0.43020	.	.	ENSG00000165185	ENST00000337530;ENST00000536272	.	.	.	5.95	4.79	0.61399	.	.	.	.	.	T	0.26448	0.0646	N	0.08118	0	0.24694	N	0.99329	B;B	0.19817	0.039;0.016	B;B	0.12156	0.007;0.004	T	0.23261	-1.0193	8	0.72032	D	0.01	.	12.7962	0.57560	0.8584:0.1416:0.0:0.0	.	736;708	B7ZKW6;Q8N8K9	.;K1958_HUMAN	G	708;736	.	ENSP00000336940:R708G	R	+	1	2	KIAA1958	114462141	1.000000	0.71417	0.991000	0.47740	0.998000	0.95712	4.442000	0.59988	1.048000	0.40298	0.533000	0.62120	AGG	.	.		0.617	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
DFNB31	25861	hgsc.bcm.edu	37	9	117186678	117186678	+	Missense_Mutation	SNP	C	C	G	rs117352600	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:117186678C>G	ENST00000362057.3	-	6	1520	c.1352G>C	c.(1351-1353)gGt>gCt	p.G451A	DFNB31_ENST00000374059.3_Missense_Mutation_p.G100A|DFNB31_ENST00000265134.6_Missense_Mutation_p.G68A	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	451					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GACGCTGCCACCACGGTACTC	0.627																																					p.G451A		Atlas-SNP	.											DFNB31,NS,carcinoma,0,1	DFNB31	100	.	0			c.G1352C						.						98.0	79.0	86.0					9																	117186678		2203	4300	6503	SO:0001583	missense	25861	exon6			CTGCCACCACGGT	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1352G>C	chr9.hg19:g.117186678C>G	ENSP00000354623:p.Gly451Ala	229.0	0.0		178.0	0.0	NM_001173425	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	hg19	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736298	0.30774	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.06294	4.21;4.2;3.32	5.49	2.08	0.27032	.	0.580016	0.18819	N	0.130285	T	0.05273	0.0140	L	0.43152	1.355	0.80722	D	1	B;B;B	0.28512	0.139;0.139;0.214	B;B;B	0.30572	0.05;0.034;0.117	T	0.39165	-0.9627	10	0.33141	T	0.24	-2.7096	2.0825	0.03638	0.2411:0.3747:0.0:0.3842	.	451;451;100	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	A	68;100;451	ENSP00000265134:G68A;ENSP00000363172:G100A;ENSP00000354623:G451A	ENSP00000265134:G68A	G	-	2	0	DFNB31	116226499	0.453000	0.25721	0.081000	0.20488	0.944000	0.59088	2.923000	0.48868	0.771000	0.33359	0.561000	0.74099	GGT	.	C|0.997;T|0.003		0.627	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
CNTRL	11064	hgsc.bcm.edu	37	9	123858738	123858738	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:123858738A>G	ENST00000373855.1	+	6	778	c.518A>G	c.(517-519)aAg>aGg	p.K173R	CNTRL_ENST00000238341.5_Missense_Mutation_p.K173R|CNTRL_ENST00000373865.2_Missense_Mutation_p.K173R			Q7Z7A1	CNTRL_HUMAN	centriolin	173					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AATCTGCAAAAGCTTAACCTT	0.328																																					p.K173R		Atlas-SNP	.											.	CNTRL	161	.	0			c.A518G						.						85.0	88.0	87.0					9																	123858738		2203	4299	6502	SO:0001583	missense	11064	exon4			TGCAAAAGCTTAA	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.518A>G	chr9.hg19:g.123858738A>G	ENSP00000362962:p.Lys173Arg	76.0	0.0		85.0	4.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	hg19	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672550	0.67928	.	.	ENSG00000119397	ENST00000373865;ENST00000373855;ENST00000238341;ENST00000454238	T;T	0.54479	0.57;0.57	6.08	6.08	0.98989	.	.	.	.	.	T	0.50292	0.1607	L	0.41632	1.29	0.32248	N	0.571781	P	0.40931	0.733	P	0.46758	0.526	T	0.56475	-0.7973	9	0.20519	T	0.43	.	11.6641	0.51364	0.9296:0.0:0.0704:0.0	.	173	Q7Z7A1	CNTRL_HUMAN	R	173	ENSP00000362962:K173R;ENSP00000238341:K173R	ENSP00000238341:K173R	K	+	2	0	CNTRL	122898559	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.228000	0.58619	2.333000	0.79357	0.482000	0.46254	AAG	.	.		0.328	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
CNTRL	11064	hgsc.bcm.edu	37	9	123924501	123924501	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:123924501T>C	ENST00000373855.1	+	34	5635	c.5375T>C	c.(5374-5376)cTc>cCc	p.L1792P	CNTRL_ENST00000373850.1_Missense_Mutation_p.L1240P|CNTRL_ENST00000238341.5_Missense_Mutation_p.L1792P|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	1792					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AAGGAAGATCTCCAAGAGAAA	0.423																																					p.L1792P		Atlas-SNP	.											.	CNTRL	161	.	0			c.T5375C						.						74.0	75.0	75.0					9																	123924501		2203	4300	6503	SO:0001583	missense	11064	exon32			AAGATCTCCAAGA	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.5375T>C	chr9.hg19:g.123924501T>C	ENSP00000362962:p.Leu1792Pro	116.0	0.0		87.0	5.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	hg19	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.256716	0.80246	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373845	T;T;T	0.54279	0.84;0.84;0.58	5.89	5.89	0.94794	.	.	.	.	.	T	0.70159	0.3192	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	T	0.71593	-0.4546	9	0.52906	T	0.07	.	15.4921	0.75615	0.0:0.0:0.0:1.0	.	1792	Q7Z7A1	CNTRL_HUMAN	P	1792;1792;1792;548;1240;474	ENSP00000362962:L1792P;ENSP00000238341:L1792P;ENSP00000362956:L1240P	ENSP00000238341:L1792P	L	+	2	0	CNTRL	122964322	1.000000	0.71417	0.985000	0.45067	0.988000	0.76386	5.284000	0.65627	2.257000	0.74773	0.460000	0.39030	CTC	.	.		0.423	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
NEK6	10783	hgsc.bcm.edu	37	9	127101926	127101926	+	Silent	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:127101926G>T	ENST00000320246.5	+	8	844	c.699G>T	c.(697-699)ctG>ctT	p.L233L	NEK6_ENST00000539416.1_Silent_p.L258L|NEK6_ENST00000546191.1_Silent_p.L233L|NEK6_ENST00000540326.1_Silent_p.L251L|NEK6_ENST00000373600.3_Silent_p.L267L|NEK6_ENST00000545174.1_Silent_p.L233L|NEK6_ENST00000373603.1_Silent_p.L233L|NEK6_ENST00000394199.2_Silent_p.L267L	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						TCTGGTCCCTGGGCTGTCTGC	0.602																																					p.L267L	NSCLC(122;934 1785 18647 44295 45571)	Atlas-SNP	.											.	NEK6	47	.	0			c.G801T						.						275.0	203.0	227.0					9																	127101926		2203	4300	6503	SO:0001819	synonymous_variant	10783	exon9			GTCCCTGGGCTGT	AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.699G>T	chr9.hg19:g.127101926G>T		257.0	0.0		238.0	10.0	NM_001166171	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Silent	SNP	ENST00000320246.5	hg19	CCDS6854.1																																																																																			.	.		0.602	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054016.1	NM_014397	
CEL	1056	hgsc.bcm.edu	37	9	135944115	135944115	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:135944115G>T	ENST00000372080.4	+	8	977	c.961G>T	c.(961-963)Gct>Tct	p.A321S	CEL_ENST00000351304.7_Missense_Mutation_p.A318S	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	318					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CTTCATCCCCGCTGACCCGAT	0.577																																					p.A321S		Atlas-SNP	.											.	CEL	71	.	0			c.G961T						.						28.0	33.0	31.0					9																	135944115		1894	4088	5982	SO:0001583	missense	1056	exon8			ATCCCCGCTGACC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.961G>T	chr9.hg19:g.135944115G>T	ENSP00000361151:p.Ala321Ser	833.0	1.0		651.0	122.0	NM_001807	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	hg19	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.000645	0.35320	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.67171	-0.25;-0.25	5.46	2.58	0.30949	Carboxylesterase, type B (1);	0.095855	0.64402	D	0.000001	T	0.46600	0.1401	N	0.13272	0.32	0.09310	N	1	B	0.14438	0.01	B	0.20577	0.03	T	0.42413	-0.9453	10	0.87932	D	0	.	7.6018	0.28079	0.1456:0.0:0.7211:0.1332	.	318	P19835	CEL_HUMAN	S	321;318;321	ENSP00000361151:A321S;ENSP00000342217:A318S	ENSP00000304021:A321S	A	+	1	0	CEL	134933936	1.000000	0.71417	0.000000	0.03702	0.503000	0.33858	7.548000	0.82154	0.262000	0.21774	0.561000	0.74099	GCT	.	.		0.577	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1		
AGPAT2	10555	hgsc.bcm.edu	37	9	139569213	139569213	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:139569213T>C	ENST00000371696.2	-	5	700	c.635A>G	c.(634-636)aAc>aGc	p.N212S	AGPAT2_ENST00000538402.1_Missense_Mutation_p.N212S|AGPAT2_ENST00000371694.3_Missense_Mutation_p.N180S	NM_006412.3	NP_006403.2	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	212					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|epidermis development (GO:0008544)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)	6	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CTTCTTGGTGTTGTAGAAGGA	0.632																																					p.N212S		Atlas-SNP	.											.	AGPAT2	17	.	0			c.A635G						.						95.0	85.0	88.0					9																	139569213		2203	4294	6497	SO:0001583	missense	10555	exon5			TTGGTGTTGTAGA	AF000237	CCDS7003.1, CCDS35181.1	9q34.3	2013-02-05	2013-02-05		ENSG00000169692	ENSG00000169692	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	325	protein-coding gene	gene with protein product	"""LPAAT-beta"", ""lysophosphatidic acid acyltransferase, beta"""	603100	"""Berardinelli-Seip congenital lipodystrophy"", ""1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)"""	BSCL		9242711, 9212163	Standard	NM_006412		Approved		uc004cii.1	O15120	OTTHUMG00000020936	ENST00000371696.2:c.635A>G	chr9.hg19:g.139569213T>C	ENSP00000360761:p.Asn212Ser	64.0	0.0		53.0	4.0	NM_006412	O00516|O15106|Q5VUD3|Q5VUD4|Q9BSV7|Q9BWR7	Missense_Mutation	SNP	ENST00000371696.2	hg19	CCDS7003.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.189907	0.00302	.	.	ENSG00000169692	ENST00000371694;ENST00000371696;ENST00000538402	D;D;D	0.92911	-3.13;-3.13;-3.13	4.36	0.699	0.18093	.	0.956133	0.08683	N	0.909205	T	0.79924	0.4530	N	0.05280	-0.08	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.13407	0.009;0.004	T	0.65274	-0.6208	10	0.17369	T	0.5	-10.5002	6.5893	0.22638	0.0:0.3073:0.0:0.6927	.	180;212	O15120-2;O15120	.;PLCB_HUMAN	S	180;212;212	ENSP00000360759:N180S;ENSP00000360761:N212S;ENSP00000438919:N212S	ENSP00000360759:N180S	N	-	2	0	AGPAT2	138689034	0.038000	0.19896	0.003000	0.11579	0.044000	0.14063	0.397000	0.20883	0.187000	0.20147	0.338000	0.21704	AAC	.	.		0.632	AGPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055090.1	NM_006412	
EHMT1	79813	hgsc.bcm.edu	37	9	140729307	140729307	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:140729307A>G	ENST00000460843.1	+	27	3826	c.3799A>G	c.(3799-3801)Agc>Ggc	p.S1267G		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1267					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CCGGCACTCGAGCGCGGCCCT	0.687																																					p.S1267G		Atlas-SNP	.											.	EHMT1	196	.	0			c.A3799G						.						24.0	24.0	24.0					9																	140729307		2201	4298	6499	SO:0001583	missense	79813	exon27			CACTCGAGCGCGG	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3799A>G	chr9.hg19:g.140729307A>G	ENSP00000417980:p.Ser1267Gly	40.0	0.0		49.0	4.0	NM_024757	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	ENST00000460843.1	hg19	CCDS7050.2	.	.	.	.	.	.	.	.	.	.	A	13.56	2.275085	0.40194	.	.	ENSG00000181090	ENST00000460843	T	0.70399	-0.48	5.22	4.07	0.47477	.	0.346503	0.35179	N	0.003385	T	0.55401	0.1918	N	0.21448	0.665	0.33246	D	0.55791	B	0.06786	0.001	B	0.08055	0.003	T	0.59590	-0.7426	10	0.41790	T	0.15	.	11.1585	0.48501	0.9269:0.0:0.0731:0.0	.	1267	Q9H9B1	EHMT1_HUMAN	G	1267	ENSP00000417980:S1267G	ENSP00000417980:S1267G	S	+	1	0	EHMT1	139849128	0.950000	0.32346	0.554000	0.28268	0.953000	0.61014	2.658000	0.46733	0.930000	0.37217	0.459000	0.35465	AGC	.	.		0.687	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757	
CACNA1B	774	hgsc.bcm.edu	37	9	140878654	140878654	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:140878654T>A	ENST00000371372.1	+	13	1866	c.1721T>A	c.(1720-1722)aTc>aAc	p.I574N	CACNA1B_ENST00000371355.4_Missense_Mutation_p.I575N|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000371357.1_Missense_Mutation_p.I575N|CACNA1B_ENST00000371363.1_Missense_Mutation_p.I574N|CACNA1B_ENST00000277551.2_Missense_Mutation_p.I574N	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	574					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCTTTGGGATCAGTGTGCTG	0.627																																					p.I574N		Atlas-SNP	.											.	CACNA1B	266	.	0			c.T1721A						.						68.0	83.0	78.0					9																	140878654		2093	4218	6311	SO:0001583	missense	774	exon13			TTGGGATCAGTGT	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1721T>A	chr9.hg19:g.140878654T>A	ENSP00000360423:p.Ile574Asn	282.0	1.0		229.0	102.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518029	0.64634	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14	4.5	4.5	0.54988	.	0.101398	0.64402	D	0.000002	D	0.99269	0.9745	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98994	1.0809	10	0.87932	D	0	.	14.1601	0.65441	0.0:0.0:0.0:1.0	.	574;574	B1AQK4;B1AQK6	.;.	N	574;574;574;575;575	ENSP00000360423:I574N;ENSP00000277551:I574N;ENSP00000360414:I574N;ENSP00000360408:I575N;ENSP00000360406:I575N	ENSP00000277551:I574N	I	+	2	0	CACNA1B	139998475	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.793000	0.85851	1.788000	0.52465	0.454000	0.30748	ATC	.	.		0.627	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
ITIH5	80760	hgsc.bcm.edu	37	10	7608182	7608182	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:7608182C>A	ENST00000256861.6	-	13	2416	c.2338G>T	c.(2338-2340)Gtg>Ttg	p.V780L	ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000446830.2_Missense_Mutation_p.V562L|ITIH5_ENST00000298441.6_Missense_Mutation_p.V566L	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	780					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTCCCCACCACCACACTCTGG	0.572																																					p.V780L		Atlas-SNP	.											.	ITIH5	343	.	0			c.G2338T						.						90.0	68.0	76.0					10																	7608182		2203	4300	6503	SO:0001583	missense	80760	exon13			CCACCACCACACT			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2338G>T	chr10.hg19:g.7608182C>A	ENSP00000256861:p.Val780Leu	198.0	0.0		158.0	64.0	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	hg19		.	.	.	.	.	.	.	.	.	.	C	11.06	1.527890	0.27299	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.11712	2.75;2.75;2.75	5.84	4.94	0.65067	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.422460	0.28312	N	0.015802	T	0.09247	0.0228	.	.	.	0.18873	N	0.999983	P;P	0.43938	0.822;0.787	B;B	0.40702	0.338;0.228	T	0.22591	-1.0212	9	0.25751	T	0.34	-13.8082	10.7982	0.46472	0.0:0.8562:0.0:0.1438	.	780;566	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	L	780;566;562	ENSP00000256861:V780L;ENSP00000298441:V566L;ENSP00000387969:V562L	ENSP00000256861:V780L	V	-	1	0	ITIH5	7648188	0.000000	0.05858	0.136000	0.22124	0.912000	0.54170	0.579000	0.23788	1.462000	0.47948	0.655000	0.94253	GTG	.	.		0.572	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
CDC123	8872	hgsc.bcm.edu	37	10	12280454	12280454	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:12280454A>G	ENST00000281141.4	+	10	968		c.e10-1		CDC123_ENST00000378900.2_Splice_Site|CDC123_ENST00000455773.3_Splice_Site	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						TCTCCTTTACAGTTGTGTTCG	0.299																																					.		Atlas-SNP	.											.	CDC123	34	.	0			c.689-2A>G						.						77.0	80.0	79.0					10																	12280454		2202	4299	6501	SO:0001630	splice_region_variant	8872	exon10			CTTTACAGTTGTG	BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.689-1A>G	chr10.hg19:g.12280454A>G		82.0	0.0		77.0	4.0	NM_006023	A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	Splice_Site	SNP	ENST00000281141.4	hg19	CCDS7090.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.976359	0.74360	.	.	ENSG00000151465	ENST00000281141;ENST00000378900;ENST00000455773;ENST00000440613	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.519	0.67838	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDC123	12320460	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.080000	0.76837	2.079000	0.62486	0.482000	0.46254	.	.	.		0.299	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046801.1	NM_006023	Intron
KIF5B	3799	hgsc.bcm.edu	37	10	32308888	32308888	+	Splice_Site	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:32308888C>T	ENST00000302418.4	-	20	2662		c.e20-1		KIF5B_ENST00000493889.1_Splice_Site	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B						ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				CTGGTTTTGGCTGACGAAAGA	0.323			T	"""RET, ALK"""	NSCLC																																.		Atlas-SNP	.		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	.	KIF5B	81	.	0			c.2205-1G>A						.						183.0	172.0	176.0					10																	32308888		2203	4298	6501	SO:0001630	splice_region_variant	3799	exon21			TTTTGGCTGACGA	X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.2205-1G>A	chr10.hg19:g.32308888C>T		102.0	0.0		125.0	5.0	NM_004521	A0AVB2|Q5VZ85	Splice_Site	SNP	ENST00000302418.4	hg19	CCDS7171.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083391	0.36758	.	.	ENSG00000170759	ENST00000302418	.	.	.	5.33	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2919	0.73872	0.1414:0.8586:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF5B	32348894	1.000000	0.71417	0.999000	0.59377	0.359000	0.29487	7.818000	0.86416	1.216000	0.43427	-0.518000	0.04402	.	.	.		0.323	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521	Intron
CCNY	219771	hgsc.bcm.edu	37	10	35857995	35857995	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:35857995T>C	ENST00000374704.4	+	10	1103	c.923T>C	c.(922-924)cTc>cCc	p.L308P	CCNY_ENST00000374706.1_Missense_Mutation_p.L254P|CCNY_ENST00000339497.5_Missense_Mutation_p.L283P|CCNY_ENST00000265375.9_Missense_Mutation_p.L254P	NM_145012.4	NP_659449.3	Q8ND76	CCNY_HUMAN	cyclin Y	308					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	8						ATCTCTCGCCTCTGCGAGGAC	0.617																																					p.L308P		Atlas-SNP	.											.	CCNY	22	.	0			c.T923C						.						59.0	51.0	54.0					10																	35857995		2203	4300	6503	SO:0001583	missense	219771	exon10			CTCGCCTCTGCGA	AF413522, AY504868	CCDS7189.1, CCDS7190.1, CCDS60513.1	10p11.22	2011-01-25	2007-02-09	2007-02-09	ENSG00000108100	ENSG00000108100			23354	protein-coding gene	gene with protein product		612786	"""chromosome 10 open reading frame 9"""	C10orf9		20441050	Standard	XM_005252388		Approved	CFP1, CBCP1	uc001iyw.4	Q8ND76	OTTHUMG00000017955	ENST00000374704.4:c.923T>C	chr10.hg19:g.35857995T>C	ENSP00000363836:p.Leu308Pro	55.0	0.0		74.0	4.0	NM_145012	B7ZKX9|D3DRY9|Q2M3V4|Q2TU96|Q6NT86|Q7Z4U7|Q8TEX2|Q8TEX3|Q96M99|Q96P45	Missense_Mutation	SNP	ENST00000374704.4	hg19	CCDS7189.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.697299	0.88830	.	.	ENSG00000108100	ENST00000374706;ENST00000537547;ENST00000374704;ENST00000339497;ENST00000265375;ENST00000456784	T;T;T;T	0.35048	1.33;1.33;1.38;1.33	5.41	5.41	0.78517	.	0.061257	0.64402	D	0.000005	T	0.56978	0.2022	M	0.64404	1.975	0.80722	D	1	P;D;D	0.89917	0.955;0.999;1.0	P;D;D	0.79108	0.707;0.985;0.992	T	0.56123	-0.8031	10	0.41790	T	0.15	-18.3654	15.4376	0.75157	0.0:0.0:0.0:1.0	.	175;283;308	B7Z8E4;Q8ND76-2;Q8ND76	.;.;CCNY_HUMAN	P	254;308;308;283;254;175	ENSP00000363838:L254P;ENSP00000363836:L308P;ENSP00000344275:L283P;ENSP00000265375:L254P	ENSP00000265375:L254P	L	+	2	0	CCNY	35898001	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.004000	0.88535	2.053000	0.61076	0.533000	0.62120	CTC	.	.		0.617	CCNY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047568.2	NM_181698	
NPY4R	5540	hgsc.bcm.edu	37	10	47087681	47087681	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:47087681G>T	ENST00000395716.1	+	2	983	c.898G>T	c.(898-900)Ggg>Tgg	p.G300W	NPY4R_ENST00000374312.1_Missense_Mutation_p.G300W			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	300					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)	p.G300W(1)									CATCTGCCACGGGAACCTCAT	0.547																																					p.G300W		Atlas-SNP	.											PPYR1,NS,carcinoma,0,1	PPYR1	54	.	1	Substitution - Missense(1)	lung(1)	c.G898T						.						182.0	155.0	164.0					10																	47087681		2203	4300	6503	SO:0001583	missense	5540	exon3			TGCCACGGGAACC		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.898G>T	chr10.hg19:g.47087681G>T	ENSP00000379066:p.Gly300Trp	218.0	0.0		235.0	0.0	NM_005972	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Missense_Mutation	SNP	ENST00000395716.1	hg19	CCDS31193.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218785	0.58560	.	.	ENSG00000204174	ENST00000374312;ENST00000395716	T;T	0.54071	0.59;0.59	5.18	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.181622	0.47455	D	0.000240	T	0.62221	0.2410	M	0.65498	2.005	0.35149	D	0.769569	D	0.64830	0.994	D	0.66084	0.941	T	0.68845	-0.5301	10	0.45353	T	0.12	.	5.0708	0.14606	0.1836:0.1737:0.6426:0.0	.	300	P50391	NPY4R_HUMAN	W	300	ENSP00000363431:G300W;ENSP00000379066:G300W	ENSP00000363431:G300W	G	+	1	0	PPYR1	46507687	0.959000	0.32827	0.982000	0.44146	0.963000	0.63663	1.986000	0.40677	1.344000	0.45657	0.655000	0.94253	GGG	.	.		0.547	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1		
ANK3	288	hgsc.bcm.edu	37	10	61822911	61822911	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:61822911T>C	ENST00000280772.2	-	40	12744	c.12553A>G	c.(12553-12555)Agt>Ggt	p.S4185G	ANK3_ENST00000373827.2_Missense_Mutation_p.S1566G|ANK3_ENST00000355288.2_Missense_Mutation_p.S706G|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000503366.1_Missense_Mutation_p.S1573G	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4185					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCTGCAAAACTTCTGGTGCCT	0.323																																					p.S4185G		Atlas-SNP	.											.	ANK3	703	.	0			c.A12553G						.						90.0	83.0	85.0					10																	61822911		2203	4300	6503	SO:0001583	missense	288	exon40			CAAAACTTCTGGT	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12553A>G	chr10.hg19:g.61822911T>C	ENSP00000280772:p.Ser4185Gly	86.0	0.0		90.0	5.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396551	0.62177	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817	D;T;T;T;T	0.93488	-3.23;0.34;0.34;0.34;0.34	5.38	5.38	0.77491	DEATH-like (2);	0.000000	0.49305	D	0.000149	D	0.92967	0.7762	L	0.27053	0.805	0.80722	D	1	P;P;B;P;P;D;D	0.56968	0.749;0.875;0.354;0.551;0.941;0.965;0.978	B;B;B;P;P;P;P	0.58172	0.206;0.377;0.101;0.673;0.737;0.834;0.688	D	0.94082	0.7345	10	0.72032	D	0.01	.	15.3904	0.74739	0.0:0.0:0.0:1.0	.	1573;706;1566;4185;807;706;105	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	G	4185;1566;164;706;706;1573;1552;807	ENSP00000280772:S4185G;ENSP00000362933:S1566G;ENSP00000362926:S164G;ENSP00000347436:S706G;ENSP00000425236:S1573G	ENSP00000280772:S4185G	S	-	1	0	ANK3	61492917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.023000	0.70848	2.048000	0.60808	0.383000	0.25322	AGT	.	.		0.323	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
RHOBTB1	9886	hgsc.bcm.edu	37	10	62671170	62671170	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:62671170T>C	ENST00000337910.5	-	3	468	c.131A>G	c.(130-132)cAg>cGg	p.Q44R	RNU2-72P_ENST00000411175.1_RNA|RHOBTB1_ENST00000357917.4_Missense_Mutation_p.Q44R	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	44	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					GGCCAGCAGCTGATACTGCGT	0.567																																					p.Q44R		Atlas-SNP	.											.	RHOBTB1	61	.	0			c.A131G						.						153.0	121.0	132.0					10																	62671170		2203	4300	6503	SO:0001583	missense	9886	exon3			AGCAGCTGATACT	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.131A>G	chr10.hg19:g.62671170T>C	ENSP00000338671:p.Gln44Arg	109.0	0.0		111.0	5.0	NM_014836		Missense_Mutation	SNP	ENST00000337910.5	hg19	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.302673	0.81136	.	.	ENSG00000072422	ENST00000357917;ENST00000337910;ENST00000536302	T;T	0.21543	2.0;2.0	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000001	T	0.21550	0.0519	N	0.21583	0.68	0.80722	D	1	B	0.28470	0.213	B	0.37943	0.261	T	0.08289	-1.0729	10	0.62326	D	0.03	.	15.9648	0.79961	0.0:0.0:0.0:1.0	.	44	O94844	RHBT1_HUMAN	R	44	ENSP00000350595:Q44R;ENSP00000338671:Q44R	ENSP00000338671:Q44R	Q	-	2	0	RHOBTB1	62341176	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	7.904000	0.87408	2.238000	0.73509	0.397000	0.26171	CAG	.	.		0.567	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
VPS26A	9559	hgsc.bcm.edu	37	10	70917887	70917887	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:70917887T>C	ENST00000373382.1	+	6	1124	c.471T>C	c.(469-471)taT>taC	p.Y157Y	VPS26A_ENST00000541711.1_Silent_p.Y46Y|VPS26A_ENST00000546041.1_Silent_p.Y140Y|VPS26A_ENST00000489794.1_Silent_p.Y132Y|VPS26A_ENST00000395098.1_Silent_p.Y157Y|VPS26A_ENST00000490696.1_Intron|VPS26A_ENST00000263559.6_Silent_p.Y157Y			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)	157					retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						TTGCCACCTATCCTGATGTTA	0.313																																					p.Y157Y	Colon(90;545 1358 4729 6702 16773)	Atlas-SNP	.											.	VPS26A	24	.	0			c.T471C						.						91.0	88.0	89.0					10																	70917887		2203	4300	6503	SO:0001819	synonymous_variant	9559	exon5			CACCTATCCTGAT	AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.471T>C	chr10.hg19:g.70917887T>C		107.0	0.0		87.0	4.0	NM_004896	A8MZ56|B2RDD3|Q8TBH4|Q9H982	Silent	SNP	ENST00000373382.1	hg19	CCDS7286.1																																																																																			.	.		0.313	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048403.1	NM_004896	
C10orf54	64115	hgsc.bcm.edu	37	10	73515148	73515148	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:73515148A>G	ENST00000394957.3	-	4	702	c.644T>C	c.(643-645)gTc>gCc	p.V215A	CDH23_ENST00000224721.6_Intron	NM_022153.1	NP_071436.1	Q9H7M9	GI24_HUMAN	chromosome 10 open reading frame 54	215					BMP signaling pathway (GO:0030509)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of T cell cytokine production (GO:0002725)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of stem cell differentiation (GO:2000738)|stem cell differentiation (GO:0048863)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	9						TTGCTTGTAGACCAGGAGCAG	0.632																																					p.V215A		Atlas-SNP	.											.	C10orf54	29	.	0			c.T644C						.						53.0	42.0	46.0					10																	73515148		2203	4299	6502	SO:0001583	missense	64115	exon4			TTGTAGACCAGGA	AF193048	CCDS31218.1	10q22.1	2013-11-28			ENSG00000107738	ENSG00000107738		"""Immunoglobulin superfamily / V-set domain containing"""	30085	protein-coding gene	gene with protein product	"""stress induced secreted protein 1"""	615608				12975309	Standard	NM_022153		Approved	SISP1, GI24, B7-H5, B7H5	uc001jsd.3	Q9H7M9	OTTHUMG00000018426	ENST00000394957.3:c.644T>C	chr10.hg19:g.73515148A>G	ENSP00000378409:p.Val215Ala	98.0	0.0		100.0	4.0	NM_022153	A1L0X9|A4ZYV1|A8MVH5|Q6UXF3|Q8WUG3|Q8WYZ8	Missense_Mutation	SNP	ENST00000394957.3	hg19	CCDS31218.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.489134	0.84962	.	.	ENSG00000107738	ENST00000394957;ENST00000263569	T	0.55052	0.54	5.22	5.22	0.72569	.	0.109143	0.64402	D	0.000008	T	0.62454	0.2429	M	0.64997	1.995	0.58432	D	0.999994	P;D	0.61080	0.953;0.989	P;P	0.52957	0.551;0.714	T	0.67848	-0.5564	10	0.87932	D	0	-19.6454	15.1123	0.72368	1.0:0.0:0.0:0.0	.	215;215	A4ZYV1;Q9H7M9	.;GI24_HUMAN	A	215;211	ENSP00000378409:V215A	ENSP00000263569:V211A	V	-	2	0	C10orf54	73185154	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.318000	0.79029	1.982000	0.57802	0.379000	0.24179	GTC	.	.		0.632	C10orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048548.1	NM_022153	
PPP3CB	5532	hgsc.bcm.edu	37	10	75206313	75206313	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:75206313T>C	ENST00000360663.5	-	11	1316	c.1205A>G	c.(1204-1206)aAa>aGa	p.K402R	PPP3CB_ENST00000544628.1_Missense_Mutation_p.K30R|PPP3CB_ENST00000394828.2_Missense_Mutation_p.K403R|PPP3CB_ENST00000545874.1_Missense_Mutation_p.K317R|PPP3CB_ENST00000394829.2_Missense_Mutation_p.K403R|PPP3CB_ENST00000342558.3_Missense_Mutation_p.K402R|PPP3CB_ENST00000394822.2_Missense_Mutation_p.K420R			P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta isozyme	402	Calmodulin-binding. {ECO:0000255}.				axon extension (GO:0048675)|calcium ion-dependent exocytosis (GO:0017156)|cellular response to drug (GO:0035690)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|learning (GO:0007612)|locomotion involved in locomotory behavior (GO:0031987)|memory (GO:0007613)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein dephosphorylation (GO:0006470)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)|social behavior (GO:0035176)|T cell activation (GO:0042110)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein phosphatase 2B binding (GO:0030346)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(7)|skin(1)|urinary_tract(1)	22	Prostate(51;0.0119)					TATGATTTCTTTCCGGGCTGC	0.373																																					p.K403R		Atlas-SNP	.											.	PPP3CB	68	.	0			c.A1208G						.						157.0	144.0	148.0					10																	75206313		2203	4300	6503	SO:0001583	missense	5532	exon11			ATTTCTTTCCGGG	M29551	CCDS7328.1, CCDS44436.1, CCDS44437.1	10q22.2	2010-03-17	2010-03-05		ENSG00000107758	ENSG00000107758	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9315	protein-coding gene	gene with protein product	"""calcineurin A beta"", ""protein phosphatase 2B, catalytic subunit, beta isoform"""	114106	"""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform"""	CALNB		1659808, 2558868	Standard	XM_005269944		Approved	CALNA2, CNA2, PP2Bbeta	uc001juf.3	P16298	OTTHUMG00000018472	ENST00000360663.5:c.1205A>G	chr10.hg19:g.75206313T>C	ENSP00000353881:p.Lys402Arg	79.0	0.0		98.0	4.0	NM_001142354	P16299|Q5F2F9|Q8N1F0|Q8N3W4	Missense_Mutation	SNP	ENST00000360663.5	hg19	CCDS7328.1	.	.	.	.	.	.	.	.	.	.	T	11.16	1.557922	0.27827	.	.	ENSG00000107758	ENST00000360663;ENST00000394829;ENST00000394828;ENST00000394823;ENST00000544628;ENST00000430762;ENST00000342558;ENST00000545874;ENST00000394822	T;T;T;T;T;T;T	0.05319	3.46;3.46;3.46;3.46;3.46;3.46;3.46	5.12	5.12	0.69794	.	0.075858	0.53938	N	0.000042	T	0.12944	0.0314	L	0.31578	0.945	0.80722	D	1	D;B;B;D;B	0.76494	0.999;0.016;0.014;0.998;0.004	D;B;B;D;B	0.87578	0.998;0.036;0.036;0.991;0.019	T	0.19160	-1.0314	10	0.07813	T	0.8	.	14.9301	0.70908	0.0:0.0:0.0:1.0	.	420;317;402;403;402	P16298-2;F5H0F8;P16298-3;Q8N1F0;P16298	.;.;.;.;PP2BB_HUMAN	R	402;403;403;74;30;64;402;317;420	ENSP00000353881:K402R;ENSP00000378306:K403R;ENSP00000378305:K403R;ENSP00000437596:K30R;ENSP00000343147:K402R;ENSP00000439876:K317R;ENSP00000378299:K420R	ENSP00000343147:K402R	K	-	2	0	PPP3CB	74876319	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.841000	0.86834	1.924000	0.55735	0.477000	0.44152	AAA	.	.		0.373	PPP3CB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048669.1	NM_021132	
GLUD1	2746	hgsc.bcm.edu	37	10	88817488	88817488	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:88817488A>G	ENST00000277865.4	-	11	1550	c.1454T>C	c.(1453-1455)aTt>aCt	p.I485T	GLUD1_ENST00000537649.1_Missense_Mutation_p.I318T|GLUD1_ENST00000465164.1_5'Flank|GLUD1_ENST00000544149.1_Missense_Mutation_p.I352T	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	485					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	TACAATGGGAATAGTTCCACC	0.403																																					p.I485T		Atlas-SNP	.											.	GLUD1	30	.	0			c.T1454C						.						185.0	168.0	174.0					10																	88817488		2203	4300	6503	SO:0001583	missense	2746	exon11			ATGGGAATAGTTC	M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.1454T>C	chr10.hg19:g.88817488A>G	ENSP00000277865:p.Ile485Thr	126.0	0.0		66.0	4.0	NM_005271	B3KV55|B4DGN5|Q5TBU3	Missense_Mutation	SNP	ENST00000277865.4	hg19	CCDS7382.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.557841	0.65425	.	.	ENSG00000148672	ENST00000277865;ENST00000394415;ENST00000537649;ENST00000535802;ENST00000513510;ENST00000544149	D;D;D	0.96587	-4.06;-4.06;-4.06	4.98	4.98	0.66077	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96793	0.8953	M	0.84433	2.695	0.80722	D	1	B;P	0.43885	0.294;0.82	B;P	0.46026	0.149;0.501	D	0.97057	0.9768	10	0.54805	T	0.06	.	14.996	0.71431	1.0:0.0:0.0:0.0	.	352;485	B4DGN5;P00367	.;DHE3_HUMAN	T	485;442;318;184;417;352	ENSP00000277865:I485T;ENSP00000439291:I318T;ENSP00000444732:I352T	ENSP00000277865:I485T	I	-	2	0	GLUD1	88807468	1.000000	0.71417	0.942000	0.38095	0.979000	0.70002	8.928000	0.92853	2.011000	0.59026	0.248000	0.18094	ATT	.	.		0.403	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049188.1	NM_005271	
FAS	355	hgsc.bcm.edu	37	10	90768720	90768720	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:90768720T>C	ENST00000355279.2	+	4	409	c.409T>C	c.(409-411)Tct>Cct	p.S137P	FAS_ENST00000357339.2_Missense_Mutation_p.S137P|FAS_ENST00000352159.4_Missense_Mutation_p.S137P|FAS_ENST00000313771.5_3'UTR|FAS_ENST00000355740.2_Missense_Mutation_p.S137P			P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	TTTTTGTAACTCTACTGTATG	0.363																																					p.S137P		Atlas-SNP	.											.	FAS	47	.	0			c.T409C						.						352.0	379.0	370.0					10																	90768720		2203	4300	6503	SO:0001583	missense	355	exon4			TGTAACTCTACTG	M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355279.2:c.409T>C	chr10.hg19:g.90768720T>C	ENSP00000347426:p.Ser137Pro	142.0	0.0		97.0	4.0	NM_152872	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000355279.2	hg19	CCDS7395.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.775538	0.31411	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000352159;ENST00000357339;ENST00000355279;ENST00000371875	D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95	4.21	-8.42	0.00957	TNFR/CD27/30/40/95 cysteine-rich region (3);	.	.	.	.	D	0.89784	0.6815	L	0.34521	1.04	0.09310	N	1	D;P;D	0.58620	0.979;0.642;0.983	P;B;P	0.61800	0.83;0.348;0.894	D	0.87133	0.2198	9	0.45353	T	0.12	-0.0355	7.8547	0.29474	0.5971:0.0:0.143:0.2599	.	137;137;137	P25445-6;Q5T9P3;P25445	.;.;TNR6_HUMAN	P	164;137;137;137;137;137	ENSP00000347979:S137P;ENSP00000345601:S137P;ENSP00000349896:S137P;ENSP00000347426:S137P	ENSP00000345601:S137P	S	+	1	0	FAS	90758700	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.087000	0.01360	-3.492000	0.00153	-1.236000	0.01555	TCT	.	.		0.363	FAS-011	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000049280.2		
HPSE2	60495	hgsc.bcm.edu	37	10	100904127	100904127	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:100904127T>C	ENST00000370552.3	-	3	537	c.478A>G	c.(478-480)Aaa>Gaa	p.K160E	HPSE2_ENST00000370546.1_Missense_Mutation_p.K160E|HPSE2_ENST00000404542.1_Intron|HPSE2_ENST00000370549.1_Missense_Mutation_p.K160E	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	160					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CCTTTCTGTTTATCTAAGGCA	0.403																																					p.K160E		Atlas-SNP	.											HPSE2_ENST00000370546,caecum,carcinoma,0,2	HPSE2	203	.	0			c.A478G						.						101.0	101.0	101.0					10																	100904127		2203	4300	6503	SO:0001583	missense	60495	exon3			TCTGTTTATCTAA	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.478A>G	chr10.hg19:g.100904127T>C	ENSP00000359583:p.Lys160Glu	74.0	0.0		29.0	2.0	NM_001166246	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Missense_Mutation	SNP	ENST00000370552.3	hg19	CCDS7477.1	.	.	.	.	.	.	.	.	.	.	T	9.426	1.084193	0.20309	.	.	ENSG00000172987	ENST00000370552;ENST00000370549;ENST00000370546	T;T;T	0.28255	7.22;1.62;7.22	5.81	5.81	0.92471	Glycoside hydrolase, superfamily (1);	0.060394	0.64402	D	0.000006	T	0.29389	0.0732	L	0.51422	1.61	0.80722	D	1	B;B;B	0.20052	0.015;0.041;0.009	B;B;B	0.20184	0.016;0.028;0.007	T	0.09684	-1.0663	10	0.12430	T	0.62	-5.7058	16.1498	0.81605	0.0:0.0:0.0:1.0	.	160;160;160	Q8WWQ2-2;Q8WWQ2-3;Q8WWQ2	.;.;HPSE2_HUMAN	E	160	ENSP00000359583:K160E;ENSP00000359580:K160E;ENSP00000359577:K160E	ENSP00000359577:K160E	K	-	1	0	HPSE2	100894117	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.658000	0.61497	2.216000	0.71823	0.528000	0.53228	AAA	.	.		0.403	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049789.1	NM_021828	
FBXW4	6468	hgsc.bcm.edu	37	10	103427709	103427709	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:103427709C>T	ENST00000331272.7	-	5	1322	c.704G>A	c.(703-705)gGg>gAg	p.G235E		NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	235					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)				breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		TAAGCACTGCCCCAGCCGGCC	0.552																																					p.G235E		Atlas-SNP	.											.	FBXW4	39	.	0			c.G704A						.						107.0	106.0	106.0					10																	103427709		2203	4300	6503	SO:0001583	missense	6468	exon5			CACTGCCCCAGCC	AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.704G>A	chr10.hg19:g.103427709C>T	ENSP00000359149:p.Gly235Glu	98.0	0.0		47.0	4.0	NM_022039	Q5SVS1|Q96IM6	Missense_Mutation	SNP	ENST00000331272.7	hg19	CCDS31271.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984101	0.93044	.	.	ENSG00000107829	ENST00000331272;ENST00000389046;ENST00000457105;ENST00000431477	T	0.75938	-0.98	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.115021	0.64402	D	0.000011	T	0.78528	0.4297	L	0.45352	1.415	0.58432	D	0.999997	D	0.69078	0.997	P	0.61874	0.895	T	0.69844	-0.5035	10	0.02654	T	1	-16.5182	20.3046	0.98621	0.0:1.0:0.0:0.0	.	235	P57775	FBXW4_HUMAN	E	235;235;148;191	ENSP00000359149:G235E	ENSP00000359149:G235E	G	-	2	0	FBXW4	103417699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.315000	0.59172	2.878000	0.98634	0.650000	0.86243	GGG	.	.		0.552	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049979.2	NM_022039	
PCGF6	84108	hgsc.bcm.edu	37	10	105110543	105110543	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:105110543T>C	ENST00000369847.3	-	1	348	c.281A>G	c.(280-282)gAa>gGa	p.E94G	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_Missense_Mutation_p.E94G	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	94	Glu-rich.				negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E94A(2)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		ctcctcctcttcttcctcctc	0.642																																					p.E94G		Atlas-SNP	.											RNF134,colon,carcinoma,0,2	PCGF6	23	.	2	Substitution - Missense(2)	large_intestine(2)	c.A281G						.						15.0	14.0	14.0					10																	105110543		2195	4298	6493	SO:0001583	missense	84108	exon1			TCCTCTTCTTCCT	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.281A>G	chr10.hg19:g.105110543T>C	ENSP00000358862:p.Glu94Gly	52.0	0.0		65.0	3.0	NM_001011663	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Missense_Mutation	SNP	ENST00000369847.3	hg19	CCDS31275.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.797435	0.31777	.	.	ENSG00000156374	ENST00000369847;ENST00000337211	T;T	0.36340	1.31;1.26	4.54	4.54	0.55810	.	0.415183	0.22337	N	0.061399	T	0.20740	0.0499	N	0.19112	0.55	0.32275	N	0.568315	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.13469	-1.0508	10	0.27785	T	0.31	.	6.7061	0.23252	0.0:0.1044:0.0:0.8956	.	94;94	Q9BYE7-3;Q9BYE7	.;PCGF6_HUMAN	G	94	ENSP00000358862:E94G;ENSP00000338845:E94G	ENSP00000338845:E94G	E	-	2	0	PCGF6	105100533	0.993000	0.37304	0.976000	0.42696	0.117000	0.20001	3.380000	0.52448	1.900000	0.55004	0.402000	0.26972	GAA	.	.		0.642	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1	NM_032154	
NRAP	4892	hgsc.bcm.edu	37	10	115401184	115401184	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:115401184T>C	ENST00000359988.3	-	13	1507	c.1263A>G	c.(1261-1263)gaA>gaG	p.E421E	NRAP_ENST00000369360.3_Silent_p.E386E|NRAP_ENST00000369358.4_Silent_p.E421E|NRAP_ENST00000360478.3_Silent_p.E386E	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		TACCAACTCCTTCATAGCGGC	0.458																																					p.E421E		Atlas-SNP	.											.	NRAP	208	.	0			c.A1263G						.						180.0	160.0	167.0					10																	115401184		2203	4300	6503	SO:0001819	synonymous_variant	4892	exon13			AACTCCTTCATAG		CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.1263A>G	chr10.hg19:g.115401184T>C		170.0	0.0		94.0	4.0	NM_001261463		Silent	SNP	ENST00000359988.3	hg19	CCDS7579.1																																																																																			.	.		0.458	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050425.2	NM_006175	
PLEKHS1	79949	hgsc.bcm.edu	37	10	115526208	115526208	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:115526208A>G	ENST00000369310.3	+	2	611	c.49A>G	c.(49-51)Aaa>Gaa	p.K17E	PLEKHS1_ENST00000361048.1_Missense_Mutation_p.K23E|PLEKHS1_ENST00000369312.4_5'UTR	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	17	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.																TGAAGTCTGCAAACAAGATTA	0.358																																					p.K23E		Atlas-SNP	.											.	PLEKHS1	19	.	0			c.A67G						.						100.0	100.0	100.0					10																	115526208		2203	4300	6503	SO:0001583	missense	79949	exon3			GTCTGCAAACAAG	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.49A>G	chr10.hg19:g.115526208A>G	ENSP00000358316:p.Lys17Glu	178.0	0.0		79.0	4.0	NM_024889	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	hg19	CCDS53580.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.125332	0.77436	.	.	ENSG00000148735	ENST00000361048;ENST00000369310	T;T	0.32023	1.47;1.47	5.45	5.45	0.79879	.	0.264668	0.36482	N	0.002577	T	0.57315	0.2045	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.74674	0.984;0.84	T	0.60727	-0.7206	10	0.44086	T	0.13	-17.4847	13.7666	0.62999	1.0:0.0:0.0:0.0	.	17;23	Q5SXH7-5;Q5SXH7-4	.;.	E	23;17	ENSP00000354332:K23E;ENSP00000358316:K17E	ENSP00000354332:K23E	K	+	1	0	C10orf81	115516198	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.398000	0.66308	2.068000	0.61886	0.533000	0.62120	AAA	.	.		0.358	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
ABLIM1	3983	hgsc.bcm.edu	37	10	116201493	116201493	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:116201493A>G	ENST00000277895.5	-	18	2083	c.1986T>C	c.(1984-1986)aaT>aaC	p.N662N	ABLIM1_ENST00000533213.2_Silent_p.N602N|ABLIM1_ENST00000369266.3_Silent_p.N339N|ABLIM1_ENST00000369252.4_Silent_p.N602N|ABLIM1_ENST00000369253.2_Silent_p.N285N|ABLIM1_ENST00000392952.3_Silent_p.N339N	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	662					axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		GGTGAAGCCCATTTCTTCCAT	0.428																																					p.N662N		Atlas-SNP	.											.	ABLIM1	131	.	0			c.T1986C						.						148.0	140.0	143.0					10																	116201493		2203	4300	6503	SO:0001819	synonymous_variant	3983	exon18			AAGCCCATTTCTT	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.1986T>C	chr10.hg19:g.116201493A>G		123.0	0.0		75.0	4.0	NM_002313	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Silent	SNP	ENST00000277895.5	hg19	CCDS7590.1	.	.	.	.	.	.	.	.	.	.	A	10.47	1.358606	0.24598	.	.	ENSG00000099204	ENST00000392955	.	.	.	5.93	-0.75	0.11080	.	.	.	.	.	T	0.55529	0.1926	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48399	-0.9039	4	.	.	.	.	9.6473	0.39875	0.5941:0.0:0.4059:0.0	.	.	.	.	T	536	.	.	M	-	2	0	ABLIM1	116191483	0.786000	0.28738	0.847000	0.33407	0.997000	0.91878	0.060000	0.14342	-0.353000	0.08224	0.533000	0.62120	ATG	.	.		0.428	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3		
GFRA1	2674	hgsc.bcm.edu	37	10	118029096	118029096	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:118029096T>C	ENST00000355422.6	-	4	887	c.337A>G	c.(337-339)Aat>Gat	p.N113D	GFRA1_ENST00000490345.1_5'Flank|GFRA1_ENST00000369236.1_Missense_Mutation_p.N113D|GFRA1_ENST00000439649.3_Missense_Mutation_p.N113D	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	113					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		AGCAGATCATTTCCTAAAAAC	0.368																																					p.N113D	Ovarian(128;329 1725 45498 46808 50759)	Atlas-SNP	.											.	GFRA1	107	.	0			c.A337G						.						101.0	94.0	96.0					10																	118029096		2203	4300	6503	SO:0001583	missense	2674	exon4			GATCATTTCCTAA	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.337A>G	chr10.hg19:g.118029096T>C	ENSP00000347591:p.Asn113Asp	94.0	0.0		60.0	5.0	NM_005264	A8KA21|O15507|O43912	Missense_Mutation	SNP	ENST00000355422.6	hg19	CCDS44481.1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.581710	0.65992	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000369234	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.45296	0.1335	L	0.43152	1.355	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.986	T	0.20773	-1.0265	10	0.12430	T	0.62	-18.4179	15.9451	0.79787	0.0:0.0:0.0:1.0	.	113;113	P56159;P56159-2	GFRA1_HUMAN;.	D	113	ENSP00000393725:N113D;ENSP00000358239:N113D;ENSP00000347591:N113D;ENSP00000358237:N113D	ENSP00000347591:N113D	N	-	1	0	GFRA1	118019086	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.301000	0.78850	2.177000	0.69029	0.533000	0.62120	AAT	.	.		0.368	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
SLC18A2	6571	hgsc.bcm.edu	37	10	119015120	119015120	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:119015120A>G	ENST00000298472.5	+	9	990	c.847A>G	c.(847-849)Aca>Gca	p.T283A	SLC18A2_ENST00000497497.1_3'UTR	NM_003054.4	NP_003045.2	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 2	283					aging (GO:0007568)|cellular response to ammonium ion (GO:0071242)|cellular response to drug (GO:0035690)|death (GO:0016265)|dopamine transport (GO:0015872)|endocytic recycling (GO:0032456)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|negative regulation of neurotransmitter transport (GO:0051589)|neurotransmitter loading into synaptic vesicle (GO:0098700)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to corticosterone (GO:0051412)|response to herbicide (GO:0009635)|response to starvation (GO:0042594)|response to zinc ion (GO:0010043)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)|terminal bouton (GO:0043195)	amine transmembrane transporter activity (GO:0005275)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)|serotonin transmembrane transporter activity (GO:0015222)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)	29		Colorectal(252;0.19)		all cancers(201;0.029)	Amphetamine(DB00182)|Benzphetamine(DB00865)|Deserpidine(DB01089)|Dextroamphetamine(DB01576)|Ephedra(DB01363)|Ephedrine(DB01364)|Isometheptene(DB06706)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Propylhexedrine(DB06714)|Reserpine(DB00206)|Tetrabenazine(DB04844)	TCAGAAGGGGACACCCCTAAC	0.607																																					p.T283A		Atlas-SNP	.											.	SLC18A2	58	.	0			c.A847G						.						58.0	59.0	59.0					10																	119015120		2203	4300	6503	SO:0001583	missense	6571	exon9			AAGGGGACACCCC	L14269	CCDS7599.1	10q25	2013-07-18	2013-07-18		ENSG00000165646	ENSG00000165646		"""Solute carriers"""	10935	protein-coding gene	gene with protein product		193001		VMAT2			Standard	NM_003054		Approved	SVMT, SVAT	uc001ldd.2	Q05940	OTTHUMG00000019121	ENST00000298472.5:c.847A>G	chr10.hg19:g.119015120A>G	ENSP00000298472:p.Thr283Ala	48.0	0.0		33.0	4.0	NM_003054	B2RC96|D3DRC4|Q15876|Q4G147|Q5VW49|Q9H3P6	Missense_Mutation	SNP	ENST00000298472.5	hg19	CCDS7599.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.317942	0.40996	.	.	ENSG00000165646	ENST00000298472	T	0.56611	0.45	5.07	5.07	0.68467	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.51483	0.1677	L	0.56396	1.775	0.53005	D	0.999969	B	0.27498	0.18	B	0.37451	0.25	T	0.47045	-0.9147	10	0.22706	T	0.39	-18.7903	10.39	0.44162	0.9229:0.0:0.0771:0.0	.	283	Q05940	VMAT2_HUMAN	A	283	ENSP00000298472:T283A	ENSP00000298472:T283A	T	+	1	0	SLC18A2	119005110	1.000000	0.71417	0.996000	0.52242	0.815000	0.46073	7.365000	0.79537	2.027000	0.59764	0.460000	0.39030	ACA	.	.		0.607	SLC18A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050563.1	NM_003054	
PLEKHA1	59338	hgsc.bcm.edu	37	10	124172507	124172507	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:124172507A>G	ENST00000368990.3	+	6	545	c.414A>G	c.(412-414)caA>caG	p.Q138Q	PLEKHA1_ENST00000433307.1_Silent_p.Q138Q|PLEKHA1_ENST00000494222.1_3'UTR|PLEKHA1_ENST00000368988.1_Silent_p.Q138Q|PLEKHA1_ENST00000538022.1_Silent_p.Q138Q|PLEKHA1_ENST00000368989.2_Silent_p.Q138Q	NM_001001974.2	NP_001001974.1	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1	138					androgen metabolic process (GO:0008209)|B cell receptor signaling pathway (GO:0050853)|cellular response to hydrogen peroxide (GO:0070301)|establishment of protein localization (GO:0045184)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|multicellular organism growth (GO:0035264)|negative regulation of protein kinase B signaling (GO:0051898)|palate development (GO:0060021)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|ruffle organization (GO:0031529)|skeletal system morphogenesis (GO:0048705)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GGAAAAAGCAAGTGTCTTACA	0.373																																					p.Q138Q		Atlas-SNP	.											.	PLEKHA1	33	.	0			c.A414G						.						133.0	121.0	125.0					10																	124172507		2203	4300	6503	SO:0001819	synonymous_variant	59338	exon6			AAAGCAAGTGTCT	AF286160	CCDS7629.1, CCDS55730.1	10q26.3	2013-01-10	2002-01-14		ENSG00000107679	ENSG00000107679		"""Pleckstrin homology (PH) domain containing"""	14335	protein-coding gene	gene with protein product	"""tandem PH domain containing protein-1"""	607772	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1"""			11001876, 15485858	Standard	NM_001001974		Approved	TAPP1	uc001lge.2	Q9HB21	OTTHUMG00000019184	ENST00000368990.3:c.414A>G	chr10.hg19:g.124172507A>G		179.0	0.0		79.0	4.0	NM_021622	B3KQ55|D3DRE2|Q9BVK0	Silent	SNP	ENST00000368990.3	hg19	CCDS7629.1																																																																																			.	.		0.373	PLEKHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050783.1	NM_001001974	
MKI67	4288	hgsc.bcm.edu	37	10	129899614	129899614	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:129899614T>C	ENST00000368654.3	-	14	9988	c.9613A>G	c.(9613-9615)Aca>Gca	p.T3205A	MKI67_ENST00000368653.3_Missense_Mutation_p.T2845A	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	3205					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGGCTTTTTGTCTTTCTTGAT	0.493																																					p.T3205A		Atlas-SNP	.											.	MKI67	363	.	0			c.A9613G						.						152.0	134.0	140.0					10																	129899614		2203	4300	6503	SO:0001583	missense	4288	exon14			TTTTTGTCTTTCT	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.9613A>G	chr10.hg19:g.129899614T>C	ENSP00000357643:p.Thr3205Ala	192.0	0.0		99.0	5.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.524706	0.27299	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01821	4.67;4.62	2.99	-5.98	0.02220	.	3.283010	0.01334	N	0.011353	T	0.01489	0.0048	N	0.24115	0.695	0.09310	N	1	B;B	0.22080	0.0;0.064	B;B	0.20955	0.001;0.032	T	0.44757	-0.9307	10	0.08381	T	0.77	.	9.5944	0.39565	0.0:0.5699:0.2547:0.1754	.	2845;3205	P46013-2;P46013	.;KI67_HUMAN	A	3205;2845;3204	ENSP00000357643:T3205A;ENSP00000357642:T2845A	ENSP00000357642:T2845A	T	-	1	0	MKI67	129789604	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.000000	0.03693	-2.878000	0.00320	-0.468000	0.05107	ACA	.	.		0.493	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
CFAP46	54777	hgsc.bcm.edu	37	10	134674359	134674359	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:134674359T>C	ENST00000368586.5	-	36	5118	c.5018A>G	c.(5017-5019)gAg>gGg	p.E1673G		NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GTACCAGAACTCCTCACTTCC	0.572																																					p.E1673G		Atlas-SNP	.											.	TTC40	100	.	0			c.A5018G						.																																			SO:0001583	missense	54777	exon36			CAGAACTCCTCAC																												ENST00000368586.5:c.5018A>G	chr10.hg19:g.134674359T>C	ENSP00000357575:p.Glu1673Gly	109.0	0.0		76.0	4.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	t	9.228	1.034979	0.19590	.	.	ENSG00000171811	ENST00000368586	T	0.75154	-0.91	3.93	2.75	0.32379	.	.	.	.	.	T	0.67287	0.2877	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58137	-0.7689	6	0.26408	T	0.33	.	5.1944	0.15227	0.0:0.0986:0.1837:0.7177	.	.	.	.	G	1673	ENSP00000357575:E1673G	ENSP00000357575:E1673G	E	-	2	0	C10orf93	134524349	0.682000	0.27624	0.982000	0.44146	0.168000	0.22595	1.176000	0.31957	0.621000	0.30232	0.478000	0.44815	GAG	.	.		0.572	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
LSP1	4046	hgsc.bcm.edu	37	11	1904750	1904750	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:1904750A>G	ENST00000311604.3	+	4	633	c.458A>G	c.(457-459)gAc>gGc	p.D153G	LSP1_ENST00000405957.2_Missense_Mutation_p.D91G|LSP1_ENST00000381775.1_Missense_Mutation_p.D281G|LSP1_ENST00000406638.2_Missense_Mutation_p.D91G|LSP1_ENST00000485341.1_3'UTR	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	153					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		ACTGTCCAGGACAACCTGGGG	0.632																																					p.D281G		Atlas-SNP	.											.	LSP1	59	.	0			c.A842G						.						49.0	54.0	52.0					11																	1904750		2202	4299	6501	SO:0001583	missense	4046	exon5			TCCAGGACAACCT	M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.458A>G	chr11.hg19:g.1904750A>G	ENSP00000308383:p.Asp153Gly	179.0	0.0		146.0	6.0	NM_001242932	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	ENST00000311604.3	hg19	CCDS31334.1	.	.	.	.	.	.	.	.	.	.	.	7.130	0.579794	0.13686	.	.	ENSG00000130592	ENST00000311604;ENST00000446808;ENST00000381775;ENST00000405957;ENST00000457279;ENST00000429923;ENST00000406638;ENST00000417766;ENST00000432093	T;T;T;T;T;T;T;T;T	0.48836	1.76;0.8;1.69;1.76;1.76;0.92;1.76;1.81;1.81	2.13	-0.301	0.12800	.	0.637869	0.11587	N	0.549162	T	0.12390	0.0301	N	0.00583	-1.355	0.19575	N	0.999967	B;B	0.12630	0.006;0.0	B;B	0.08055	0.003;0.0	T	0.24693	-1.0153	10	0.22109	T	0.4	.	2.5753	0.04805	0.5083:0.2788:0.213:0.0	.	281;153	E9PFP3;P33241	.;LSP1_HUMAN	G	153;91;281;91;144;136;91;91;91	ENSP00000308383:D153G;ENSP00000402543:D91G;ENSP00000371194:D281G;ENSP00000383932:D91G;ENSP00000400346:D144G;ENSP00000400999:D136G;ENSP00000384022:D91G;ENSP00000416363:D91G;ENSP00000412405:D91G	ENSP00000308383:D153G	D	+	2	0	LSP1	1861326	0.124000	0.22315	0.077000	0.20336	0.077000	0.17291	-0.045000	0.12003	-0.057000	0.13199	0.375000	0.23000	GAC	.	.		0.632	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034045.3	NM_002339	
FAM160A2	84067	hgsc.bcm.edu	37	11	6244470	6244470	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:6244470T>C	ENST00000449352.2	-	4	1041		c.e4-2		FAM160A2_ENST00000265978.4_Splice_Site|FAM160A2_ENST00000524416.1_Splice_Site			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2						early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGCCAGCACCTATGAGAAGTT	0.453																																					.		Atlas-SNP	.											.	FAM160A2	100	.	0			c.778-2A>G						.						72.0	74.0	73.0					11																	6244470		2201	4296	6497	SO:0001630	splice_region_variant	84067	exon5			AGCACCTATGAGA		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.778-2A>G	chr11.hg19:g.6244470T>C		94.0	0.0		96.0	4.0	NM_001098794	Q9C0A4|Q9H0N3|Q9H624	Splice_Site	SNP	ENST00000449352.2	hg19	CCDS44530.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.521942	0.64747	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4376	0.67293	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM160A2	6201046	1.000000	0.71417	0.989000	0.46669	0.846000	0.48090	5.745000	0.68672	2.205000	0.71048	0.528000	0.53228	.	.	.		0.453	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000383759.1	NM_032127	Intron
CTC-497E21.3	0	hgsc.bcm.edu	37	11	13031942	13031942	+	lincRNA	SNP	G	G	T	rs375762962		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:13031942G>T	ENST00000533002.1	-	0	0																											TCAACTACGTGCAGGACACTT	0.682																																					p.V273V		Atlas-SNP	.											.	.	.	.	0			c.G819T						.						16.0	19.0	18.0					11																	13031942		1899	3670	5569			644943	exon1			CTACGTGCAGGAC																													chr11.hg19:g.13031942G>T		453.0	0.0		363.0	169.0	NM_001080521		Silent	SNP	ENST00000533002.1	hg19																																																																																				.	.		0.682	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
LDHC	3948	hgsc.bcm.edu	37	11	18467858	18467858	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:18467858A>G	ENST00000541669.1	+	7	923	c.812A>G	c.(811-813)cAc>cGc	p.H271R	LDHC_ENST00000546146.1_Intron|LDHC_ENST00000536880.1_Missense_Mutation_p.H257R|LDHC_ENST00000535809.1_Intron|LDHC_ENST00000544105.1_Intron|LDHC_ENST00000537486.1_Intron|LDHC_ENST00000280704.4_Missense_Mutation_p.H271R			P07864	LDHC_HUMAN	lactate dehydrogenase C	271					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGGAGAGTGCACCCAGTTTCC	0.383																																					p.H271R		Atlas-SNP	.											.	LDHC	37	.	0			c.A812G						.						147.0	145.0	146.0					11																	18467858		2199	4293	6492	SO:0001583	missense	3948	exon7			GAGTGCACCCAGT	AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.812A>G	chr11.hg19:g.18467858A>G	ENSP00000437783:p.His271Arg	84.0	0.0		108.0	5.0	NM_002301	D3DQY4|Q6GSG8|Q7Z7J4	Missense_Mutation	SNP	ENST00000541669.1	hg19	CCDS7840.1	.	.	.	.	.	.	.	.	.	.	A	17.23	3.337946	0.60963	.	.	ENSG00000166796	ENST00000541669;ENST00000280704;ENST00000536880	T;T;T	0.66638	-0.22;-0.22;-0.22	4.88	3.72	0.42706	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.78742	0.4331	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79531	-0.1765	10	0.56958	D	0.05	-16.9389	8.6746	0.34172	0.9086:0.0:0.0914:0.0	.	271	P07864	LDHC_HUMAN	R	271;271;257	ENSP00000437783:H271R;ENSP00000280704:H271R;ENSP00000439555:H257R	ENSP00000280704:H271R	H	+	2	0	LDHC	18424434	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	8.285000	0.89914	2.045000	0.60652	0.459000	0.35465	CAC	.	.		0.383	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448	
PRDM11	56981	hgsc.bcm.edu	37	11	45204634	45204634	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:45204634T>C	ENST00000530656.1	+	4	548	c.548T>C	c.(547-549)aTc>aCc	p.I183T	PRDM11_ENST00000528980.1_3'UTR|PRDM11_ENST00000263765.4_Missense_Mutation_p.I183T|PRDM11_ENST00000424263.2_Missense_Mutation_p.I149T			Q9NQV5	PRD11_HUMAN	PR domain containing 11	183	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						GAGGGGCAGATCTCCACCCAG	0.562											OREG0020926	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I149T	NSCLC(118;1511 1736 6472 36603 43224)	Atlas-SNP	.											.	PRDM11	53	.	0			c.T446C						.						59.0	59.0	59.0					11																	45204634		2203	4299	6502	SO:0001583	missense	56981	exon4			GGCAGATCTCCAC	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.548T>C	chr11.hg19:g.45204634T>C	ENSP00000435976:p.Ile183Thr	112.0	0.0	929	100.0	4.0	NM_001256695	Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	hg19		.	.	.	.	.	.	.	.	.	.	T	21.0	4.077491	0.76528	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000526442;ENST00000424263	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.02	5.02	0.67125	SET domain (2);	0.000000	0.64402	D	0.000006	T	0.53818	0.1820	M	0.64567	1.98	0.42188	D	0.991719	P	0.48694	0.914	B	0.44044	0.439	T	0.61227	-0.7105	10	0.62326	D	0.03	-24.9399	13.302	0.60330	0.0:0.0:0.0:1.0	.	183	Q9NQV5	PRD11_HUMAN	T	183;183;149;149	ENSP00000263765:I183T;ENSP00000435976:I183T;ENSP00000431898:I149T;ENSP00000394314:I149T	ENSP00000263765:I183T	I	+	2	0	PRDM11	45161210	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.081000	0.76844	1.877000	0.54381	0.397000	0.26171	ATC	.	.		0.562	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229	
OR4C12	283093	hgsc.bcm.edu	37	11	50003747	50003747	+	Silent	SNP	A	A	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:50003747A>T	ENST00000335238.4	-	1	324	c.291T>A	c.(289-291)gcT>gcA	p.A97A		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						CATAGGCTTGAGCCATACACC	0.418																																					p.A97A		Atlas-SNP	.											.	OR4C12	82	.	0			c.T291A						.						123.0	123.0	123.0					11																	50003747		2201	4296	6497	SO:0001819	synonymous_variant	283093	exon1			GGCTTGAGCCATA	BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.291T>A	chr11.hg19:g.50003747A>T		224.0	0.0		209.0	99.0	NM_001005270	B2RNF0|Q6IF49	Silent	SNP	ENST00000335238.4	hg19	CCDS31496.1																																																																																			.	.		0.418	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270	
OR5W2	390148	hgsc.bcm.edu	37	11	55681562	55681562	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:55681562A>G	ENST00000344514.1	-	1	496	c.497T>C	c.(496-498)cTa>cCa	p.L166P		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ACAGAAGCATAGGCGGAAGGC	0.428																																					p.L166P	Melanoma(48;171 1190 15239 43886 49348)	Atlas-SNP	.											.,1	OR5W2	112	.	0			c.T497C						.						88.0	78.0	81.0					11																	55681562		2201	4296	6497	SO:0001583	missense	390148	exon1			AAGCATAGGCGGA	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.497T>C	chr11.hg19:g.55681562A>G	ENSP00000342448:p.Leu166Pro	101.0	0.0		99.0	4.0	NM_001001960		Missense_Mutation	SNP	ENST00000344514.1	hg19	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	A	11.36	1.615401	0.28801	.	.	ENSG00000187612	ENST00000344514	T	0.00301	8.21	4.77	4.77	0.60923	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31472	N	0.007581	T	0.01387	0.0045	H	0.99261	4.49	0.23023	N	0.998411	D	0.89917	1.0	D	0.91635	0.999	T	0.25641	-1.0126	10	0.87932	D	0	.	12.2509	0.54597	1.0:0.0:0.0:0.0	.	166	Q8NH69	OR5W2_HUMAN	P	166	ENSP00000342448:L166P	ENSP00000342448:L166P	L	-	2	0	OR5W2	55438138	0.213000	0.23551	0.031000	0.17742	0.065000	0.16274	4.611000	0.61162	1.781000	0.52344	0.448000	0.29417	CTA	.	.		0.428	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
P2RX3	5024	hgsc.bcm.edu	37	11	57114119	57114119	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:57114119T>C	ENST00000263314.2	+	2	255	c.221T>C	c.(220-222)gTc>gCc	p.V74A		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	74					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						GCCAACAGAGTCATGGATGTG	0.552																																					p.V74A		Atlas-SNP	.											.	P2RX3	55	.	0			c.T221C						.						136.0	95.0	109.0					11																	57114119		2201	4296	6497	SO:0001583	missense	5024	exon2			ACAGAGTCATGGA	Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.221T>C	chr11.hg19:g.57114119T>C	ENSP00000263314:p.Val74Ala	138.0	0.0		144.0	6.0	NM_002559	Q6DK37|Q9UQB6	Missense_Mutation	SNP	ENST00000263314.2	hg19	CCDS7953.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.823015	0.90873	.	.	ENSG00000109991	ENST00000439993;ENST00000263314	T	0.05996	3.36	4.66	4.66	0.58398	.	0.141200	0.48767	D	0.000169	T	0.24509	0.0594	M	0.85373	2.75	0.41368	D	0.987477	D	0.63046	0.992	P	0.62740	0.906	T	0.02411	-1.1163	10	0.87932	D	0	-34.7111	11.7302	0.51732	0.0:0.0:0.0:1.0	.	74	P56373	P2RX3_HUMAN	A	74	ENSP00000263314:V74A	ENSP00000263314:V74A	V	+	2	0	P2RX3	56870695	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.838000	0.75359	1.950000	0.56595	0.459000	0.35465	GTC	.	.		0.552	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392465.1	NM_002559	
SLC22A9	114571	hgsc.bcm.edu	37	11	63149671	63149671	+	Missense_Mutation	SNP	A	A	C	rs564236291|rs76547355|rs78765214	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:63149671A>C	ENST00000279178.3	+	6	1244	c.995A>C	c.(994-996)cAa>cCa	p.Q332P	SLC22A9_ENST00000310969.4_3'UTR	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	332					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						GAGGCAGCACAAAAAAAAAAA	0.398																																					p.Q332P		Atlas-SNP	.											.,5	SLC22A9	77	.	0			c.A995C						.						133.0	130.0	131.0					11																	63149671		2201	4298	6499	SO:0001583	missense	114571	exon6			CAGCACAAAAAAA	AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.995A>C	chr11.hg19:g.63149671A>C	ENSP00000279178:p.Gln332Pro	117.0	1.0		123.0	7.0	NM_080866	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	ENST00000279178.3	hg19	CCDS8043.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.493804	0.26774	.	.	ENSG00000149742	ENST00000279178	T	0.58940	0.3	0.0465	0.0465	0.14256	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	3.812700	0.01193	N	0.007392	T	0.54854	0.1884	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	D	0.67725	0.953	T	0.50591	-0.8810	9	0.38643	T	0.18	.	.	.	.	.	332	Q8IVM8	S22A9_HUMAN	P	332	ENSP00000279178:Q332P	ENSP00000279178:Q332P	Q	+	2	0	SLC22A9	62906247	0.001000	0.12720	0.005000	0.12908	0.600000	0.36913	0.132000	0.15891	0.115000	0.18071	0.113000	0.15668	CAA	.	A|0.500;C|0.500		0.398	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396371.1	NM_080866	
MUS81	80198	hgsc.bcm.edu	37	11	65632582	65632582	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:65632582T>C	ENST00000308110.4	+	13	1716	c.1367T>C	c.(1366-1368)tTc>tCc	p.F456S	EFEMP2_ENST00000532648.1_5'Flank|MUS81_ENST00000533035.1_Missense_Mutation_p.F381S	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	456					DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		CTCCTCACCTTCAGTGACTTC	0.602								Homologous recombination																													p.F456S		Atlas-SNP	.											.	MUS81	68	.	0			c.T1367C						.						158.0	167.0	164.0					11																	65632582		2201	4296	6497	SO:0001583	missense	80198	exon13			TCACCTTCAGTGA		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.1367T>C	chr11.hg19:g.65632582T>C	ENSP00000307853:p.Phe456Ser	124.0	0.0		108.0	5.0	NM_025128	Q9H7D9	Missense_Mutation	SNP	ENST00000308110.4	hg19	CCDS8115.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.741650	0.89573	.	.	ENSG00000172732	ENST00000533035;ENST00000308110;ENST00000437855	T;T	0.19394	2.15;2.36	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.52370	0.1730	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.60786	-0.7194	10	0.87932	D	0	-22.5993	12.7462	0.57283	0.0:0.0:0.0:1.0	.	456	Q96NY9	MUS81_HUMAN	S	381;456;456	ENSP00000432287:F381S;ENSP00000307853:F456S	ENSP00000307853:F456S	F	+	2	0	MUS81	65389158	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.334000	0.72944	2.265000	0.75225	0.459000	0.35465	TTC	.	.		0.602	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390941.3	NM_025128	
C11orf80	79703	hgsc.bcm.edu	37	11	66581347	66581347	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:66581347T>C	ENST00000360962.4	+	10	1057	c.1050T>C	c.(1048-1050)taT>taC	p.Y350Y	C11orf80_ENST00000540737.1_Silent_p.Y185Y|C11orf80_ENST00000532565.2_Silent_p.Y132Y|C11orf80_ENST00000346672.4_Silent_p.Y196Y|C11orf80_ENST00000525449.2_Silent_p.Y195Y|C11orf80_ENST00000527634.1_Silent_p.Y133Y	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	350										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						TATTTCTATATGGACCTTTGG	0.353																																					p.Y350Y		Atlas-SNP	.											.	C11orf80	31	.	0			c.T1050C						.						80.0	74.0	75.0					11																	66581347		1830	4078	5908	SO:0001819	synonymous_variant	79703	exon10			TCTATATGGACCT			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.1050T>C	chr11.hg19:g.66581347T>C		90.0	0.0		98.0	4.0	NM_024650	Q9H677	Silent	SNP	ENST00000360962.4	hg19	CCDS53664.1																																																																																			.	.		0.353	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
CPT1A	1374	hgsc.bcm.edu	37	11	68530124	68530124	+	Missense_Mutation	SNP	C	C	T	rs573452454		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:68530124C>T	ENST00000265641.5	-	15	2000	c.1846G>A	c.(1846-1848)Gtg>Atg	p.V616M	CPT1A_ENST00000539743.1_Missense_Mutation_p.V616M|CPT1A_ENST00000376618.2_Missense_Mutation_p.V616M|CPT1A_ENST00000540367.1_Missense_Mutation_p.V616M|CPT1A_ENST00000537756.2_5'UTR	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	616					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	ATGGCCCGCACGAAGTCGCAT	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18473	0.0		0.0	False		,,,				2504	0.0				p.V616M		Atlas-SNP	.											.	CPT1A	89	.	0			c.G1846A						.						73.0	65.0	68.0					11																	68530124		2200	4294	6494	SO:0001583	missense	1374	exon15			CCCGCACGAAGTC	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1846G>A	chr11.hg19:g.68530124C>T	ENSP00000265641:p.Val616Met	80.0	0.0		84.0	34.0	NM_001876	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	hg19	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572108	0.86542	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78	5.57	5.57	0.84162	.	0.133714	0.50627	D	0.000102	D	0.94023	0.8085	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.68943	0.915;0.961	D	0.95158	0.8279	10	0.87932	D	0	.	19.912	0.97027	0.0:1.0:0.0:0.0	.	616;616	P50416;P50416-2	CPT1A_HUMAN;.	M	616	ENSP00000439084:V616M;ENSP00000365803:V616M;ENSP00000265641:V616M;ENSP00000446108:V616M	ENSP00000265641:V616M	V	-	1	0	CPT1A	68286700	1.000000	0.71417	0.967000	0.41034	0.444000	0.32077	7.354000	0.79424	2.783000	0.95769	0.655000	0.94253	GTG	.	.		0.607	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
CTTN	2017	hgsc.bcm.edu	37	11	70279767	70279767	+	Missense_Mutation	SNP	G	G	T	rs144726386		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:70279767G>T	ENST00000301843.8	+	17	1665	c.1459G>T	c.(1459-1461)Gat>Tat	p.D487Y	CTTN_ENST00000346329.3_Missense_Mutation_p.D450Y|CTTN_ENST00000376561.3_Missense_Mutation_p.D450Y|CTTN_ENST00000538675.1_Missense_Mutation_p.D171Y	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	487					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)		p.D487N(1)|p.D450N(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		CAGCACCTACGATGAGTACGA	0.537																																					p.D487Y		Atlas-SNP	.											CTTN_ENST00000376561,NS,carcinoma,0,2	CTTN	162	.	2	Substitution - Missense(2)	cervix(2)	c.G1459T						.						153.0	147.0	149.0					11																	70279767		2200	4294	6494	SO:0001583	missense	2017	exon17			ACCTACGATGAGT	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.1459G>T	chr11.hg19:g.70279767G>T	ENSP00000301843:p.Asp487Tyr	163.0	1.0		167.0	0.0	NM_005231	Q8N707|Q96H99	Missense_Mutation	SNP	ENST00000301843.8	hg19	CCDS41680.1	.	.	.	.	.	.	.	.	.	.	G	8.931	0.963545	0.18583	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561;ENST00000538675;ENST00000529736	T;T;T;T;T	0.35048	1.4;1.4;1.33;1.7;1.69	4.96	4.04	0.47022	Src homology-3 domain (1);	0.231118	0.36409	N	0.002619	T	0.53222	0.1783	L	0.52759	1.655	0.48185	D	0.999608	D;D;D;B	0.89917	1.0;0.999;0.996;0.426	D;D;D;B	0.97110	1.0;0.997;0.956;0.044	T	0.50659	-0.8802	10	0.38643	T	0.18	-26.7345	15.244	0.73493	0.0:0.1412:0.8588:0.0	.	171;450;487;450	B4E358;Q96H99;Q14247;Q8N707	.;.;SRC8_HUMAN;.	Y	450;487;450;171;144	ENSP00000317189:D450Y;ENSP00000301843:D487Y;ENSP00000365745:D450Y;ENSP00000439762:D171Y;ENSP00000431421:D144Y	ENSP00000301843:D487Y	D	+	1	0	CTTN	69957415	0.692000	0.27719	0.014000	0.15608	0.017000	0.09413	2.595000	0.46197	1.058000	0.40530	-0.180000	0.13094	GAT	.	G|1.000;A|0.000		0.537	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565	
C2CD3	26005	hgsc.bcm.edu	37	11	73817537	73817537	+	Splice_Site	SNP	G	G	A	rs555646012	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:73817537G>A	ENST00000334126.7	-	13	2190	c.1964C>T	c.(1963-1965)cCa>cTa	p.P655L	C2CD3_ENST00000313663.7_Splice_Site_p.P655L			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	655					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AATGACTTCTGGCTGAGAAAG	0.383																																					p.P655L		Atlas-SNP	.											.	C2CD3	288	.	0			c.C1964T						.						64.0	62.0	63.0					11																	73817537		2200	4293	6493	SO:0001630	splice_region_variant	26005	exon13			ACTTCTGGCTGAG	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1963-1C>T	chr11.hg19:g.73817537G>A		111.0	0.0		99.0	4.0	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	hg19		.	.	.	.	.	.	.	.	.	.	G	22.9	4.355025	0.82243	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.21543	2.0;2.07	5.47	5.47	0.80525	.	0.058059	0.64402	D	0.000001	T	0.43322	0.1242	M	0.68952	2.095	0.52099	D	0.99994	D	0.69078	0.997	P	0.61132	0.884	T	0.29458	-1.0011	10	0.87932	D	0	-11.5497	17.4704	0.87645	0.0:0.0:1.0:0.0	.	655	Q4AC94-1	.	L	655	ENSP00000334379:P655L;ENSP00000323339:P655L	ENSP00000323339:P655L	P	-	2	0	C2CD3	73495185	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	6.069000	0.71209	2.728000	0.93425	0.591000	0.81541	CCA	.	.		0.383	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	Missense_Mutation
SERPINH1	871	hgsc.bcm.edu	37	11	75277809	75277809	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:75277809T>C	ENST00000524558.1	+	2	1850	c.415T>C	c.(415-417)Tca>Cca	p.S139P	SERPINH1_ENST00000533603.1_Missense_Mutation_p.S139P|SERPINH1_ENST00000358171.3_Missense_Mutation_p.S139P|SERPINH1_ENST00000525876.1_5'Flank|SERPINH1_ENST00000530284.1_Missense_Mutation_p.S139P			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	139					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					CGGACCCAGCTCAGTGAGCTT	0.642																																					p.S139P		Atlas-SNP	.											.	SERPINH1	33	.	0			c.T415C						.						38.0	35.0	36.0					11																	75277809		2200	4292	6492	SO:0001583	missense	871	exon2			CCCAGCTCAGTGA	X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.415T>C	chr11.hg19:g.75277809T>C	ENSP00000434412:p.Ser139Pro	167.0	0.0		154.0	7.0	NM_001235	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	ENST00000524558.1	hg19	CCDS8239.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453767	0.63290	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000526397;ENST00000421448;ENST00000529643;ENST00000525492;ENST00000530284;ENST00000532356;ENST00000524558;ENST00000528990;ENST00000533449;ENST00000525611;ENST00000528760	D;D;D;T;T;D;D;D;T;D;D	0.88586	-2.4;-2.4;-2.4;-0.97;-0.97;-2.4;-2.4;-2.4;-0.97;-2.4;-2.4	4.98	4.98	0.66077	Serpin domain (3);	0.056941	0.64402	D	0.000001	D	0.93628	0.7965	M	0.79258	2.445	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.70487	0.969;0.941	D	0.94288	0.7526	10	0.87932	D	0	.	12.9296	0.58280	0.0:0.0:0.0:1.0	.	139;139	E9PPV6;P50454	.;SERPH_HUMAN	P	139;139;139;118;139;92;139;139;139;139;139;139;139	ENSP00000434657:S139P;ENSP00000350894:S139P;ENSP00000434964:S139P;ENSP00000435936:S139P;ENSP00000434482:S92P;ENSP00000436305:S139P;ENSP00000436040:S139P;ENSP00000434412:S139P;ENSP00000431827:S139P;ENSP00000435452:S139P;ENSP00000437108:S139P	ENSP00000350894:S139P	S	+	1	0	SERPINH1	74955457	1.000000	0.71417	0.995000	0.50966	0.800000	0.45204	4.004000	0.57068	2.000000	0.58554	0.460000	0.39030	TCA	.	.		0.642	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383610.1	NM_004353	
NAALAD2	10003	hgsc.bcm.edu	37	11	89892488	89892488	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:89892488A>G	ENST00000534061.1	+	8	1202	c.972A>G	c.(970-972)acA>acG	p.T324T	NAALAD2_ENST00000375944.3_Intron|NAALAD2_ENST00000321955.4_Intron|NAALAD2_ENST00000525171.1_Intron	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	324	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				CTGGCTTTACAGGGAGTGATT	0.368																																					p.T324T		Atlas-SNP	.											.	NAALAD2	113	.	0			c.A972G						.						127.0	122.0	123.0					11																	89892488		2201	4299	6500	SO:0001819	synonymous_variant	10003	exon8			CTTTACAGGGAGT	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.972A>G	chr11.hg19:g.89892488A>G		122.0	0.0		126.0	6.0	NM_005467	B3KQR4|Q4KKV4|Q4VAM9	Silent	SNP	ENST00000534061.1	hg19	CCDS8288.1																																																																																			.	.		0.368	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
GPR83	10888	hgsc.bcm.edu	37	11	94113691	94113691	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:94113691A>G	ENST00000243673.2	-	4	1067	c.896T>C	c.(895-897)gTc>gCc	p.V299A	GPR83_ENST00000539203.2_Missense_Mutation_p.V257A	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	299					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GGCAAAGAGGACTACCACCAG	0.532																																					p.V299A		Atlas-SNP	.											.	GPR83	47	.	0			c.T896C						.						147.0	103.0	118.0					11																	94113691		2201	4298	6499	SO:0001583	missense	10888	exon4			AAGAGGACTACCA	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.896T>C	chr11.hg19:g.94113691A>G	ENSP00000243673:p.Val299Ala	150.0	0.0		123.0	7.0	NM_016540	B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	ENST00000243673.2	hg19	CCDS8297.1	.	.	.	.	.	.	.	.	.	.	A	9.765	1.171005	0.21621	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.59906	0.23;0.23	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.184952	0.46758	D	0.000280	T	0.43478	0.1249	N	0.26162	0.8	0.38212	D	0.94049	B	0.14012	0.009	B	0.23419	0.046	T	0.38585	-0.9654	10	0.10111	T	0.7	.	13.9262	0.63964	1.0:0.0:0.0:0.0	.	299	Q9NYM4	GPR83_HUMAN	A	299;257	ENSP00000243673:V299A;ENSP00000441550:V257A	ENSP00000243673:V299A	V	-	2	0	GPR83	93753339	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.767000	0.55288	1.967000	0.57214	0.533000	0.62120	GTC	.	.		0.532	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396232.1	NM_016540	
ALKBH8	91801	hgsc.bcm.edu	37	11	107396182	107396182	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:107396182T>C	ENST00000428149.2	-	9	1166	c.1015A>G	c.(1015-1017)Aca>Gca	p.T339A	ALKBH8_ENST00000429370.1_Intron|ALKBH8_ENST00000417449.2_Missense_Mutation_p.T342A|ALKBH8_ENST00000389568.3_Missense_Mutation_p.T339A	NM_138775.2	NP_620130.2	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8 (E. coli)	339					cellular response to DNA damage stimulus (GO:0006974)|tRNA methylation (GO:0030488)	cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|RNA binding (GO:0003723)|tRNA (uracil) methyltransferase activity (GO:0016300)			breast(2)|large_intestine(2)|lung(5)	9		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		TTACAAGGTGTTTGCCTCACT	0.373																																					p.T339A		Atlas-SNP	.											.	ALKBH8	88	.	0			c.A1015G						.						141.0	115.0	123.0					11																	107396182		692	1591	2283	SO:0001583	missense	91801	exon9			AAGGTGTTTGCCT	AF086489	CCDS8337.2, CCDS73376.1	11q22.3	2013-10-04			ENSG00000137760	ENSG00000137760	2.1.1.229	"""Alkylation repair homologs"", ""RNA binding motif (RRM) containing"""	25189	protein-coding gene	gene with protein product		613306				20123966	Standard	NM_138775		Approved	MGC10235	uc009yxp.3	Q96BT7	OTTHUMG00000157008	ENST00000428149.2:c.1015A>G	chr11.hg19:g.107396182T>C	ENSP00000415885:p.Thr339Ala	106.0	0.0		99.0	4.0	NM_138775	B1Q2M0|B4DEF6|Q8N989	Missense_Mutation	SNP	ENST00000428149.2	hg19	CCDS8337.2	.	.	.	.	.	.	.	.	.	.	T	6.172	0.399869	0.11696	.	.	ENSG00000137760	ENST00000428149;ENST00000389568;ENST00000417449	T;T;T	0.43294	0.96;0.96;0.95	5.83	4.71	0.59529	.	0.459276	0.23342	N	0.049221	T	0.38665	0.1049	M	0.70595	2.14	0.21325	N	0.999724	B;B	0.27140	0.011;0.169	B;B	0.27380	0.008;0.079	T	0.34750	-0.9816	10	0.08179	T	0.78	-19.9623	10.8681	0.46866	0.0:0.0732:0.0:0.9268	.	339;342	Q96BT7;Q96BT7-4	ALKB8_HUMAN;.	A	339;339;342	ENSP00000415885:T339A;ENSP00000374219:T339A;ENSP00000397673:T342A	ENSP00000374219:T339A	T	-	1	0	ALKBH8	106901392	0.464000	0.25807	0.273000	0.24645	0.441000	0.31987	1.852000	0.39348	1.052000	0.40392	0.477000	0.44152	ACA	.	.		0.373	ALKBH8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347071.2	NM_138775	
NXPE1	120400	hgsc.bcm.edu	37	11	114393611	114393611	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:114393611T>C	ENST00000424269.1	-	4	1097	c.1098A>G	c.(1096-1098)aaA>aaG	p.K366K	NXPE1_ENST00000536271.1_Silent_p.K82K|NXPE1_ENST00000251921.2_Silent_p.K224K			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	366						extracellular region (GO:0005576)											TTTTTACAACTTTGGGGAAGT	0.358																																					p.K224K		Atlas-SNP	.											.	NXPE1	8	.	0			c.A672G						.						67.0	63.0	64.0					11																	114393611		2201	4296	6497	SO:0001819	synonymous_variant	120400	exon5			TACAACTTTGGGG	BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.1098A>G	chr11.hg19:g.114393611T>C		118.0	0.0		96.0	4.0	NM_152315	B0YJ13	Silent	SNP	ENST00000424269.1	hg19																																																																																				.	.		0.358	NXPE1-201	KNOWN	basic	protein_coding	protein_coding		NM_152315	
DSCAML1	57453	hgsc.bcm.edu	37	11	117314661	117314661	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:117314661A>G	ENST00000321322.6	-	21	3984	c.3983T>C	c.(3982-3984)gTc>gCc	p.V1328A	DSCAML1_ENST00000527706.1_Missense_Mutation_p.V1058A	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1268	Ig-like C2-type 10.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGCAGAGGTGACGGCGGCCAC	0.642																																					p.V1328A		Atlas-SNP	.											.	DSCAML1	286	.	0			c.T3983C						.						31.0	30.0	30.0					11																	117314661		2200	4296	6496	SO:0001583	missense	57453	exon21			GAGGTGACGGCGG		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3983T>C	chr11.hg19:g.117314661A>G	ENSP00000315465:p.Val1328Ala	68.0	0.0		64.0	4.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.476160	0.84640	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.61859	0.07;0.07	4.59	4.59	0.56863	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69187	0.3083	L	0.58669	1.825	0.80722	D	1	D	0.59357	0.985	D	0.64595	0.927	T	0.67929	-0.5543	9	0.33940	T	0.23	.	14.1423	0.65327	1.0:0.0:0.0:0.0	.	1268	Q8TD84	DSCL1_HUMAN	A	1058;1328;1035	ENSP00000434335:V1058A;ENSP00000315465:V1328A	ENSP00000315465:V1328A	V	-	2	0	DSCAML1	116819871	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.259000	0.78381	1.916000	0.55485	0.260000	0.18958	GTC	.	.		0.642	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
KMT2A	4297	hgsc.bcm.edu	37	11	118377090	118377090	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:118377090A>G	ENST00000389506.5	+	27	10474	c.10474A>G	c.(10474-10476)Agc>Ggc	p.S3492G	KMT2A_ENST00000534358.1_Missense_Mutation_p.S3495G|KMT2A_ENST00000354520.4_Missense_Mutation_p.S3454G			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3492					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CGCTCCTAATAGCATGGGACT	0.547																																					p.S3495G		Atlas-SNP	.											.	MLL	548	.	0			c.A10483G						.						114.0	116.0	115.0					11																	118377090		2200	4295	6495	SO:0001583	missense	4297	exon27			CCTAATAGCATGG	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.10474A>G	chr11.hg19:g.118377090A>G	ENSP00000374157:p.Ser3492Gly	145.0	0.0		164.0	7.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	A	2.183	-0.387148	0.04932	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;T	0.81659	-1.52;-1.52;-1.49	5.53	0.697	0.18081	.	0.779687	0.13079	N	0.415426	T	0.62097	0.2400	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42361	-0.9456	10	0.20046	T	0.44	.	4.512	0.11915	0.5893:0.1596:0.2511:0.0	.	3495;3492	E9PQG7;Q03164	.;MLL1_HUMAN	G	3495;3492;3454;2402	ENSP00000436786:S3495G;ENSP00000374157:S3492G;ENSP00000346516:S3454G	ENSP00000346516:S3454G	S	+	1	0	MLL	117882300	0.004000	0.15560	0.000000	0.03702	0.199000	0.23934	1.909000	0.39917	0.153000	0.19213	0.482000	0.46254	AGC	.	.		0.547	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
HMBS	3145	hgsc.bcm.edu	37	11	118963697	118963697	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:118963697A>G	ENST00000278715.3	+	13	1029	c.878A>G	c.(877-879)gAg>gGg	p.E293G	HMBS_ENST00000392841.1_Missense_Mutation_p.E276G|HMBS_ENST00000544387.1_Missense_Mutation_p.E253G|HMBS_ENST00000542729.1_Missense_Mutation_p.E236G|HMBS_ENST00000543090.1_Missense_Mutation_p.E262G|HMBS_ENST00000537841.1_Missense_Mutation_p.E276G|HMBS_ENST00000442944.2_Missense_Mutation_p.E276G	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	293					heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		AGCATACAAGAGACCATGCAG	0.512																																					p.E293G		Atlas-SNP	.											.	HMBS	27	.	0			c.A878G						.						97.0	97.0	97.0					11																	118963697		2200	4295	6495	SO:0001583	missense	3145	exon13			TACAAGAGACCAT	X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.878A>G	chr11.hg19:g.118963697A>G	ENSP00000278715:p.Glu293Gly	178.0	0.0		156.0	7.0	NM_000190	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Missense_Mutation	SNP	ENST00000278715.3	hg19	CCDS8409.1	.	.	.	.	.	.	.	.	.	.	a	21.7	4.192535	0.78902	.	.	ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000256269;ENSG00000149397	ENST00000278715;ENST00000537841;ENST00000542729;ENST00000544387;ENST00000543090;ENST00000392841;ENST00000442944	D;D;D;D;D;D;D	0.98178	-4.77;-4.77;-4.77;-4.77;-4.77;-4.77;-4.77	5.24	5.24	0.73138	Porphobilinogen deaminase, C-terminal (3);	0.152799	0.56097	D	0.000023	D	0.96327	0.8802	L	0.33753	1.03	0.80722	D	1	B;P;B;P	0.41131	0.223;0.694;0.0;0.739	B;B;B;P	0.47251	0.142;0.29;0.001;0.542	D	0.94985	0.8129	10	0.16420	T	0.52	-15.2548	12.6299	0.56651	1.0:0.0:0.0:0.0	.	236;262;253;293	G3V1P4;F5H345;G5EA58;P08397	.;.;.;HEM3_HUMAN	G	293;276;236;253;262;276;276	ENSP00000278715:E293G;ENSP00000444730:E276G;ENSP00000443058:E236G;ENSP00000438424:E253G;ENSP00000445429:E262G;ENSP00000376584:E276G;ENSP00000392041:E276G	ENSP00000392041:E276G	E	+	2	0	CTD-2589C9.4;HMBS	118468907	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	8.266000	0.89871	2.187000	0.69744	0.529000	0.55759	GAG	.	.		0.512	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399188.1	NM_000190	
MCAM	4162	hgsc.bcm.edu	37	11	119185942	119185942	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:119185942A>G	ENST00000264036.4	-	2	113	c.99T>C	c.(97-99)ccT>ccC	p.P33P	MCAM_ENST00000530144.2_5'UTR|MCAM_ENST00000392814.1_5'Flank	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	33	Ig-like V-type 1.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCACCAGCTCAGGCGCAGGCT	0.682																																					p.P33P		Atlas-SNP	.											.	MCAM	57	.	0			c.T99C						.						43.0	38.0	40.0					11																	119185942		2199	4295	6494	SO:0001819	synonymous_variant	4162	exon2			CAGCTCAGGCGCA	X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.99T>C	chr11.hg19:g.119185942A>G		83.0	0.0		66.0	5.0	NM_006500	O95812|Q59E86|Q6PHR3|Q6ZTR2	Silent	SNP	ENST00000264036.4	hg19	CCDS31690.1																																																																																			.	.		0.682	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
ZNF202	7753	hgsc.bcm.edu	37	11	123598256	123598256	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:123598256C>T	ENST00000529691.1	-	6	1099	c.880G>A	c.(880-882)Gag>Aag	p.E294K	ZNF202_ENST00000336139.4_Missense_Mutation_p.E294K|ZNF202_ENST00000530393.1_Missense_Mutation_p.E294K			O95125	ZN202_HUMAN	zinc finger protein 202	294	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		ACCCAAGGCTCTTCCTCTCTA	0.483																																					p.E294K		Atlas-SNP	.											ZNF202,bladder,carcinoma,0,1	ZNF202	72	.	0			c.G880A						.						104.0	100.0	101.0					11																	123598256		2202	4299	6501	SO:0001583	missense	7753	exon8			AAGGCTCTTCCTC	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.880G>A	chr11.hg19:g.123598256C>T	ENSP00000433881:p.Glu294Lys	196.0	0.0		186.0	8.0	NM_003455	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	ENST00000529691.1	hg19	CCDS8443.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608230	0.46527	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.09073	3.02;3.02;3.02	4.86	4.86	0.63082	Krueppel-associated box (3);	0.000000	0.48767	D	0.000175	T	0.17704	0.0425	L	0.45352	1.415	0.44956	D	0.997978	D	0.67145	0.996	P	0.61070	0.883	T	0.01956	-1.1240	10	0.25106	T	0.35	-20.9101	15.528	0.75928	0.0:1.0:0.0:0.0	.	294	O95125	ZN202_HUMAN	K	294	ENSP00000337724:E294K;ENSP00000432504:E294K;ENSP00000433881:E294K	ENSP00000337724:E294K	E	-	1	0	ZNF202	123103466	0.852000	0.29690	1.000000	0.80357	0.998000	0.95712	3.302000	0.51849	2.524000	0.85096	0.650000	0.86243	GAG	.	.		0.483	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387419.1	NM_003455	
VWA5A	4013	hgsc.bcm.edu	37	11	124013240	124013240	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:124013240T>C	ENST00000456829.2	+	17	2366	c.2115T>C	c.(2113-2115)ggT>ggC	p.G705G	VWA5A_ENST00000392748.1_Silent_p.G705G|VWA5A_ENST00000360334.4_3'UTR	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	705										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						AGATCCTAGGTATGAGTTTGG	0.418																																					p.G705G		Atlas-SNP	.											.	VWA5A	102	.	0			c.T2115C						.						115.0	107.0	110.0					11																	124013240		2201	4299	6500	SO:0001819	synonymous_variant	4013	exon16			CCTAGGTATGAGT	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.2115T>C	chr11.hg19:g.124013240T>C		103.0	0.0		90.0	40.0	NM_014622	Q6UN19|Q6UN20|Q9BVF8	Silent	SNP	ENST00000456829.2	hg19	CCDS8444.1																																																																																			.	.		0.418	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622	
SPA17	53340	hgsc.bcm.edu	37	11	124551288	124551288	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:124551288C>T	ENST00000532692.1	+	2	1579	c.158C>T	c.(157-159)aCc>aTc	p.T53I	SIAE_ENST00000525730.1_Intron|SPA17_ENST00000227135.2_Missense_Mutation_p.T53I|SPA17_ENST00000524614.1_3'UTR			Q15506	SP17_HUMAN	sperm autoantigenic protein 17	53					binding of sperm to zona pellucida (GO:0007339)|epithelial cilium movement (GO:0003351)|single fertilization (GO:0007338)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|primary cilium (GO:0072372)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	5	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0223)		TATTTAGAAACCAACTTTGAT	0.328																																					p.T53I		Atlas-SNP	.											.	SPA17	16	.	0			c.C158T						.						71.0	75.0	73.0					11																	124551288		2201	4299	6500	SO:0001583	missense	53340	exon3			TAGAAACCAACTT	AF334735	CCDS8450.1	11q24.2	2009-03-12			ENSG00000064199	ENSG00000064199			11210	protein-coding gene	gene with protein product	"""cancer/testis antigen 22"""	608621				8688458	Standard	NM_017425		Approved	SP17, CT22	uc001qap.3	Q15506	OTTHUMG00000165927	ENST00000532692.1:c.158C>T	chr11.hg19:g.124551288C>T	ENSP00000432305:p.Thr53Ile	70.0	0.0		63.0	4.0	NM_017425	B2R4F2|Q9BXF7	Missense_Mutation	SNP	ENST00000532692.1	hg19	CCDS8450.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241748	0.79912	.	.	ENSG00000064199	ENST00000227135;ENST00000532692	.	.	.	5.49	5.49	0.81192	.	0.155983	0.41396	D	0.000882	T	0.64427	0.2597	M	0.66939	2.045	0.40998	D	0.984903	D	0.59767	0.986	P	0.47206	0.541	T	0.71052	-0.4704	9	0.72032	D	0.01	-7.8147	18.1401	0.89637	0.0:1.0:0.0:0.0	.	53	Q15506	SP17_HUMAN	I	53	.	ENSP00000227135:T53I	T	+	2	0	SPA17	124056498	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.842000	0.48230	2.582000	0.87167	0.460000	0.39030	ACC	.	.		0.328	SPA17-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387075.1	NM_017425	
NCAPD3	23310	hgsc.bcm.edu	37	11	134072792	134072792	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:134072792A>G	ENST00000534548.2	-	13	1598	c.1534T>C	c.(1534-1536)Tac>Cac	p.Y512H		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	512					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TGCCTTTGGTAGGAAAAAGCT	0.358																																					p.Y512H		Atlas-SNP	.											.	NCAPD3	141	.	0			c.T1534C						.						111.0	106.0	108.0					11																	134072792		2201	4297	6498	SO:0001583	missense	23310	exon13			TTTGGTAGGAAAA	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1534T>C	chr11.hg19:g.134072792A>G	ENSP00000433681:p.Tyr512His	95.0	0.0		103.0	5.0	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	hg19	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	A	0.041	-1.283995	0.01398	.	.	ENSG00000151503	ENST00000534548	T	0.64991	-0.13	4.86	3.73	0.42828	Armadillo-type fold (1);	1.698150	0.02702	N	0.111819	T	0.46092	0.1375	N	0.14661	0.345	0.25224	N	0.989883	B	0.02656	0.0	B	0.01281	0.0	T	0.32745	-0.9895	10	0.15499	T	0.54	4.6814	7.6688	0.28447	0.9016:0.0:0.0984:0.0	.	512	P42695	CNDD3_HUMAN	H	512	ENSP00000433681:Y512H	ENSP00000431612:Y512H	Y	-	1	0	NCAPD3	133578002	0.529000	0.26322	0.022000	0.16811	0.003000	0.03518	0.786000	0.26844	0.802000	0.34089	-0.280000	0.10049	TAC	.	.		0.358	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
C12orf4	57102	hgsc.bcm.edu	37	12	4599703	4599703	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:4599703T>C	ENST00000261250.3	-	13	1638	c.1551A>G	c.(1549-1551)caA>caG	p.Q517Q	C12orf4_ENST00000545746.1_Silent_p.Q517Q	NM_020374.2	NP_065107.1	Q9NQ89	CL004_HUMAN	chromosome 12 open reading frame 4	517										NS(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		GTACTAGAAATTGCACTGTCC	0.383																																					p.Q517Q		Atlas-SNP	.											.	C12orf4	58	.	0			c.A1551G						.						110.0	107.0	108.0					12																	4599703		2203	4300	6503	SO:0001819	synonymous_variant	57102	exon13			TAGAAATTGCACT	AJ272205	CCDS8528.1	12p13.3	2012-08-10			ENSG00000047621	ENSG00000047621			1184	protein-coding gene	gene with protein product							Standard	NM_020374		Approved		uc001qms.3	Q9NQ89	OTTHUMG00000168258	ENST00000261250.3:c.1551A>G	chr12.hg19:g.4599703T>C		56.0	0.0		95.0	4.0	NM_020374	D3DUQ8|Q6MZH5	Silent	SNP	ENST00000261250.3	hg19	CCDS8528.1																																																																																			.	.		0.383	C12orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398992.1	NM_020374	
PLCZ1	89869	hgsc.bcm.edu	37	12	18841042	18841042	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:18841042A>G	ENST00000538330.1	-	9	1299	c.918T>C	c.(916-918)acT>acC	p.T306T	PLCZ1_ENST00000541695.1_Silent_p.T387T|PLCZ1_ENST00000539875.1_Silent_p.T331T|PLCZ1_ENST00000534932.1_Silent_p.T5T|PLCZ1_ENST00000447925.2_Silent_p.T522T|PLCZ1_ENST00000266505.7_Silent_p.T524T|PLCZ1_ENST00000435379.1_Silent_p.T329T					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TAATTACACGAGTCTGCTGCT	0.318																																					p.T524T		Atlas-SNP	.											.	PLCZ1	107	.	0			c.T1572C						.						91.0	95.0	93.0					12																	18841042		2203	4297	6500	SO:0001819	synonymous_variant	89869	exon13			TACACGAGTCTGC	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.918T>C	chr12.hg19:g.18841042A>G		78.0	0.0		82.0	4.0	NM_033123		Silent	SNP	ENST00000538330.1	hg19																																																																																				.	.		0.318	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000401666.3	NM_033123	
PLEKHA5	54477	hgsc.bcm.edu	37	12	19518932	19518932	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:19518932C>T	ENST00000299275.6	+	24	3151	c.3145C>T	c.(3145-3147)Cca>Tca	p.P1049S	PLEKHA5_ENST00000539256.1_Missense_Mutation_p.P807S|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.P1112S|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.P1038S|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.P1107S|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.P993S|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.P1215S|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.P1031S|PLEKHA5_ENST00000355397.3_Missense_Mutation_p.P1107S	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	1049					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					AAATCATAAACCAGAAGAGCA	0.323																																					p.P1215S	Pancreas(196;329 2193 11246 14234 19524)	Atlas-SNP	.											.	PLEKHA5	198	.	0			c.C3643T						.						80.0	73.0	75.0					12																	19518932		2203	4300	6503	SO:0001583	missense	54477	exon30			CATAAACCAGAAG	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.3145C>T	chr12.hg19:g.19518932C>T	ENSP00000299275:p.Pro1049Ser	34.0	0.0		48.0	4.0	NM_001256470	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	hg19	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	C	4.245	0.044378	0.08196	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000538972	T;T;T;T;T;T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04;3.04	4.45	-7.17	0.01511	.	1.993890	0.02465	N	0.086916	T	0.03608	0.0103	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B	0.15719	0.004;0.002;0.002;0.002;0.014	B;B;B;B;B	0.13407	0.006;0.002;0.003;0.002;0.009	T	0.37244	-0.9714	10	0.13853	T	0.58	1.1337	3.6818	0.08313	0.1868:0.239:0.4378:0.1364	.	1031;1038;993;1049;1107	F5H0I0;E7EME8;Q9HAU0-5;Q9HAU0;Q9HAU0-2	.;.;.;PKHA5_HUMAN;.	S	1112;1107;993;1215;1049;807;1107;1038;1031;330	ENSP00000325155:P1112S;ENSP00000347560:P1107S;ENSP00000352104:P993S;ENSP00000404296:P1215S;ENSP00000299275:P1049S;ENSP00000440611:P807S;ENSP00000439673:P1107S;ENSP00000400411:P1038S;ENSP00000439837:P1031S;ENSP00000443553:P330S	ENSP00000299275:P1049S	P	+	1	0	PLEKHA5	19410199	0.028000	0.19301	0.000000	0.03702	0.018000	0.09664	-0.597000	0.05713	-1.126000	0.02929	0.460000	0.39030	CCA	.	.		0.323	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
SLCO1B7	338821	hgsc.bcm.edu	37	12	21207384	21207385	+	Splice_Site	DNP	AG	AG	CT			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A|G	A|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:21207384_21207385AG>CT	ENST00000421593.2	+	10	1356		c.e10-1		RP11-125O5.2_ENST00000590779.1_5'Flank|LST3_ENST00000540229.1_Intron|SLCO1B7_ENST00000554957.1_Splice_Site|LST3_ENST00000381541.3_Splice_Site|SLCO1B3_ENST00000553473.1_Intron	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						AATTATTTTTAGGTGTTTTATA	0.332																																					.		Atlas-SNP	.											.	SLCO1B7	85	.	0			c.1357-2A>C|c.1357-1G>T						.																																			SO:0001630	splice_region_variant	338821	exon10			ATTTTTAGGTGTT|TTTTTAGGTGTTT	AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	Exception_encountered	chr12.hg19:g.21207384_21207385delinsCT		122.0|124.0	0.0		179.0|182.0	28.0|30.0	NM_001009562	Q71QF0	Splice_Site	SNP	ENST00000421593.2	hg19	CCDS44843.1																																																																																			.	.		0.332	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402066.1	NM_001009562	Intron
PUS7L	83448	hgsc.bcm.edu	37	12	44132189	44132189	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:44132189T>C	ENST00000416848.2	-	6	1856	c.1368A>G	c.(1366-1368)aaA>aaG	p.K456K	PUS7L_ENST00000431332.3_Silent_p.K143K|RP11-210N13.1_ENST00000548437.1_RNA|PUS7L_ENST00000344862.5_Silent_p.K456K|PUS7L_ENST00000551923.1_Silent_p.K456K	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	456	TRUD. {ECO:0000255|PROSITE- ProRule:PRU00342}.				pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		ATTTTATGGCTTTCATCTTAA	0.294																																					p.K456K		Atlas-SNP	.											.	PUS7L	73	.	0			c.A1368G						.						96.0	96.0	96.0					12																	44132189		2203	4294	6497	SO:0001819	synonymous_variant	83448	exon6			TATGGCTTTCATC	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.1368A>G	chr12.hg19:g.44132189T>C		77.0	0.0		95.0	5.0	NM_001098614	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Silent	SNP	ENST00000416848.2	hg19	CCDS8743.1																																																																																			.	.		0.294	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	
KRT84	3890	hgsc.bcm.edu	37	12	52771877	52771877	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:52771877C>A	ENST00000257951.3	-	9	1810	c.1744G>T	c.(1744-1746)Ggc>Tgc	p.G582C	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	582	Tail.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GAGCTGCGGCCGCCGCTGCAG	0.677																																					p.G582C		Atlas-SNP	.											.	KRT84	61	.	0			c.G1744T						.						12.0	14.0	13.0					12																	52771877		2182	4273	6455	SO:0001583	missense	3890	exon9			TGCGGCCGCCGCT	Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.1744G>T	chr12.hg19:g.52771877C>A	ENSP00000257951:p.Gly582Cys	209.0	0.0		162.0	72.0	NM_033045	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	hg19	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524879	0.27299	.	.	ENSG00000161849	ENST00000257951	D	0.82984	-1.67	3.57	2.66	0.31614	.	0.230288	0.22348	N	0.061253	D	0.82710	0.5096	L	0.36672	1.1	0.09310	N	1	D	0.76494	0.999	D	0.64410	0.925	T	0.70923	-0.4740	10	0.87932	D	0	.	6.1951	0.20546	0.0:0.8602:0.0:0.1398	.	582	Q9NSB2	KRT84_HUMAN	C	582	ENSP00000257951:G582C	ENSP00000257951:G582C	G	-	1	0	KRT84	51058144	0.697000	0.27767	0.207000	0.23584	0.189000	0.23516	1.818000	0.39012	1.991000	0.58162	0.462000	0.41574	GGC	.	.		0.677	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
MFSD5	84975	hgsc.bcm.edu	37	12	53646714	53646714	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:53646714C>T	ENST00000329548.4	+	2	286	c.95C>T	c.(94-96)gCc>gTc	p.A32V	MFSD5_ENST00000534842.1_Missense_Mutation_p.A139V	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	32					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CCTGGAAGGGCCTGCAGCAAT	0.577																																					p.A139V		Atlas-SNP	.											.	MFSD5	40	.	0			c.C416T						.						104.0	111.0	108.0					12																	53646714		2203	4300	6503	SO:0001583	missense	84975	exon2			GAAGGGCCTGCAG	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.95C>T	chr12.hg19:g.53646714C>T	ENSP00000332624:p.Ala32Val	149.0	0.0		174.0	84.0	NM_001170790	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	hg19	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708820	0.30322	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	.	.	.	4.3	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.43590	0.1254	L	0.33339	1.005	0.49130	D	0.999753	B;B	0.29988	0.065;0.264	B;B	0.27715	0.033;0.082	T	0.33752	-0.9856	9	0.37606	T	0.19	-8.2227	10.7748	0.46343	0.0:0.9055:0.0:0.0945	.	32;139	Q6N075;G3V1N7	MFSD5_HUMAN;.	V	139;139;139;32	.	ENSP00000331231:A139V	A	+	2	0	MFSD5	51932981	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.012000	0.29924	1.037000	0.40024	0.561000	0.74099	GCC	.	.		0.577	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
GPR84	53831	hgsc.bcm.edu	37	12	54756956	54756956	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:54756956A>G	ENST00000551809.1	-	1	1315	c.680T>C	c.(679-681)gTg>gCg	p.V227A	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA|GPR84_ENST00000267015.3_Missense_Mutation_p.V227A			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						AGTCCTGGCCACATGGTTGGA	0.557																																					p.V227A		Atlas-SNP	.											.	GPR84	38	.	0			c.T680C						.						177.0	162.0	167.0					12																	54756956		2203	4300	6503	SO:0001583	missense	53831	exon2			CTGGCCACATGGT	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.680T>C	chr12.hg19:g.54756956A>G	ENSP00000450310:p.Val227Ala	95.0	0.0		97.0	41.0	NM_020370	B6V9G7	Missense_Mutation	SNP	ENST00000551809.1	hg19	CCDS8878.1	.	.	.	.	.	.	.	.	.	.	A	11.55	1.672176	0.29693	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.60672	0.17;0.17	4.5	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.325101	0.22054	N	0.065272	T	0.44095	0.1277	L	0.40543	1.245	0.35004	D	0.756234	B	0.29909	0.261	B	0.29524	0.103	T	0.47971	-0.9075	10	0.07990	T	0.79	-11.5828	12.0877	0.53706	1.0:0.0:0.0:0.0	.	227	Q9NQS5	GPR84_HUMAN	A	227	ENSP00000267015:V227A;ENSP00000450310:V227A	ENSP00000267015:V227A	V	-	2	0	GPR84	53043223	0.923000	0.31300	0.971000	0.41717	0.664000	0.39144	1.456000	0.35201	2.023000	0.59567	0.459000	0.35465	GTG	.	.		0.557	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
TSPAN31	6302	hgsc.bcm.edu	37	12	58135818	58135818	+	5'Flank	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:58135818T>C	ENST00000257910.3	+	0	0				TSPAN31_ENST00000553221.1_Intron|AGAP2_ENST00000257897.3_Missense_Mutation_p.R13G|TSPAN31_ENST00000547992.1_5'Flank	NM_005981.3	NP_005972.1	Q12999	TSN31_HUMAN	tetraspanin 31						positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(1)|kidney(1)|lung(5)	7	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			ACTTCTGCTCTCACTGCAGCT	0.597																																					p.R13G		Atlas-SNP	.											.	AGAP2	167	.	0			c.A37G						.						201.0	160.0	174.0					12																	58135818		2203	4300	6503	SO:0001631	upstream_gene_variant	116986	exon1			CTGCTCTCACTGC		CCDS8952.1	12q13-q14	2013-02-14	2005-08-16	2005-08-16		ENSG00000135452		"""Tetraspanins"""	10539	protein-coding gene	gene with protein product		181035	"""sarcoma amplified sequence"""	SAS			Standard	NM_005981		Approved		uc001spt.3	Q12999			chr12.hg19:g.58135818T>C	Exception_encountered	125.0	0.0		123.0	5.0	NM_014770	O00577|Q53X76	Missense_Mutation	SNP	ENST00000257910.3	hg19	CCDS8952.1	.	.	.	.	.	.	.	.	.	.	t	13.26	2.184917	0.38609	.	.	ENSG00000135439	ENST00000257897	T	0.39229	1.09	4.76	3.52	0.40303	.	.	.	.	.	T	0.31796	0.0808	.	.	.	0.80722	D	1	B	0.25609	0.13	B	0.19391	0.025	T	0.28808	-1.0032	8	0.87932	D	0	.	8.0692	0.30678	0.0:0.0:0.2056:0.7944	.	13	Q99490-2	.	G	13	ENSP00000257897:R13G	ENSP00000257897:R13G	R	-	1	2	AGAP2	56422085	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	2.613000	0.46351	1.924000	0.55735	0.235000	0.17854	AGA	.	.		0.597	TSPAN31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408778.1		
USP15	9958	hgsc.bcm.edu	37	12	62696641	62696641	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:62696641T>C	ENST00000280377.5	+	3	346	c.288T>C	c.(286-288)ggT>ggC	p.G96G	USP15_ENST00000353364.3_Silent_p.G96G|USP15_ENST00000312635.6_Silent_p.G96G|USP15_ENST00000393654.3_Silent_p.G96G|USP15_ENST00000550632.1_3'UTR	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	96	DUSP. {ECO:0000255|PROSITE- ProRule:PRU00613}.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		CAACTGAAGGTTGGAATAAAC	0.343																																					p.G96G	Melanoma(181;615 2041 39364 49691 50001)	Atlas-SNP	.											.	USP15	105	.	0			c.T288C						.						122.0	121.0	121.0					12																	62696641		2203	4300	6503	SO:0001819	synonymous_variant	9958	exon3			TGAAGGTTGGAAT	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.288T>C	chr12.hg19:g.62696641T>C		96.0	0.0		112.0	5.0	NM_001252078	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	ENST00000280377.5	hg19	CCDS58251.1	.	.	.	.	.	.	.	.	.	.	T	10.08	1.253303	0.22965	.	.	ENSG00000135655	ENST00000549237	.	.	.	5.72	4.79	0.61399	.	.	.	.	.	T	0.60301	0.2258	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58509	-0.7624	4	.	.	.	-7.1095	9.6221	0.39727	0.0:0.6711:0.2567:0.0722	.	.	.	.	A	92	.	.	V	+	2	0	USP15	60982908	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.005000	0.40864	1.403000	0.46800	-0.321000	0.08615	GTT	.	.		0.343	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
MSRB3	253827	hgsc.bcm.edu	37	12	65762781	65762781	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:65762781A>G	ENST00000355192.3	+	4	414	c.288A>G	c.(286-288)tcA>tcG	p.S96S	MSRB3_ENST00000535664.1_Silent_p.S89S|MSRB3_ENST00000308259.5_Silent_p.S89S|MSRB3_ENST00000540804.1_Silent_p.S96S	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	96					protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		TTTGCAGGTCAGAAACCAAAT	0.348																																					p.S96S		Atlas-SNP	.											.	MSRB3	80	.	0			c.A288G						.						37.0	41.0	40.0					12																	65762781		2202	4298	6500	SO:0001819	synonymous_variant	253827	exon4			CAGGTCAGAAACC	BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.288A>G	chr12.hg19:g.65762781A>G		172.0	0.0		97.0	5.0	NM_198080	B4DR19|B7ZAQ0|Q6UXS2	Silent	SNP	ENST00000355192.3	hg19	CCDS8973.1	.	.	.	.	.	.	.	.	.	.	A	6.773	0.511578	0.12944	.	.	ENSG00000174099	ENST00000541189;ENST00000446731	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	T	0.63331	0.2502	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62364	-0.6870	4	.	.	.	-23.5263	11.1184	0.48275	0.8621:0.0:0.0:0.1379	.	.	.	.	G	105;48	.	.	R	+	1	2	MSRB3	64049048	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.267000	0.43329	2.242000	0.73789	0.460000	0.39030	AGA	.	.		0.348	MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401421.1	NM_198080	
IFNG	3458	hgsc.bcm.edu	37	12	68553390	68553390	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:68553390T>C	ENST00000229135.3	-	1	137	c.6A>G	c.(4-6)aaA>aaG	p.K2K	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	2					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	AACTTGTATATTTCATCGTTT	0.383																																					p.K2K		Atlas-SNP	.											.	IFNG	38	.	0			c.A6G						.						33.0	30.0	31.0					12																	68553390		2203	4297	6500	SO:0001819	synonymous_variant	3458	exon1			TGTATATTTCATC		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.6A>G	chr12.hg19:g.68553390T>C		59.0	0.0		100.0	4.0	NM_000619	B5BU88|Q53ZV4	Silent	SNP	ENST00000229135.3	hg19	CCDS8980.1																																																																																			.	.		0.383	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1		
IL26	55801	hgsc.bcm.edu	37	12	68619375	68619375	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:68619375T>C	ENST00000229134.4	-	1	226	c.162A>G	c.(160-162)gcA>gcG	p.A54A	IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26	54					cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		CTGGAATCGTTGCTTTGAGCC	0.403																																					p.A54A		Atlas-SNP	.											.	IL26	32	.	0			c.A162G						.						235.0	213.0	220.0					12																	68619375		2203	4300	6503	SO:0001819	synonymous_variant	55801	exon1			AATCGTTGCTTTG	AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.162A>G	chr12.hg19:g.68619375T>C		73.0	0.0		94.0	4.0	NM_018402		Silent	SNP	ENST00000229134.4	hg19	CCDS8981.1																																																																																			.	.		0.403	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402302.1	NM_018402	
E2F7	144455	hgsc.bcm.edu	37	12	77421889	77421889	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:77421889A>G	ENST00000322886.7	-	11	2149	c.1914T>C	c.(1912-1914)tcT>tcC	p.S638S	E2F7_ENST00000416496.2_Silent_p.S638S	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	638					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						TAGTCTTGGGAGAGGCAAGGT	0.418																																					p.S638S		Atlas-SNP	.											.	E2F7	201	.	0			c.T1914C						.						90.0	87.0	88.0					12																	77421889		2203	4300	6503	SO:0001819	synonymous_variant	144455	exon11			CTTGGGAGAGGCA	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1914T>C	chr12.hg19:g.77421889A>G		135.0	0.0		125.0	6.0	NM_203394	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Silent	SNP	ENST00000322886.7	hg19	CCDS9016.1																																																																																			.	.		0.418	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871	
OTOGL	283310	hgsc.bcm.edu	37	12	80722448	80722448	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:80722448T>C	ENST00000547103.1	+	35	4182	c.4176T>C	c.(4174-4176)gtT>gtC	p.V1392V	OTOGL_ENST00000458043.2_Silent_p.V1392V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1392					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TGTAAAGGGTTGAAGGATGCT	0.348																																					p.V1392V		Atlas-SNP	.											.	OTOGL	235	.	0			c.T4176C						.						99.0	87.0	91.0					12																	80722448		1847	4090	5937	SO:0001819	synonymous_variant	283310	exon35			AAGGGTTGAAGGA	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4176T>C	chr12.hg19:g.80722448T>C		148.0	0.0		124.0	6.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	ENST00000547103.1	hg19																																																																																				.	.		0.348	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
HCFC2	29915	hgsc.bcm.edu	37	12	104461781	104461781	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:104461781T>C	ENST00000229330.4	+	3	473	c.369T>C	c.(367-369)ccT>ccC	p.P123P		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	123					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						CTGGTTTACCTCCTTGTCCTC	0.403																																					p.P123P	Esophageal Squamous(184;1814 2036 4771 6974 15702)	Atlas-SNP	.											.	HCFC2	94	.	0			c.T369C						.						248.0	240.0	243.0					12																	104461781		2203	4300	6503	SO:0001819	synonymous_variant	29915	exon3			TTTACCTCCTTGT	AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.369T>C	chr12.hg19:g.104461781T>C		54.0	0.0		76.0	4.0	NM_013320	B2R8Q5|C0H5X3	Silent	SNP	ENST00000229330.4	hg19	CCDS9097.1																																																																																			.	.		0.403	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320	
ANKRD13A	88455	hgsc.bcm.edu	37	12	110468463	110468463	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:110468463T>C	ENST00000261739.4	+	12	1414	c.1248T>C	c.(1246-1248)ttT>ttC	p.F416F	C12orf76_ENST00000546651.2_Intron	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	416						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						TTCCCTTGTTTCATGTCTTAA	0.333																																					p.F416F		Atlas-SNP	.											.	ANKRD13A	39	.	0			c.T1248C						.						55.0	53.0	54.0					12																	110468463		2203	4300	6503	SO:0001819	synonymous_variant	88455	exon12			CTTGTTTCATGTC	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.1248T>C	chr12.hg19:g.110468463T>C		53.0	0.0		29.0	4.0	NM_033121	O60736	Silent	SNP	ENST00000261739.4	hg19	CCDS9140.1	.	.	.	.	.	.	.	.	.	.	T	9.167	1.020254	0.19433	.	.	ENSG00000076513	ENST00000547639	T	0.48522	0.81	5.94	1.93	0.25924	.	0.000000	0.85682	D	0.000000	T	0.53142	0.1778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52653	-0.8547	7	0.59425	D	0.04	-19.254	8.8073	0.34945	0.0:0.3575:0.0:0.6425	.	.	.	.	S	269	ENSP00000449781:F269S	ENSP00000449781:F269S	F	+	2	0	ANKRD13A	108952846	0.994000	0.37717	1.000000	0.80357	0.999000	0.98932	0.253000	0.18296	0.505000	0.28104	0.528000	0.53228	TTC	.	.		0.333	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403430.1	NM_033121	
RNFT2	84900	hgsc.bcm.edu	37	12	117290508	117290508	+	3'UTR	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:117290508A>G	ENST00000392549.2	+	0	1970				RNFT2_ENST00000319176.7_3'UTR|RNFT2_ENST00000407967.3_Silent_p.A418A|RNFT2_ENST00000551251.1_3'UTR	NM_001109903.1	NP_001103373.1	Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		ATGAaagtgcaggtgtgtaag	0.458																																					p.A418A		Atlas-SNP	.											.	RNFT2	28	.	0			c.A1254G						.						135.0	141.0	139.0					12																	117290508		2203	4300	6503	SO:0001624	3_prime_UTR_variant	84900	exon11			AAGTGCAGGTGTG	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000392549.2:c.*402A>G	chr12.hg19:g.117290508A>G		105.0	0.0		104.0	5.0	NM_032814	E9PAM7|Q96SU5	Silent	SNP	ENST00000392549.2	hg19	CCDS44987.1																																																																																			.	.		0.458	RNFT2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032814	
SBNO1	55206	hgsc.bcm.edu	37	12	123813423	123813423	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:123813423G>T	ENST00000602398.1	-	10	1281	c.1154C>A	c.(1153-1155)tCt>tAt	p.S385Y	SBNO1_ENST00000420886.2_Missense_Mutation_p.S385Y|SBNO1_ENST00000267176.4_Missense_Mutation_p.S384Y|SBNO1_ENST00000602750.1_Missense_Mutation_p.S384Y			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	385					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		ATGTTTGGAAGAAATTTTTCC	0.328																																					p.S385Y		Atlas-SNP	.											SBNO1,NS,carcinoma,0,1	SBNO1	138	.	0			c.C1154A						.						66.0	66.0	66.0					12																	123813423		2203	4300	6503	SO:0001583	missense	55206	exon9			TTGGAAGAAATTT	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.1154C>A	chr12.hg19:g.123813423G>T	ENSP00000473665:p.Ser385Tyr	37.0	0.0		33.0	2.0	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	hg19	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691780	0.88735	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	D;D	0.93366	-3.21;-3.21	5.53	5.53	0.82687	Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	D	0.96852	0.8972	M	0.86178	2.8	0.80722	D	1	P;P;D	0.64830	0.933;0.942;0.994	P;P;D	0.65010	0.796;0.674;0.931	D	0.96535	0.9396	10	0.49607	T	0.09	-17.9778	19.4671	0.94946	0.0:0.0:1.0:0.0	.	385;384;383	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	Y	385;384;384	ENSP00000387361:S385Y;ENSP00000267176:S384Y	ENSP00000267176:S384Y	S	-	2	0	SBNO1	122379376	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.869000	0.99810	2.603000	0.88011	0.313000	0.20887	TCT	.	.		0.328	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
GJB6	10804	hgsc.bcm.edu	37	13	20797265	20797265	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:20797265C>T	ENST00000356192.6	-	5	975	c.355G>A	c.(355-357)Gag>Aag	p.E119K	GJB6_ENST00000400065.3_Missense_Mutation_p.E119K|GJB6_ENST00000400066.3_Missense_Mutation_p.E119K|GJB6_ENST00000241124.6_Missense_Mutation_p.E119K	NM_001110219.2	NP_001103689.1	O95452	CXB6_HUMAN	gap junction protein, beta 6, 30kDa	119					apoptotic process (GO:0006915)|cell communication (GO:0007154)|ear morphogenesis (GO:0042471)|inner ear development (GO:0048839)|negative regulation of cell proliferation (GO:0008285)|sensory perception of sound (GO:0007605)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)				biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	9		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		TTAATGTCCTCTATGTCTTTG	0.502																																					p.E119K		Atlas-SNP	.											.	GJB6	33	.	0			c.G355A						.						80.0	69.0	72.0					13																	20797265		2203	4300	6503	SO:0001583	missense	10804	exon4			TGTCCTCTATGTC	AJ005585	CCDS9291.1	13q12	2010-01-06	2007-11-06		ENSG00000121742	ENSG00000121742		"""Ion channels / Gap junction proteins (connexins)"""	4288	protein-coding gene	gene with protein product	"""connexin 30"""	604418	"""ectodermal dysplasia 2, hidrotic (Clouston syndrome)"", ""gap junction protein, beta 6 (connexin 30)"", ""gap junction protein, beta 6"""	DFNA3, ED2		10471490, 8845850	Standard	NM_006783		Approved	EDH, HED, CX30	uc001und.4	O95452	OTTHUMG00000016515	ENST00000356192.6:c.355G>A	chr13.hg19:g.20797265C>T	ENSP00000348521:p.Glu119Lys	84.0	0.0		51.0	4.0	NM_001110220	B3KQN2|Q5Q1H9|Q5Q1I0|Q5Q1I1|Q5T5U0|Q8IUP0	Missense_Mutation	SNP	ENST00000356192.6	hg19	CCDS9291.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.388609	0.25118	.	.	ENSG00000121742	ENST00000241124;ENST00000400065;ENST00000400066;ENST00000356192	D;D;D;D	0.97642	-4.47;-4.47;-4.47;-4.47	5.28	5.28	0.74379	.	0.268407	0.31010	N	0.008429	D	0.95950	0.8681	L	0.55103	1.725	0.53005	D	0.999965	P	0.35456	0.502	B	0.39419	0.299	D	0.94993	0.8136	10	0.24483	T	0.36	.	18.9412	0.92605	0.0:1.0:0.0:0.0	.	119	O95452	CXB6_HUMAN	K	119	ENSP00000241124:E119K;ENSP00000382938:E119K;ENSP00000382939:E119K;ENSP00000348521:E119K	ENSP00000241124:E119K	E	-	1	0	GJB6	19695265	0.991000	0.36638	0.716000	0.30569	0.104000	0.19210	3.052000	0.49893	2.450000	0.82876	0.655000	0.94253	GAG	.	.		0.502	GJB6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272906.1		
XPO4	64328	hgsc.bcm.edu	37	13	21442811	21442811	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:21442811T>C	ENST00000255305.6	-	2	170	c.99A>G	c.(97-99)caA>caG	p.Q33Q	XPO4_ENST00000490513.1_5'UTR|XPO4_ENST00000400602.2_Silent_p.Q33Q			Q9C0E2	XPO4_HUMAN	exportin 4	33					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		CATGCTGGCGTTGTTCATTAT	0.323																																					p.Q33Q		Atlas-SNP	.											.	XPO4	153	.	0			c.A99G						.						158.0	151.0	153.0					13																	21442811		1914	4127	6041	SO:0001819	synonymous_variant	64328	exon2			CTGGCGTTGTTCA	AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.99A>G	chr13.hg19:g.21442811T>C		71.0	0.0		102.0	5.0	NM_022459	Q5VUZ5|Q8N3V6|Q9H934	Silent	SNP	ENST00000255305.6	hg19	CCDS41872.1																																																																																			.	.		0.323	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044096.1	NM_022459	
NBEA	26960	hgsc.bcm.edu	37	13	35756614	35756614	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:35756614A>G	ENST00000400445.3	+	29	5314	c.4780A>G	c.(4780-4782)Agc>Ggc	p.S1594G	NBEA_ENST00000540320.1_Missense_Mutation_p.S1594G|NBEA_ENST00000379939.2_Missense_Mutation_p.S1591G|NBEA_ENST00000310336.4_Missense_Mutation_p.S1594G	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1594					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AAGAACTGGAAGCCAACCAGG	0.378																																					p.S1594G		Atlas-SNP	.											.	NBEA	340	.	0			c.A4780G						.						124.0	115.0	118.0					13																	35756614		1838	4086	5924	SO:0001583	missense	26960	exon29			ACTGGAAGCCAAC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4780A>G	chr13.hg19:g.35756614A>G	ENSP00000383295:p.Ser1594Gly	126.0	0.0		87.0	4.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.823753	0.50739	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.11	3.93	0.45458	.	0.161285	0.56097	N	0.000033	T	0.38401	0.1039	L	0.29908	0.895	0.80722	D	1	B;B	0.25441	0.035;0.126	B;B	0.21546	0.018;0.035	T	0.15009	-1.0452	10	0.33141	T	0.24	.	10.796	0.46461	0.9258:0.0:0.0742:0.0	.	1594;1591	Q8NFP9;Q5T321	NBEA_HUMAN;.	G	1594;1594;1591;1594;253	ENSP00000440951:S1594G;ENSP00000383295:S1594G;ENSP00000369271:S1591G;ENSP00000308534:S1594G	ENSP00000308534:S1594G	S	+	1	0	NBEA	34654614	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	5.947000	0.70242	0.969000	0.38237	0.383000	0.25322	AGC	.	.		0.378	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
STOML3	161003	hgsc.bcm.edu	37	13	39542653	39542653	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:39542653T>C	ENST00000379631.4	-	6	879	c.535A>G	c.(535-537)Acc>Gcc	p.T179A	STOML3_ENST00000423210.1_Missense_Mutation_p.T170A	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	179					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		CACAGTTCGGTGGCATCATCA	0.463																																					p.T179A		Atlas-SNP	.											.	STOML3	47	.	0			c.A535G						.						79.0	82.0	81.0					13																	39542653		2203	4300	6503	SO:0001583	missense	161003	exon6			GTTCGGTGGCATC	BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.535A>G	chr13.hg19:g.39542653T>C	ENSP00000368952:p.Thr179Ala	96.0	0.0		50.0	4.0	NM_145286	B4E285|Q5JS35	Missense_Mutation	SNP	ENST00000379631.4	hg19	CCDS9367.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.039303	0.75617	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	D;D	0.93811	-3.29;-3.29	5.68	5.68	0.88126	Band 7/stomatin-like, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.96175	0.8753	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.96539	0.9399	10	0.72032	D	0.01	-21.4531	14.7487	0.69508	0.0:0.0:0.0:1.0	.	170;179	B4E285;Q8TAV4	.;STML3_HUMAN	A	179;170	ENSP00000368952:T179A;ENSP00000401989:T170A	ENSP00000368952:T179A	T	-	1	0	STOML3	38440653	1.000000	0.71417	0.997000	0.53966	0.520000	0.34377	5.980000	0.70516	2.165000	0.68154	0.533000	0.62120	ACC	.	.		0.463	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044604.2		
SLC25A30	253512	hgsc.bcm.edu	37	13	45973083	45973083	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:45973083A>G	ENST00000539591.1	-	7	755	c.592T>C	c.(592-594)Ttg>Ctg	p.L198L				Q5SVS4	KMCP1_HUMAN	solute carrier family 25, member 30	249					mitochondrial transport (GO:0006839)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)		ACCTGTAACAAGCAATCCAGG	0.408																																					p.L249L		Atlas-SNP	.											.	SLC25A30	24	.	0			c.T745C						.						123.0	102.0	109.0					13																	45973083		2203	4300	6503	SO:0001819	synonymous_variant	253512	exon8			GTAACAAGCAATC	AK074457	CCDS31967.1, CCDS66539.1	13q14	2013-05-22			ENSG00000174032	ENSG00000174032		"""Solute carriers"""	27371	protein-coding gene	gene with protein product		610793					Standard	XM_005266321		Approved		uc001vag.3	Q5SVS4	OTTHUMG00000016853	ENST00000539591.1:c.592T>C	chr13.hg19:g.45973083A>G		116.0	0.0		61.0	4.0	NM_001010875	B2RN96|B4DZK3|F5H8H8	Silent	SNP	ENST00000539591.1	hg19																																																																																				.	.		0.408	SLC25A30-201	KNOWN	basic	protein_coding	protein_coding		XM_170736	
WDFY2	115825	hgsc.bcm.edu	37	13	52301856	52301856	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:52301856A>G	ENST00000298125.5	+	6	708	c.528A>G	c.(526-528)tcA>tcG	p.S176S		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	176							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		GTGACCACTCAGGCCAAGTAA	0.403																																					p.S176S		Atlas-SNP	.											.	WDFY2	36	.	0			c.A528G						.						143.0	127.0	133.0					13																	52301856		2203	4300	6503	SO:0001819	synonymous_variant	115825	exon6			CCACTCAGGCCAA	AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.528A>G	chr13.hg19:g.52301856A>G		101.0	0.0		99.0	4.0	NM_052950	B1AL86|Q96CS1	Silent	SNP	ENST00000298125.5	hg19	CCDS9429.1																																																																																			.	.		0.403	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045985.3	NM_052950	
BORA	79866	hgsc.bcm.edu	37	13	73320191	73320191	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:73320191A>G	ENST00000390667.5	+	9	945	c.848A>G	c.(847-849)cAg>cGg	p.Q283R	BORA_ENST00000377815.3_Missense_Mutation_p.Q213R	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator	283					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)	p.Q283R(1)									ATTGAATTTCAGATAGGAGAG	0.348																																					p.Q283R		Atlas-SNP	.											C13orf34,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	lung(1)	c.A848G						.						116.0	109.0	111.0					13																	73320191		1810	4073	5883	SO:0001583	missense	79866	exon9			AATTTCAGATAGG	BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.848A>G	chr13.hg19:g.73320191A>G	ENSP00000375082:p.Gln283Arg	137.0	0.0		91.0	5.0	NM_024808	B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Missense_Mutation	SNP	ENST00000390667.5	hg19	CCDS9446.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.893912	0.33442	.	.	ENSG00000136122	ENST00000377815;ENST00000390667	T;T	0.33216	1.42;1.43	5.69	5.69	0.88448	.	0.424023	0.28317	N	0.015781	T	0.49029	0.1533	M	0.62723	1.935	0.39911	D	0.97403	D;P;D;P	0.60575	0.988;0.902;0.988;0.902	P;P;P;P	0.57960	0.778;0.52;0.83;0.52	T	0.52487	-0.8569	10	0.59425	D	0.04	-6.1825	15.9518	0.79846	1.0:0.0:0.0:0.0	.	213;283;343;283	B4DQ30;A8K631;B5LMG6;Q6PGQ7	.;.;.;BORA_HUMAN	R	213;283	ENSP00000367046:Q213R;ENSP00000375082:Q283R	ENSP00000367046:Q213R	Q	+	2	0	BORA	72218192	1.000000	0.71417	0.911000	0.35937	0.150000	0.21749	6.748000	0.74877	2.180000	0.69256	0.533000	0.62120	CAG	.	.		0.348	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045245.3	NM_024808	
PIBF1	10464	hgsc.bcm.edu	37	13	73366611	73366611	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:73366611T>C	ENST00000326291.6	+	3	617	c.279T>C	c.(277-279)aaT>aaC	p.N93N		NM_006346.2	NP_006337.2	Q8WXW3	PIBF1_HUMAN	progesterone immunomodulatory binding factor 1	93						centrosome (GO:0005813)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		AGAAACTTAATGATGCACTTC	0.284																																					p.N93N		Atlas-SNP	.											.	PIBF1	65	.	0			c.T279C						.						57.0	63.0	61.0					13																	73366611		2203	4297	6500	SO:0001819	synonymous_variant	10464	exon3			ACTTAATGATGCA	AF330046	CCDS31991.1	13q21.33	2014-02-20	2007-10-17	2007-10-17	ENSG00000083535	ENSG00000083535			23352	protein-coding gene	gene with protein product	"""progesterone-induced blocking factor 1"""	607532	"""chromosome 13 open reading frame 24"""	C13orf24		11935316	Standard	NM_006346		Approved	CEP90	uc001vjc.3	Q8WXW3	OTTHUMG00000017071	ENST00000326291.6:c.279T>C	chr13.hg19:g.73366611T>C		138.0	0.0		95.0	4.0	NM_006346	O95664|Q6U9V2|Q6UG50|Q86V07|Q96SF4	Silent	SNP	ENST00000326291.6	hg19	CCDS31991.1																																																																																			.	.		0.284	PIBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045255.1	NM_006346	
SCEL	8796	hgsc.bcm.edu	37	13	78176797	78176797	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:78176797A>G	ENST00000349847.3	+	17	1070	c.986A>G	c.(985-987)aAt>aGt	p.N329S	SCEL_ENST00000377246.3_Missense_Mutation_p.N309S|SCEL_ENST00000535157.1_Missense_Mutation_p.N307S|SCEL-AS1_ENST00000457528.2_RNA|SCEL_ENST00000469982.1_Intron|SCEL-AS1_ENST00000456280.2_RNA	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	329	16 X approximate tandem repeats.				embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		AGAAGACAAAATCTCGAATCT	0.348																																					p.N329S		Atlas-SNP	.											.	SCEL	85	.	0			c.A986G						.						132.0	140.0	137.0					13																	78176797		2203	4300	6503	SO:0001583	missense	8796	exon17			GACAAAATCTCGA	AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.986A>G	chr13.hg19:g.78176797A>G	ENSP00000302579:p.Asn329Ser	118.0	0.0		94.0	4.0	NM_144777	B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	ENST00000349847.3	hg19	CCDS9459.1	.	.	.	.	.	.	.	.	.	.	A	14.06	2.423341	0.43020	.	.	ENSG00000136155	ENST00000535157;ENST00000377246;ENST00000349847	T;T;T	0.21734	1.99;1.99;1.99	3.93	2.74	0.32292	.	0.298408	0.23716	N	0.045279	T	0.09818	0.0241	N	0.08118	0	0.21020	N	0.999803	B;B;B	0.12013	0.004;0.004;0.005	B;B;B	0.15484	0.013;0.007;0.01	T	0.21177	-1.0253	10	0.66056	D	0.02	-6.007	6.0949	0.20015	0.8805:0.0:0.1195:0.0	.	307;309;329	F5H651;O95171-2;O95171	.;.;SCEL_HUMAN	S	307;309;329	ENSP00000437895:N307S;ENSP00000366454:N309S;ENSP00000302579:N329S	ENSP00000302579:N329S	N	+	2	0	SCEL	77074798	0.228000	0.23718	0.924000	0.36721	0.474000	0.32979	1.191000	0.32138	0.679000	0.31345	0.533000	0.62120	AAT	.	.		0.348	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045339.2	NM_144777	
DOCK9	23348	hgsc.bcm.edu	37	13	99537983	99537983	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:99537983T>C	ENST00000376460.1	-	20	2319	c.2239A>G	c.(2239-2241)Agg>Ggg	p.R747G	DOCK9_ENST00000339416.2_Missense_Mutation_p.R748G|DOCK9_ENST00000448493.2_Missense_Mutation_p.R759G|DOCK9_ENST00000442173.1_Missense_Mutation_p.R747G	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	748	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ACGACATCCCTCTTCTTCGTG	0.398																																					p.R748G		Atlas-SNP	.											.	DOCK9	311	.	0			c.A2242G						.						120.0	123.0	122.0					13																	99537983		1881	4112	5993	SO:0001583	missense	23348	exon20			CATCCCTCTTCTT	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2239A>G	chr13.hg19:g.99537983T>C	ENSP00000365643:p.Arg747Gly	122.0	0.0		100.0	4.0	NM_001130049	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	hg19	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	T	17.00	3.275942	0.59649	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.19938	2.43;2.52;2.11;2.13	6.03	6.03	0.97812	.	0.091405	0.64402	D	0.000001	T	0.17238	0.0414	N	0.17082	0.46	0.42605	D	0.993296	B;B;B;B;B	0.33940	0.14;0.433;0.004;0.0;0.037	B;B;B;B;B	0.35353	0.099;0.201;0.016;0.001;0.099	T	0.05666	-1.0871	10	0.62326	D	0.03	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	748;747;747;747;748	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	G	747;748;748;748;747;748;759;747	ENSP00000365643:R747G;ENSP00000341086:R748G;ENSP00000401958:R759G;ENSP00000406883:R747G	ENSP00000341086:R748G	R	-	1	2	DOCK9	98335984	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.675000	0.61619	2.308000	0.77769	0.533000	0.62120	AGG	.	.		0.398	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
GPR183	1880	hgsc.bcm.edu	37	13	99947814	99947814	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:99947814T>C	ENST00000376414.4	-	2	669	c.586A>G	c.(586-588)Att>Gtt	p.I196V	UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	196					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)			cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						CCAAGCAGAATCCAGGGAAGA	0.423																																					p.I196V		Atlas-SNP	.											.	GPR183	38	.	0			c.A586G						.						81.0	79.0	80.0					13																	99947814		2203	4300	6503	SO:0001583	missense	1880	exon2			GCAGAATCCAGGG	L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.586A>G	chr13.hg19:g.99947814T>C	ENSP00000365596:p.Ile196Val	180.0	0.0		144.0	6.0	NM_004951	B2R8N5|Q53F99|Q5JUH7	Missense_Mutation	SNP	ENST00000376414.4	hg19	CCDS9492.1	.	.	.	.	.	.	.	.	.	.	T	8.742	0.919164	0.17982	.	.	ENSG00000169508	ENST00000376414	T	0.36520	1.25	5.76	5.76	0.90799	GPCR, rhodopsin-like superfamily (1);	0.150199	0.64402	D	0.000016	T	0.21347	0.0514	N	0.05351	-0.065	0.39609	D	0.969853	B	0.23854	0.092	B	0.24541	0.054	T	0.12863	-1.0531	9	.	.	.	.	16.0843	0.81031	0.0:0.0:0.0:1.0	.	196	P32249	GP183_HUMAN	V	196	ENSP00000365596:I196V	.	I	-	1	0	GPR183	98745815	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.896000	0.56266	2.191000	0.70037	0.533000	0.62120	ATT	.	.		0.423	GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045582.2	NM_004951	
ANKRD10	55608	hgsc.bcm.edu	37	13	111532117	111532117	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:111532117T>C	ENST00000267339.2	-	6	1264	c.1130A>G	c.(1129-1131)tAc>tGc	p.Y377C	ANKRD10_ENST00000375758.5_3'UTR	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	377										central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			AAACCCGTGGTAGTGTCCATA	0.552																																					p.Y377C		Atlas-SNP	.											.	ANKRD10	24	.	0			c.A1130G						.						152.0	110.0	124.0					13																	111532117		2203	4300	6503	SO:0001583	missense	55608	exon6			CCGTGGTAGTGTC	AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.1130A>G	chr13.hg19:g.111532117T>C	ENSP00000267339:p.Tyr377Cys	80.0	0.0		77.0	4.0	NM_017664	Q5VW12|Q9BV12	Missense_Mutation	SNP	ENST00000267339.2	hg19	CCDS9520.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.050857	0.75960	.	.	ENSG00000088448	ENST00000267339	T	0.79749	-1.3	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.89019	0.6596	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.90405	0.4405	10	0.87932	D	0	-22.7768	15.4534	0.75294	0.0:0.0:0.0:1.0	.	377	Q9NXR5	ANR10_HUMAN	C	377	ENSP00000267339:Y377C	ENSP00000267339:Y377C	Y	-	2	0	ANKRD10	110330118	1.000000	0.71417	0.990000	0.47175	0.913000	0.54294	5.954000	0.70298	2.051000	0.60960	0.528000	0.53228	TAC	.	.		0.552	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045783.1		
MCF2L	23263	hgsc.bcm.edu	37	13	113739231	113739231	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr13:113739231A>G	ENST00000375608.3	+	20	2235	c.2177A>G	c.(2176-2178)aAg>aGg	p.K726R	MCF2L_ENST00000375604.2_Missense_Mutation_p.K753R|MCF2L_ENST00000423482.2_Missense_Mutation_p.K694R|MCF2L_ENST00000442652.2_Missense_Mutation_p.K726R|MCF2L_ENST00000535094.2_Missense_Mutation_p.K696R|MCF2L_ENST00000375601.3_Missense_Mutation_p.K700R|MCF2L_ENST00000397030.1_Missense_Mutation_p.K729R|MCF2L_ENST00000421756.1_Missense_Mutation_p.K700R|MCF2L_ENST00000375597.4_Missense_Mutation_p.K694R|MCF2L_ENST00000434480.2_Missense_Mutation_p.K702R			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	726	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				ATCTATGAGAAGTACTGTCAG	0.582																																					p.K696R		Atlas-SNP	.											.	MCF2L	182	.	0			c.A2087G						.						128.0	122.0	124.0					13																	113739231		2203	4300	6503	SO:0001583	missense	23263	exon19			ATGAGAAGTACTG	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.2177A>G	chr13.hg19:g.113739231A>G	ENSP00000364758:p.Lys726Arg	123.0	0.0		81.0	4.0	NM_001112732	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	hg19		.	.	.	.	.	.	.	.	.	.	A	21.3	4.128925	0.77549	.	.	ENSG00000126217	ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000375597;ENST00000440749	T;T;T;T;T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	4.64	4.64	0.57946	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.69975	0.3171	L	0.41356	1.27	0.51012	D	0.9999	P;P;D;D;P;P	0.69078	0.869;0.722;0.997;0.997;0.515;0.892	P;P;D;D;P;P	0.71656	0.605;0.605;0.951;0.974;0.505;0.813	T	0.69840	-0.5036	10	0.40728	T	0.16	.	14.1203	0.65182	1.0:0.0:0.0:0.0	.	694;696;753;658;694;726	E9PDN8;O15068-9;G5E9A1;E2QRA2;O15068-4;O15068	.;.;.;.;.;MCF2L_HUMAN	R	726;726;753;729;696;700;700;702;694;694;537	ENSP00000364758:K726R;ENSP00000401422:K726R;ENSP00000364754:K753R;ENSP00000380225:K729R;ENSP00000440374:K696R;ENSP00000397285:K700R;ENSP00000364751:K700R;ENSP00000407722:K702R;ENSP00000405639:K694R;ENSP00000364747:K694R	ENSP00000364747:K694R	K	+	2	0	MCF2L	112787232	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	4.960000	0.63673	1.732000	0.51606	0.248000	0.18094	AAG	.	.		0.582	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
SYNE2	23224	hgsc.bcm.edu	37	14	64600817	64600817	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:64600817T>C	ENST00000344113.4	+	78	14757	c.14545T>C	c.(14545-14547)Tct>Cct	p.S4849P	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.S1234P|SYNE2_ENST00000394768.2_Missense_Mutation_p.S1234P|SYNE2_ENST00000554584.1_Missense_Mutation_p.S4766P|SYNE2_ENST00000555002.1_Missense_Mutation_p.S1483P|SYNE2_ENST00000358025.3_Missense_Mutation_p.S4849P	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4849					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAACTATGCATCTCTTGAAAA	0.353																																					p.S4849P		Atlas-SNP	.											.	SYNE2	577	.	0			c.T14545C						.						131.0	135.0	133.0					14																	64600817		2203	4300	6503	SO:0001583	missense	23224	exon78			TATGCATCTCTTG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14545T>C	chr14.hg19:g.64600817T>C	ENSP00000341781:p.Ser4849Pro	142.0	0.0		75.0	4.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.485329	0.26598	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.58506	0.68;3.99;0.68;0.33;4.04;3.99	5.95	3.47	0.39725	.	0.406135	0.21002	N	0.081843	T	0.59636	0.2208	M	0.64997	1.995	0.19775	N	0.999958	P;P;D	0.56287	0.942;0.891;0.975	P;B;P	0.53450	0.708;0.37;0.726	T	0.53330	-0.8454	10	0.49607	T	0.09	.	3.582	0.07957	0.1214:0.0694:0.2811:0.5281	.	1234;4849;4849	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	P	4849;1234;4849;4766;4766;1483;1234	ENSP00000350719:S4849P;ENSP00000349969:S1234P;ENSP00000341781:S4849P;ENSP00000452570:S4766P;ENSP00000450831:S1483P;ENSP00000378249:S1234P	ENSP00000261678:S4766P	S	+	1	0	SYNE2	63670570	0.011000	0.17503	0.983000	0.44433	0.997000	0.91878	0.600000	0.24104	0.431000	0.26258	0.459000	0.35465	TCT	.	.		0.353	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
ESR2	2100	hgsc.bcm.edu	37	14	64727316	64727316	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:64727316A>G	ENST00000341099.4	-	5	1220	c.803T>C	c.(802-804)cTa>cCa	p.L268P	ESR2_ENST00000542956.1_Missense_Mutation_p.L268P|ESR2_ENST00000353772.3_Missense_Mutation_p.L268P|ESR2_ENST00000358599.5_Missense_Mutation_p.L268P|ESR2_ENST00000555483.1_5'UTR|ESR2_ENST00000554572.1_Missense_Mutation_p.L268P|ESR2_ENST00000555278.1_Missense_Mutation_p.L268P|ESR2_ENST00000553796.1_Missense_Mutation_p.L268P|ESR2_ENST00000557772.1_Missense_Mutation_p.L268P|ESR2_ENST00000267525.6_Missense_Mutation_p.L268P|ESR2_ENST00000357782.2_Missense_Mutation_p.L268P	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	268	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	GGTGAGCACTAGCTGCTCGGG	0.682																																					p.L268P		Atlas-SNP	.											.	ESR2	82	.	0			c.T803C						.						35.0	37.0	36.0					14																	64727316		2203	4299	6502	SO:0001583	missense	2100	exon4			AGCACTAGCTGCT	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.803T>C	chr14.hg19:g.64727316A>G	ENSP00000343925:p.Leu268Pro	170.0	0.0		94.0	4.0	NM_001214902	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	ENST00000341099.4	hg19	CCDS9762.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.074584	0.76415	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;T	0.91996	-2.93;-2.86;-2.86;-2.86;-2.86;-2.95;-2.93;-2.95;-2.93;-2.76;0.4	5.74	5.74	0.90152	Nuclear hormone receptor, ligand-binding (2);	0.177454	0.50627	D	0.000118	D	0.96374	0.8817	M	0.84433	2.695	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.993;0.996;0.999;0.999;0.996	D	0.96973	0.9710	10	0.87932	D	0	.	16.0363	0.80631	1.0:0.0:0.0:0.0	.	268;268;268;268;268	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	P	268	ENSP00000452485:L268P;ENSP00000441792:L268P;ENSP00000450699:L268P;ENSP00000335551:L268P;ENSP00000351412:L268P;ENSP00000450488:L268P;ENSP00000452426:L268P;ENSP00000350427:L268P;ENSP00000451582:L268P;ENSP00000343925:L268P;ENSP00000267525:L268P	ENSP00000267525:L268P	L	-	2	0	ESR2	63797069	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	5.987000	0.70571	2.193000	0.70182	0.460000	0.39030	CTA	.	.		0.682	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280621.1		
NEK9	91754	hgsc.bcm.edu	37	14	75563856	75563856	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:75563856A>G	ENST00000238616.5	-	17	2278	c.2120T>C	c.(2119-2121)cTg>cCg	p.L707P		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	707					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		GACATGATGCAGAGATCCAAA	0.527																																					p.L707P		Atlas-SNP	.											.	NEK9	64	.	0			c.T2120C						.						90.0	78.0	82.0					14																	75563856		2203	4300	6503	SO:0001583	missense	91754	exon17			TGATGCAGAGATC	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.2120T>C	chr14.hg19:g.75563856A>G	ENSP00000238616:p.Leu707Pro	89.0	0.0		68.0	4.0	NM_033116	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	ENST00000238616.5	hg19	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.592777	0.86953	.	.	ENSG00000119638	ENST00000238616	T	0.80824	-1.42	5.72	5.72	0.89469	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.84092	0.5396	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.995;0.999	D	0.83543	0.0097	10	0.36615	T	0.2	.	16.3035	0.82836	1.0:0.0:0.0:0.0	.	707;50	Q8TD19;Q6PKF2	NEK9_HUMAN;.	P	707	ENSP00000238616:L707P	ENSP00000238616:L707P	L	-	2	0	NEK9	74633609	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.287000	0.95975	2.299000	0.77371	0.528000	0.53228	CTG	.	.		0.527	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116	
SPATA7	55812	hgsc.bcm.edu	37	14	88899513	88899513	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:88899513G>A	ENST00000393545.4	+	10	1406	c.1117G>A	c.(1117-1119)Gat>Aat	p.D373N	SPATA7_ENST00000356583.5_Missense_Mutation_p.D341N|SPATA7_ENST00000045347.7_Missense_Mutation_p.D373N|SPATA7_ENST00000556553.1_Missense_Mutation_p.D341N	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	373					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						TTTCATTGAAGATGTAACAGA	0.269																																					p.D373N		Atlas-SNP	.											SPATA7,NS,carcinoma,0,1	SPATA7	58	.	0			c.G1117A						.						82.0	84.0	83.0					14																	88899513		2199	4272	6471	SO:0001583	missense	55812	exon10			ATTGAAGATGTAA	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.1117G>A	chr14.hg19:g.88899513G>A	ENSP00000377176:p.Asp373Asn	60.0	0.0		40.0	2.0	NM_018418	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	hg19	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	G	14.50	2.553794	0.45487	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000045347;ENST00000554802	T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75	5.08	4.18	0.49190	.	0.208574	0.40144	N	0.001162	T	0.20981	0.0505	L	0.33245	0.995	0.34791	D	0.735754	B;B;B;B	0.33448	0.412;0.412;0.385;0.197	B;B;B;B	0.35688	0.119;0.192;0.208;0.119	T	0.28459	-1.0043	10	0.35671	T	0.21	-9.0797	11.8403	0.52350	0.0885:0.0:0.9115:0.0	.	373;341;341;373	Q9P0W8-3;A8K3L6;Q9P0W8-2;Q9P0W8	.;.;.;SPAT7_HUMAN	N	341;373;341;373;5	ENSP00000451128:D341N;ENSP00000377176:D373N;ENSP00000348991:D341N;ENSP00000045347:D373N;ENSP00000451019:D5N	ENSP00000045347:D373N	D	+	1	0	SPATA7	87969266	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	3.475000	0.53136	1.241000	0.43820	0.591000	0.81541	GAT	.	.		0.269	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
UNC79	57578	hgsc.bcm.edu	37	14	94155183	94155183	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:94155183A>G	ENST00000393151.2	+	45	7199	c.7199A>G	c.(7198-7200)cAa>cGa	p.Q2400R	UNC79_ENST00000256339.4_Missense_Mutation_p.Q2223R|UNC79_ENST00000555664.1_Missense_Mutation_p.Q2361R|UNC79_ENST00000553484.1_Missense_Mutation_p.Q2422R			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2400					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GCAATGCAGCAAGGGTAAGAC	0.517																																					p.Q2223R		Atlas-SNP	.											.	UNC79	366	.	0			c.A6668G						.						88.0	78.0	81.0					14																	94155183		2203	4300	6503	SO:0001583	missense	57578	exon45			TGCAGCAAGGGTA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7199A>G	chr14.hg19:g.94155183A>G	ENSP00000376858:p.Gln2400Arg	122.0	0.0		77.0	5.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	A	25.8	4.670953	0.88348	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.19806	2.12;2.14;2.12;2.12	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.43656	0.1257	L	0.61218	1.895	0.58432	D	0.999999	D	0.60575	0.988	D	0.65874	0.939	T	0.33777	-0.9855	10	0.72032	D	0.01	-10.5258	16.1082	0.81241	1.0:0.0:0.0:0.0	.	2422	C9JQL1	.	R	2223;2361;2422;2400;2422	ENSP00000256339:Q2223R;ENSP00000450868:Q2361R;ENSP00000451360:Q2422R;ENSP00000376858:Q2400R	ENSP00000256339:Q2223R	Q	+	2	0	KIAA1409	93224936	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.263000	0.95617	2.268000	0.75426	0.459000	0.35465	CAA	.	.		0.517	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
UNC79	57578	hgsc.bcm.edu	37	14	94158267	94158267	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:94158267T>C	ENST00000393151.2	+	47	7562	c.7562T>C	c.(7561-7563)cTt>cCt	p.L2521P	UNC79_ENST00000256339.4_Missense_Mutation_p.L2344P|UNC79_ENST00000555664.1_Missense_Mutation_p.L2482P|UNC79_ENST00000553484.1_Missense_Mutation_p.L2543P			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2521					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CCCAGCATCCTTCAGCTAATG	0.473																																					p.L2344P		Atlas-SNP	.											.	UNC79	366	.	0			c.T7031C						.						132.0	121.0	124.0					14																	94158267		2203	4300	6503	SO:0001583	missense	57578	exon47			GCATCCTTCAGCT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7562T>C	chr14.hg19:g.94158267T>C	ENSP00000376858:p.Leu2521Pro	159.0	0.0		72.0	4.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	T	23.7	4.446465	0.84101	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.56776	0.46;0.52;0.44;0.46	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.73079	0.3541	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76526	-0.2927	10	0.87932	D	0	-18.2659	16.1668	0.81768	0.0:0.0:0.0:1.0	.	2543	C9JQL1	.	P	2344;2482;2543;2521;2543	ENSP00000256339:L2344P;ENSP00000450868:L2482P;ENSP00000451360:L2543P;ENSP00000376858:L2521P	ENSP00000256339:L2344P	L	+	2	0	KIAA1409	93228020	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.040000	0.89188	2.210000	0.71456	0.533000	0.62120	CTT	.	.		0.473	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
SERPINA6	866	hgsc.bcm.edu	37	14	94776279	94776279	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:94776279T>C	ENST00000341584.3	-	3	824	c.678A>G	c.(676-678)acA>acG	p.T226T		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	226					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	TCACCACAGTTGTCTCGTCCA	0.557																																					p.T226T		Atlas-SNP	.											.	SERPINA6	102	.	0			c.A678G						.						131.0	102.0	112.0					14																	94776279		2203	4300	6503	SO:0001819	synonymous_variant	866	exon3			CACAGTTGTCTCG	J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.678A>G	chr14.hg19:g.94776279T>C		126.0	0.0		76.0	4.0	NM_001756	A8K456|Q7Z2Q9	Silent	SNP	ENST00000341584.3	hg19	CCDS9924.1																																																																																			.	.		0.557	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1	NM_001756	
PPP2R5C	5527	hgsc.bcm.edu	37	14	102252487	102252487	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:102252487A>G	ENST00000328724.5	+	3	235	c.226A>G	c.(226-228)Aat>Gat	p.N76D	PPP2R5C_ENST00000556068.1_3'UTR|PPP2R5C_ENST00000422945.2_Intron|PPP2R5C_ENST00000554442.1_Missense_Mutation_p.N76D	NM_001161726.1	NP_001155198.1	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	19					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CGCAAGCAATAATAGAGAACT	0.353																																					p.N76D		Atlas-SNP	.											.	PPP2R5C	74	.	0			c.A226G						.						37.0	32.0	33.0					14																	102252487		1563	3574	5137	SO:0001583	missense	5527	exon3			AGCAATAATAGAG	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000328724.5:c.226A>G	chr14.hg19:g.102252487A>G	ENSP00000329009:p.Asn76Asp	178.0	0.0		100.0	4.0	NM_001161726	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	ENST00000328724.5	hg19	CCDS53911.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.167986	0.78339	.	.	ENSG00000078304	ENST00000554442;ENST00000328724	T	0.45276	0.9	5.25	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.23330	0.0564	.	.	.	0.80722	D	1	B;P	0.40619	0.021;0.724	B;B	0.35470	0.029;0.203	T	0.03403	-1.1040	9	0.11182	T	0.66	-16.9017	9.9581	0.41680	0.9185:0.0:0.0815:0.0	.	76;76	Q6ZN33;G3V292	.;.	D	76	ENSP00000329009:N76D	ENSP00000329009:N76D	N	+	1	0	PPP2R5C	101322240	1.000000	0.71417	0.981000	0.43875	0.979000	0.70002	5.067000	0.64357	0.841000	0.35020	0.459000	0.35465	AAT	.	.		0.353	PPP2R5C-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414362.1	NM_002719	
TRMT61A	115708	hgsc.bcm.edu	37	14	103999139	103999139	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:103999139A>G	ENST00000389749.4	+	3	659	c.552A>G	c.(550-552)tcA>tcG	p.S184S		NM_152307.2	NP_689520.2	Q96FX7	TRM61_HUMAN	tRNA methyltransferase 61 homolog A (S. cerevisiae)	184						nucleus (GO:0005634)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			skin(1)	1						ACATCCCATCACCCTGGGAGG	0.697																																					p.S184S		Atlas-SNP	.											.	TRMT61A	15	.	0			c.A552G						.						17.0	22.0	20.0					14																	103999139		2030	4165	6195	SO:0001819	synonymous_variant	115708	exon3			CCCATCACCCTGG	AK097771	CCDS41994.1	14q32	2009-01-09	2009-01-09	2009-01-09		ENSG00000166166			23790	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 172"""	C14orf172		16043508	Standard	NM_152307		Approved	FLJ40452, GCD14, Gcd14p, hTRM61	uc010aws.3	Q96FX7		ENST00000389749.4:c.552A>G	chr14.hg19:g.103999139A>G		180.0	0.0		98.0	4.0	NM_152307	A6NN78|Q8N7Q9	Silent	SNP	ENST00000389749.4	hg19	CCDS41994.1	.	.	.	.	.	.	.	.	.	.	A	1.890	-0.455669	0.04540	.	.	ENSG00000166166	ENST00000299202	.	.	.	5.1	-6.64	0.01801	.	.	.	.	.	T	0.34366	0.0895	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41805	-0.9488	4	.	.	.	-4.2072	0.6469	0.00819	0.3398:0.2493:0.2204:0.1906	.	.	.	.	R	86	.	.	H	+	2	0	TRMT61A	103068892	0.001000	0.12720	0.833000	0.33012	0.005000	0.04900	-1.636000	0.02016	-1.031000	0.03308	-0.648000	0.03929	CAC	.	.		0.697	TRMT61A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414988.1	NM_152307	
NDN	4692	hgsc.bcm.edu	37	15	23931946	23931946	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:23931946A>G	ENST00000331837.4	-	1	504	c.419T>C	c.(418-420)cTc>cCc	p.L140P		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	140	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GGTGCGCCGGAGGATGCTCCT	0.582									Prader-Willi syndrome																												p.L140P		Atlas-SNP	.											.	NDN	79	.	0			c.T419C						.						61.0	59.0	60.0					15																	23931946		2203	4300	6503	SO:0001583	missense	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	CGCCGGAGGATGC	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.419T>C	chr15.hg19:g.23931946A>G	ENSP00000332643:p.Leu140Pro	91.0	0.0		94.0	4.0	NM_002487	B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	hg19	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.707947	0.48412	.	.	ENSG00000182636	ENST00000331837	T	0.06768	3.26	3.87	2.76	0.32466	.	0.346719	0.29314	N	0.012519	T	0.21307	0.0513	M	0.72118	2.19	0.45747	D	0.99864	D	0.76494	0.999	D	0.75484	0.986	T	0.00812	-1.1556	10	0.72032	D	0.01	.	5.1451	0.14981	0.87:0.0:0.13:0.0	.	140	Q99608	NECD_HUMAN	P	140	ENSP00000332643:L140P	ENSP00000332643:L140P	L	-	2	0	NDN	21483039	0.995000	0.38212	0.519000	0.27824	0.887000	0.51463	2.471000	0.45127	1.717000	0.51406	0.459000	0.35465	CTC	.	.		0.582	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
FMN1	342184	hgsc.bcm.edu	37	15	33194132	33194132	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:33194132T>C	ENST00000559047.1	-	10	3486	c.3487A>G	c.(3487-3489)Atc>Gtc	p.I1163V	FMN1_ENST00000561249.1_Missense_Mutation_p.I1065V|FMN1_ENST00000334528.9_Missense_Mutation_p.I940V			Q68DA7	FMN1_HUMAN	formin 1	1163	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CGCGTGATGATCTCTACCTTT	0.418																																					p.I940V		Atlas-SNP	.											.	FMN1	174	.	0			c.A2818G						.						100.0	95.0	96.0					15																	33194132		1852	4106	5958	SO:0001583	missense	342184	exon9			TGATGATCTCTAC	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.3487A>G	chr15.hg19:g.33194132T>C	ENSP00000454047:p.Ile1163Val	68.0	0.0		116.0	5.0	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	hg19		.	.	.	.	.	.	.	.	.	.	T	18.40	3.616114	0.66672	.	.	ENSG00000248905	ENST00000334528	T	0.16324	2.35	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.25044	0.0608	L	0.38175	1.15	.	.	.	P	0.36110	0.537	P	0.47251	0.542	T	0.12708	-1.0537	9	0.41790	T	0.15	.	16.2035	0.82105	0.0:0.0:0.0:1.0	.	940	Q68DA7-5	.	V	940	ENSP00000333950:I940V	ENSP00000333950:I940V	I	-	1	0	FMN1	30981424	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.756000	0.62205	2.304000	0.77564	0.528000	0.53228	ATC	.	.		0.418	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
SPRED1	161742	hgsc.bcm.edu	37	15	38643506	38643506	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:38643506A>G	ENST00000299084.4	+	7	1836	c.976A>G	c.(976-978)Aga>Gga	p.R326G		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	326					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GTCAAAACGAAGAAAAGAGGA	0.413									Legius syndrome																												p.R326G	Melanoma(196;2146 2959 7698 16532)	Atlas-SNP	.											.	SPRED1	51	.	0			c.A976G						.						76.0	74.0	75.0					15																	38643506		2200	4297	6497	SO:0001583	missense	161742	exon7	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AAACGAAGAAAAG	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.976A>G	chr15.hg19:g.38643506A>G	ENSP00000299084:p.Arg326Gly	56.0	0.0		98.0	4.0	NM_152594	B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	ENST00000299084.4	hg19	CCDS32193.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.786401	0.49997	.	.	ENSG00000166068	ENST00000299084	D	0.86297	-2.1	6.01	4.83	0.62350	.	0.000000	0.85682	D	0.000000	D	0.85991	0.5826	M	0.72894	2.215	0.49299	D	0.999774	B	0.15719	0.014	B	0.15484	0.013	D	0.84290	0.0499	10	0.66056	D	0.02	-15.946	13.047	0.58933	0.866:0.134:0.0:0.0	.	326	Q7Z699	SPRE1_HUMAN	G	326	ENSP00000299084:R326G	ENSP00000299084:R326G	R	+	1	2	SPRED1	36430798	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.963000	0.56773	2.312000	0.78011	0.514000	0.50259	AGA	.	.		0.413	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1		
KNSTRN	90417	hgsc.bcm.edu	37	15	40678607	40678607	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:40678607T>C	ENST00000249776.8	+	3	464	c.349T>C	c.(349-351)Tcc>Ccc	p.S117P	KNSTRN_ENST00000448395.2_Missense_Mutation_p.S117P|KNSTRN_ENST00000608100.1_Missense_Mutation_p.S39P|KNSTRN_ENST00000416151.2_Missense_Mutation_p.S117P	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein																		ACCTGTTAGGTCCAAAGAAGT	0.453																																					p.S117P		Atlas-SNP	.											.	.	.	.	0			c.T349C						.						86.0	82.0	83.0					15																	40678607		1893	4122	6015	SO:0001583	missense	90417	exon3			GTTAGGTCCAAAG	AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.349T>C	chr15.hg19:g.40678607T>C	ENSP00000249776:p.Ser117Pro	108.0	0.0		183.0	9.0	NM_033286		Missense_Mutation	SNP	ENST00000249776.8	hg19	CCDS42021.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.741170	0.69304	.	.	ENSG00000128944	ENST00000249776;ENST00000416151;ENST00000448395	T;T;T	0.34072	1.39;1.38;1.41	5.15	4.01	0.46588	.	0.716608	0.13766	N	0.364232	T	0.42449	0.1203	L	0.34521	1.04	0.26709	N	0.971015	D;D;D	0.63880	0.993;0.993;0.993	P;P;P	0.61132	0.884;0.884;0.884	T	0.18085	-1.0348	10	0.54805	T	0.06	-3.1168	8.0448	0.30542	0.1804:0.0:0.0:0.8196	.	117;117;117	Q9Y448-2;Q9Y448-3;Q9Y448	.;.;T4AF1_HUMAN	P	117	ENSP00000249776:S117P;ENSP00000391233:S117P;ENSP00000393001:S117P	ENSP00000249776:S117P	S	+	1	0	C15orf23	38465899	0.300000	0.24435	0.994000	0.49952	0.933000	0.57130	1.213000	0.32407	0.957000	0.37930	0.533000	0.62120	TCC	.	.		0.453	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418636.1	NM_001142761	
C15orf43	145645	hgsc.bcm.edu	37	15	45250636	45250636	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:45250636C>T	ENST00000340827.3	+	3	229	c.212C>T	c.(211-213)gCg>gTg	p.A71V		NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	71										NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		TATCTCTCTGCGGTAGCTAAT	0.383																																					p.A71V		Atlas-SNP	.											.	C15orf43	19	.	0			c.C212T						.						95.0	95.0	95.0					15																	45250636		2196	4298	6494	SO:0001583	missense	145645	exon3			TCTCTGCGGTAGC	BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.212C>T	chr15.hg19:g.45250636C>T	ENSP00000340644:p.Ala71Val	117.0	0.0		141.0	73.0	NM_152448		Missense_Mutation	SNP	ENST00000340827.3	hg19	CCDS10115.1	.	.	.	.	.	.	.	.	.	.	c	19.28	3.797020	0.70567	.	.	ENSG00000167014	ENST00000340827	T	0.48522	0.81	4.45	3.53	0.40419	.	0.000000	0.64402	D	0.000014	T	0.30039	0.0752	L	0.29908	0.895	0.34047	D	0.655732	D	0.56287	0.975	B	0.37422	0.249	T	0.50355	-0.8838	10	0.72032	D	0.01	.	8.2804	0.31898	0.0:0.8909:0.0:0.1091	.	71	Q8NHR7	CO043_HUMAN	V	71	ENSP00000340644:A71V	ENSP00000340644:A71V	A	+	2	0	C15orf43	43037928	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	2.048000	0.41278	1.231000	0.43661	0.643000	0.83706	GCG	.	.		0.383	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448	
DTWD1	56986	hgsc.bcm.edu	37	15	49917370	49917370	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:49917370T>C	ENST00000251250.6	+	3	213	c.6T>C	c.(4-6)tcT>tcC	p.S2S	DTWD1_ENST00000558653.1_Silent_p.S2S|DTWD1_ENST00000559223.1_3'UTR|DTWD1_ENST00000403028.3_Silent_p.S2S|DTWD1_ENST00000329873.5_Silent_p.S2S	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	2										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		GAAGAATGTCTCTCAATCCAC	0.323																																					p.S2S		Atlas-SNP	.											.	DTWD1	22	.	0			c.T6C						.						32.0	33.0	33.0					15																	49917370		2193	4291	6484	SO:0001819	synonymous_variant	56986	exon2			AATGTCTCTCAAT	BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.6T>C	chr15.hg19:g.49917370T>C		112.0	0.0		94.0	4.0	NM_001144955	Q567Q3|Q8WVG9|Q9NRU6	Silent	SNP	ENST00000251250.6	hg19	CCDS10132.1																																																																																			.	.		0.323	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254431.2	NM_020234	
ADAM10	102	hgsc.bcm.edu	37	15	58902675	58902675	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:58902675T>C	ENST00000260408.3	-	14	2289	c.1846A>G	c.(1846-1848)Agt>Ggt	p.S616G	ADAM10_ENST00000396140.2_Missense_Mutation_p.S315G|ADAM10_ENST00000402627.1_Intron|ADAM10_ENST00000561288.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	616	Cys-rich.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		AAGTGCCTACTCCACTGCACA	0.448																																					p.S616G		Atlas-SNP	.											.	ADAM10	59	.	0			c.A1846G						.						85.0	78.0	81.0					15																	58902675		2192	4292	6484	SO:0001583	missense	102	exon14			GCCTACTCCACTG	AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.1846A>G	chr15.hg19:g.58902675T>C	ENSP00000260408:p.Ser616Gly	118.0	0.0		149.0	8.0	NM_001110	B4DU28|Q10742|Q92650	Missense_Mutation	SNP	ENST00000260408.3	hg19	CCDS10167.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484275	0.26598	.	.	ENSG00000137845	ENST00000260408;ENST00000396136;ENST00000396140	T;T	0.25749	1.78;3.08	5.37	4.23	0.50019	.	0.622514	0.19699	N	0.108083	T	0.14657	0.0354	N	0.24115	0.695	0.33716	D	0.616368	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.17098	0.017;0.017;0.007	T	0.16808	-1.0390	10	0.15066	T	0.55	-0.0574	7.4057	0.26989	0.0:0.1209:0.1327:0.7464	.	315;435;616	B4DU28;A8MY20;O14672	.;.;ADA10_HUMAN	G	616;435;315	ENSP00000260408:S616G;ENSP00000379444:S315G	ENSP00000260408:S616G	S	-	1	0	ADAM10	56689967	0.115000	0.22152	0.922000	0.36590	0.888000	0.51559	0.423000	0.21313	2.154000	0.67381	0.533000	0.62120	AGT	.	.		0.448	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255880.2	NM_001110	
ZNF609	23060	hgsc.bcm.edu	37	15	64792108	64792108	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:64792108T>C	ENST00000326648.3	+	1	618	c.490T>C	c.(490-492)Tca>Cca	p.S164P	ZNF609_ENST00000416172.1_Missense_Mutation_p.S164P	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	164						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGAGAACAGCTCATCTAAGAG	0.567																																					p.S164P		Atlas-SNP	.											.	ZNF609	106	.	0			c.T490C						.						57.0	54.0	55.0					15																	64792108		2203	4299	6502	SO:0001583	missense	23060	exon1			AACAGCTCATCTA	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.490T>C	chr15.hg19:g.64792108T>C	ENSP00000316527:p.Ser164Pro	138.0	0.0		152.0	7.0	NM_015042	Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	hg19	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	.	16.20	3.057189	0.55325	.	.	ENSG00000180357	ENST00000416172;ENST00000326648	T	0.52057	0.68	5.5	4.37	0.52481	.	0.231325	0.36972	N	0.002314	T	0.47358	0.1441	M	0.69823	2.125	0.50313	D	0.999864	B;B	0.24768	0.111;0.046	B;B	0.26202	0.067;0.019	T	0.47381	-0.9122	10	0.62326	D	0.03	-3.2333	10.1414	0.42738	0.0:0.0762:0.0:0.9238	.	164;164	E7ERY8;O15014	.;ZN609_HUMAN	P	164	ENSP00000316527:S164P	ENSP00000316527:S164P	S	+	1	0	ZNF609	62579161	0.997000	0.39634	0.993000	0.49108	0.987000	0.75469	1.566000	0.36396	1.021000	0.39600	0.529000	0.55759	TCA	.	.		0.567	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418130.1	XM_042833	
NEO1	4756	hgsc.bcm.edu	37	15	73418808	73418808	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:73418808G>T	ENST00000339362.5	+	5	1222	c.775G>T	c.(775-777)Gtc>Ttc	p.V259F	NEO1_ENST00000558964.1_Missense_Mutation_p.V259F|NEO1_ENST00000560262.1_Missense_Mutation_p.V259F|NEO1_ENST00000261908.6_Missense_Mutation_p.V259F			Q92859	NEO1_HUMAN	neogenin 1	259	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						TTCTCCCTTAGTCAGAGTCAT	0.378																																					p.V259F		Atlas-SNP	.											.	NEO1	102	.	0			c.G775T						.						157.0	145.0	149.0					15																	73418808		2198	4297	6495	SO:0001583	missense	4756	exon4			CCCTTAGTCAGAG	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.775G>T	chr15.hg19:g.73418808G>T	ENSP00000341198:p.Val259Phe	64.0	0.0		89.0	5.0	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	hg19	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069529	0.36470	.	.	ENSG00000067141	ENST00000339362;ENST00000261908	T;T	0.69306	-0.39;-0.39	5.65	2.37	0.29283	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.410317	0.27696	N	0.018237	T	0.65238	0.2672	M	0.71581	2.175	0.21553	N	0.999643	B;B;B	0.29552	0.051;0.136;0.248	B;B;B	0.38655	0.073;0.278;0.278	T	0.61768	-0.6995	10	0.72032	D	0.01	-2.0476	5.3899	0.16237	0.5772:0.0:0.4228:0.0	.	259;259;259	B7ZKM9;B7ZKN0;Q92859	.;.;NEO1_HUMAN	F	259	ENSP00000341198:V259F;ENSP00000261908:V259F	ENSP00000261908:V259F	V	+	1	0	NEO1	71205861	0.863000	0.29885	0.991000	0.47740	0.504000	0.33889	2.117000	0.41939	0.729000	0.32403	0.467000	0.42956	GTC	.	.		0.378	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
CYP1A1	1543	hgsc.bcm.edu	37	15	75015113	75015113	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:75015113A>G	ENST00000379727.3	-	2	524	c.326T>C	c.(325-327)cTc>cCc	p.L109P	CYP1A1_ENST00000395049.4_Missense_Mutation_p.L109P|CYP1A1_ENST00000567032.1_Missense_Mutation_p.L109P|CYP1A1_ENST00000395048.2_Missense_Mutation_p.L109P|CYP1A1_ENST00000564596.1_Intron			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	109					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	GAAGGTGTAGAGGTCGGGCCG	0.647									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.L109P		Atlas-SNP	.											.	CYP1A1	60	.	0			c.T326C						.						48.0	47.0	48.0					15																	75015113		2197	4295	6492	SO:0001583	missense	1543	exon2	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	GTGTAGAGGTCGG	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.326T>C	chr15.hg19:g.75015113A>G	ENSP00000369050:p.Leu109Pro	78.0	0.0		86.0	4.0	NM_000499	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	hg19	CCDS10268.1	.	.	.	.	.	.	.	.	.	.	A	16.61	3.171699	0.57584	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.68025	-0.3;-0.3;-0.3	5.23	5.23	0.72850	.	0.059927	0.64402	D	0.000002	D	0.84737	0.5538	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.88246	0.2913	10	0.87932	D	0	.	15.1201	0.72434	1.0:0.0:0.0:0.0	.	109;109	E7EMT5;P04798	.;CP1A1_HUMAN	P	109	ENSP00000369050:L109P;ENSP00000378488:L109P;ENSP00000378489:L109P	ENSP00000268062:L109P	L	-	2	0	CYP1A1	72802166	1.000000	0.71417	1.000000	0.80357	0.311000	0.27955	9.158000	0.94723	1.968000	0.57251	0.379000	0.24179	CTC	.	.		0.647	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286396.1	NM_000499	
MAN2C1	4123	hgsc.bcm.edu	37	15	75653703	75653703	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:75653703T>C	ENST00000267978.5	-	11	1284	c.1238A>G	c.(1237-1239)gAg>gGg	p.E413G	MAN2C1_ENST00000569482.1_Missense_Mutation_p.E413G|MAN2C1_ENST00000563622.1_Missense_Mutation_p.E314G|MAN2C1_ENST00000565683.1_Missense_Mutation_p.E413G|MAN2C1_ENST00000563539.1_5'Flank	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	413					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						ATCCAGGCCCTCCCAGAAAAA	0.617																																					p.E413G		Atlas-SNP	.											.	MAN2C1	76	.	0			c.A1238G						.						30.0	30.0	30.0					15																	75653703		2180	4278	6458	SO:0001583	missense	4123	exon11			AGGCCCTCCCAGA	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1238A>G	chr15.hg19:g.75653703T>C	ENSP00000267978:p.Glu413Gly	90.0	0.0		72.0	5.0	NM_001256494	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	ENST00000267978.5	hg19	CCDS32298.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.032717	0.75504	.	.	ENSG00000140400	ENST00000267978	T	0.81163	-1.46	5.33	5.33	0.75918	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.050242	0.85682	D	0.000000	D	0.90283	0.6961	M	0.91768	3.24	0.53688	D	0.999978	D;D;D	0.60575	0.971;0.988;0.988	P;D;D	0.66979	0.811;0.948;0.932	D	0.91618	0.5308	10	0.66056	D	0.02	-31.8377	10.5227	0.44929	0.0:0.0786:0.0:0.9214	.	195;413;413	B4DVP6;Q68EM8;Q9NTJ4	.;.;MA2C1_HUMAN	G	413	ENSP00000267978:E413G	ENSP00000267978:E413G	E	-	2	0	MAN2C1	73440756	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.709000	0.68384	2.015000	0.59207	0.459000	0.35465	GAG	.	.		0.617	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1		
PEAK1	79834	hgsc.bcm.edu	37	15	77471450	77471450	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:77471450T>C	ENST00000560626.2	-	4	3294	c.2819A>G	c.(2818-2820)gAg>gGg	p.E940G	PEAK1_ENST00000312493.4_Missense_Mutation_p.E940G|PEAK1_ENST00000558305.1_Missense_Mutation_p.E940G			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	940					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TTTGTCATCCTCCTCATCTGT	0.522																																					p.E940G		Atlas-SNP	.											.	.	.	.	0			c.A2819G						.						114.0	131.0	125.0					15																	77471450		2000	4173	6173	SO:0001583	missense	0	exon5			TCATCCTCCTCAT		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.2819A>G	chr15.hg19:g.77471450T>C	ENSP00000452796:p.Glu940Gly	97.0	0.0		106.0	5.0	NM_024776	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	ENST00000560626.2	hg19	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	T	19.85	3.903481	0.72754	.	.	ENSG00000173517	ENST00000312493	T	0.73575	-0.76	5.91	5.91	0.95273	.	0.080647	0.44902	D	0.000417	T	0.56587	0.1995	N	0.19112	0.55	0.41705	D	0.989425	P	0.36282	0.546	B	0.30401	0.115	T	0.60037	-0.7341	10	0.37606	T	0.19	-6.8164	10.6452	0.45615	0.0:0.0708:0.0:0.9292	.	940	Q9H792	PEAK1_HUMAN	G	940	ENSP00000309230:E940G	ENSP00000309230:E940G	E	-	2	0	AC087465.1	75258505	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.685000	0.84117	2.254000	0.74563	0.533000	0.62120	GAG	.	.		0.522	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
AP3B2	8120	hgsc.bcm.edu	37	15	83331627	83331627	+	Silent	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:83331627C>A	ENST00000261722.3	-	22	2802	c.2595G>T	c.(2593-2595)cgG>cgT	p.R865R	AP3B2_ENST00000535359.1_Silent_p.R884R|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Silent_p.R833R	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	865					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CGCCAGCTACCCGGTGCAGCA	0.602																																					p.R865R		Atlas-SNP	.											.	AP3B2	103	.	0			c.G2595T						.						26.0	32.0	30.0					15																	83331627		2038	4200	6238	SO:0001819	synonymous_variant	8120	exon22			AGCTACCCGGTGC	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2595G>T	chr15.hg19:g.83331627C>A		61.0	0.0		70.0	42.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	hg19	CCDS45331.1																																																																																			.	.		0.602	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
NMB	4828	hgsc.bcm.edu	37	15	85200578	85200578	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:85200578A>G	ENST00000360476.3	-	2	554	c.159T>C	c.(157-159)ggT>ggC	p.G53G	NMB_ENST00000394588.3_Splice_Site_p.G53G			P08949	NMB_HUMAN	neuromedin B	53					arachidonic acid secretion (GO:0050482)|cell-cell signaling (GO:0007267)|glucose homeostasis (GO:0042593)|negative regulation of hormone secretion (GO:0046888)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hormone secretion (GO:0046887)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|neuron projection (GO:0043005)	hormone activity (GO:0005179)			endometrium(1)	1				all cancers(203;3.5e-06)		CCATGAAGTGACCTGGAAAGG	0.572																																					p.G53G		Atlas-SNP	.											.	NMB	14	.	0			c.T159C						.						24.0	18.0	20.0					15																	85200578		2197	4292	6489	SO:0001630	splice_region_variant	4828	exon2			GAAGTGACCTGGA		CCDS10332.1, CCDS42076.1	15q25.2-q25.3	2013-09-19			ENSG00000197696	ENSG00000197696			7842	protein-coding gene	gene with protein product		162340				2458345	Standard	NM_021077		Approved	MGC2277, MGC3936, MGC17211	uc002bla.3	P08949	OTTHUMG00000148666	ENST00000360476.3:c.158-1T>C	chr15.hg19:g.85200578A>G		87.0	0.0		78.0	5.0	NM_205858	Q96A06|Q96HH5	Silent	SNP	ENST00000360476.3	hg19	CCDS10332.1																																																																																			.	.		0.572	NMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308995.1	NM_021077	Silent
TICRR	90381	hgsc.bcm.edu	37	15	90167599	90167599	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:90167599T>C	ENST00000268138.7	+	20	4163	c.4058T>C	c.(4057-4059)cTc>cCc	p.L1353P	TICRR_ENST00000560985.1_Missense_Mutation_p.L1352P|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1353	Pro-rich.				cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										GCTGCATCTCTCTCCTGCCCT	0.517																																					p.L1353P		Atlas-SNP	.											.	.	.	.	0			c.T4058C						.						120.0	121.0	121.0					15																	90167599		2200	4299	6499	SO:0001583	missense	90381	exon20			CATCTCTCTCCTG	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.4058T>C	chr15.hg19:g.90167599T>C	ENSP00000268138:p.Leu1353Pro	53.0	0.0		56.0	4.0	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	hg19	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	T	8.993	0.978132	0.18812	.	.	ENSG00000140534	ENST00000268138	T	0.08807	3.05	3.81	-0.15	0.13416	.	0.954574	0.08561	N	0.927581	T	0.06781	0.0173	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44034	-0.9354	10	0.27785	T	0.31	0.0232	3.2449	0.06793	0.1845:0.2259:0.0:0.5895	.	1353	Q7Z2Z1	TICRR_HUMAN	P	1353	ENSP00000268138:L1353P	ENSP00000268138:L1353P	L	+	2	0	C15orf42	87968603	0.000000	0.05858	0.001000	0.08648	0.406000	0.30931	-1.021000	0.03615	-0.258000	0.09446	0.533000	0.62120	CTC	.	.		0.517	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
ALDH1A3	220	hgsc.bcm.edu	37	15	101425535	101425535	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:101425535T>C	ENST00000329841.5	+	2	695	c.163T>C	c.(163-165)Tca>Cca	p.S55P	ALDH1A3_ENST00000560555.1_3'UTR|RP11-66B24.8_ENST00000558568.1_lincRNA|ALDH1A3_ENST00000346623.6_Missense_Mutation_p.S55P	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	55					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	ATGTAACCCTTCAACTCGGGA	0.348																																					p.S55P		Atlas-SNP	.											.	ALDH1A3	61	.	0			c.T163C						.						94.0	95.0	95.0					15																	101425535		2203	4300	6503	SO:0001583	missense	220	exon2			AACCCTTCAACTC	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.163T>C	chr15.hg19:g.101425535T>C	ENSP00000332256:p.Ser55Pro	87.0	0.0		83.0	4.0	NM_000693	Q6NT64	Missense_Mutation	SNP	ENST00000329841.5	hg19	CCDS10389.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.679746	0.88542	.	.	ENSG00000184254	ENST00000329841;ENST00000415812;ENST00000346623	T	0.16897	2.31	5.71	5.71	0.89125	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.060855	0.64402	D	0.000004	T	0.41259	0.1151	M	0.92507	3.315	0.31158	N	0.70464	D;D;P	0.57257	0.97;0.979;0.913	P;P;P	0.52386	0.697;0.643;0.618	T	0.63024	-0.6729	10	0.72032	D	0.01	.	11.6347	0.51196	0.0:0.0:0.1484:0.8516	.	66;55;55	Q7Z3A2;B2R5T2;P47895	.;.;AL1A3_HUMAN	P	55;55;66	ENSP00000332256:S55P	ENSP00000332256:S55P	S	+	1	0	ALDH1A3	99243058	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	4.776000	0.62354	2.179000	0.69175	0.459000	0.35465	TCA	.	.		0.348	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313620.2		
CCDC154	645811	hgsc.bcm.edu	37	16	1488735	1488735	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:1488735T>C	ENST00000389176.3	-	9	1103	c.937A>G	c.(937-939)Agc>Ggc	p.S313G	CCDC154_ENST00000409671.1_Missense_Mutation_p.S159G	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	313						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						AGGAGGTGGCTCTCCTGCCAG	0.726																																					p.S304G		Atlas-SNP	.											.	CCDC154	27	.	0			c.A910G						.						32.0	35.0	34.0					16																	1488735		692	1590	2282	SO:0001583	missense	645811	exon9			GGTGGCTCTCCTG			16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.937A>G	chr16.hg19:g.1488735T>C	ENSP00000373828:p.Ser313Gly	90.0	0.0		83.0	4.0	NM_001143980	G9JV18	Missense_Mutation	SNP	ENST00000389176.3	hg19		.	.	.	.	.	.	.	.	.	.	T	0.868	-0.733022	0.03135	.	.	ENSG00000197599	ENST00000409671;ENST00000389176	.	.	.	4.12	0.71	0.18157	.	0.831256	0.10111	N	0.714694	T	0.12817	0.0311	N	0.04508	-0.205	0.20489	N	0.999899	B	0.09022	0.002	B	0.08055	0.003	T	0.28902	-1.0029	9	0.15499	T	0.54	-2.2744	0.921	0.01315	0.384:0.3182:0.1392:0.1586	.	313	A6NI56	CC154_HUMAN	G	159;313	.	ENSP00000373828:S313G	S	-	1	0	CCDC154	1428736	0.000000	0.05858	0.001000	0.08648	0.631000	0.37964	-0.521000	0.06245	-0.020000	0.14032	-0.415000	0.06103	AGC	.	.		0.726	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001143980	
IGFALS	3483	hgsc.bcm.edu	37	16	1841743	1841743	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:1841743T>C	ENST00000215539.3	-	2	786	c.676A>G	c.(676-678)Agc>Ggc	p.S226G	IGFALS_ENST00000415638.3_Missense_Mutation_p.S264G			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	226					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						GCGTTCCTGCTCAGGTCCAGC	0.697																																					p.S264G		Atlas-SNP	.											.	IGFALS	29	.	0			c.A790G						.						24.0	22.0	23.0					16																	1841743		2148	4254	6402	SO:0001583	missense	3483	exon2			TCCTGCTCAGGTC	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.676A>G	chr16.hg19:g.1841743T>C	ENSP00000215539:p.Ser226Gly	93.0	0.0		97.0	5.0	NM_001146006	B4DZY8|E9PGU3	Missense_Mutation	SNP	ENST00000215539.3	hg19	CCDS10446.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742377	0.49151	.	.	ENSG00000099769	ENST00000215539;ENST00000415638	D;D	0.82344	-1.6;-1.6	5.09	3.99	0.46301	.	0.098049	0.64402	D	0.000002	D	0.85084	0.5616	L	0.38531	1.155	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.76575	0.988;0.95	D	0.84221	0.0461	10	0.59425	D	0.04	.	9.4588	0.38772	0.0:0.0855:0.0:0.9145	.	264;226	E9PGU3;P35858	.;ALS_HUMAN	G	226;264	ENSP00000215539:S226G;ENSP00000416683:S264G	ENSP00000215539:S226G	S	-	1	0	IGFALS	1781744	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.929000	0.63455	0.798000	0.33994	0.448000	0.29417	AGC	.	.		0.697	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250509.2		
SRRM2	23524	hgsc.bcm.edu	37	16	2814503	2814503	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:2814503A>G	ENST00000301740.8	+	11	4523	c.3974A>G	c.(3973-3975)aAc>aGc	p.N1325S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1325	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTCAGGGAGAACAGCTTTGGA	0.433																																					p.N1325S		Atlas-SNP	.											.	SRRM2	263	.	0			c.A3974G						.						101.0	108.0	106.0					16																	2814503		2197	4300	6497	SO:0001583	missense	23524	exon11			GGGAGAACAGCTT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3974A>G	chr16.hg19:g.2814503A>G	ENSP00000301740:p.Asn1325Ser	73.0	0.0		74.0	4.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	A	12.30	1.895845	0.33442	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.23348	1.91	6.11	5.03	0.67393	.	0.347767	0.28360	N	0.015634	T	0.09468	0.0233	N	0.02916	-0.46	0.24954	N	0.991774	B	0.14438	0.01	B	0.06405	0.002	T	0.28650	-1.0037	10	0.13470	T	0.59	-15.9798	8.2168	0.31516	0.9138:0.0:0.0862:0.0	.	1325	Q9UQ35	SRRM2_HUMAN	S	1325;1325;577	ENSP00000301740:N1325S	ENSP00000301740:N1325S	N	+	2	0	SRRM2	2754504	0.979000	0.34478	1.000000	0.80357	0.897000	0.52465	2.392000	0.44433	2.343000	0.79666	0.533000	0.62120	AAC	.	.		0.433	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
CIITA	4261	hgsc.bcm.edu	37	16	11001915	11001915	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:11001915G>A	ENST00000324288.8	+	11	2699	c.2566G>A	c.(2566-2568)Ggc>Agc	p.G856S	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	856					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GGAGGCGGCGGGCCAAGACTT	0.647			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.G856S		Atlas-SNP	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	CIITA_ENST00000324288,NS,carcinoma,0,1	CIITA	92	.	0			c.G2566A						.						15.0	17.0	16.0					16																	11001915		2196	4290	6486	SO:0001583	missense	4261	exon11			GCGGCGGGCCAAG	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2566G>A	chr16.hg19:g.11001915G>A	ENSP00000316328:p.Gly856Ser	154.0	0.0		148.0	0.0	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	hg19	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	G	1.253	-0.617942	0.03663	.	.	ENSG00000179583	ENST00000324288;ENST00000388910	T	0.50548	0.74	4.86	3.89	0.44902	.	0.111166	0.40385	N	0.001118	T	0.29524	0.0736	L	0.39397	1.21	0.34964	D	0.752507	B;B;B;B	0.28667	0.077;0.017;0.126;0.219	B;B;B;B	0.27715	0.021;0.009;0.082;0.074	T	0.23583	-1.0184	10	0.06494	T	0.89	.	4.861	0.13583	0.1966:0.1787:0.6247:0.0	.	856;856;808;856	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	S	856;808	ENSP00000316328:G856S	ENSP00000316328:G856S	G	+	1	0	CIITA	10909416	0.344000	0.24827	0.431000	0.26735	0.061000	0.15899	1.411000	0.34702	0.989000	0.38761	0.655000	0.94253	GGC	.	.		0.647	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
XYLT1	64131	hgsc.bcm.edu	37	16	17211555	17211555	+	Silent	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:17211555G>T	ENST00000261381.6	-	11	2589	c.2505C>A	c.(2503-2505)acC>acA	p.T835T		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	835					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGAGGAATTTGGTCTCTGCAA	0.542																																					p.T835T		Atlas-SNP	.											.	XYLT1	147	.	0			c.C2505A						.						84.0	81.0	82.0					16																	17211555		2197	4300	6497	SO:0001819	synonymous_variant	64131	exon11			GAATTTGGTCTCT	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2505C>A	chr16.hg19:g.17211555G>T		218.0	0.0		216.0	107.0	NM_022166	Q9H1B6	Silent	SNP	ENST00000261381.6	hg19	CCDS10569.1																																																																																			.	.		0.542	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
KIF22	3835	hgsc.bcm.edu	37	16	29810070	29810070	+	Splice_Site	SNP	T	T	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:29810070T>G	ENST00000160827.4	+	4	589		c.e4+2		KIF22_ENST00000569382.2_Splice_Site|KIF22_ENST00000400751.5_Splice_Site|KIF22_ENST00000561482.1_Splice_Site|KIF22_ENST00000400750.2_Splice_Site	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						CAGGAGAAGGTGAGGCCCCGT	0.567																																					.		Atlas-SNP	.											.	KIF22	29	.	0			c.549+2T>G						.						30.0	33.0	32.0					16																	29810070		2197	4296	6493	SO:0001630	splice_region_variant	3835	exon4			AGAAGGTGAGGCC	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.549+2T>G	chr16.hg19:g.29810070T>G		109.0	0.0		84.0	5.0	NM_007317	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Splice_Site	SNP	ENST00000160827.4	hg19	CCDS10653.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336063	0.60963	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3589	0.66757	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIF22	29717571	1.000000	0.71417	0.993000	0.49108	0.790000	0.44656	4.200000	0.58433	2.274000	0.75844	0.533000	0.62120	.	.	.		0.567	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2		Intron
BCL7C	9274	hgsc.bcm.edu	37	16	30904020	30904020	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:30904020C>T	ENST00000215115.4	-	4	1344	c.329G>A	c.(328-330)gGc>gAc	p.G110D	BCL7C_ENST00000380317.4_Missense_Mutation_p.G110D|AC106782.20_ENST00000572471.1_RNA|MIR4519_ENST00000565573.1_RNA|MIR4519_ENST00000564901.1_RNA|MIR762_ENST00000390236.1_RNA|MIR4519_ENST00000570025.1_RNA	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	110	Pro-rich.				apoptotic process (GO:0006915)					large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			GGGCTCTGTGCCCTTTTGCAG	0.637																																					p.G110D		Atlas-SNP	.											.	BCL7C	30	.	0			c.G329A						.						57.0	63.0	61.0					16																	30904020		2197	4300	6497	SO:0001583	missense	9274	exon4			TCTGTGCCCTTTT	AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.329G>A	chr16.hg19:g.30904020C>T	ENSP00000215115:p.Gly110Asp	113.0	0.0		100.0	5.0	NM_004765	O43770|Q6PD89	Missense_Mutation	SNP	ENST00000215115.4	hg19	CCDS10693.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.340199	0.41398	.	.	ENSG00000099385	ENST00000380317;ENST00000215115	T;T	0.42513	0.97;0.98	5.08	5.08	0.68730	.	0.110120	0.39909	N	0.001230	T	0.49474	0.1559	N	0.25380	0.74	0.46521	D	0.999089	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.29150	-1.0021	10	0.10636	T	0.68	-2.623	17.6012	0.88025	0.0:1.0:0.0:0.0	.	110;110	Q8WUZ0;Q8WUZ0-2	BCL7C_HUMAN;.	D	110	ENSP00000369674:G110D;ENSP00000215115:G110D	ENSP00000215115:G110D	G	-	2	0	BCL7C	30811521	0.941000	0.31946	1.000000	0.80357	0.992000	0.81027	1.144000	0.31565	2.519000	0.84933	0.561000	0.74099	GGC	.	.		0.637	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255547.3	NM_004765	
PHKB	5257	hgsc.bcm.edu	37	16	47531308	47531308	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:47531308A>G	ENST00000323584.5	+	2	100		c.e2-1		PHKB_ENST00000567402.1_Splice_Site|PHKB_ENST00000455779.1_Splice_Site|PHKB_ENST00000566044.1_Splice_Site|PHKB_ENST00000299167.8_Splice_Site	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta						carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TTTTTCTTTTAGGCTCAGTTT	0.313																																					.		Atlas-SNP	.											PHKB_ENST00000323584,NS,carcinoma,0,3	PHKB	298	.	0			c.77-2A>G						.						43.0	45.0	44.0					16																	47531308		2201	4297	6498	SO:0001630	splice_region_variant	5257	exon2			TCTTTTAGGCTCA		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.77-1A>G	chr16.hg19:g.47531308A>G		17.0	0.0		10.0	2.0	NM_000293	Q8N4T5	Splice_Site	SNP	ENST00000323584.5	hg19	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164763	0.78339	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7168	0.77674	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHKB	46088809	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	7.564000	0.82326	2.126000	0.65437	0.482000	0.46254	.	.	.		0.313	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		Intron
N4BP1	9683	hgsc.bcm.edu	37	16	48595062	48595062	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:48595062A>G	ENST00000262384.3	-	2	1728	c.1492T>C	c.(1492-1494)Tct>Cct	p.S498P	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	498					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				GGACTTGGAGAGGCAACAGAA	0.448																																					p.S498P		Atlas-SNP	.											.	N4BP1	121	.	0			c.T1492C						.						143.0	146.0	145.0					16																	48595062		1913	4121	6034	SO:0001583	missense	9683	exon2			TTGGAGAGGCAAC	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.1492T>C	chr16.hg19:g.48595062A>G	ENSP00000262384:p.Ser498Pro	169.0	0.0		103.0	5.0	NM_153029	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	hg19	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	A	4.145	0.025216	0.08054	.	.	ENSG00000102921	ENST00000262384	T	0.43294	0.95	6.08	1.96	0.26148	.	0.692420	0.15023	N	0.284865	T	0.14270	0.0345	N	0.02916	-0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30650	-0.9971	10	0.07030	T	0.85	-2.386	5.3727	0.16148	0.3122:0.1363:0.5515:0.0	.	498	O75113	N4BP1_HUMAN	P	498	ENSP00000262384:S498P	ENSP00000262384:S498P	S	-	1	0	N4BP1	47152563	0.000000	0.05858	0.005000	0.12908	0.720000	0.41350	-0.630000	0.05502	0.137000	0.18759	-0.462000	0.05337	TCT	.	.		0.448	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
TPPP3	51673	hgsc.bcm.edu	37	16	67425009	67425009	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:67425009T>C	ENST00000564104.1	-	1	847	c.6A>G	c.(4-6)gcA>gcG	p.A2A	TPPP3_ENST00000562206.1_Silent_p.A2A|RNU1-123P_ENST00000458950.1_RNA|TPPP3_ENST00000290942.5_Silent_p.A2A|TPPP3_ENST00000393957.2_Silent_p.A2A			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	2					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		CTGTGCTCGCTGCCATGCCAC	0.597																																					p.A2A		Atlas-SNP	.											.	TPPP3	13	.	0			c.A6G						.						62.0	56.0	58.0					16																	67425009		2198	4300	6498	SO:0001819	synonymous_variant	51673	exon3			GCTCGCTGCCATG	BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.6A>G	chr16.hg19:g.67425009T>C		115.0	0.0		58.0	4.0	NM_016140	Q49AH9|Q9Y326|Q9Y6H0	Silent	SNP	ENST00000564104.1	hg19	CCDS10835.1																																																																																			.	.		0.597	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421787.2	NM_015964	
CENPT	80152	hgsc.bcm.edu	37	16	67863958	67863958	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:67863958T>C	ENST00000562787.1	-	12	1444	c.896A>G	c.(895-897)gAg>gGg	p.E299G	CENPT_ENST00000564817.1_Missense_Mutation_p.E299G|CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000219172.3_Missense_Mutation_p.E299G|CENPT_ENST00000440851.2_Missense_Mutation_p.E299G	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	299	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		CTCCTCTGCCTCTCCTGCCAG	0.572																																					p.E299G		Atlas-SNP	.											.	CENPT	26	.	0			c.A896G						.						64.0	65.0	65.0					16																	67863958		2018	4193	6211	SO:0001583	missense	80152	exon12			TCTGCCTCTCCTG	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.896A>G	chr16.hg19:g.67863958T>C	ENSP00000457810:p.Glu299Gly	109.0	0.0		59.0	4.0	NM_025082	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	hg19	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.550697	0.45383	.	.	ENSG00000102901	ENST00000440851;ENST00000436104;ENST00000219172	T;T	0.46063	0.88;0.88	3.83	-1.6	0.08426	.	1.368410	0.05054	N	0.478714	T	0.26484	0.0647	L	0.36672	1.1	0.20638	N	0.999879	B;B;B	0.27732	0.027;0.187;0.187	B;B;B	0.24701	0.018;0.055;0.038	T	0.11227	-1.0596	10	0.24483	T	0.36	-2.4585	0.2782	0.00241	0.3999:0.1786:0.2016:0.2199	.	57;299;299	F5H5A6;Q96BT3;B3KPB2	.;CENPT_HUMAN;.	G	299;57;299	ENSP00000400140:E299G;ENSP00000219172:E299G	ENSP00000219172:E299G	E	-	2	0	CENPT	66421459	0.003000	0.15002	0.000000	0.03702	0.269000	0.26545	0.297000	0.19101	-0.411000	0.07530	-1.548000	0.00902	GAG	.	.		0.572	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
ZFP90	146198	hgsc.bcm.edu	37	16	68598370	68598370	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:68598370A>G	ENST00000570495.1	+	5	1972	c.1680A>G	c.(1678-1680)aaA>aaG	p.K560K	ZFP90_ENST00000563169.2_Silent_p.K560K|ZFP90_ENST00000398253.2_Silent_p.K560K			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	560					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		ACTGTGGGAAAGCCTTTAGTC	0.433																																					p.K560K		Atlas-SNP	.											.	ZFP90	67	.	0			c.A1680G						.						82.0	94.0	90.0					16																	68598370		2193	4299	6492	SO:0001819	synonymous_variant	146198	exon4			TGGGAAAGCCTTT	AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.1680A>G	chr16.hg19:g.68598370A>G		51.0	0.0		44.0	4.0	NM_133458	B2RU00|B3KVE7|Q49AD1|Q96MQ6	Silent	SNP	ENST00000570495.1	hg19	CCDS42183.1																																																																																			.	.		0.433	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436217.3	XM_085375	
TP53	7157	hgsc.bcm.edu	37	17	7577565	7577565	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:7577565T>C	ENST00000269305.4	-	7	905	c.716A>G	c.(715-717)aAc>aGc	p.N239S	TP53_ENST00000359597.4_Missense_Mutation_p.N239S|TP53_ENST00000445888.2_Missense_Mutation_p.N239S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.N239S|TP53_ENST00000455263.2_Missense_Mutation_p.N239S|TP53_ENST00000420246.2_Missense_Mutation_p.N239S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239S(28)|p.0?(8)|p.?(5)|p.N239T(4)|p.M237_N239delMCN(4)|p.N146S(3)|p.N239_C242delNSSC(3)|p.N239fs*25(2)|p.N239_S240delNS(2)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238fs*21(1)|p.N239I(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.N239fs*>48(1)|p.N146fs*>10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGAACTGTTACACATGTA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.N239S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,-1,40	TP53	33396	.	76	Substitution - Missense(36)|Deletion - In frame(14)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(4)|Substitution - Nonsense(1)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	biliary_tract(10)|urinary_tract(6)|lung(6)|ovary(6)|upper_aerodigestive_tract(5)|haematopoietic_and_lymphoid_tissue(5)|oesophagus(5)|breast(5)|bone(5)|central_nervous_system(4)|large_intestine(4)|endometrium(4)|kidney(4)|stomach(3)|thyroid(1)|soft_tissue(1)|liver(1)|pancreas(1)	c.A716G						.						135.0	105.0	115.0					17																	7577565		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GAACTGTTACACA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.716A>G	chr17.hg19:g.7577565T>C	ENSP00000269305:p.Asn239Ser	265.0	0.0		110.0	98.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565663	0.86439	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	M	0.87381	2.88	0.58432	D	0.999991	D;B;D;D;D;D	0.89917	0.988;0.31;0.999;0.98;0.99;1.0	P;B;D;P;P;D	0.87578	0.826;0.104;0.981;0.815;0.891;0.998	D	0.97237	0.9888	10	0.87932	D	0	-35.9081	12.3101	0.54924	0.0:0.0:0.0:1.0	.	239;239;146;239;239;239	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	239;239;239;239;239;239;228;146;107;146	ENSP00000410739:N239S;ENSP00000352610:N239S;ENSP00000269305:N239S;ENSP00000398846:N239S;ENSP00000391127:N239S;ENSP00000391478:N239S;ENSP00000425104:N107S;ENSP00000423862:N146S	ENSP00000269305:N239S	N	-	2	0	TP53	7518290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.074000	0.62210	0.379000	0.24179	AAC	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	hgsc.bcm.edu	37	17	7636446	7636446	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:7636446T>C	ENST00000572933.1	+	5	1901	c.441T>C	c.(439-441)gtT>gtC	p.V147V	DNAH2_ENST00000570791.1_Silent_p.V147V|DNAH2_ENST00000389173.2_Silent_p.V147V|DNAH2_ENST00000082259.3_Silent_p.V147V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	147	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AAGCACCAGTTCCCATCACCT	0.587																																					p.V147V		Atlas-SNP	.											.	DNAH2	498	.	0			c.T441C						.						97.0	90.0	93.0					17																	7636446		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon4			ACCAGTTCCCATC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.441T>C	chr17.hg19:g.7636446T>C		146.0	0.0		95.0	5.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	hg19	CCDS32551.1																																																																																			.	.		0.587	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CHD3	1107	hgsc.bcm.edu	37	17	7810554	7810554	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:7810554A>G	ENST00000330494.7	+	31	4927	c.4777A>G	c.(4777-4779)Atg>Gtg	p.M1593V	CHD3_ENST00000358181.4_Missense_Mutation_p.M1593V|SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000380358.4_Missense_Mutation_p.M1652V	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1593	Required for interaction with PCNT.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				TGGGGAGAAGATGGAGACAGA	0.572																																					p.M1652V		Atlas-SNP	.											.	CHD3	169	.	0			c.A4954G						.						115.0	119.0	117.0					17																	7810554		2203	4300	6503	SO:0001583	missense	1107	exon31			GAGAAGATGGAGA	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4777A>G	chr17.hg19:g.7810554A>G	ENSP00000332628:p.Met1593Val	128.0	0.0		83.0	5.0	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	hg19	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	A	4.407	0.075230	0.08485	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.89485	-2.52;-2.48;-2.46	4.54	3.46	0.39613	.	0.108333	0.41194	D	0.000921	T	0.75413	0.3846	N	0.08118	0	0.33675	D	0.611388	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.72030	-0.4413	10	0.29301	T	0.29	-14.3174	9.5615	0.39371	0.9145:0.0:0.0855:0.0	.	169;1593;1593;1652	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	V	1652;1593;1593	ENSP00000369716:M1652V;ENSP00000350907:M1593V;ENSP00000332628:M1593V	ENSP00000332628:M1593V	M	+	1	0	CHD3	7751279	0.843000	0.29541	1.000000	0.80357	0.612000	0.37316	0.612000	0.24283	0.877000	0.35895	-0.521000	0.04368	ATG	.	.		0.572	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
MYH4	4622	hgsc.bcm.edu	37	17	10354170	10354170	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:10354170G>T	ENST00000255381.2	-	29	4018	c.3908C>A	c.(3907-3909)tCt>tAt	p.S1303Y	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1303					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GGATAGCTGAGAAACCATAGC	0.378																																					p.S1303Y		Atlas-SNP	.											.	MYH4	349	.	0			c.C3908A						.						161.0	147.0	152.0					17																	10354170		2203	4300	6503	SO:0001583	missense	4622	exon29			AGCTGAGAAACCA		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3908C>A	chr17.hg19:g.10354170G>T	ENSP00000255381:p.Ser1303Tyr	249.0	0.0		145.0	124.0	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258015	0.80246	.	.	ENSG00000141048	ENST00000255381	T	0.79940	-1.32	5.71	5.71	0.89125	Myosin tail (1);	0.000000	0.37304	U	0.002144	D	0.92482	0.7613	M	0.93241	3.395	0.50632	D	0.999886	D	0.69078	0.997	D	0.71184	0.972	D	0.93703	0.7017	10	0.87932	D	0	.	18.9878	0.92779	0.0:0.0:1.0:0.0	.	1303	Q9Y623	MYH4_HUMAN	Y	1303	ENSP00000255381:S1303Y	ENSP00000255381:S1303Y	S	-	2	0	MYH4	10294895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.763000	0.68818	2.850000	0.98022	0.655000	0.94253	TCT	.	.		0.378	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
MYH3	4621	hgsc.bcm.edu	37	17	10543929	10543929	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:10543929A>G	ENST00000583535.1	-	20	2327	c.2240T>C	c.(2239-2241)cTg>cCg	p.L747P	MYH3_ENST00000226209.7_Missense_Mutation_p.L747P	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	747	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						AATGGATGCCAGAAGCTTTTC	0.448																																					p.L747P		Atlas-SNP	.											.	MYH3	227	.	0			c.T2240C						.						146.0	131.0	136.0					17																	10543929		2203	4300	6503	SO:0001583	missense	4621	exon20			GATGCCAGAAGCT		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2240T>C	chr17.hg19:g.10543929A>G	ENSP00000464317:p.Leu747Pro	169.0	0.0		94.0	4.0	NM_002470	Q15492	Missense_Mutation	SNP	ENST00000583535.1	hg19	CCDS11157.1	.	.	.	.	.	.	.	.	.	.	A	19.14	3.770302	0.69992	.	.	ENSG00000109063	ENST00000226209	D	0.91792	-2.91	5.52	5.52	0.82312	Myosin head, motor domain (2);	.	.	.	.	D	0.98040	0.9354	H	0.99368	4.535	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99771	1.1024	9	0.87932	D	0	.	15.9319	0.79668	1.0:0.0:0.0:0.0	.	747	P11055	MYH3_HUMAN	P	747	ENSP00000226209:L747P	ENSP00000226209:L747P	L	-	2	0	MYH3	10484654	1.000000	0.71417	0.957000	0.39632	0.928000	0.56348	9.287000	0.95975	2.225000	0.72522	0.459000	0.35465	CTG	.	.		0.448	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
DNAH9	1770	hgsc.bcm.edu	37	17	11648192	11648192	+	Missense_Mutation	SNP	C	C	T	rs375918058		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:11648192C>T	ENST00000262442.4	+	31	6258	c.6190C>T	c.(6190-6192)Cgg>Tgg	p.R2064W	DNAH9_ENST00000454412.2_Missense_Mutation_p.R2064W	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2064					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGACCCTGACCGGCCTGAGGA	0.577																																					p.R2064W		Atlas-SNP	.											DNAH9,NS,carcinoma,0,1	DNAH9	695	.	0			c.C6190T						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	63.0	56.0	59.0		6190	4.5	1.0	17		59	0,8600		0,0,4300	no	missense	DNAH9	NM_001372.3	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	2064/4487	11648192	1,13005	2203	4300	6503	SO:0001583	missense	1770	exon31			CCTGACCGGCCTG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6190C>T	chr17.hg19:g.11648192C>T	ENSP00000262442:p.Arg2064Trp	160.0	0.0		67.0	3.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480558	0.84747	2.27E-4	0.0	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.27557	1.7;1.66	5.46	4.47	0.54385	.	0.679543	0.13145	N	0.410309	T	0.66268	0.2772	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.72276	-0.4341	10	0.66056	D	0.02	.	15.4422	0.75195	0.1401:0.8599:0.0:0.0	.	2064	Q9NYC9	DYH9_HUMAN	W	2064;2064;646	ENSP00000262442:R2064W;ENSP00000414874:R2064W	ENSP00000262442:R2064W	R	+	1	2	DNAH9	11588917	0.797000	0.28877	1.000000	0.80357	0.970000	0.65996	1.561000	0.36342	1.264000	0.44198	0.650000	0.86243	CGG	.	.		0.577	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SHMT1	6470	hgsc.bcm.edu	37	17	18232099	18232099	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:18232099A>G	ENST00000316694.3	-	12	1551	c.1417T>C	c.(1417-1419)Tct>Cct	p.S473P	RP1-178F10.3_ENST00000577764.1_lincRNA|SHMT1_ENST00000352886.6_Missense_Mutation_p.S393P|SHMT1_ENST00000354098.3_Missense_Mutation_p.S434P|SHMT1_ENST00000539052.1_Missense_Mutation_p.S335P	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	473					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	GGGAAGAGAGAGGCGAAGCTC	0.637																																					p.S473P		Atlas-SNP	.											.	SHMT1	36	.	0			c.T1417C						.						26.0	25.0	25.0					17																	18232099		2203	4299	6502	SO:0001583	missense	6470	exon12			AGAGAGAGGCGAA		CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.1417T>C	chr17.hg19:g.18232099A>G	ENSP00000318868:p.Ser473Pro	84.0	0.0		85.0	4.0	NM_004169	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	hg19	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	A	9.270	1.045465	0.19748	.	.	ENSG00000176974	ENST00000316694;ENST00000395684;ENST00000352886;ENST00000539052;ENST00000354098;ENST00000395685	T;T;T;T	0.33865	1.39;1.39;1.39;1.39	5.37	-3.73	0.04398	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.415553	0.27043	N	0.021204	T	0.38719	0.1051	M	0.81682	2.555	0.09310	N	1	B;P;B	0.37663	0.042;0.604;0.007	B;B;B	0.41088	0.066;0.347;0.018	T	0.44019	-0.9355	10	0.41790	T	0.15	-6.1079	11.6982	0.51556	0.2492:0.585:0.0:0.1658	.	436;434;473	A8MYA6;P34896-2;P34896	.;.;GLYC_HUMAN	P	473;248;393;335;434;436	ENSP00000318868:S473P;ENSP00000345881:S393P;ENSP00000440089:S335P;ENSP00000318805:S434P	ENSP00000318868:S473P	S	-	1	0	SHMT1	18172824	0.002000	0.14202	0.000000	0.03702	0.202000	0.24057	0.688000	0.25422	-0.491000	0.06697	0.533000	0.62120	TCT	.	.		0.637	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169	
TMEM199	147007	hgsc.bcm.edu	37	17	26692221	26692221	+	IGR	SNP	G	G	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:26692221G>C	ENST00000292114.3	+	0	3148				VTN_ENST00000536498.1_Intron|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron|VTN_ENST00000438614.1_Intron|VTN_ENST00000431468.1_Missense_Mutation_p.H11D|CTB-96E2.7_ENST00000577850.1_RNA|CTB-96E2.3_ENST00000591482.1_RNA|CTB-96E2.2_ENST00000555059.2_Intron	NM_152464.1	NP_689677.1	Q8N511	TM199_HUMAN	transmembrane protein 199							integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		AGAGGGCCATGCCAGGCTGTG	0.612																																					p.H11D		Atlas-SNP	.											.	SEBOX	20	.	0			c.C31G						.						38.0	44.0	42.0					17																	26692221		1984	4161	6145	SO:0001628	intergenic_variant	645832	exon1			GGCCATGCCAGGC	AY074907	CCDS11228.1	17q11.2	2007-12-17	2007-12-17	2007-12-17	ENSG00000244045	ENSG00000244045			18085	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 32"""	C17orf32			Standard	NM_152464		Approved	MGC45714	uc002hba.3	Q8N511	OTTHUMG00000132498		chr17.hg19:g.26692221G>C		97.0	0.0		91.0	4.0	NM_001080837		Missense_Mutation	SNP	ENST00000292114.3	hg19	CCDS11228.1	.	.	.	.	.	.	.	.	.	.	g	7.242	0.601512	0.13939	.	.	ENSG00000109072	ENST00000431468;ENST00000247029	D	0.91521	-2.86	.	.	.	.	.	.	.	.	T	0.76962	0.4061	N	0.08118	0	0.33615	D	0.604127	P	0.34662	0.462	B	0.36534	0.227	T	0.71391	-0.4607	7	0.11794	T	0.64	.	.	.	.	.	11	Q9HB31	SEBOX_HUMAN	D	11;15	ENSP00000416240:H11D	ENSP00000247029:H15D	H	-	1	0	VTN	23716348	0.498000	0.26075	0.650000	0.29550	0.207000	0.24258	0.075000	0.14686	0.073000	0.16731	0.074000	0.15403	CAT	.	.		0.612	TMEM199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255676.2	NM_152464	
KIAA0100	9703	hgsc.bcm.edu	37	17	26948170	26948170	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:26948170T>C	ENST00000528896.2	-	28	5152	c.5078A>G	c.(5077-5079)gAg>gGg	p.E1693G	KIAA0100_ENST00000579924.2_5'Flank|KIAA0100_ENST00000389003.3_Missense_Mutation_p.E1550G|KIAA0100_ENST00000544884.1_Missense_Mutation_p.E1550G	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1693						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TTGCTGTGCCTCAGCTGGCTG	0.458																																					p.E1693G		Atlas-SNP	.											.	KIAA0100	175	.	0			c.A5078G						.						61.0	56.0	58.0					17																	26948170		2203	4300	6503	SO:0001583	missense	9703	exon28			TGTGCCTCAGCTG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5078A>G	chr17.hg19:g.26948170T>C	ENSP00000436773:p.Glu1693Gly	99.0	0.0		123.0	5.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	13.34	2.207486	0.39003	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.25250	1.81;1.81	5.53	5.53	0.82687	.	0.101164	0.64402	D	0.000001	T	0.10208	0.0250	N	0.01168	-0.975	0.51233	D	0.999914	P	0.47762	0.9	B	0.39706	0.307	T	0.32268	-0.9913	10	0.34782	T	0.22	.	14.5272	0.67897	0.0:0.0:0.0:1.0	.	1693	Q14667	K0100_HUMAN	G	1693;1663;1693;1550	ENSP00000436773:E1693G;ENSP00000446443:E1550G	ENSP00000005905:E1693G	E	-	2	0	KIAA0100	23972297	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	5.648000	0.67930	2.231000	0.72958	0.459000	0.35465	GAG	.	.		0.458	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
CCT6B	10693	hgsc.bcm.edu	37	17	33278993	33278993	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:33278993T>C	ENST00000314144.5	-	5	705	c.590A>G	c.(589-591)aAg>aGg	p.K197R	CCT6B_ENST00000421975.3_Missense_Mutation_p.K197R|CCT6B_ENST00000436961.3_Missense_Mutation_p.K152R	NM_006584.3	NP_006575.2	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B (zeta 2)	197					chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	chaperonin-containing T-complex (GO:0005832)	ATP binding (GO:0005524)|protein transporter activity (GO:0008565)|unfolded protein binding (GO:0051082)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	20		Ovarian(249;0.17)				TAATTTATGCTTCATCTCCAT	0.308																																					p.K197R		Atlas-SNP	.											.	CCT6B	63	.	0			c.A590G						.						103.0	96.0	98.0					17																	33278993		2203	4300	6503	SO:0001583	missense	10693	exon5			TTATGCTTCATCT	D78333	CCDS32617.1, CCDS54105.1, CCDS54106.1	17q	2011-09-02			ENSG00000132141	ENSG00000132141		"""Heat Shock Proteins / Chaperonins"""	1621	protein-coding gene	gene with protein product		610730				8812458, 9013858	Standard	NM_006584		Approved	Cctz2, TSA303	uc002hig.3	Q92526		ENST00000314144.5:c.590A>G	chr17.hg19:g.33278993T>C	ENSP00000327191:p.Lys197Arg	100.0	0.0		96.0	4.0	NM_006584	B4DX20|B4DYB0|Q8TC34	Missense_Mutation	SNP	ENST00000314144.5	hg19	CCDS32617.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.428399	0.25726	.	.	ENSG00000132141	ENST00000421975;ENST00000314144;ENST00000436961	T;T;T	0.79454	-0.23;-1.27;-1.27	4.75	3.68	0.42216	.	0.044381	0.85682	N	0.000000	T	0.65375	0.2685	L	0.37507	1.11	0.45161	D	0.998172	B;B;B	0.10296	0.001;0.003;0.002	B;B;B	0.17979	0.013;0.02;0.013	T	0.56715	-0.7933	10	0.25106	T	0.35	-6.6445	8.3908	0.32526	0.0:0.094:0.0:0.906	.	152;197;197	B4DYB0;B4DX20;Q92526	.;.;TCPW_HUMAN	R	197;197;152	ENSP00000398044:K197R;ENSP00000327191:K197R;ENSP00000400917:K152R	ENSP00000327191:K197R	K	-	2	0	CCT6B	30303106	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	4.029000	0.57253	0.964000	0.38108	0.533000	0.62120	AAG	.	.		0.308	CCT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448014.1	NM_006584	
ERBB2	2064	hgsc.bcm.edu	37	17	37863315	37863315	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:37863315T>C	ENST00000269571.5	+	2	305	c.146T>C	c.(145-147)cTc>cCc	p.L49P	ERBB2_ENST00000584601.1_Missense_Mutation_p.L19P|ERBB2_ENST00000406381.2_Missense_Mutation_p.L19P|ERBB2_ENST00000578199.1_Missense_Mutation_p.L19P|ERBB2_ENST00000540147.1_Missense_Mutation_p.L19P|ERBB2_ENST00000584450.1_Missense_Mutation_p.L49P|ERBB2_ENST00000540042.1_Missense_Mutation_p.L19P|ERBB2_ENST00000541774.1_Missense_Mutation_p.L34P|ERBB2_ENST00000445658.2_Intron			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	49					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L49H(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CTCCGCCACCTCTACCAGGGC	0.642		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.L49P		Atlas-SNP	.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,colon,carcinoma,0,2	ERBB2	429	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.T146C						.						43.0	38.0	39.0					17																	37863315		2203	4300	6503	SO:0001583	missense	2064	exon2			GCCACCTCTACCA	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.146T>C	chr17.hg19:g.37863315T>C	ENSP00000269571:p.Leu49Pro	158.0	2.0		168.0	7.0	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	hg19	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560683	0.45590	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000269571;ENST00000540147;ENST00000540042	D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75	5.23	5.23	0.72850	.	.	.	.	.	D	0.88698	0.6507	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.994;0.971;0.991	D	0.89628	0.3853	9	0.72032	D	0.01	.	14.2408	0.65956	0.0:0.0:0.0:1.0	.	19;34;49;49	F5H1T4;P04626-4;P04626;Q9UK79	.;.;ERBB2_HUMAN;.	P	19;34;49;19;19	ENSP00000385185:L19P;ENSP00000446466:L34P;ENSP00000269571:L49P;ENSP00000443562:L19P;ENSP00000446382:L19P	ENSP00000269571:L49P	L	+	2	0	ERBB2	35116841	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.882000	0.69714	2.200000	0.70718	0.459000	0.35465	CTC	.	.		0.642	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
BRCA1	672	hgsc.bcm.edu	37	17	41276097	41276097	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:41276097A>G	ENST00000357654.3	-	2	135	c.17T>C	c.(16-18)cTt>cCt	p.L6P	BRCA1_ENST00000346315.3_Missense_Mutation_p.L6P|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000354071.3_Missense_Mutation_p.L6P|BRCA1_ENST00000351666.3_Missense_Mutation_p.L6P|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000491747.2_Missense_Mutation_p.L6P|NBR2_ENST00000460115.1_RNA|BRCA1_ENST00000471181.2_Missense_Mutation_p.L6P|BRCA1_ENST00000352993.3_Missense_Mutation_p.L6P|BRCA1_ENST00000468300.1_Missense_Mutation_p.L6P|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_5'UTR	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	6					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TTCAACGCGAAGAGCAGATAA	0.308			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.L6P		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.T17C						.						106.0	92.0	97.0					17																	41276097		2202	4299	6501	SO:0001583	missense	672	exon1	Familial Cancer Database		ACGCGAAGAGCAG	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.17T>C	chr17.hg19:g.41276097A>G	ENSP00000350283:p.Leu6Pro	165.0	0.0		98.0	4.0	NM_007298	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	hg19	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	A	7.954	0.745464	0.15710	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000468300;ENST00000471181;ENST00000491747;ENST00000478531;ENST00000470026;ENST00000477152;ENST00000494123;ENST00000476777;ENST00000489037	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	3.83	0.603	0.17541	.	0.751799	0.11314	N	0.576860	T	0.72732	0.3497	L	0.29908	0.895	0.09310	N	0.999995	B;B;B;B;B;B;B	0.27882	0.021;0.012;0.008;0.036;0.061;0.192;0.031	B;B;B;B;B;B;B	0.25140	0.026;0.011;0.013;0.058;0.018;0.024;0.016	T	0.62478	-0.6846	10	0.72032	D	0.01	-0.6375	2.7625	0.05311	0.5326:0.0:0.1973:0.27	.	6;6;6;6;6;6;6	E7ETR2;E7EMP0;Q5YLB2;P38398-3;Q6IN79;E9PFC7;P38398	.;.;.;.;.;.;BRCA1_HUMAN	P	6	ENSP00000350283:L6P;ENSP00000326002:L6P;ENSP00000312236:L6P;ENSP00000246907:L6P;ENSP00000338007:L6P;ENSP00000417148:L6P;ENSP00000418960:L6P;ENSP00000420705:L6P;ENSP00000420412:L6P;ENSP00000419274:L6P;ENSP00000419988:L6P;ENSP00000419103:L6P;ENSP00000417554:L6P;ENSP00000420781:L6P	ENSP00000246907:L6P	L	-	2	0	BRCA1	38529623	0.801000	0.28930	0.012000	0.15200	0.757000	0.42996	1.242000	0.32755	0.070000	0.16634	0.334000	0.21626	CTT	.	.		0.308	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
EFTUD2	9343	hgsc.bcm.edu	37	17	42960512	42960512	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:42960512A>G	ENST00000426333.2	-	6	738	c.441T>C	c.(439-441)gaT>gaC	p.D147D	RN7SL405P_ENST00000582502.1_RNA|EFTUD2_ENST00000402521.3_Silent_p.D112D|EFTUD2_ENST00000592576.1_Intron|EFTUD2_ENST00000591382.1_Silent_p.D147D	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	147	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				CAATTAAACAATCCACAAAAC	0.418																																					p.D147D	Ovarian(10;65 485 10258 29980 30707)	Atlas-SNP	.											.	EFTUD2	85	.	0			c.T441C						.						110.0	93.0	99.0					17																	42960512		2203	4300	6503	SO:0001819	synonymous_variant	9343	exon6			TAAACAATCCACA	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.441T>C	chr17.hg19:g.42960512A>G		156.0	0.0		86.0	4.0	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Silent	SNP	ENST00000426333.2	hg19	CCDS11489.1																																																																																			.	.		0.418	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
ERN1	2081	hgsc.bcm.edu	37	17	62125246	62125246	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:62125246C>T	ENST00000433197.3	-	19	2596	c.2501G>A	c.(2500-2502)aGc>aAc	p.S834N		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						CTTCTCTAGGCTCCAGAAGAA	0.438																																					p.S834N		Atlas-SNP	.											.	ERN1	102	.	0			c.G2501A						.						88.0	87.0	87.0					17																	62125246		1899	4116	6015	SO:0001583	missense	2081	exon19			TCTAGGCTCCAGA	AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.2501G>A	chr17.hg19:g.62125246C>T	ENSP00000401445:p.Ser834Asn	81.0	0.0		57.0	4.0	NM_001433		Missense_Mutation	SNP	ENST00000433197.3	hg19	CCDS45762.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214490	0.58452	.	.	ENSG00000178607	ENST00000433197	T	0.50001	0.76	5.32	4.32	0.51571	Protein kinase-like domain (1);	0.268637	0.47852	D	0.000215	T	0.29126	0.0724	N	0.17838	0.53	0.45528	D	0.998483	B	0.09022	0.002	B	0.04013	0.001	T	0.07501	-1.0769	10	0.18710	T	0.47	-8.8444	9.1781	0.37125	0.0:0.7764:0.1435:0.0801	.	834	O75460	ERN1_HUMAN	N	834	ENSP00000401445:S834N	ENSP00000401445:S834N	S	-	2	0	ERN1	59478978	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	2.360000	0.44151	1.310000	0.45006	0.561000	0.74099	AGC	.	.		0.438	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443734.2	NM_001433	
PITPNC1	26207	hgsc.bcm.edu	37	17	65665662	65665662	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:65665662A>G	ENST00000581322.1	+	7	501	c.501A>G	c.(499-501)ggA>ggG	p.G167G	PITPNC1_ENST00000299954.9_Silent_p.G167G|PITPNC1_ENST00000335257.6_Silent_p.G167G|PITPNC1_ENST00000580974.1_Silent_p.G167G			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1	167					phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			CAGGACGGGGACAGTTGAGGG	0.423																																					p.G167G		Atlas-SNP	.											.	PITPNC1	47	.	0			c.A501G						.						78.0	77.0	77.0					17																	65665662		1890	4123	6013	SO:0001819	synonymous_variant	26207	exon7			ACGGGGACAGTTG	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.501A>G	chr17.hg19:g.65665662A>G		111.0	0.0		98.0	4.0	NM_012417	A8K473|J3QR20|Q96I07	Silent	SNP	ENST00000581322.1	hg19	CCDS58588.1																																																																																			.	.		0.423	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447194.1	NM_012417	
NUP85	79902	hgsc.bcm.edu	37	17	73205985	73205985	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:73205985T>C	ENST00000245544.4	+	3	266	c.195T>C	c.(193-195)tcT>tcC	p.S65S	NUP85_ENST00000541827.1_Silent_p.S19S|NUP85_ENST00000579324.1_5'UTR|NUP85_ENST00000579298.1_Silent_p.S65S|NUP85_ENST00000447371.2_5'UTR|NUP85_ENST00000449421.2_3'UTR	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	65					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			ATGTTTACTCTCAAATCTTGA	0.368																																					p.S65S		Atlas-SNP	.											.	NUP85	44	.	0			c.T195C						.						72.0	76.0	75.0					17																	73205985		2203	4300	6503	SO:0001819	synonymous_variant	79902	exon3			TTACTCTCAAATC	AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.195T>C	chr17.hg19:g.73205985T>C		79.0	0.0		99.0	4.0	NM_024844	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Silent	SNP	ENST00000245544.4	hg19	CCDS32730.1																																																																																			.	.		0.368	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446619.1	NM_024844	
MXRA7	439921	hgsc.bcm.edu	37	17	74681182	74681182	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:74681182T>C	ENST00000355797.3	-	3	480	c.472A>G	c.(472-474)Acc>Gcc	p.T158A	MXRA7_ENST00000592148.1_Missense_Mutation_p.T201A|MXRA7_ENST00000589082.1_Missense_Mutation_p.T3A|MXRA7_ENST00000585519.1_Missense_Mutation_p.T3A|MXRA7_ENST00000588114.1_Missense_Mutation_p.T3A|MXRA7_ENST00000375036.2_Missense_Mutation_p.T158A|MXRA7_ENST00000449428.2_Missense_Mutation_p.T158A	NM_001008528.1	NP_001008528.1	P84157	MXRA7_HUMAN	matrix-remodelling associated 7	158						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						TCCTCTTTGGTCATCATCTTC	0.622																																					p.T158A		Atlas-SNP	.											.	MXRA7	11	.	0			c.A472G						.						168.0	156.0	160.0					17																	74681182		2203	4300	6503	SO:0001583	missense	439921	exon3			CTTTGGTCATCAT	BC053983	CCDS32745.1, CCDS32746.1, CCDS45786.1	17q25.1	2007-08-01				ENSG00000182534			7541	protein-coding gene	gene with protein product							Standard	XM_005257382		Approved	FLJ46603, TMAP1, PS1TP1	uc002jsk.1	P84157		ENST00000355797.3:c.472A>G	chr17.hg19:g.74681182T>C	ENSP00000348050:p.Thr158Ala	194.0	0.0		127.0	6.0	NM_001008529	Q0P5W3	Missense_Mutation	SNP	ENST00000355797.3	hg19	CCDS32745.1	.	.	.	.	.	.	.	.	.	.	T	13.03	2.114136	0.37339	.	.	ENSG00000182534	ENST00000355797;ENST00000449428;ENST00000375036;ENST00000392488	T;T;T	0.38887	1.11;1.11;1.11	5.27	5.27	0.74061	.	0.065190	0.64402	D	0.000014	T	0.63674	0.2531	M	0.70595	2.14	0.22819	N	0.998693	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.83275	0.996;0.996;0.96	T	0.59537	-0.7436	10	0.59425	D	0.04	-34.9645	14.8581	0.70355	0.0:0.0:0.0:1.0	.	158;158;158	P84157-2;P84157-3;P84157	.;.;MXRA7_HUMAN	A	158	ENSP00000348050:T158A;ENSP00000391466:T158A;ENSP00000364176:T158A	ENSP00000348050:T158A	T	-	1	0	MXRA7	72192777	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.144000	0.42197	1.997000	0.58415	0.379000	0.24179	ACC	.	.		0.622	MXRA7-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450983.1	NM_001008529	
PGS1	9489	hgsc.bcm.edu	37	17	76421461	76421461	+	IGR	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:76421461T>C	ENST00000262764.6	+	0	2201				DNAH17_ENST00000389840.5_Silent_p.R4392R|AC061992.1_ENST00000600087.1_5'Flank|DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000585328.1_Silent_p.R4364R	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			AGGAGCCCTCTCGCGGAGGAG	0.547																																					p.R4369R	Esophageal Squamous(45;182 1126 10685 43198)	Atlas-SNP	.											.	DNAH17	347	.	0			c.A13107G						.						114.0	113.0	113.0					17																	76421461		2203	4300	6503	SO:0001628	intergenic_variant	8632	exon80			GCCCTCTCGCGGA		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8			chr17.hg19:g.76421461T>C		148.0	0.0		63.0	5.0	NM_173628	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Silent	SNP	ENST00000262764.6	hg19	CCDS42391.1																																																																																			.	.		0.547	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
CARD14	79092	hgsc.bcm.edu	37	17	78163550	78163550	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:78163550A>G	ENST00000573882.1	+	8	1379		c.e8-1		CARD14_ENST00000344227.2_Splice_Site|CARD14_ENST00000573754.1_Splice_Site|CARD14_ENST00000392434.2_Splice_Site|CARD14_ENST00000570421.1_Splice_Site			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14						activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TCTCTGCCCCAGGCGGAGAAG	0.677																																					.		Atlas-SNP	.											CARD14_ENST00000309710,right_upper_lobe,carcinoma,0,2	CARD14	98	.	0			c.844-2A>G						.						10.0	13.0	12.0					17																	78163550		2180	4246	6426	SO:0001630	splice_region_variant	79092	exon6			TGCCCCAGGCGGA	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.844-1A>G	chr17.hg19:g.78163550A>G		125.0	0.0		92.0	5.0	NM_001257970	B8QQJ3|Q9BVB5	Splice_Site	SNP	ENST00000573882.1	hg19	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	A	11.94	1.789921	0.31685	.	.	ENSG00000141527	ENST00000344227;ENST00000392434;ENST00000309710	.	.	.	3.9	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.359	0.43982	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CARD14	75778145	1.000000	0.71417	0.777000	0.31699	0.384000	0.30261	4.838000	0.62803	1.640000	0.50565	0.383000	0.25322	.	.	.		0.677	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		Intron
MYADML2	255275	hgsc.bcm.edu	37	17	79899113	79899113	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:79899113T>C	ENST00000409745.2	-	3	859	c.505A>G	c.(505-507)Atc>Gtc	p.I169V	AC137723.5_ENST00000415556.1_RNA|MYADML2_ENST00000330655.3_Missense_Mutation_p.I169V	NM_001145113.2	NP_001138585.2	A6NDP7	MADL2_HUMAN	myeloid-associated differentiation marker-like 2	169	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)	1						GCCTGGACGATCTTGAGGAGC	0.687																																					p.I169V		Atlas-SNP	.											.	MYADML2	11	.	0			c.A505G						.						18.0	28.0	25.0					17																	79899113		691	1590	2281	SO:0001583	missense	255275	exon3			GGACGATCTTGAG	AC137723, BC029306	CCDS45815.1	17q25.3	2008-10-15			ENSG00000185105	ENSG00000185105			34548	protein-coding gene	gene with protein product							Standard	NM_001145113		Approved	LOC255275	uc010wvf.1	A6NDP7	OTTHUMG00000154388	ENST00000409745.2:c.505A>G	chr17.hg19:g.79899113T>C	ENSP00000386702:p.Ile169Val	205.0	0.0		109.0	5.0	NM_001145113		Missense_Mutation	SNP	ENST00000409745.2	hg19	CCDS45815.1	.	.	.	.	.	.	.	.	.	.	T	1.536	-0.542959	0.04053	.	.	ENSG00000185105	ENST00000409745;ENST00000330655	T;T	0.26660	1.72;1.72	4.95	3.88	0.44766	Marvel (1);MARVEL-like domain (1);	0.207537	0.43579	N	0.000549	T	0.06508	0.0167	N	0.01128	-1	0.30016	N	0.814733	B	0.06786	0.001	B	0.06405	0.002	T	0.33650	-0.9860	10	0.02654	T	1	-2.6774	7.7198	0.28725	0.0:0.1612:0.0:0.8388	.	169	A6NDP7	MADL2_HUMAN	V	169	ENSP00000386702:I169V;ENSP00000327718:I169V	ENSP00000327718:I169V	I	-	1	0	MYADML2	77492404	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	1.959000	0.40412	0.933000	0.37291	0.459000	0.35465	ATC	.	.		0.687	MYADML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335008.2	XR_041347	
OGFOD3	79701	hgsc.bcm.edu	37	17	80373502	80373502	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:80373502T>C	ENST00000313056.5	-	2	227	c.76A>G	c.(76-78)Acc>Gcc	p.T26A	Y_RNA_ENST00000364369.1_RNA|OGFOD3_ENST00000329197.5_Splice_Site_p.T26A|HEXDC_ENST00000337014.6_5'Flank	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	26						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										TCCTTCTTGGTGCTGAGAACA	0.627																																					p.T26A		Atlas-SNP	.											.	.	.	.	0			c.A76G						.						22.0	22.0	22.0					17																	80373502		2202	4300	6502	SO:0001630	splice_region_variant	79701	exon2			TCTTGGTGCTGAG	BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.75-1A>G	chr17.hg19:g.80373502T>C		40.0	0.0		39.0	4.0	NM_175902	C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	ENST00000313056.5	hg19	CCDS11811.1	.	.	.	.	.	.	.	.	.	.	T	5.200	0.222353	0.09863	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.30981	1.97;1.51	4.8	1.3	0.21679	.	1.190410	0.06440	N	0.725797	T	0.14141	0.0342	N	0.19112	0.55	0.09310	N	1	B;B	0.18013	0.002;0.025	B;B	0.13407	0.001;0.009	T	0.25813	-1.0121	10	0.05721	T	0.95	-19.1623	0.563	0.00682	0.1721:0.1931:0.1785:0.4563	.	26;26	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	A	26	ENSP00000320116:T26A;ENSP00000330075:T26A	ENSP00000320116:T26A	T	-	1	0	C17orf101	77966791	0.311000	0.24536	0.019000	0.16419	0.197000	0.23852	0.497000	0.22514	0.179000	0.19938	0.533000	0.62120	ACC	.	.		0.627	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442895.1	NM_175902	Missense_Mutation
NDC80	10403	hgsc.bcm.edu	37	18	2578924	2578924	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:2578924A>G	ENST00000261597.4	+	6	658		c.e6-1			NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component						attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						GATTTCTCATAGGTATCCTTT	0.348																																					.		Atlas-SNP	.											.	NDC80	62	.	0			c.477-2A>G						.						79.0	75.0	76.0					18																	2578924		2203	4300	6503	SO:0001630	splice_region_variant	10403	exon6			TCTCATAGGTATC	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.477-1A>G	chr18.hg19:g.2578924A>G		90.0	0.0		79.0	4.0	NM_006101	Q6PJX2	Splice_Site	SNP	ENST00000261597.4	hg19	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	A	6.054	0.378338	0.11466	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.884	0.46955	0.8424:0.1576:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NDC80	2568924	1.000000	0.71417	0.638000	0.29380	0.981000	0.71138	7.783000	0.85696	2.048000	0.60808	0.454000	0.30748	.	.	.		0.348	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	Intron
MYOM1	8736	hgsc.bcm.edu	37	18	3086103	3086103	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:3086103T>C	ENST00000356443.4	-	30	4517	c.4184A>G	c.(4183-4185)gAg>gGg	p.E1395G	MYOM1_ENST00000400569.3_Missense_Mutation_p.E1395G|MYOM1_ENST00000261606.7_Missense_Mutation_p.E1299G	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1395	Ig-like C2-type 4.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TATCTCCCTCTCATCTTTGTA	0.328																																					p.E1395G		Atlas-SNP	.											.	MYOM1	192	.	0			c.A4184G						.						157.0	142.0	146.0					18																	3086103		1869	4096	5965	SO:0001583	missense	8736	exon30			TCCCTCTCATCTT	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4184A>G	chr18.hg19:g.3086103T>C	ENSP00000348821:p.Glu1395Gly	74.0	0.0		74.0	5.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	hg19	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	T	4.856	0.159101	0.09236	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.63255	-0.03;-0.03;-0.03	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.270699	0.42172	D	0.000741	T	0.36771	0.0979	N	0.01705	-0.755	0.41370	D	0.987482	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.30031	-0.9992	10	0.21540	T	0.41	.	16.0953	0.81117	0.0:0.0:0.0:1.0	.	1299;1395	P52179-2;P52179	.;MYOM1_HUMAN	G	1395;1395;1299	ENSP00000348821:E1395G;ENSP00000383413:E1395G;ENSP00000261606:E1299G	ENSP00000261606:E1299G	E	-	2	0	MYOM1	3076103	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	3.997000	0.57016	2.204000	0.70986	0.383000	0.25322	GAG	.	.		0.328	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
ANKRD12	23253	hgsc.bcm.edu	37	18	9256481	9256481	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:9256481T>C	ENST00000262126.4	+	9	3456	c.3216T>C	c.(3214-3216)aaT>aaC	p.N1072N	ANKRD12_ENST00000383440.2_Silent_p.N1049N|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Silent_p.N1049N	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1072						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						GGTTAGTGAATGATGATTTAA	0.338																																					p.N1072N		Atlas-SNP	.											.	ANKRD12	167	.	0			c.T3216C						.						106.0	113.0	111.0					18																	9256481		2200	4294	6494	SO:0001819	synonymous_variant	23253	exon9			AGTGAATGATGAT	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3216T>C	chr18.hg19:g.9256481T>C		86.0	0.0		83.0	4.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	hg19	CCDS11843.1																																																																																			.	.		0.338	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANKRD12	23253	hgsc.bcm.edu	37	18	9258341	9258341	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:9258341A>T	ENST00000262126.4	+	9	5316	c.5076A>T	c.(5074-5076)ttA>ttT	p.L1692F	ANKRD12_ENST00000383440.2_Missense_Mutation_p.L1669F|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Missense_Mutation_p.L1669F	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1692						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AAAGCATTTTATCAAGTCTGG	0.348																																					p.L1692F		Atlas-SNP	.											.	ANKRD12	167	.	0			c.A5076T						.						43.0	39.0	40.0					18																	9258341		2203	4300	6503	SO:0001583	missense	23253	exon9			CATTTTATCAAGT	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5076A>T	chr18.hg19:g.9258341A>T	ENSP00000262126:p.Leu1692Phe	59.0	0.0		65.0	4.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.296553	0.60086	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.61040	0.14;0.14	5.33	2.94	0.34122	.	0.505173	0.19543	N	0.111741	T	0.57888	0.2084	L	0.32530	0.975	0.40439	D	0.980025	D;P	0.56746	0.977;0.933	P;P	0.58873	0.847;0.518	T	0.55218	-0.8175	10	0.38643	T	0.18	-4.8767	9.4447	0.38690	0.8548:0.0:0.1452:0.0	.	1669;1692	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	F	1669;1692	ENSP00000372932:L1669F;ENSP00000262126:L1692F	ENSP00000262126:L1692F	L	+	3	2	ANKRD12	9248341	1.000000	0.71417	0.999000	0.59377	0.711000	0.40976	1.963000	0.40452	0.962000	0.38057	0.533000	0.62120	TTA	.	.		0.348	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
CEP192	55125	hgsc.bcm.edu	37	18	13071058	13071058	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:13071058A>G	ENST00000325971.8	+	26	5000	c.3407A>G	c.(3406-3408)cAg>cGg	p.Q1136R	CEP192_ENST00000430049.2_Missense_Mutation_p.Q1257R|CEP192_ENST00000506447.1_Missense_Mutation_p.Q1732R			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1136					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ATATTTGTGCAGCCATTTGGA	0.373																																					p.Q1732R		Atlas-SNP	.											.	CEP192	340	.	0			c.A5195G						.						88.0	86.0	87.0					18																	13071058		2203	4300	6503	SO:0001583	missense	55125	exon28			TTGTGCAGCCATT	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.3407A>G	chr18.hg19:g.13071058A>G	ENSP00000317156:p.Gln1136Arg	118.0	0.0		112.0	5.0	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	hg19		.	.	.	.	.	.	.	.	.	.	A	6.117	0.389777	0.11581	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.41400	1.0;1.0;1.0	5.35	4.18	0.49190	.	0.279464	0.29293	N	0.012580	T	0.47395	0.1443	L	0.54323	1.7	0.26227	N	0.979068	P;P;P	0.47910	0.902;0.681;0.634	P;B;B	0.51701	0.677;0.204;0.167	T	0.35226	-0.9797	10	0.42905	T	0.14	-1.8017	9.8998	0.41340	0.647:0.0:0.0:0.353	.	1257;1732;334	C9JT09;E9PF99;Q9HCK3	.;.;.	R	1732;1136;1136;1257	ENSP00000427550:Q1732R;ENSP00000317156:Q1136R;ENSP00000389190:Q1257R	ENSP00000317156:Q1136R	Q	+	2	0	CEP192	13061058	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	3.824000	0.55723	0.841000	0.35020	0.528000	0.53228	CAG	.	.		0.373	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
LDLRAD4	753	hgsc.bcm.edu	37	18	13643356	13643356	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:13643356A>G	ENST00000359446.5	+	5	804		c.e5-1		LDLRAD4_ENST00000586765.1_Intron|LDLRAD4_ENST00000361205.4_Splice_Site|LDLRAD4_ENST00000585931.1_Splice_Site|RP11-701H16.4_ENST00000588397.1_RNA|LDLRAD4_ENST00000399848.3_Intron|LDLRAD4_ENST00000587757.1_Splice_Site|LDLRAD4_ENST00000592991.1_Splice_Site	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4						negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)										CCCCTCCGCCAGGAAGGGTGC	0.652																																					.		Atlas-SNP	.											.	.	.	.	0			c.226-2A>G						.						10.0	8.0	9.0					18																	13643356		2197	4281	6478	SO:0001630	splice_region_variant	753	exon3			TCCGCCAGGAAGG	AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.337-1A>G	chr18.hg19:g.13643356A>G		251.0	0.0		199.0	8.0	NM_001003674	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Splice_Site	SNP	ENST00000359446.5	hg19	CCDS32793.1	.	.	.	.	.	.	.	.	.	.	A	18.06	3.540032	0.65085	.	.	ENSG00000168675	ENST00000361205;ENST00000359446;ENST00000361303	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9913	0.71390	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C18orf1	13633356	1.000000	0.71417	0.993000	0.49108	0.660000	0.38997	7.988000	0.88194	2.013000	0.59113	0.528000	0.53228	.	.	.		0.652	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458326.1	NM_181481	Intron
DSG3	1830	hgsc.bcm.edu	37	18	29056124	29056124	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:29056124T>C	ENST00000257189.4	+	16	2984	c.2901T>C	c.(2899-2901)tgT>tgC	p.C967C		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	967					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GGGTGATCTGTCCCATTTCCA	0.512																																					p.C967C		Atlas-SNP	.											.	DSG3	172	.	0			c.T2901C						.						140.0	127.0	131.0					18																	29056124		2203	4300	6503	SO:0001819	synonymous_variant	1830	exon16			GATCTGTCCCATT	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2901T>C	chr18.hg19:g.29056124T>C		109.0	0.0		111.0	5.0	NM_001944	A8K2V2	Silent	SNP	ENST00000257189.4	hg19	CCDS11898.1																																																																																			.	.		0.512	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944	
TTR	7276	hgsc.bcm.edu	37	18	29172906	29172906	+	Silent	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:29172906T>A	ENST00000237014.3	+	2	294	c.117T>A	c.(115-117)gcT>gcA	p.A39A		NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin	39					extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)			cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TTCTAGATGCTGTCCGAGGCA	0.502																																					p.A39A		Atlas-SNP	.											.	TTR	21	.	0			c.T117A						.						140.0	115.0	123.0					18																	29172906		2203	4300	6503	SO:0001819	synonymous_variant	7276	exon2			AGATGCTGTCCGA	M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.117T>A	chr18.hg19:g.29172906T>A		145.0	0.0		144.0	64.0	NM_000371	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Silent	SNP	ENST00000237014.3	hg19	CCDS11899.1																																																																																			.	.		0.502	TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254948.1	NM_000371	
PIGN	23556	hgsc.bcm.edu	37	18	59806257	59806257	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:59806257T>C	ENST00000357637.5	-	13	1490	c.1075A>G	c.(1075-1077)Agc>Ggc	p.S359G	PIGN_ENST00000400334.3_Missense_Mutation_p.S359G	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	359					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				GTAAACATGCTCTCTGCTTTG	0.343																																					p.S359G		Atlas-SNP	.											.	PIGN	62	.	0			c.A1075G						.						62.0	57.0	58.0					18																	59806257		1830	4089	5919	SO:0001583	missense	23556	exon13			ACATGCTCTCTGC	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1075A>G	chr18.hg19:g.59806257T>C	ENSP00000350263:p.Ser359Gly	154.0	0.0		174.0	8.0	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	hg19	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.504461	0.85176	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.26660	1.72;1.72	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.37156	0.0993	M	0.80028	2.48	0.58432	D	0.999996	P;P	0.43885	0.82;0.82	B;B	0.42593	0.392;0.392	T	0.28839	-1.0031	9	.	.	.	-10.5543	15.3535	0.74409	0.0:0.0:0.0:1.0	.	359;359	B2RCI8;O95427	.;PIGN_HUMAN	G	359	ENSP00000350263:S359G;ENSP00000383188:S359G	.	S	-	1	0	PIGN	57957237	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.945000	0.63568	2.267000	0.75376	0.477000	0.44152	AGC	.	.		0.343	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
MIER2	54531	hgsc.bcm.edu	37	19	327183	327183	+	Missense_Mutation	SNP	G	G	T	rs201881025	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:327183G>T	ENST00000264819.4	-	5	453	c.443C>A	c.(442-444)cCg>cAg	p.P148Q	MIER2_ENST00000592722.1_5'Flank	NM_017550.1	NP_060020.1	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family member 2	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(4)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCACGGACGGGGTGAGGTC	0.527																																					p.P148Q		Atlas-SNP	.											MIER2,lower_third,carcinoma,0,1	MIER2	51	.	0			c.C443A						.						230.0	206.0	214.0					19																	327183		2203	4300	6503	SO:0001583	missense	54531	exon5			ACGGACGGGGTGA	AB033019	CCDS32855.1	19p13.3	2008-02-05	2006-04-20	2006-04-20		ENSG00000105556			29210	protein-coding gene	gene with protein product			"""KIAA1193"""	KIAA1193		10574462	Standard	NM_017550		Approved		uc002lok.1	Q8N344		ENST00000264819.4:c.443C>A	chr19.hg19:g.327183G>T	ENSP00000264819:p.Pro148Gln	139.0	0.0		101.0	0.0	NM_017550	Q9ULM7	Missense_Mutation	SNP	ENST00000264819.4	hg19	CCDS32855.1	.	.	.	.	.	.	.	.	.	.	.	19.76	3.888213	0.72524	.	.	ENSG00000105556	ENST00000264819	T	0.35236	1.32	5.27	5.27	0.74061	.	0.000000	0.47852	D	0.000209	T	0.56396	0.1982	M	0.64567	1.98	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.50866	-0.8777	10	0.30854	T	0.27	-18.6425	16.085	0.81038	0.0:0.0:1.0:0.0	.	148	Q8N344	MIER2_HUMAN	Q	148	ENSP00000264819:P148Q	ENSP00000264819:P148Q	P	-	2	0	MIER2	278183	1.000000	0.71417	0.819000	0.32651	0.736000	0.42039	8.384000	0.90160	2.474000	0.83562	0.650000	0.86243	CCG	.	G|0.998;A|0.002		0.527	MIER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451784.1	XM_041843	
REXO1	57455	hgsc.bcm.edu	37	19	1828117	1828117	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:1828117T>C	ENST00000170168.4	-	2	765	c.671A>G	c.(670-672)gAc>gGc	p.D224G	REXO1_ENST00000587524.1_5'UTR	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	224						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGAGTTGTCCACCACGTA	0.682																																					p.D224G		Atlas-SNP	.											.	REXO1	55	.	0			c.A671G						.						40.0	45.0	44.0					19																	1828117		2196	4281	6477	SO:0001583	missense	57455	exon2			GAGTTGTCCACCA	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.671A>G	chr19.hg19:g.1828117T>C	ENSP00000170168:p.Asp224Gly	50.0	0.0		72.0	4.0	NM_020695	Q9ULT2	Missense_Mutation	SNP	ENST00000170168.4	hg19	CCDS32866.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.968891	0.53614	.	.	ENSG00000079313	ENST00000170168;ENST00000413153	T	0.53640	0.61	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.66674	0.2813	M	0.75264	2.295	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.70824	-0.4767	10	0.66056	D	0.02	-27.6895	12.4807	0.55839	0.0:0.0:0.0:1.0	.	178;224	F5H016;Q8N1G1	.;REXO1_HUMAN	G	224;178	ENSP00000170168:D224G	ENSP00000170168:D224G	D	-	2	0	REXO1	1779117	1.000000	0.71417	0.924000	0.36721	0.064000	0.16182	7.113000	0.77095	1.734000	0.51633	0.459000	0.35465	GAC	.	.		0.682	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
IZUMO4	113177	hgsc.bcm.edu	37	19	2098975	2098975	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:2098975A>G	ENST00000395301.3	+	9	619	c.555A>G	c.(553-555)agA>agG	p.R185R	MOB3A_ENST00000357066.3_5'Flank|IZUMO4_ENST00000588003.1_3'UTR|IZUMO4_ENST00000395307.2_Intron	NM_001039846.1	NP_001034935.1	Q1ZYL8	IZUM4_HUMAN	IZUMO family member 4	185						extracellular region (GO:0005576)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	6						TCATGAACAGACCACGCTCCT	0.607																																					p.R185R		Atlas-SNP	.											.	IZUMO4	25	.	0			c.A555G						.						93.0	103.0	100.0					19																	2098975		2143	4232	6375	SO:0001630	splice_region_variant	113177	exon9			GAACAGACCACGC	BC014609	CCDS35499.1, CCDS42458.1	19p13.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000099840	ENSG00000099840		"""-"""	26950	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 36"""	C19orf36		12975309, 19658160, 22957301	Standard	XM_005259480		Approved		uc002luw.1	Q1ZYL8	OTTHUMG00000141290	ENST00000395301.3:c.555-1A>G	chr19.hg19:g.2098975A>G		107.0	0.0		98.0	4.0	NM_001039846	A7RA93|A7RA94|Q6UXA2|Q96FT6|Q96L02	Silent	SNP	ENST00000395301.3	hg19	CCDS42458.1																																																																																			.	.		0.607	IZUMO4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280536.3	NM_052878	Silent
ACSBG2	81616	hgsc.bcm.edu	37	19	6161259	6161259	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:6161259A>G	ENST00000586696.1	+	6	817	c.541A>G	c.(541-543)Atc>Gtc	p.I181V	ACSBG2_ENST00000588304.1_Missense_Mutation_p.I131V|ACSBG2_ENST00000252669.5_Missense_Mutation_p.I181V|ACSBG2_ENST00000591403.1_Missense_Mutation_p.I181V|ACSBG2_ENST00000588485.1_5'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	181					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCTAAAAGCGATCATCCAGTA	0.522																																					p.I181V		Atlas-SNP	.											.	ACSBG2	83	.	0			c.A541G						.						97.0	88.0	91.0					19																	6161259		2203	4300	6503	SO:0001583	missense	81616	exon6			AAAGCGATCATCC		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.541A>G	chr19.hg19:g.6161259A>G	ENSP00000465589:p.Ile181Val	93.0	0.0		88.0	4.0	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	hg19	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	A	8.218	0.801916	0.16397	.	.	ENSG00000130377	ENST00000252669	T	0.09163	3.01	4.65	4.65	0.58169	AMP-dependent synthetase/ligase (1);	0.000000	0.37348	N	0.002122	T	0.15435	0.0372	L	0.33710	1.025	0.48236	D	0.999612	B;D	0.53885	0.276;0.963	P;P	0.57720	0.557;0.826	T	0.09292	-1.0681	10	0.17369	T	0.5	-45.9474	11.0323	0.47781	1.0:0.0:0.0:0.0	.	181;181	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	V	181	ENSP00000252669:I181V	ENSP00000252669:I181V	I	+	1	0	ACSBG2	6112259	0.926000	0.31397	0.068000	0.19968	0.033000	0.12548	3.388000	0.52509	2.026000	0.59711	0.467000	0.42956	ATC	.	.		0.522	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
EPOR	2057	hgsc.bcm.edu	37	19	11491862	11491862	+	Silent	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:11491862G>T	ENST00000222139.6	-	5	713	c.609C>A	c.(607-609)acC>acA	p.T203T	EPOR_ENST00000592375.2_Silent_p.T203T	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	203	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	GCACACACTCGGTGCGGCCCT	0.677											OREG0025255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T203T		Atlas-SNP	.											.	EPOR	26	.	0			c.C609A						.						3.0	4.0	4.0					19																	11491862		1948	3854	5802	SO:0001819	synonymous_variant	2057	exon5			ACACTCGGTGCGG	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.609C>A	chr19.hg19:g.11491862G>T		63.0	0.0	672	25.0	22.0	NM_000121	B2RCG4|Q15443|Q2M205	Silent	SNP	ENST00000222139.6	hg19	CCDS12260.1																																																																																			.	.		0.677	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458791.1		
RGL3	57139	hgsc.bcm.edu	37	19	11527335	11527335	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:11527335C>T	ENST00000380456.3	-	4	441	c.378G>A	c.(376-378)gaG>gaA	p.E126E	RGL3_ENST00000393423.3_Silent_p.E126E	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	126	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						TCTTCTTGATCTCTACCCTGG	0.562																																					p.E126E	GBM(174;751 2067 17998 27979 33959)	Atlas-SNP	.											.	RGL3	100	.	0			c.G378A						.						96.0	89.0	92.0					19																	11527335		2203	4300	6503	SO:0001819	synonymous_variant	57139	exon4			CTTGATCTCTACC	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.378G>A	chr19.hg19:g.11527335C>T		132.0	0.0		66.0	4.0	NM_001035223	B5ME84|B7ZL22|Q0P6G0	Silent	SNP	ENST00000380456.3	hg19	CCDS32910.1																																																																																			.	.		0.562	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3	XM_290867	
ACP5	54	hgsc.bcm.edu	37	19	11687318	11687318	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:11687318T>C	ENST00000592828.1	-	6	877	c.475A>G	c.(475-477)Aca>Gca	p.T159A	ACP5_ENST00000218758.5_Missense_Mutation_p.T159A|ACP5_ENST00000433365.2_Missense_Mutation_p.T159A|ACP5_ENST00000412435.2_Missense_Mutation_p.T159A|ACP5_ENST00000590420.1_Intron	NM_001111034.1	NP_001104504.1	P13686	PPA5_HUMAN	acid phosphatase 5, tartrate resistant	159					bone morphogenesis (GO:0060349)|bone resorption (GO:0045453)|defense response to Gram-positive bacterium (GO:0050830)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of superoxide anion generation (GO:0032929)|negative regulation of tumor necrosis factor production (GO:0032720)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	acid phosphatase activity (GO:0003993)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	9						CCACATAGTGTCACTGTGTCC	0.557																																					p.T159A		Atlas-SNP	.											.	ACP5	30	.	0			c.A475G						.						79.0	80.0	80.0					19																	11687318		2203	4300	6503	SO:0001583	missense	54	exon5			ATAGTGTCACTGT	X14618	CCDS12265.1	19p13.2	2012-10-02			ENSG00000102575	ENSG00000102575	3.1.3.2		124	protein-coding gene	gene with protein product	"""tartrate-resistant acid phosphatase"""	171640				8449511, 2338077	Standard	NM_001611		Approved	TRAP	uc002msj.4	P13686	OTTHUMG00000182036	ENST00000592828.1:c.475A>G	chr19.hg19:g.11687318T>C	ENSP00000468767:p.Thr159Ala	132.0	0.0		60.0	4.0	NM_001111034	A8K3V2|Q2TAB1|Q6IAS6|Q9UCJ5|Q9UCJ6|Q9UCJ7	Missense_Mutation	SNP	ENST00000592828.1	hg19	CCDS12265.1	.	.	.	.	.	.	.	.	.	.	t	1.834	-0.469146	0.04445	.	.	ENSG00000102575	ENST00000218758;ENST00000412435;ENST00000433365	D;D;D	0.84442	-1.85;-1.85;-1.85	5.32	4.3	0.51218	Metallophosphoesterase domain (1);	0.432598	0.27991	N	0.017034	T	0.70762	0.3261	N	0.17594	0.5	0.58432	D	0.999998	B	0.12013	0.005	B	0.20767	0.031	T	0.59193	-0.7500	10	0.15952	T	0.53	-14.1409	7.5348	0.27704	0.0:0.1705:0.0:0.8295	.	159	P13686	PPA5_HUMAN	A	159	ENSP00000218758:T159A;ENSP00000392374:T159A;ENSP00000413456:T159A	ENSP00000218758:T159A	T	-	1	0	ACP5	11548318	0.035000	0.19736	0.642000	0.29436	0.018000	0.09664	0.534000	0.23098	0.864000	0.35578	0.533000	0.62120	ACA	.	.		0.557	ACP5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458881.1		
ZNF564	163050	hgsc.bcm.edu	37	19	12638001	12638001	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:12638001T>C	ENST00000339282.7	-	4	1117	c.921A>G	c.(919-921)ggA>ggG	p.G307G	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						ATTTATAAGGTCCATCCCCAG	0.388																																					p.G307G		Atlas-SNP	.											.	ZNF564	55	.	0			c.A921G						.						51.0	57.0	55.0					19																	12638001		2117	4254	6371	SO:0001819	synonymous_variant	163050	exon4			ATAAGGTCCATCC	BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.921A>G	chr19.hg19:g.12638001T>C		80.0	0.0		53.0	4.0	NM_144976	B9EGT4|Q6P1K6	Silent	SNP	ENST00000339282.7	hg19	CCDS42505.1																																																																																			.	.		0.388	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344120.2	NM_144976	
PRDX2	7001	hgsc.bcm.edu	37	19	12911584	12911584	+	Intron	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:12911584T>C	ENST00000301522.2	-	3	386				PRDX2_ENST00000435703.1_Missense_Mutation_p.R135G|CTD-2659N19.10_ENST00000585496.1_RNA|PRDX2_ENST00000334482.5_Intron	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2						cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						gtcatcatccttaaagacttg	0.448																																					p.R135G		Atlas-SNP	.											.	PRDX2	20	.	0			c.A403G						.						93.0	95.0	94.0					19																	12911584		1271	2268	3539	SO:0001627	intron_variant	7001	exon3			TCATCCTTAAAGA		CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.257+145A>G	chr19.hg19:g.12911584T>C		166.0	0.0		93.0	4.0	NM_181738	A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Missense_Mutation	SNP	ENST00000301522.2	hg19	CCDS12281.1	.	.	.	.	.	.	.	.	.	.	T	11.00	1.510123	0.27036	.	.	ENSG00000167815	ENST00000435703	T	0.53206	0.63	3.75	-1.07	0.09968	.	.	.	.	.	T	0.35248	0.0925	.	.	.	0.09310	N	1	B	0.25105	0.118	B	0.16289	0.015	T	0.25676	-1.0125	8	0.87932	D	0	.	10.4652	0.44602	0.0:0.0:0.607:0.393	.	135	A8K0C0	.	G	135	ENSP00000408905:R135G	ENSP00000408905:R135G	R	-	1	2	PRDX2	12772584	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.055000	0.11807	-0.367000	0.08052	0.379000	0.24179	AGG	.	.		0.448	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258950.2	NM_005809	
DNASE2	1777	hgsc.bcm.edu	37	19	12987072	12987072	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:12987072T>C	ENST00000222219.3	-	6	907	c.815A>G	c.(814-816)cAg>cGg	p.Q272R	DNASE2_ENST00000538460.1_Missense_Mutation_p.Q217R	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	272					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)			breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						ATTCAGAACCTGCCAGATATC	0.567																																					p.Q272R		Atlas-SNP	.											.	DNASE2	23	.	0			c.A815G						.						73.0	66.0	68.0					19																	12987072		2203	4300	6503	SO:0001583	missense	1777	exon6			AGAACCTGCCAGA	AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.815A>G	chr19.hg19:g.12987072T>C	ENSP00000222219:p.Gln272Arg	157.0	0.0		95.0	4.0	NM_001375	B2RD06|B7Z4K6|O43910	Missense_Mutation	SNP	ENST00000222219.3	hg19	CCDS12284.1	.	.	.	.	.	.	.	.	.	.	T	3.412	-0.119902	0.06838	.	.	ENSG00000105612	ENST00000222219;ENST00000538460	T;T	0.14144	2.53;2.53	4.75	2.64	0.31445	.	0.648987	0.16136	N	0.227968	T	0.09862	0.0242	L	0.43152	1.355	0.09310	N	1	B;B	0.12630	0.006;0.005	B;B	0.15052	0.004;0.012	T	0.33727	-0.9857	10	0.10111	T	0.7	.	7.5244	0.27647	0.0:0.1631:0.0:0.8369	.	217;272	B7Z4K6;O00115	.;DNS2A_HUMAN	R	272;217	ENSP00000222219:Q272R;ENSP00000445988:Q217R	ENSP00000222219:Q272R	Q	-	2	0	DNASE2	12848072	0.115000	0.22152	0.002000	0.10522	0.051000	0.14879	3.007000	0.49536	1.792000	0.52537	0.379000	0.24179	CAG	.	.		0.567	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451790.1		
SLC35E1	79939	hgsc.bcm.edu	37	19	16677349	16677349	+	Silent	SNP	G	G	A	rs371476983		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:16677349G>A	ENST00000595753.1	-	4	767	c.750C>T	c.(748-750)agC>agT	p.S250S	CTD-3222D19.10_ENST00000597851.1_RNA|CTD-3222D19.2_ENST00000409035.1_3'UTR|SLC35E1_ENST00000431408.1_Silent_p.S94S	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	250					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.S106R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						TCACCAAGTCGCTGCTGACCA	0.532																																					p.S250S		Atlas-SNP	.											SLC35E1,medulla,primitive_neuroectodermal_tumour-medulloblastoma,0,1	SLC35E1	48	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.C750T						.	G		0,4406		0,0,2203	67.0	66.0	67.0		750	-6.7	0.6	19		67	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC35E1	NM_024881.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		250/411	16677349	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	79939	exon4			CAAGTCGCTGCTG	AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.750C>T	chr19.hg19:g.16677349G>A		67.0	0.0		50.0	2.0	NM_024881	Q8NBQ2|Q96JV7	Silent	SNP	ENST00000595753.1	hg19	CCDS12346.2																																																																																			.	.		0.532	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
MYO9B	4650	hgsc.bcm.edu	37	19	17296790	17296790	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:17296790A>G	ENST00000594824.1	+	18	2704	c.2557A>G	c.(2557-2559)Atc>Gtc	p.I853V	MYO9B_ENST00000397274.2_Missense_Mutation_p.I853V|MYO9B_ENST00000595618.1_Missense_Mutation_p.I853V			Q13459	MYO9B_HUMAN	myosin IXB	853	Actin-binding.|Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TATCCGCTGCATCCGTTCCAA	0.532																																					p.I853V		Atlas-SNP	.											.	MYO9B	264	.	0			c.A2557G						.						94.0	94.0	94.0					19																	17296790		1956	4137	6093	SO:0001583	missense	4650	exon18			CGCTGCATCCGTT		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2557A>G	chr19.hg19:g.17296790A>G	ENSP00000471367:p.Ile853Val	127.0	0.0		76.0	4.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	hg19		.	.	.	.	.	.	.	.	.	.	A	21.7	4.192570	0.78902	.	.	ENSG00000099331	ENST00000397274	D	0.91407	-2.84	5.21	3.14	0.36123	Myosin head, motor domain (2);	0.107097	0.41097	N	0.000948	D	0.93494	0.7924	M	0.71920	2.185	0.39077	D	0.960827	P;P;D	0.64830	0.938;0.938;0.994	P;P;D	0.70227	0.895;0.895;0.968	D	0.92702	0.6175	10	0.72032	D	0.01	.	9.2272	0.37414	0.8691:0.0:0.1309:0.0	.	853;853;859	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	V	853	ENSP00000380444:I853V	ENSP00000380444:I853V	I	+	1	0	MYO9B	17157790	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.902000	0.56310	0.409000	0.25649	0.533000	0.62120	ATC	.	.		0.532	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
PGLS	25796	hgsc.bcm.edu	37	19	17622717	17622717	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:17622717A>G	ENST00000252603.2	+	1	280	c.236A>G	c.(235-237)gAc>gGc	p.D79G	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	79					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						GGCTTCTGCGACGAGCGCCTC	0.726																																					p.D79G		Atlas-SNP	.											.	PGLS	12	.	0			c.A236G						.						4.0	4.0	4.0					19																	17622717		1887	3720	5607	SO:0001583	missense	25796	exon1			TCTGCGACGAGCG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.236A>G	chr19.hg19:g.17622717A>G	ENSP00000252603:p.Asp79Gly	107.0	0.0		94.0	4.0	NM_012088		Missense_Mutation	SNP	ENST00000252603.2	hg19	CCDS12361.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.724584	0.89298	.	.	ENSG00000130313	ENST00000252603	T	0.73575	-0.76	4.91	4.91	0.64330	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.000000	0.85682	D	0.000000	D	0.91264	0.7246	H	0.99211	4.47	0.58432	D	0.999998	D	0.69078	0.997	D	0.79108	0.992	D	0.93425	0.6780	10	0.87932	D	0	-32.9105	10.9196	0.47156	1.0:0.0:0.0:0.0	.	79	O95336	6PGL_HUMAN	G	79	ENSP00000252603:D79G	ENSP00000252603:D79G	D	+	2	0	PGLS	17483717	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	6.477000	0.73591	1.834000	0.53371	0.402000	0.26972	GAC	.	.		0.726	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
ZNF507	22847	hgsc.bcm.edu	37	19	32843842	32843842	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:32843842C>A	ENST00000311921.4	+	2	298	c.106C>A	c.(106-108)Caa>Aaa	p.Q36K	ZNF507_ENST00000544431.1_Missense_Mutation_p.Q36K|ZNF507_ENST00000355898.5_Missense_Mutation_p.Q36K	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	36					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					AATTGATGAACAAAGAAAAAC	0.363																																					p.Q36K		Atlas-SNP	.											.	ZNF507	92	.	0			c.C106A						.						79.0	77.0	78.0					19																	32843842		2203	4300	6503	SO:0001583	missense	22847	exon3			GATGAACAAAGAA	AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.106C>A	chr19.hg19:g.32843842C>A	ENSP00000312277:p.Gln36Lys	106.0	0.0		125.0	5.0	NM_001136156	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Missense_Mutation	SNP	ENST00000311921.4	hg19	CCDS32985.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.505816	0.44558	.	.	ENSG00000168813	ENST00000355898;ENST00000311921;ENST00000544431	T;T;T	0.10382	3.21;3.21;2.88	5.5	4.47	0.54385	.	0.052456	0.85682	D	0.000000	T	0.28764	0.0713	M	0.65498	2.005	0.37694	D	0.923943	D;D	0.69078	0.982;0.997	P;D	0.64144	0.734;0.922	T	0.18304	-1.0341	10	0.59425	D	0.04	.	14.513	0.67800	0.1467:0.8533:0.0:0.0	.	36;36	Q8TCN5;Q8TCN5-2	ZN507_HUMAN;.	K	36	ENSP00000348162:Q36K;ENSP00000312277:Q36K;ENSP00000441549:Q36K	ENSP00000312277:Q36K	Q	+	1	0	ZNF507	37535682	1.000000	0.71417	0.992000	0.48379	0.854000	0.48673	2.630000	0.46494	1.449000	0.47699	0.491000	0.48974	CAA	.	.		0.363	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450301.3	NM_014910	
ZNF781	163115	hgsc.bcm.edu	37	19	38160811	38160811	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:38160811T>C	ENST00000590008.1	-	5	1091	c.239A>G	c.(238-240)aAg>aGg	p.K80R	ZNF781_ENST00000593040.1_5'Flank|ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000358582.4_Missense_Mutation_p.K80R			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	80					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						GTGAGTTCTCTTATGTTGAAT	0.388																																					p.K80R		Atlas-SNP	.											.	ZNF781	66	.	0			c.A239G						.						116.0	116.0	116.0					19																	38160811		2203	4300	6503	SO:0001583	missense	163115	exon4			GTTCTCTTATGTT	AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.239A>G	chr19.hg19:g.38160811T>C	ENSP00000466370:p.Lys80Arg	65.0	0.0		73.0	4.0	NM_152605	Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	hg19	CCDS12507.1	.	.	.	.	.	.	.	.	.	.	T	11.53	1.666019	0.29604	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	T	0.17854	2.25	2.23	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13841	0.0335	L	0.28458	0.855	0.18873	N	0.999989	B	0.22003	0.063	B	0.32465	0.146	T	0.36504	-0.9745	9	0.66056	D	0.02	.	6.0011	0.19521	0.0:0.1456:0.0:0.8544	.	80	Q8N8C0	ZN781_HUMAN	R	80	ENSP00000351391:K80R	ENSP00000351391:K80R	K	-	2	0	ZNF781	42852651	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.407000	0.07178	0.118000	0.18165	0.443000	0.29094	AAG	.	.		0.388	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	NM_152605	
CAPN12	147968	hgsc.bcm.edu	37	19	39226821	39226821	+	Silent	SNP	C	C	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:39226821C>G	ENST00000328867.4	-	12	1820	c.1512G>C	c.(1510-1512)ccG>ccC	p.P504P	CAPN12_ENST00000601953.1_Silent_p.P355P|CTD-2540F13.2_ENST00000602255.1_RNA	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	504	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GGGCGGTGCTCGGCACCACCA	0.746																																					p.P504P		Atlas-SNP	.											.	CAPN12	43	.	0			c.G1512C						.						5.0	6.0	6.0					19																	39226821		1557	2830	4387	SO:0001819	synonymous_variant	147968	exon12			GGTGCTCGGCACC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1512G>C	chr19.hg19:g.39226821C>G		55.0	0.0		31.0	15.0	NM_144691		Silent	SNP	ENST00000328867.4	hg19	CCDS12519.1																																																																																			.	.		0.746	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
PSMC4	5704	hgsc.bcm.edu	37	19	40478358	40478358	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:40478358T>C	ENST00000157812.2	+	3	416	c.218T>C	c.(217-219)cTc>cCc	p.L73P	PSMC4_ENST00000455878.2_Intron	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	73				L -> F (in Ref. 4; AAC32612). {ECO:0000305}.	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AAGGAATTTCTCCATGCCCAG	0.522																																					p.L73P	Colon(105;1478 1543 4034 6132 38638)	Atlas-SNP	.											.	PSMC4	48	.	0			c.T218C						.						78.0	78.0	78.0					19																	40478358		2203	4300	6503	SO:0001583	missense	5704	exon3			AATTTCTCCATGC	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.218T>C	chr19.hg19:g.40478358T>C	ENSP00000157812:p.Leu73Pro	63.0	0.0		92.0	5.0	NM_006503	Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	ENST00000157812.2	hg19	CCDS12547.1	.	.	.	.	.	.	.	.	.	.	t	21.1	4.097558	0.76870	.	.	ENSG00000013275	ENST00000157812	D	0.94376	-3.41	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.94631	0.8269	M	0.63843	1.955	0.80722	D	1	D	0.56968	0.978	P	0.59825	0.864	D	0.93612	0.6940	10	0.35671	T	0.21	-4.659	12.4603	0.55729	0.0:0.0:0.0:1.0	.	73	P43686	PRS6B_HUMAN	P	73	ENSP00000157812:L73P	ENSP00000157812:L73P	L	+	2	0	PSMC4	45170198	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.381000	0.79718	1.843000	0.53566	0.459000	0.35465	CTC	.	.		0.522	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	
PSMC4	5704	hgsc.bcm.edu	37	19	40478370	40478370	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:40478370A>G	ENST00000157812.2	+	3	428	c.230A>G	c.(229-231)gAg>gGg	p.E77G	PSMC4_ENST00000455878.2_Splice_Site_p.E46G	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	77					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CATGCCCAGGAGGAGGTGAAG	0.512																																					p.E77G	Colon(105;1478 1543 4034 6132 38638)	Atlas-SNP	.											.	PSMC4	48	.	0			c.A230G						.						74.0	74.0	74.0					19																	40478370		2203	4300	6503	SO:0001583	missense	5704	exon3			CCCAGGAGGAGGT	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.230A>G	chr19.hg19:g.40478370A>G	ENSP00000157812:p.Glu77Gly	65.0	0.0		95.0	4.0	NM_006503	Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	ENST00000157812.2	hg19	CCDS12547.1	.	.	.	.	.	.	.	.	.	.	a	24.3	4.511413	0.85389	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95103	-3.61;-3.52	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.95771	0.8624	L	0.52266	1.64	0.80722	D	1	B;D	0.89917	0.178;1.0	B;D	0.91635	0.088;0.999	D	0.95711	0.8758	10	0.56958	D	0.05	-3.8069	12.4603	0.55729	1.0:0.0:0.0:0.0	.	46;77	P43686-2;P43686	.;PRS6B_HUMAN	G	77;46	ENSP00000157812:E77G;ENSP00000413869:E46G	ENSP00000157812:E77G	E	+	2	0	PSMC4	45170210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.132000	0.77251	1.843000	0.53566	0.459000	0.35465	GAG	.	.		0.512	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	
LIG1	3978	hgsc.bcm.edu	37	19	48636271	48636271	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:48636271A>G	ENST00000263274.7	-	18	2112	c.1693T>C	c.(1693-1695)Tgc>Cgc	p.C565R	LIG1_ENST00000427526.2_Missense_Mutation_p.C534R|LIG1_ENST00000536218.1_Missense_Mutation_p.C497R	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	565					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	TTGTATTCGCAGGTGAAAGCT	0.567								Nucleotide excision repair (NER)																													p.C565R		Atlas-SNP	.											.	LIG1	151	.	0			c.T1693C						.						181.0	167.0	172.0					19																	48636271		2203	4300	6503	SO:0001583	missense	3978	exon18			ATTCGCAGGTGAA		CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1693T>C	chr19.hg19:g.48636271A>G	ENSP00000263274:p.Cys565Arg	102.0	0.0		124.0	5.0	NM_000234	B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	ENST00000263274.7	hg19	CCDS12711.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.313989	0.81358	.	.	ENSG00000105486	ENST00000263274;ENST00000544761;ENST00000427526;ENST00000536218	T;T;T	0.81330	-1.48;-1.48;-1.48	5.48	5.48	0.80851	DNA ligase, ATP-dependent, central (1);	0.000000	0.85682	D	0.000000	D	0.93609	0.7959	H	0.98594	4.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.95656	0.8711	10	0.87932	D	0	-26.6684	13.8169	0.63297	1.0:0.0:0.0:0.0	.	534;497;565	B4DTU4;F5GZ28;P18858	.;.;DNLI1_HUMAN	R	565;596;534;497	ENSP00000263274:C565R;ENSP00000442841:C534R;ENSP00000441531:C497R	ENSP00000263274:C565R	C	-	1	0	LIG1	53328083	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.964000	0.87933	2.215000	0.71742	0.533000	0.62120	TGC	.	.		0.567	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465575.1	NM_000234	
TULP2	7288	hgsc.bcm.edu	37	19	49385453	49385453	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:49385453T>C	ENST00000221399.3	-	12	1427	c.1283A>G	c.(1282-1284)gAg>gGg	p.E428G		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	428					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		CAGTAGCGACTCCTGTTCCTA	0.522																																					p.E428G		Atlas-SNP	.											.	TULP2	60	.	0			c.A1283G						.						72.0	64.0	67.0					19																	49385453		2203	4300	6503	SO:0001583	missense	7288	exon12			AGCGACTCCTGTT	U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.1283A>G	chr19.hg19:g.49385453T>C	ENSP00000221399:p.Glu428Gly	70.0	0.0		89.0	5.0	NM_003323	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	hg19	CCDS12739.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.113029	0.37242	.	.	ENSG00000104804	ENST00000221399	D	0.86694	-2.16	4.49	3.47	0.39725	Tubby, C-terminal (3);	0.236440	0.41294	N	0.000913	D	0.88190	0.6370	L	0.61218	1.895	0.42735	D	0.993723	P	0.49559	0.925	P	0.52957	0.714	D	0.87546	0.2462	10	0.87932	D	0	-16.2848	8.5097	0.33208	0.0:0.0938:0.0:0.9062	.	428	O00295	TULP2_HUMAN	G	428	ENSP00000221399:E428G	ENSP00000221399:E428G	E	-	2	0	TULP2	54077265	1.000000	0.71417	0.810000	0.32431	0.041000	0.13682	5.596000	0.67570	0.858000	0.35431	-0.451000	0.05528	GAG	.	.		0.522	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323	
MED25	81857	hgsc.bcm.edu	37	19	50333046	50333046	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:50333046G>A	ENST00000312865.6	+	6	582	c.529G>A	c.(529-531)Ggg>Agg	p.G177R	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	177	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		CCTACAGCGGGGGATCCACTT	0.662																																					p.G177R	GBM(51;894 1657 37868)	Atlas-SNP	.											.	MED25	98	.	0			c.G529A						.						12.0	11.0	11.0					19																	50333046		2200	4293	6493	SO:0001583	missense	81857	exon6			CAGCGGGGGATCC	AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.529G>A	chr19.hg19:g.50333046G>A	ENSP00000326767:p.Gly177Arg	147.0	0.0		167.0	83.0	NM_030973	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	ENST00000312865.6	hg19	CCDS33075.1	.	.	.	.	.	.	.	.	.	.	G	36	5.913557	0.97099	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000542221;ENST00000544580	T	0.77750	-1.12	5.38	4.35	0.52113	.	0.054424	0.64402	D	0.000001	T	0.82217	0.4989	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.83705	0.0184	10	0.66056	D	0.02	.	12.8803	0.58014	0.0786:0.0:0.9214:0.0	.	177	Q71SY5	MED25_HUMAN	R	177	ENSP00000326767:G177R	ENSP00000326767:G177R	G	+	1	0	MED25	55024858	1.000000	0.71417	0.638000	0.29380	0.929000	0.56500	7.993000	0.88291	1.503000	0.48686	0.655000	0.94253	GGG	.	.		0.662	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1	NM_030973	
IZUMO2	126123	hgsc.bcm.edu	37	19	50666320	50666320	+	Silent	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:50666320G>A	ENST00000293405.3	-	1	132	c.132C>T	c.(130-132)ttC>ttT	p.F44F		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	44						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						GCTCCAACTGGAAGCGACTGG	0.701																																					p.F44F		Atlas-SNP	.											.	IZUMO2	26	.	0			c.C132T						.						23.0	28.0	26.0					19																	50666320		1948	4132	6080	SO:0001819	synonymous_variant	126123	exon1			CAACTGGAAGCGA	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.132C>T	chr19.hg19:g.50666320G>A		196.0	0.0		178.0	76.0	NM_152358	Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Silent	SNP	ENST00000293405.3	hg19	CCDS12792.2																																																																																			.	.		0.701	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358	
SIGLEC12	89858	hgsc.bcm.edu	37	19	52002711	52002711	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:52002711A>G	ENST00000291707.3	-	3	1123	c.1068T>C	c.(1066-1068)gcT>gcC	p.A356A	SIGLEC12_ENST00000598614.1_Silent_p.A238A	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	356	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGAGTCGGACAGCCCTGGTCA	0.607																																					p.A356A		Atlas-SNP	.											.	SIGLEC12	243	.	0			c.T1068C						.						55.0	51.0	52.0					19																	52002711		2203	4300	6503	SO:0001819	synonymous_variant	89858	exon3			TCGGACAGCCCTG	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1068T>C	chr19.hg19:g.52002711A>G		194.0	0.0		154.0	7.0	NM_053003	Q8IYH7	Silent	SNP	ENST00000291707.3	hg19	CCDS12833.1																																																																																			.	.		0.607	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
EPS8L1	54869	hgsc.bcm.edu	37	19	55594861	55594861	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:55594861C>T	ENST00000201647.6	+	13	1386	c.1330C>T	c.(1330-1332)Cta>Tta	p.L444L	EPS8L1_ENST00000540810.1_Silent_p.L380L|EPS8L1_ENST00000586329.1_Silent_p.L426L|EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000588359.1_Silent_p.L98L|EPS8L1_ENST00000245618.5_Silent_p.L317L	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	444					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		TGAGAAACAGCTACAGCACGA	0.716																																					p.L444L	Ovarian(149;255 1863 3636 27051 29647)	Atlas-SNP	.											.	EPS8L1	122	.	0			c.C1330T						.						9.0	12.0	11.0					19																	55594861		2163	4228	6391	SO:0001819	synonymous_variant	54869	exon13			AAACAGCTACAGC	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.1330C>T	chr19.hg19:g.55594861C>T		80.0	0.0		89.0	4.0	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Silent	SNP	ENST00000201647.6	hg19	CCDS12914.1																																																																																			.	.		0.716	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
SYT5	6861	hgsc.bcm.edu	37	19	55687412	55687412	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:55687412T>C	ENST00000354308.3	-	4	702	c.333A>G	c.(331-333)cgA>cgG	p.R111R	SYT5_ENST00000590851.1_Silent_p.R108R|SYT5_ENST00000592935.1_5'Flank|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000537500.1_Silent_p.R111R	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	111			R -> Q (in dbSNP:rs11542503). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		AGTACTGCAGTCGTCCTAGCT	0.602																																					p.R111R		Atlas-SNP	.											.	SYT5	45	.	0			c.A333G						.						149.0	146.0	147.0					19																	55687412		2203	4300	6503	SO:0001819	synonymous_variant	6861	exon4			CTGCAGTCGTCCT	X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.333A>G	chr19.hg19:g.55687412T>C		108.0	0.0		98.0	4.0	NM_003180	B3KWJ8|B7Z300|Q86X72	Silent	SNP	ENST00000354308.3	hg19	CCDS12919.1																																																																																			.	.		0.602	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
SIRPD	128646	hgsc.bcm.edu	37	20	1532596	1532596	+	Silent	SNP	G	G	C	rs144302855		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:1532596G>C	ENST00000381623.3	-	2	1351	c.162C>G	c.(160-162)ccC>ccG	p.P54P	SIRPD_ENST00000381621.1_Silent_p.P54P			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	54	Ig-like V-type.					extracellular region (GO:0005576)		p.P54P(1)		breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						GTAAGGTATTGGGTACGCTGC	0.438																																					p.P54P		Atlas-SNP	.											.	SIRPD	34	.	1	Substitution - coding silent(1)	lung(1)	c.C162G						.						127.0	120.0	122.0					20																	1532596		2203	4300	6503	SO:0001819	synonymous_variant	128646	exon2			GGTATTGGGTACG	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.162C>G	chr20.hg19:g.1532596G>C		164.0	0.0		165.0	7.0	NM_178460	B3KS88|Q5TFQ6	Silent	SNP	ENST00000381623.3	hg19	CCDS13018.1																																																																																			.	G|1.000;A|0.000		0.438	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
C20orf194	25943	hgsc.bcm.edu	37	20	3356928	3356928	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:3356928G>A	ENST00000252032.9	-	4	372	c.305C>T	c.(304-306)tCg>tTg	p.S102L		NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	102										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						GACGCTATCCGATTTAATCAA	0.333																																					p.S102L		Atlas-SNP	.											C20orf194,colon,carcinoma,0,1	C20orf194	83	.	0			c.C305T						.						83.0	75.0	78.0					20																	3356928		1837	4097	5934	SO:0001583	missense	25943	exon4			CTATCCGATTTAA	AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.305C>T	chr20.hg19:g.3356928G>A	ENSP00000252032:p.Ser102Leu	109.0	2.0		94.0	6.0	NM_001009984	Q66K86|Q6P2R9|Q9UFX9	Missense_Mutation	SNP	ENST00000252032.9	hg19	CCDS42851.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521577	0.44866	.	.	ENSG00000088854	ENST00000252032	T	0.17691	2.26	5.4	5.4	0.78164	.	0.231822	0.36374	N	0.002626	T	0.07279	0.0184	N	0.02539	-0.55	0.80722	D	1	B	0.14805	0.011	B	0.10450	0.005	T	0.35500	-0.9786	10	0.27082	T	0.32	.	11.7576	0.51884	0.0826:0.0:0.9174:0.0	.	102	Q5TEA3	CT194_HUMAN	L	102	ENSP00000252032:S102L	ENSP00000252032:S102L	S	-	2	0	C20orf194	3304928	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.082000	0.64450	2.693000	0.91896	0.491000	0.48974	TCG	.	.		0.333	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077734.1	NM_001009984	
SIGLEC1	6614	hgsc.bcm.edu	37	20	3672111	3672111	+	Silent	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:3672111G>A	ENST00000344754.4	-	17	4466	c.4467C>T	c.(4465-4467)caC>caT	p.H1489H	SIGLEC1_ENST00000202578.4_Silent_p.H1489H	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1489	Ig-like C2-type 15.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CAGGCTCCGCGTGCAGCCGCC	0.672																																					p.H1489H		Atlas-SNP	.											.	SIGLEC1	210	.	0			c.C4467T						.						66.0	67.0	66.0					20																	3672111		2203	4300	6503	SO:0001819	synonymous_variant	6614	exon17			CTCCGCGTGCAGC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.4467C>T	chr20.hg19:g.3672111G>A		363.0	0.0		358.0	174.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	hg19	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	G	0.074	-1.195928	0.01594	.	.	ENSG00000088827	ENST00000419548	.	.	.	5.34	-9.34	0.00636	.	.	.	.	.	T	0.14874	0.0359	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.18871	-1.0323	4	.	.	.	.	1.8855	0.03237	0.4812:0.1018:0.1642:0.2527	.	.	.	.	C	303	.	.	R	-	1	0	SIGLEC1	3620111	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.686000	0.01929	-1.228000	0.02568	-0.140000	0.14226	CGC	.	.		0.672	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
HAO1	54363	hgsc.bcm.edu	37	20	7915282	7915282	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:7915282T>C	ENST00000378789.3	-	2	189	c.138A>G	c.(136-138)agA>agG	p.R46R		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	46	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)	p.R46S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						ACAGCTTCCATCTAGaattaa	0.343																																					p.R46R		Atlas-SNP	.											HAO1,NS,carcinoma,0,1	HAO1	71	.	1	Substitution - Missense(1)	ovary(1)	c.A138G						.						29.0	26.0	27.0					20																	7915282		2203	4300	6503	SO:0001630	splice_region_variant	54363	exon2			CTTCCATCTAGAA	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.138-1A>G	chr20.hg19:g.7915282T>C		51.0	0.0		54.0	3.0	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	ENST00000378789.3	hg19	CCDS13100.1																																																																																			.	.		0.343	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		Silent
SNAP25	6616	hgsc.bcm.edu	37	20	10277665	10277665	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:10277665A>G	ENST00000254976.2	+	6	585	c.374A>G	c.(373-375)gAg>gGg	p.E125G	SNAP25_ENST00000495883.1_3'UTR|SNAP25-AS1_ENST00000421143.2_RNA|SNAP25-AS1_ENST00000453544.1_RNA|SNAP25_ENST00000304886.2_Missense_Mutation_p.E125G	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa	125					energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)			endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	GACGAACGGGAGCAGATGGCC	0.507																																					p.E125G		Atlas-SNP	.											.	SNAP25	79	.	0			c.A374G						.						71.0	67.0	68.0					20																	10277665		2203	4300	6503	SO:0001583	missense	6616	exon6			AACGGGAGCAGAT		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.374A>G	chr20.hg19:g.10277665A>G	ENSP00000254976:p.Glu125Gly	116.0	0.0		122.0	5.0	NM_003081	B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	Missense_Mutation	SNP	ENST00000254976.2	hg19	CCDS13110.1	.	.	.	.	.	.	.	.	.	.	A	12.38	1.921159	0.33908	.	.	ENSG00000132639	ENST00000254976;ENST00000304886	.	.	.	5.86	5.86	0.93980	SNAP-25 (1);	0.000000	0.85682	D	0.000000	T	0.77377	0.4121	M	0.75447	2.3	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.69824	0.962;0.966	T	0.74671	-0.3587	9	0.23302	T	0.38	-0.6447	16.2652	0.82574	1.0:0.0:0.0:0.0	.	125;125	P60880-2;P60880	.;SNP25_HUMAN	G	125	.	ENSP00000254976:E125G	E	+	2	0	SNAP25	10225665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.241000	0.73720	0.528000	0.53228	GAG	.	.		0.507	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077976.3	NM_130811	
RRBP1	6238	hgsc.bcm.edu	37	20	17640671	17640671	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:17640671T>C	ENST00000377813.1	-	3	785	c.482A>G	c.(481-483)cAg>cGg	p.Q161R	RRBP1_ENST00000377807.2_Missense_Mutation_p.Q161R|RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000246043.4_Missense_Mutation_p.Q161R|RRBP1_ENST00000360807.4_Missense_Mutation_p.Q161R			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	161					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						AGTGAGAACCTGGATGGAATT	0.557																																					p.Q161R		Atlas-SNP	.											.	RRBP1	157	.	0			c.A482G						.						77.0	64.0	68.0					20																	17640671		2203	4300	6503	SO:0001583	missense	6238	exon2			AGAACCTGGATGG	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.482A>G	chr20.hg19:g.17640671T>C	ENSP00000367044:p.Gln161Arg	91.0	0.0		77.0	5.0	NM_004587	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.63	3.177373	0.57692	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000398782	T;T;T;T	0.42131	0.98;1.86;0.98;1.86	4.06	4.06	0.47325	.	0.000000	0.33075	N	0.005313	T	0.32675	0.0837	L	0.43152	1.355	0.80722	D	1	P	0.46512	0.879	B	0.40256	0.324	T	0.09271	-1.0682	10	0.39692	T	0.17	-21.8668	9.5679	0.39409	0.0:0.0:0.1912:0.8088	.	161	Q9P2E9-3	.	R	161	ENSP00000354045:Q161R;ENSP00000367044:Q161R;ENSP00000367038:Q161R;ENSP00000246043:Q161R	ENSP00000246043:Q161R	Q	-	2	0	RRBP1	17588671	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	4.419000	0.59835	1.852000	0.53769	0.460000	0.39030	CAG	.	.		0.557	RRBP1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000078125.1	NM_001042576	
RIN2	54453	hgsc.bcm.edu	37	20	19981288	19981288	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:19981288A>G	ENST00000255006.6	+	12	2692	c.2543A>G	c.(2542-2544)aAc>aGc	p.N848S	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Missense_Mutation_p.N366S	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	799	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						CAGGAGGTCAACAGTGGTTGC	0.502																																					p.N848S		Atlas-SNP	.											.	RIN2	126	.	0			c.A2543G						.						144.0	140.0	142.0					20																	19981288		2011	4194	6205	SO:0001583	missense	54453	exon12			AGGTCAACAGTGG	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2543A>G	chr20.hg19:g.19981288A>G	ENSP00000255006:p.Asn848Ser	102.0	0.0		88.0	4.0	NM_001242581	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	ENST00000255006.6	hg19	CCDS56182.1	.	.	.	.	.	.	.	.	.	.	A	8.181	0.793849	0.16327	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.15718	2.4;2.4	5.69	1.01	0.19927	Ras-association (3);	0.313274	0.40554	N	0.001064	T	0.06234	0.0161	N	0.03608	-0.345	0.45307	D	0.998306	B;B	0.21520	0.0;0.057	B;B	0.20955	0.002;0.032	T	0.38993	-0.9635	9	.	.	.	-20.4559	9.0633	0.36447	0.7184:0.0:0.2816:0.0	.	366;799	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	S	848;366	ENSP00000255006:N848S;ENSP00000391239:N366S	.	N	+	2	0	RIN2	19929288	0.972000	0.33761	0.993000	0.49108	0.852000	0.48524	0.638000	0.24674	-0.086000	0.12550	-0.464000	0.05259	AAC	.	.		0.502	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078212.1		
NAPB	63908	hgsc.bcm.edu	37	20	23383705	23383705	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:23383705T>C	ENST00000377026.4	-	2	188	c.103A>G	c.(103-105)Aac>Gac	p.N35D	NAPB_ENST00000472855.1_5'UTR|NAPB_ENST00000432543.2_Missense_Mutation_p.N35D|NAPB_ENST00000398425.3_5'UTR	NM_001283018.1|NM_001283020.1|NM_022080.2	NP_001269947.1|NP_001269949.1|NP_071363.1	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, beta	35					intracellular protein transport (GO:0006886)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	extracellular vesicular exosome (GO:0070062)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					ATTCTTGTGTTTCCTCTGAGA	0.328																																					p.N35D		Atlas-SNP	.											.	NAPB	22	.	0			c.A103G						.						79.0	75.0	76.0					20																	23383705		2201	4300	6501	SO:0001583	missense	63908	exon2			TTGTGTTTCCTCT	AK022817	CCDS13152.1, CCDS63241.1, CCDS63242.1, CCDS74710.1	20p12.3-p11.21	2008-08-01			ENSG00000125814	ENSG00000125814			15751	protein-coding gene	gene with protein product		611270				8455721	Standard	NM_022080		Approved	SNAP-BETA, SNAPB	uc002wta.3	Q9H115	OTTHUMG00000032062	ENST00000377026.4:c.103A>G	chr20.hg19:g.23383705T>C	ENSP00000366225:p.Asn35Asp	92.0	0.0		82.0	4.0	NM_022080	B4DK44|Q4G0M0|Q4G187|Q5JXF9|Q8N3C4	Missense_Mutation	SNP	ENST00000377026.4	hg19	CCDS13152.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799639	0.50208	.	.	ENSG00000125814	ENST00000377026;ENST00000432543	T;T	0.75367	1.63;-0.93	5.95	5.95	0.96441	Tetratricopeptide-like helical (1);	0.343450	0.33591	N	0.004749	T	0.64638	0.2616	N	0.20881	0.62	0.80722	D	1	B;B;B	0.26147	0.143;0.143;0.072	B;B;B	0.29077	0.062;0.098;0.098	T	0.61787	-0.6991	10	0.39692	T	0.17	0.4372	15.5971	0.76595	0.0:0.0:0.0:1.0	.	35;35;35	B4DK44;B4DIV0;Q9H115	.;.;SNAB_HUMAN	D	35	ENSP00000366225:N35D;ENSP00000413600:N35D	ENSP00000366225:N35D	N	-	1	0	NAPB	23331705	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.382000	0.52463	2.279000	0.76181	0.533000	0.62120	AAC	.	.		0.328	NAPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078317.2	NM_022080	
VSX1	30813	hgsc.bcm.edu	37	20	25057157	25057157	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:25057157T>C	ENST00000376709.4	-	5	1101	c.838A>G	c.(838-840)Agg>Ggg	p.R280G	VSX1_ENST00000444511.2_Intron|VSX1_ENST00000424574.1_Intron|VSX1_ENST00000451258.1_Intron|VSX1_ENST00000429762.3_Intron	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	280					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						CCTGGCTTCCTTATCATCCCC	0.368																																					p.R280G		Atlas-SNP	.											.	VSX1	20	.	0			c.A838G						.						90.0	99.0	96.0					20																	25057157		2203	4300	6503	SO:0001583	missense	30813	exon5			GCTTCCTTATCAT	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.838A>G	chr20.hg19:g.25057157T>C	ENSP00000365899:p.Arg280Gly	88.0	0.0		97.0	4.0	NM_014588	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	hg19	CCDS13168.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.940829	0.34283	.	.	ENSG00000100987	ENST00000376709	D	0.92397	-3.03	3.77	3.77	0.43336	.	0.156351	0.56097	D	0.000026	D	0.88183	0.6368	L	0.55834	1.745	0.33126	D	0.542457	B	0.14438	0.01	B	0.06405	0.002	D	0.87015	0.2125	10	0.34782	T	0.22	.	9.9927	0.41881	0.0:0.0:0.0:1.0	.	280	Q9NZR4	VSX1_HUMAN	G	280	ENSP00000365899:R280G	ENSP00000365899:R280G	R	-	1	2	VSX1	25005157	0.847000	0.29606	0.942000	0.38095	0.937000	0.57800	1.913000	0.39956	1.576000	0.49790	0.533000	0.62120	AGG	.	.		0.368	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3		
CBFA2T2	9139	hgsc.bcm.edu	37	20	32217714	32217714	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:32217714A>G	ENST00000346541.3	+	9	1786	c.1249A>G	c.(1249-1251)Agc>Ggc	p.S417G	CBFA2T2_ENST00000397800.1_Missense_Mutation_p.S388G|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.S427G|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.S417G|CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.S408G|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.S388G	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	417					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						AGATTCTCTCAGCAATGGTAA	0.483																																					p.S417G	Esophageal Squamous(174;142 1955 14837 21276 28041)	Atlas-SNP	.											.	CBFA2T2	93	.	0			c.A1249G						.						46.0	45.0	45.0					20																	32217714		2203	4300	6503	SO:0001583	missense	9139	exon9			TCTCTCAGCAATG	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.1249A>G	chr20.hg19:g.32217714A>G	ENSP00000262653:p.Ser417Gly	95.0	0.0		104.0	5.0	NM_005093	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	ENST00000346541.3	hg19	CCDS13221.1	.	.	.	.	.	.	.	.	.	.	A	13.65	2.301204	0.40694	.	.	ENSG00000078699	ENST00000397803;ENST00000375279;ENST00000342704;ENST00000346541;ENST00000397800;ENST00000359606	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;1.42	5.73	4.64	0.57946	.	0.617048	0.18818	N	0.130327	T	0.30792	0.0776	N	0.19112	0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.06991	-1.0796	10	0.33141	T	0.24	-14.9003	8.4422	0.32822	0.8174:0.0:0.1826:0.0	.	417;408	O43439;F8W6D7	MTG8R_HUMAN;.	G	191;417;408;417;388;427	ENSP00000364428:S417G;ENSP00000345810:S408G;ENSP00000262653:S417G;ENSP00000380902:S388G;ENSP00000352622:S427G	ENSP00000345810:S408G	S	+	1	0	CBFA2T2	31681375	0.862000	0.29867	0.998000	0.56505	0.986000	0.74619	1.867000	0.39499	1.106000	0.41623	0.533000	0.62120	AGC	.	.		0.483	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	
MYH7B	57644	hgsc.bcm.edu	37	20	33586333	33586333	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:33586333A>G	ENST00000262873.7	+	32	4112	c.4020A>G	c.(4018-4020)ctA>ctG	p.L1340L		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1298						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GTCGCCTGCTAGAGGAGAAGG	0.642																																					p.L1340L		Atlas-SNP	.											.	MYH7B	145	.	0			c.A4020G						.						42.0	48.0	46.0					20																	33586333		2095	4218	6313	SO:0001819	synonymous_variant	57644	exon34			CCTGCTAGAGGAG	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.4020A>G	chr20.hg19:g.33586333A>G		80.0	0.0		88.0	4.0	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	ENST00000262873.7	hg19	CCDS42869.1																																																																																			.	.		0.642	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
SOGA1	140710	hgsc.bcm.edu	37	20	35437068	35437068	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:35437068G>T	ENST00000357779.3	-	8	2274	c.1948C>A	c.(1948-1950)Cag>Aag	p.Q650K	SOGA1_ENST00000237536.4_Missense_Mutation_p.Q888K|SOGA1_ENST00000456801.2_Missense_Mutation_p.Q491K|SOGA1_ENST00000279034.6_Missense_Mutation_p.Q650K			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	650					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CAGAATTTCTGCTCCAGCCTC	0.577											OREG0025909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q888K		Atlas-SNP	.											.	SOGA1	136	.	0			c.C2662A						.						36.0	39.0	38.0					20																	35437068		1923	4140	6063	SO:0001583	missense	140710	exon8			ATTTCTGCTCCAG	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1948C>A	chr20.hg19:g.35437068G>T	ENSP00000350424:p.Gln650Lys	86.0	0.0	855	61.0	25.0	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	hg19		.	.	.	.	.	.	.	.	.	.	G	15.96	2.988168	0.53934	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.32346	0.0826	L	0.36672	1.1	0.53688	D	0.999977	P	0.43412	0.806	B	0.35073	0.195	T	0.07177	-1.0786	10	0.23302	T	0.38	-43.3312	17.8379	0.88706	0.0:0.0:1.0:0.0	.	650	O94964-4	.	K	888;650;491;650	ENSP00000237536:Q888K;ENSP00000279034:Q650K;ENSP00000413886:Q491K;ENSP00000350424:Q650K	ENSP00000237536:Q888K	Q	-	1	0	KIAA0889	34870482	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.493000	0.60341	2.745000	0.94114	0.655000	0.94253	CAG	.	.		0.577	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
SRC	6714	hgsc.bcm.edu	37	20	36028552	36028552	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:36028552A>G	ENST00000373578.2	+	10	1243	c.894A>G	c.(892-894)aaA>aaG	p.K298K	SRC_ENST00000445403.1_Silent_p.K298K|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000373558.2_Silent_p.K304K|SRC_ENST00000373567.2_Silent_p.K298K|SRC_ENST00000358208.4_Silent_p.K298K|SRC_ENST00000360723.4_Silent_p.K304K	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	298	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	TGGCCATCAAAACCCTGAAGC	0.592																																					p.K298K		Atlas-SNP	.											.	SRC	52	.	0			c.A894G						.						80.0	67.0	71.0					20																	36028552		2203	4300	6503	SO:0001819	synonymous_variant	6714	exon10			CATCAAAACCCTG	AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.894A>G	chr20.hg19:g.36028552A>G		127.0	0.0		95.0	5.0	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Silent	SNP	ENST00000373578.2	hg19	CCDS13294.1																																																																																			.	.		0.592	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
CTSA	5476	hgsc.bcm.edu	37	20	44520238	44520238	+	Silent	SNP	C	C	T	rs3080212|rs11468075|rs10582052|rs397784956|rs397839006	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:44520238C>T	ENST00000372459.2	+	1	224	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L	NEURL2_ENST00000372518.4_5'Flank|RP3-337O18.9_ENST00000607703.1_RNA|CTSA_ENST00000372484.3_Silent_p.L29L|CTSA_ENST00000191018.5_Silent_p.L11L|CTSA_ENST00000354880.5_Silent_p.L29L			P10619	PPGB_HUMAN	cathepsin A	11					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)	p.L29delL(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				gccgctgttcctgctgctgct	0.706																																					p.L29L		Atlas-SNP	.											.,5	CTSA	52	.	1	Deletion - In frame(1)	breast(1)	c.C85T						.						8.0	10.0	10.0					20																	44520238		2013	3921	5934	SO:0001819	synonymous_variant	5476	exon2			CTGTTCCTGCTGC	M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.31C>T	chr20.hg19:g.44520238C>T		35.0	0.0		48.0	2.0	NM_000308	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Silent	SNP	ENST00000372459.2	hg19	CCDS46609.1																																																																																			.	.		0.706	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	
SYCP2	10388	hgsc.bcm.edu	37	20	58487429	58487429	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:58487429T>C	ENST00000357552.3	-	13	1100	c.875A>G	c.(874-876)gAg>gGg	p.E292G	SYCP2_ENST00000371001.2_Splice_Site_p.E292G			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	292					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			AAATTTTACCTCATATTTATC	0.234																																					p.E292G		Atlas-SNP	.											.	SYCP2	204	.	0			c.A875G						.						9.0	9.0	9.0					20																	58487429		2072	4160	6232	SO:0001630	splice_region_variant	10388	exon12			TTTACCTCATATT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.876+1A>G	chr20.hg19:g.58487429T>C		77.0	0.0		85.0	4.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	hg19	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.328628	0.81690	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.25085	2.06;2.06;1.82	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	T	0.52948	0.1766	M	0.78637	2.42	0.43408	D	0.99554	D;D	0.89917	1.0;1.0	D;D	0.91635	0.988;0.999	T	0.57441	-0.7811	10	0.87932	D	0	-20.0419	14.8452	0.70254	0.0:0.0:0.0:1.0	.	292;292	A2A341;Q9BX26	.;SYCP2_HUMAN	G	292	ENSP00000360040:E292G;ENSP00000350162:E292G;ENSP00000402456:E292G	ENSP00000350162:E292G	E	-	2	0	SYCP2	57920824	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	6.595000	0.74109	2.299000	0.77371	0.533000	0.62120	GAG	.	.		0.234	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	Missense_Mutation
ZNF512B	57473	hgsc.bcm.edu	37	20	62594753	62594753	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:62594753T>C	ENST00000450537.1	-	11	1799	c.1739A>G	c.(1738-1740)gAg>gGg	p.E580G	ZNF512B_ENST00000217130.3_Missense_Mutation_p.E580G|ZNF512B_ENST00000369888.1_Missense_Mutation_p.E580G			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	580					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCTCTCGCGCTCCTCCTGCTC	0.741																																					p.E580G		Atlas-SNP	.											.	ZNF512B	72	.	0			c.A1739G						.						7.0	8.0	8.0					20																	62594753		2143	4230	6373	SO:0001583	missense	57473	exon11			TCGCGCTCCTCCT	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1739A>G	chr20.hg19:g.62594753T>C	ENSP00000393795:p.Glu580Gly	39.0	0.0		50.0	4.0	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	hg19	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.349538	0.82132	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.28069	1.63;1.63;1.63	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.51329	0.1668	M	0.61703	1.905	0.58432	D	0.999998	D	0.89917	1.0	D	0.79784	0.993	T	0.55315	-0.8160	10	0.87932	D	0	-31.4643	13.1253	0.59351	0.0:0.0:0.0:1.0	.	580	Q96KM6	Z512B_HUMAN	G	580	ENSP00000358904:E580G;ENSP00000393795:E580G;ENSP00000217130:E580G	ENSP00000217130:E580G	E	-	2	0	ZNF512B	62065197	0.648000	0.27313	0.998000	0.56505	0.895000	0.52256	1.990000	0.40717	1.804000	0.52760	0.379000	0.24179	GAG	.	.		0.741	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
GRIK1	2897	hgsc.bcm.edu	37	21	30949468	30949468	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr21:30949468C>T	ENST00000399907.1	-	14	2357	c.1946G>A	c.(1945-1947)aGa>aAa	p.R649K	GRIK1_ENST00000399914.1_Missense_Mutation_p.R634K|GRIK1_ENST00000327783.4_Missense_Mutation_p.R649K|GRIK1_ENST00000309434.7_Missense_Mutation_p.R651K|GRIK1_ENST00000389125.3_Missense_Mutation_p.R634K|GRIK1_ENST00000389124.2_Missense_Mutation_p.R649K|GRIK1_ENST00000399909.1_Missense_Mutation_p.R634K|GRIK1_ENST00000399913.1_Missense_Mutation_p.R649K|GRIK1_ENST00000535441.1_Missense_Mutation_p.R651K	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	649					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	TCCAACTATTCTGGTCGATAG	0.463																																					p.R649K		Atlas-SNP	.											.	GRIK1	293	.	0			c.G1946A						.						107.0	99.0	102.0					21																	30949468		2203	4300	6503	SO:0001583	missense	2897	exon14			ACTATTCTGGTCG		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1946G>A	chr21.hg19:g.30949468C>T	ENSP00000382791:p.Arg649Lys	169.0	0.0		138.0	6.0	NM_000830	Q13001|Q86SU9	Missense_Mutation	SNP	ENST00000399907.1	hg19	CCDS42913.1	.	.	.	.	.	.	.	.	.	.	C	34	5.368720	0.95900	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.3	5.3	0.74995	Ionotropic glutamate receptor (2);	0.088817	0.85682	D	0.000000	D	0.88819	0.6540	M	0.94142	3.5	0.80722	D	1	D;D;D;D	0.65815	0.995;0.995;0.995;0.993	D;D;D;D	0.72338	0.977;0.968;0.968;0.946	D	0.91433	0.5167	10	0.87932	D	0	.	18.7417	0.91775	0.0:1.0:0.0:0.0	.	634;649;649;634	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	K	649;634;649;634;651;510;649;649;634;651	ENSP00000327687:R649K;ENSP00000373777:R634K;ENSP00000382797:R649K;ENSP00000382798:R634K;ENSP00000446326:R651K;ENSP00000373776:R649K;ENSP00000382791:R649K;ENSP00000382793:R634K;ENSP00000311646:R651K	ENSP00000311646:R651K	R	-	2	0	GRIK1	29871339	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.540000	0.82074	2.765000	0.95021	0.650000	0.86243	AGA	.	.		0.463	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
BRWD1	54014	hgsc.bcm.edu	37	21	40571299	40571299	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr21:40571299T>C	ENST00000333229.2	-	40	5370	c.5043A>G	c.(5041-5043)gaA>gaG	p.E1681E	BRWD1_ENST00000342449.3_Silent_p.E1681E|BRWD1_ENST00000380800.3_Silent_p.E1681E	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1681					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TTAAGCTCTGTTCATCTTCAG	0.398																																					p.E1681E	Melanoma(170;988 1986 4794 16843 39731)	Atlas-SNP	.											.	BRWD1	325	.	0			c.A5043G						.						59.0	57.0	58.0					21																	40571299		2203	4300	6503	SO:0001819	synonymous_variant	54014	exon40			GCTCTGTTCATCT	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5043A>G	chr21.hg19:g.40571299T>C		72.0	0.0		84.0	4.0	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	hg19	CCDS13662.1																																																																																			.	.		0.398	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
KRTAP10-12	386685	hgsc.bcm.edu	37	21	46117817	46117817	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr21:46117817T>C	ENST00000400365.3	+	1	731	c.701T>C	c.(700-702)cTc>cCc	p.L234P	TSPEAR_ENST00000323084.4_Intron	NM_198699.1	NP_941972.1	P60413	KR10C_HUMAN	keratin associated protein 10-12	234						keratin filament (GO:0045095)				large_intestine(1)|lung(8)	9						TGCGGGTCCCTCCTCTGCCGC	0.721																																					p.L234P		Atlas-SNP	.											.	KRTAP10-12	21	.	0			c.T701C						.						32.0	43.0	39.0					21																	46117817		2118	4232	6350	SO:0001583	missense	386685	exon1			GGTCCCTCCTCTG	AB076364	CCDS42967.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000189169	ENSG00000189169		"""Keratin associated proteins"""	20533	protein-coding gene	gene with protein product			"""keratin associated protein 18-12"""	KRTAP18-12			Standard	NM_198699		Approved	KRTAP18.12, KAP10.12	uc002zfw.1	P60413	OTTHUMG00000057629	ENST00000400365.3:c.701T>C	chr21.hg19:g.46117817T>C	ENSP00000383216:p.Leu234Pro	81.0	0.0		79.0	5.0	NM_198699	B2RPA3	Missense_Mutation	SNP	ENST00000400365.3	hg19	CCDS42967.1	.	.	.	.	.	.	.	.	.	.	t	6.901	0.535861	0.13188	.	.	ENSG00000189169	ENST00000400365	T	0.00808	5.67	3.58	3.58	0.41010	.	.	.	.	.	T	0.04227	0.0117	M	0.84433	2.695	0.40862	D	0.98384	D	0.71674	0.998	D	0.65874	0.939	T	0.20472	-1.0274	9	0.49607	T	0.09	.	5.8006	0.18412	0.0:0.1284:0.0:0.8716	.	234	P60413	KR10C_HUMAN	P	234	ENSP00000383216:L234P	ENSP00000383216:L234P	L	+	2	0	KRTAP10-12	44942245	0.276000	0.24211	0.994000	0.49952	0.017000	0.09413	1.089000	0.30890	1.381000	0.46364	0.369000	0.22263	CTC	.	.		0.721	KRTAP10-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128032.1	NM_198699	
PCBP3	54039	hgsc.bcm.edu	37	21	47330925	47330925	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr21:47330925T>C	ENST00000400314.1	+	9	919	c.581T>C	c.(580-582)aTc>aCc	p.I194T	PCBP3_ENST00000400304.1_Missense_Mutation_p.I162T|PCBP3_ENST00000400310.1_Missense_Mutation_p.I194T|PCBP3_ENST00000400309.1_Missense_Mutation_p.I194T|PCBP3_ENST00000449640.1_Missense_Mutation_p.I194T|PCBP3_ENST00000400308.1_Missense_Mutation_p.I194T			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	194					mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		GTCAAGCAGATCTGTGTGGTC	0.647																																					p.I194T		Atlas-SNP	.											.	PCBP3	82	.	0			c.T581C						.						86.0	93.0	91.0					21																	47330925		2178	4273	6451	SO:0001583	missense	54039	exon7			AGCAGATCTGTGT	AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.581T>C	chr21.hg19:g.47330925T>C	ENSP00000383168:p.Ile194Thr	98.0	0.0		82.0	4.0	NM_001130141	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	ENST00000400314.1	hg19	CCDS42974.2	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410186	0.83340	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000400308;ENST00000449640;ENST00000346743;ENST00000400305;ENST00000400304	T;T;T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13;0.13;0.13	5.74	5.74	0.90152	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.81997	0.4941	H	0.96175	3.78	0.80722	D	1	B;B;P;P;B;B;B	0.37330	0.21;0.304;0.59;0.497;0.176;0.403;0.304	P;B;P;B;B;P;B	0.53549	0.553;0.364;0.729;0.428;0.364;0.663;0.326	D	0.85695	0.1309	10	0.62326	D	0.03	-14.3865	16.0357	0.80628	0.0:0.0:0.0:1.0	.	162;194;162;194;194;194;194	Q5MJP6;P57721-3;E9PFP8;P57721-2;P57721-4;P57721;P57721-5	.;.;.;.;.;PCBP3_HUMAN;.	T	194;194;194;194;194;194;170;162	ENSP00000383168:I194T;ENSP00000383165:I194T;ENSP00000383164:I194T;ENSP00000383163:I194T;ENSP00000401198:I194T;ENSP00000383160:I170T;ENSP00000383159:I162T	ENSP00000330225:I194T	I	+	2	0	PCBP3	46155353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.588000	0.82629	2.192000	0.70111	0.528000	0.53228	ATC	.	.		0.647	PCBP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206808.2		
COL6A1	1291	hgsc.bcm.edu	37	21	47421253	47421253	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr21:47421253T>C	ENST00000361866.3	+	30	2023	c.1909T>C	c.(1909-1911)Ttc>Ctc	p.F637L	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	637	C-terminal globular domain.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		TGCCAAGGACTTCGTCGTCAA	0.647																																					p.F637L		Atlas-SNP	.											.	COL6A1	101	.	0			c.T1909C						.						127.0	126.0	126.0					21																	47421253		2203	4300	6503	SO:0001583	missense	1291	exon30			AAGGACTTCGTCG	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1909T>C	chr21.hg19:g.47421253T>C	ENSP00000355180:p.Phe637Leu	55.0	0.0		44.0	4.0	NM_001848	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	hg19	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	T	34	5.325800	0.95708	.	.	ENSG00000142156	ENST00000361866	D	0.86627	-2.15	5.2	5.2	0.72013	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.94178	0.8132	M	0.88775	2.98	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.94726	0.7905	10	0.52906	T	0.07	-14.4548	15.0511	0.71872	0.0:0.0:0.0:1.0	.	637	P12109	CO6A1_HUMAN	L	637	ENSP00000355180:F637L	ENSP00000355180:F637L	F	+	1	0	COL6A1	46245681	1.000000	0.71417	0.998000	0.56505	0.745000	0.42441	7.084000	0.76866	1.968000	0.57251	0.445000	0.29226	TTC	.	.		0.647	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	
LSS	4047	hgsc.bcm.edu	37	21	47636415	47636415	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr21:47636415G>A	ENST00000397728.3	-	7	749	c.671C>T	c.(670-672)gCa>gTa	p.A224V	LSS_ENST00000464357.1_5'UTR|LSS_ENST00000522411.1_Missense_Mutation_p.A213V|LSS_ENST00000457828.2_Missense_Mutation_p.A144V|LSS_ENST00000356396.4_Missense_Mutation_p.A224V	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	224					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					GGAGGGGTGTGCCGGTGCCCA	0.657																																					p.A224V	Pancreas(114;955 2313 34923 50507)	Atlas-SNP	.											.	LSS	50	.	0			c.C671T						.						29.0	31.0	30.0					21																	47636415		2203	4300	6503	SO:0001583	missense	4047	exon7			GGGTGTGCCGGTG	U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.671C>T	chr21.hg19:g.47636415G>A	ENSP00000380837:p.Ala224Val	107.0	0.0		93.0	4.0	NM_001001438	B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	ENST00000397728.3	hg19	CCDS13733.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002397	0.74932	.	.	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411;ENST00000450351	T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19	5.58	5.58	0.84498	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.055632	0.64402	D	0.000001	T	0.24661	0.0598	L	0.31157	0.91	0.80722	D	1	P;P	0.40681	0.727;0.607	B;B	0.23574	0.047;0.021	T	0.04752	-1.0929	10	0.32370	T	0.25	.	19.156	0.93510	0.0:0.0:1.0:0.0	.	213;224	E9PEI9;P48449	.;ERG7_HUMAN	V	224;144;224;213;225	ENSP00000348762:A224V;ENSP00000409191:A144V;ENSP00000380837:A224V;ENSP00000429133:A213V;ENSP00000391368:A225V	ENSP00000348762:A224V	A	-	2	0	LSS	46460843	1.000000	0.71417	0.275000	0.24674	0.185000	0.23345	6.511000	0.73733	2.645000	0.89757	0.655000	0.94253	GCA	.	.		0.657	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207274.2		
THAP7	80764	hgsc.bcm.edu	37	22	21354223	21354223	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr22:21354223A>G	ENST00000215742.4	-	4	1050	c.876T>C	c.(874-876)acT>acC	p.T292T	THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000429962.1_RNA|THAP7-AS1_ENST00000436079.1_RNA|THAP7_ENST00000399133.2_Silent_p.T292T	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	292					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GCTCCTTCAGAGTCTGGCGGG	0.662																																					p.T292T		Atlas-SNP	.											.	THAP7	15	.	0			c.T876C						.						31.0	32.0	31.0					22																	21354223		2201	4298	6499	SO:0001819	synonymous_variant	80764	exon4			CTTCAGAGTCTGG	BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.876T>C	chr22.hg19:g.21354223A>G		143.0	0.0		140.0	6.0	NM_030573	B2RD97|D3DX40	Silent	SNP	ENST00000215742.4	hg19	CCDS13787.1																																																																																			.	.		0.662	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320405.1	NM_030573	
HPS4	89781	hgsc.bcm.edu	37	22	26860271	26860271	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr22:26860271T>C	ENST00000398145.2	-	11	1941	c.1325A>G	c.(1324-1326)cAg>cGg	p.Q442R	HPS4_ENST00000336873.5_Missense_Mutation_p.Q442R|HPS4_ENST00000493455.2_5'Flank|HPS4_ENST00000398141.1_Missense_Mutation_p.Q455R|HPS4_ENST00000402105.3_Missense_Mutation_p.Q437R	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	442					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						GTCTTCGAGCTGCTCTTGGGC	0.617									Hermansky-Pudlak syndrome																												p.Q442R		Atlas-SNP	.											.	HPS4	123	.	0			c.A1325G						.						94.0	90.0	91.0					22																	26860271		2203	4300	6503	SO:0001583	missense	89781	exon11	Familial Cancer Database	HPS, HPS1-8	TCGAGCTGCTCTT		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.1325A>G	chr22.hg19:g.26860271T>C	ENSP00000381213:p.Gln442Arg	89.0	0.0		98.0	4.0	NM_022081	B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Missense_Mutation	SNP	ENST00000398145.2	hg19	CCDS13835.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.261430	0.23051	.	.	ENSG00000100099	ENST00000398145;ENST00000398141;ENST00000402105;ENST00000336873;ENST00000312736;ENST00000422379	T;T;T;T;T	0.57273	1.48;1.46;1.48;1.48;0.41	4.83	-5.99	0.02213	.	1.684920	0.02902	N	0.135548	T	0.44244	0.1284	M	0.67953	2.075	0.09310	N	1	B;B;B;B;B;B	0.14012	0.002;0.002;0.009;0.004;0.004;0.009	B;B;B;B;B;B	0.12156	0.004;0.004;0.007;0.007;0.006;0.007	T	0.34477	-0.9827	10	0.66056	D	0.02	0.005	0.6657	0.00850	0.3913:0.2059:0.1129:0.2899	.	442;442;442;442;455;437	Q6ICH6;Q6P1K3;Q9NQG7;A8K2E6;Q9NQG7-4;Q9NQG7-3	.;.;HPS4_HUMAN;.;.;.	R	442;455;437;442;460;460	ENSP00000381213:Q442R;ENSP00000381210:Q455R;ENSP00000384185:Q437R;ENSP00000338457:Q442R;ENSP00000415081:Q460R	ENSP00000325840:Q460R	Q	-	2	0	HPS4	25190271	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.360000	0.02600	-1.040000	0.03271	-0.438000	0.05819	CAG	.	.		0.617	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320778.1	NM_022081	
EMID1	129080	hgsc.bcm.edu	37	22	29611591	29611591	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr22:29611591T>C	ENST00000404820.3	+	3	418	c.291T>C	c.(289-291)ccT>ccC	p.P97P	EMID1_ENST00000404755.3_Silent_p.P97P|EMID1_ENST00000484039.1_3'UTR|EMID1_ENST00000334018.6_Silent_p.P97P			Q96A84	EMID1_HUMAN	EMI domain containing 1	97	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						GGTGCTGCCCTGGGCACTCAG	0.637																																					p.P97P		Atlas-SNP	.											.	EMID1	33	.	0			c.T291C						.						96.0	88.0	90.0					22																	29611591		2203	4300	6503	SO:0001819	synonymous_variant	129080	exon3			CTGCCCTGGGCAC	AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.291T>C	chr22.hg19:g.29611591T>C		91.0	0.0		100.0	4.0	NM_001267895	B0QYK6|Q6ICG1|Q86SS7	Silent	SNP	ENST00000404820.3	hg19																																																																																				.	.		0.637	EMID1-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321075.1	NM_133455	
GCAT	23464	hgsc.bcm.edu	37	22	38204108	38204108	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr22:38204108A>G	ENST00000248924.6	+	1	190	c.134A>G	c.(133-135)aAg>aGg	p.K45R	GCAT_ENST00000323205.6_Missense_Mutation_p.K45R|GCAT_ENST00000415371.1_3'UTR	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	45					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	GGCACTTGGAAGAGTGAGCGG	0.682																																					p.K45R		Atlas-SNP	.											.	GCAT	27	.	0			c.A134G						.						30.0	20.0	24.0					22																	38204108		2192	4289	6481	SO:0001583	missense	23464	exon1			CTTGGAAGAGTGA	AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.134A>G	chr22.hg19:g.38204108A>G	ENSP00000248924:p.Lys45Arg	118.0	0.0		77.0	4.0	NM_001171690	E2QC23|Q6ZWF1|Q96CA9	Missense_Mutation	SNP	ENST00000248924.6	hg19	CCDS13957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	36|36	5.752845|5.752845	0.96890|0.96890	.|.	.|.	ENSG00000100116|ENSG00000100116	ENST00000323205;ENST00000248924;ENST00000445195;ENST00000394944|ENST00000451984	D;D;D|.	0.98666|.	-5.06;-3.3;-3.32|.	4.6|4.6	4.6|4.6	0.57074|0.57074	Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74658|0.74658	0.3745|0.3745	M|M	0.77616|0.77616	2.38|2.38	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.91635|.	0.999;0.996|.	T|T	0.76615|0.76615	-0.2894|-0.2894	10|5	0.87932|.	D|.	0|.	-25.2705|-25.2705	14.4519|14.4519	0.67392|0.67392	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	45;45|.	E2QC23;O75600|.	.;KBL_HUMAN|.	R|G	45|30	ENSP00000371110:K45R;ENSP00000248924:K45R;ENSP00000406719:K45R|.	ENSP00000248924:K45R|.	K|R	+|+	2|1	0|2	GCAT|GCAT	36534054|36534054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.367000|6.367000	0.73099|0.73099	2.058000|2.058000	0.61347|0.61347	0.533000|0.533000	0.62120|0.62120	AAG|AGA	.	.		0.682	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319506.1	NM_014291.2	
SCUBE1	80274	hgsc.bcm.edu	37	22	43627876	43627876	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr22:43627876T>C	ENST00000360835.4	-	8	976	c.850A>G	c.(850-852)Aac>Gac	p.N284D	Z82214.2_ENST00000419643.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	284	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				AGGCACTCGTTGATGTCTGTG	0.632																																					p.N284D		Atlas-SNP	.											.	SCUBE1	105	.	0			c.A850G						.						67.0	54.0	58.0					22																	43627876		2203	4300	6503	SO:0001583	missense	80274	exon8			ACTCGTTGATGTC		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.850A>G	chr22.hg19:g.43627876T>C	ENSP00000354080:p.Asn284Asp	207.0	0.0		77.0	4.0	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	hg19	CCDS14048.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.945|8.945	0.966837|0.966837	0.18659|0.18659	.|.	.|.	ENSG00000159307|ENSG00000159307	ENST00000360835;ENST00000434132|ENST00000449304	T|.	0.26810|.	1.71|.	4.47|4.47	3.44|3.44	0.39384|0.39384	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);|.	0.095657|.	0.64402|.	D|.	0.000001|.	T|T	0.20210|0.20210	0.0486|0.0486	N|N	0.02960|0.02960	-0.455|-0.455	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|T	0.06991|0.06991	-1.0796|-1.0796	10|5	0.02654|.	T|.	1|.	.|.	4.396|4.396	0.11363|0.11363	0.0:0.2678:0.0:0.7322|0.0:0.2678:0.0:0.7322	.|.	284|.	Q8IWY4|.	SCUB1_HUMAN|.	D|R	284|137	ENSP00000354080:N284D|.	ENSP00000354080:N284D|.	N|Q	-|-	1|2	0|0	SCUBE1|SCUBE1	41957820|41957820	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	5.732000|5.732000	0.68563|0.68563	2.002000|2.002000	0.58637|0.58637	0.459000|0.459000	0.35465|0.35465	AAC|CAA	.	.		0.632	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
SHANK3	85358	hgsc.bcm.edu	37	22	51143468	51143468	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr22:51143468T>C	ENST00000414786.2	+	16	2158	c.1931T>C	c.(1930-1932)gTc>gCc	p.V644A	SHANK3_ENST00000262795.3_Missense_Mutation_p.V674A|SHANK3_ENST00000445220.2_Missense_Mutation_p.V659A			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	658	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		AACCGCCTCGTCATGAAGGTT	0.612																																					p.V644A		Atlas-SNP	.											.	SHANK3	96	.	0			c.T1931C						.						96.0	112.0	106.0					22																	51143468		2174	4272	6446	SO:0001583	missense	85358	exon16			GCCTCGTCATGAA	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.1931T>C	chr22.hg19:g.51143468T>C	ENSP00000464552:p.Val644Ala	149.0	0.0		61.0	5.0	NM_033517	D7UT47|Q8TET3	Missense_Mutation	SNP	ENST00000414786.2	hg19		.	.	.	.	.	.	.	.	.	.	T	18.34	3.602988	0.66445	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.25250	1.81;1.81	4.43	4.43	0.53597	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.21227	0.0511	N	0.25647	0.755	0.22096	N	0.999363	P;P	0.46142	0.873;0.775	B;P	0.46510	0.422;0.519	T	0.06625	-1.0816	9	0.38643	T	0.18	.	6.5334	0.22339	0.0:0.1074:0.0:0.8926	.	659;674	Q9BYB0;F2Z3L0	SHAN3_HUMAN;.	A	674;659	ENSP00000442518:V674A;ENSP00000446078:V659A	ENSP00000442518:V674A	V	+	2	0	SHANK3	49490334	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.081000	0.50120	1.869000	0.54173	0.482000	0.46254	GTC	.	.		0.612	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000316674.2	NM_001080420	
NLGN4X	57502	hgsc.bcm.edu	37	X	6069292	6069292	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:6069292C>A	ENST00000381095.3	-	2	843	c.216G>T	c.(214-216)caG>caT	p.Q72H	NLGN4X_ENST00000381092.1_Missense_Mutation_p.Q72H|NLGN4X_ENST00000538097.1_Missense_Mutation_p.Q72H|NLGN4X_ENST00000275857.6_Missense_Mutation_p.Q72H|NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381093.2_Missense_Mutation_p.Q72H	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	72					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CCCCTAAGTACTGCTCCACTG	0.542																																					p.Q72H		Atlas-SNP	.											.	NLGN4X	191	.	0			c.G216T						.						96.0	83.0	88.0					X																	6069292		2203	4300	6503	SO:0001583	missense	57502	exon2			TAAGTACTGCTCC	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.216G>T	chrX.hg19:g.6069292C>A	ENSP00000370485:p.Gln72His	378.0	0.0		304.0	139.0	NM_181332	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	hg19	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456250	0.63401	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34	4.2	-8.4	0.00965	Carboxylesterase, type B (1);	.	.	.	.	T	0.80757	0.4684	M	0.86268	2.805	0.48696	D	0.99969	D;D;D	0.89917	1.0;1.0;0.99	D;D;P	0.79784	0.984;0.993;0.795	D	0.87332	0.2325	9	0.62326	D	0.03	.	18.999	0.92826	0.0:0.7632:0.0:0.2368	.	72;72;72	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	H	72	ENSP00000370485:Q72H;ENSP00000370483:Q72H;ENSP00000275857:Q72H;ENSP00000370482:Q72H;ENSP00000439203:Q72H	ENSP00000275857:Q72H	Q	-	3	2	NLGN4X	6079292	0.044000	0.20184	0.773000	0.31616	0.903000	0.53119	-0.995000	0.03712	-2.273000	0.00681	-0.380000	0.06706	CAG	.	.		0.542	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
TCEANC	170082	hgsc.bcm.edu	37	X	13681572	13681572	+	Silent	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:13681572T>A	ENST00000380600.1	+	2	1032	c.945T>A	c.(943-945)ctT>ctA	p.L315L	TCEANC_ENST00000314720.4_Silent_p.L345L|TCEANC_ENST00000490617.1_3'UTR|TCEANC_ENST00000545566.1_Silent_p.L315L|TCEANC_ENST00000544987.1_Silent_p.L315L			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	315					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						GAGGAACACTTTTCCTTCCCA	0.423																																					p.L345L		Atlas-SNP	.											.	TCEANC	29	.	0			c.T1035A						.						50.0	41.0	44.0					X																	13681572		1913	4100	6013	SO:0001819	synonymous_variant	170082	exon4			AACACTTTTCCTT		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.945T>A	chrX.hg19:g.13681572T>A		156.0	0.0		144.0	72.0	NM_152634	A6NI06|B2RDM3	Silent	SNP	ENST00000380600.1	hg19																																																																																				.	.		0.423	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055796.1	NM_152634	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20194413	20194413	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:20194413C>A	ENST00000379565.3	-	13	1264	c.1057G>T	c.(1057-1059)Gat>Tat	p.D353Y	RPS6KA3_ENST00000544447.1_Missense_Mutation_p.D325Y|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.D324Y|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.D325Y	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	353	AGC-kinase C-terminal.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TAGAATGTATCTTCAGGCCTG	0.333																																					p.D353Y		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.G1057T						.						80.0	77.0	78.0					X																	20194413		2203	4300	6503	SO:0001583	missense	6197	exon13			ATGTATCTTCAGG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1057G>T	chrX.hg19:g.20194413C>A	ENSP00000368884:p.Asp353Tyr	314.0	0.0		353.0	146.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501688	0.85176	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.3	5.3	0.74995	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91486	0.7312	H	0.95611	3.695	0.80722	D	1	P;D;B;D	0.76494	0.503;0.999;0.022;0.994	P;D;B;D	0.66847	0.803;0.947;0.097;0.927	D	0.94048	0.7315	10	0.72032	D	0.01	.	18.0569	0.89366	0.0:1.0:0.0:0.0	.	325;324;325;353	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	Y	353;325;324;325	ENSP00000368884:D353Y;ENSP00000440220:D325Y;ENSP00000368865:D324Y;ENSP00000444837:D325Y	ENSP00000368865:D324Y	D	-	1	0	RPS6KA3	20104334	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.346000	0.79347	2.198000	0.70561	0.513000	0.50165	GAT	.	.		0.333	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
ZNF157	7712	hgsc.bcm.edu	37	X	47272506	47272506	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:47272506T>C	ENST00000377073.3	+	4	1120	c.1034T>C	c.(1033-1035)cTc>cCc	p.L345P		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	345					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						AAGATGACTCTCAATAATCAT	0.418																																					p.L345P		Atlas-SNP	.											.	ZNF157	46	.	0			c.T1034C						.						42.0	38.0	39.0					X																	47272506		2203	4299	6502	SO:0001583	missense	7712	exon4			TGACTCTCAATAA	U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.1034T>C	chrX.hg19:g.47272506T>C	ENSP00000366273:p.Leu345Pro	97.0	0.0		107.0	5.0	NM_003446	Q96LE9	Missense_Mutation	SNP	ENST00000377073.3	hg19	CCDS14278.1	.	.	.	.	.	.	.	.	.	.	T	16.37	3.104671	0.56291	.	.	ENSG00000147117	ENST00000377073	T	0.53857	0.6	3.18	3.18	0.36537	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71500	0.3347	M	0.85197	2.74	0.51233	D	0.999912	D	0.89917	1.0	D	0.97110	1.0	T	0.74719	-0.3570	9	0.87932	D	0	.	9.0532	0.36389	0.0:0.0:0.0:1.0	.	345	P51786	ZN157_HUMAN	P	345	ENSP00000366273:L345P	ENSP00000366273:L345P	L	+	2	0	ZNF157	47157450	0.998000	0.40836	0.294000	0.24946	0.996000	0.88848	7.089000	0.76909	1.486000	0.48398	0.486000	0.48141	CTC	.	.		0.418	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056415.1	NM_003446	
WNK3	65267	hgsc.bcm.edu	37	X	54265313	54265313	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:54265313T>C	ENST00000375159.2	-	17	3870	c.3871A>G	c.(3871-3873)Aaa>Gaa	p.K1291E	WNK3_ENST00000375169.3_Intron|WNK3_ENST00000354646.2_Missense_Mutation_p.K1291E			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1291					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TGACGGACTTTTGATCTCTTG	0.383																																					p.K1291E		Atlas-SNP	.											.	WNK3	218	.	0			c.A3871G						.						85.0	72.0	76.0					X																	54265313		2203	4300	6503	SO:0001583	missense	65267	exon18			GGACTTTTGATCT	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3871A>G	chrX.hg19:g.54265313T>C	ENSP00000364301:p.Lys1291Glu	84.0	0.0		95.0	4.0	NM_020922	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	hg19	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	T	15.38	2.817316	0.50633	.	.	ENSG00000196632	ENST00000354646;ENST00000375159	T;T	0.73575	-0.76;-0.76	5.03	5.03	0.67393	.	0.000000	0.56097	D	0.000027	T	0.66557	0.2801	L	0.27053	0.805	0.31471	N	0.668321	D	0.60575	0.988	P	0.52343	0.696	T	0.64097	-0.6487	10	0.05351	T	0.99	-16.7075	12.8618	0.57918	0.0:0.0:0.0:1.0	.	1291	Q9BYP7	WNK3_HUMAN	E	1291	ENSP00000346667:K1291E;ENSP00000364301:K1291E	ENSP00000346667:K1291E	K	-	1	0	WNK3	54282038	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.037000	0.57311	1.676000	0.50930	0.441000	0.28932	AAA	.	.		0.383	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
DCAF12L2	340578	hgsc.bcm.edu	37	X	125299293	125299293	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:125299293G>T	ENST00000360028.2	-	1	641	c.615C>A	c.(613-615)gaC>gaA	p.D205E	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.D205E			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	205										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CAGCTACGGTGTCACTCAGCC	0.652																																					p.D205E		Atlas-SNP	.											.	DCAF12L2	157	.	0			c.C615A						.						47.0	49.0	48.0					X																	125299293		2203	4299	6502	SO:0001583	missense	340578	exon1			TACGGTGTCACTC	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.615C>A	chrX.hg19:g.125299293G>T	ENSP00000353128:p.Asp205Glu	266.0	0.0		246.0	49.0	NM_001013628	B2RN42	Missense_Mutation	SNP	ENST00000360028.2	hg19	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102377	0.37145	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.62788	0.0;0.0	3.87	2.05	0.26809	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.34959	N	0.003555	T	0.73737	0.3625	M	0.76170	2.325	0.35008	D	0.756662	D	0.89917	1.0	D	0.87578	0.998	T	0.77233	-0.2663	10	0.62326	D	0.03	.	7.1017	0.25340	0.244:0.0:0.756:0.0	.	205	Q5VW00	DC122_HUMAN	E	205	ENSP00000441489:D205E;ENSP00000353128:D205E	ENSP00000353128:D205E	D	-	3	2	DCAF12L2	125126974	1.000000	0.71417	0.908000	0.35775	0.044000	0.14063	1.602000	0.36783	0.409000	0.25649	0.544000	0.68410	GAC	.	.		0.652	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
MAGEC2	51438	hgsc.bcm.edu	37	X	141291446	141291446	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:141291446T>C	ENST00000247452.3	-	3	675	c.328A>G	c.(328-330)Agc>Ggc	p.S110G		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	110	Ser-rich.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					CTGAATGAGCTCCATGAAAAA	0.537										HNSCC(46;0.14)																											p.S110G		Atlas-SNP	.											.	MAGEC2	102	.	0			c.A328G						.						75.0	72.0	73.0					X																	141291446		2203	4300	6503	SO:0001583	missense	51438	exon3			ATGAGCTCCATGA	AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.328A>G	chrX.hg19:g.141291446T>C	ENSP00000354660:p.Ser110Gly	68.0	0.0		91.0	4.0	NM_016249	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	ENST00000247452.3	hg19	CCDS14678.1	.	.	.	.	.	.	.	.	.	.	-	7.177	0.588735	0.13812	.	.	ENSG00000046774	ENST00000247452	T	0.05139	3.49	1.16	-2.32	0.06745	Melanoma associated antigen, MAGE, N-terminal (1);	0.798826	0.10596	U	0.656147	T	0.03220	0.0094	N	0.19112	0.55	0.09310	N	1	P	0.36048	0.534	B	0.32864	0.154	T	0.35475	-0.9787	10	0.52906	T	0.07	.	2.1628	0.03829	0.0:0.2538:0.3243:0.4219	.	110	Q9UBF1	MAGC2_HUMAN	G	110	ENSP00000354660:S110G	ENSP00000354660:S110G	S	-	1	0	MAGEC2	141119112	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.797000	0.04570	-0.746000	0.04766	-0.451000	0.05528	AGC	.	.		0.537	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058611.1	NM_016249	
SLITRK4	139065	hgsc.bcm.edu	37	X	142717432	142717432	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:142717432A>G	ENST00000381779.4	-	2	1718	c.1493T>C	c.(1492-1494)tTa>tCa	p.L498S	SLITRK4_ENST00000356928.1_Missense_Mutation_p.L498S|SLITRK4_ENST00000338017.4_Missense_Mutation_p.L498S	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	498						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTCTAGCTAAGGGTGCTCC	0.453																																					p.L498S		Atlas-SNP	.											.	SLITRK4	162	.	0			c.T1493C						.						103.0	108.0	106.0					X																	142717432		2203	4300	6503	SO:0001583	missense	139065	exon2			CTAGCTAAGGGTG	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1493T>C	chrX.hg19:g.142717432A>G	ENSP00000371198:p.Leu498Ser	273.0	0.0		244.0	113.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.914539	0.52546	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.80653	-1.4;-1.4;-1.4	5.38	5.38	0.77491	.	0.000000	0.64402	U	0.000004	D	0.91270	0.7248	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92915	0.6350	10	0.72032	D	0.01	-5.2205	13.372	0.60719	1.0:0.0:0.0:0.0	.	498	Q8IW52	SLIK4_HUMAN	S	498	ENSP00000371198:L498S;ENSP00000349400:L498S;ENSP00000336627:L498S	ENSP00000336627:L498S	L	-	2	0	SLITRK4	142545098	1.000000	0.71417	0.863000	0.33907	0.968000	0.65278	9.287000	0.95975	1.910000	0.55303	0.486000	0.48141	TTA	.	.		0.453	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
PNMA3	29944	hgsc.bcm.edu	37	X	152226392	152226392	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:152226392T>C	ENST00000370264.4	+	1	1006	c.980T>C	c.(979-981)gTg>gCg	p.V327A	PNMA3_ENST00000370265.4_Missense_Mutation_p.V327A|PNMA3_ENST00000447306.1_Missense_Mutation_p.V327A			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	327					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					ctggccctggtgaagctcctg	0.567																																					p.V327A		Atlas-SNP	.											.	PNMA3	81	.	0			c.T980C						.						40.0	41.0	40.0					X																	152226392		2203	4300	6503	SO:0001583	missense	29944	exon2			CCCTGGTGAAGCT	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.980T>C	chrX.hg19:g.152226392T>C	ENSP00000359286:p.Val327Ala	126.0	0.0		91.0	4.0	NM_013364	D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	hg19	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	t	13.13	2.144452	0.37825	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.09817	2.94;2.94;2.94	1.67	1.67	0.24075	.	.	.	.	.	T	0.13457	0.0326	L	0.43152	1.355	0.09310	N	1	P	0.50943	0.94	P	0.50659	0.647	T	0.14420	-1.0473	9	0.66056	D	0.02	.	4.9316	0.13919	0.0:0.0:0.0:1.0	.	327	Q9UL41	PNMA3_HUMAN	A	327	ENSP00000359288:V327A;ENSP00000407642:V327A;ENSP00000359286:V327A	ENSP00000359286:V327A	V	+	2	0	PNMA3	151977048	0.007000	0.16637	0.004000	0.12327	0.098000	0.18820	1.989000	0.40707	0.923000	0.37045	0.237000	0.17872	GTG	.	.		0.567	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364	
UBR1	197131	hgsc.bcm.edu	37	15	43363075	43363075	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:43363075delT	ENST00000290650.4	-	5	655	c.577delA	c.(577-579)atafs	p.I193fs	UBR1_ENST00000382177.2_Frame_Shift_Del_p.I193fs	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	193					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GAAGGAAATATTTTCCTGGCT	0.363																																					p.I193fs		Atlas-INDEL	.											.	UBR1	124	.	0			c.578delT						.						119.0	115.0	117.0					15																	43363075		2203	4299	6502	SO:0001589	frameshift_variant	197131	exon5			.		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.577delA	chr15.hg19:g.43363075delT	ENSP00000290650:p.Ile193fs	74.0	0.0		130.0	12.0	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Frame_Shift_Del	DEL	ENST00000290650.4	hg19	CCDS10091.1																																																																																			.	.		0.363	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
TNRC18	84629	hgsc.bcm.edu	37	7	5410486	5410486	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:5410486delC	ENST00000430969.1	-	11	4087	c.3739delG	c.(3739-3741)gtgfs	p.V1247fs	TNRC18_ENST00000399537.4_Frame_Shift_Del_p.V1247fs	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1247							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GTCAGCTGCACCCCCAGGTCC	0.697																																					p.V1247fs		Atlas-INDEL	.											.	TNRC18	311	.	0			c.3740delT						.						14.0	17.0	16.0					7																	5410486		1989	4160	6149	SO:0001589	frameshift_variant	84629	exon11			.	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.3739delG	chr7.hg19:g.5410486delC	ENSP00000395538:p.Val1247fs	168.0	0.0		144.0	10.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Frame_Shift_Del	DEL	ENST00000430969.1	hg19	CCDS47534.1																																																																																			.	.		0.697	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
SCAMP5	192683	hgsc.bcm.edu	37	15	75308993	75308993	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:75308993delG	ENST00000361900.6	+	5	403	c.196delG	c.(196-198)gggfs	p.G67fs	SCAMP5_ENST00000562212.1_Frame_Shift_Del_p.G67fs|SCAMP5_ENST00000545456.1_Intron|SCAMP5_ENST00000565923.1_3'UTR|SCAMP5_ENST00000568081.1_5'Flank|SCAMP5_ENST00000425597.3_Frame_Shift_Del_p.G67fs	NM_001178111.1	NP_001171582.1	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	67					exocytosis (GO:0006887)|negative regulation of endocytosis (GO:0045806)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of cytokine secretion (GO:0050715)|protein transport (GO:0015031)|response to endoplasmic reticulum stress (GO:0034976)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)|trans-Golgi network membrane (GO:0032588)				large_intestine(1)|lung(1)|ovary(1)|urinary_tract(2)	5						GATCGGAGGCGGGGGAGCCAC	0.597																																					p.G65fs		Atlas-INDEL	.											.	SCAMP5	34	.	0			c.195delC						.						114.0	120.0	118.0					15																	75308993		2157	4252	6409	SO:0001589	frameshift_variant	192683	exon5			.	AL833230	CCDS45306.1	15q24.2	2014-05-20			ENSG00000198794	ENSG00000198794		"""Secretory carrier membrane proteins"""	30386	protein-coding gene	gene with protein product		613766				12477932	Standard	NM_001178111		Approved	MGC24969	uc002azk.2	Q8TAC9	OTTHUMG00000172704	ENST00000361900.6:c.196delG	chr15.hg19:g.75308993delG	ENSP00000355387:p.Gly67fs	123.0	0.0		155.0	10.0	NM_001178111	B3KPJ7|B7Z762|D3DW71|Q8N3M4	Frame_Shift_Del	DEL	ENST00000361900.6	hg19	CCDS45306.1																																																																																			.	.		0.597	SCAMP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420015.2	NM_138967	
NOL10	79954	hgsc.bcm.edu	37	2	10729763	10729763	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:10729763delT	ENST00000381685.5	-	18	1642	c.1537delA	c.(1537-1539)attfs	p.I513fs	NOL10_ENST00000542668.1_Frame_Shift_Del_p.I463fs|NOL10_ENST00000538384.1_Frame_Shift_Del_p.I487fs|NOL10_ENST00000345985.3_Frame_Shift_Del_p.I463fs|AC092687.5_ENST00000414538.1_RNA	NM_024894.3	NP_079170.2	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	513						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)					Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		TTTTCACTAATTTTTGAAACA	0.343																																					p.I513fs		Atlas-INDEL	.											.	NOL10	22	.	0			c.1538delT						.						77.0	73.0	74.0					2																	10729763		2200	4296	6496	SO:0001589	frameshift_variant	79954	exon18			.	AK024137	CCDS1673.2, CCDS58697.1, CCDS58698.1	2p25.1	2008-05-23			ENSG00000115761	ENSG00000115761			25862	protein-coding gene	gene with protein product			"""polyglutamine binding protein 5"""	PQBP5		12477932	Standard	NM_024894		Approved	FLJ14075	uc002raq.3	Q9BSC4	OTTHUMG00000119023	ENST00000381685.5:c.1537delA	chr2.hg19:g.10729763delT	ENSP00000371101:p.Ile513fs	120.0	0.0		140.0	10.0	NM_024894	A8K3R5|B4DLV0|Q53RC9|Q96TA5|Q9H7Y7|Q9H855	Frame_Shift_Del	DEL	ENST00000381685.5	hg19	CCDS1673.2																																																																																			.	.		0.343	NOL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239227.1	NM_024894	
ARID1B	57492	hgsc.bcm.edu	37	6	157528676	157528676	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:157528676delT	ENST00000350026.5	+	19	6363	c.6362delT	c.(6361-6363)cttfs	p.L2122fs	ARID1B_ENST00000367148.1_Frame_Shift_Del_p.L2175fs|ARID1B_ENST00000275248.4_Frame_Shift_Del_p.L2117fs|ARID1B_ENST00000346085.5_Frame_Shift_Del_p.L2135fs	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	2122					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TCCATGGCGCTTTTATCGAAC	0.493																																					p.L2134fs		Atlas-INDEL	.											.	ARID1B	320	.	0			c.6400delC						.						174.0	178.0	177.0					6																	157528676		2203	4296	6499	SO:0001589	frameshift_variant	57492	exon20			.	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.6362delT	chr6.hg19:g.157528676delT	ENSP00000055163:p.Leu2122fs	123.0	0.0		153.0	10.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Frame_Shift_Del	DEL	ENST00000350026.5	hg19	CCDS5251.2																																																																																			.	.		0.493	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
RFX5	5993	hgsc.bcm.edu	37	1	151318753	151318753	+	Frame_Shift_Del	DEL	C	C	-	rs569159154		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:151318753delC	ENST00000290524.4	-	3	222	c.44delG	c.(43-45)ggafs	p.G15fs	RFX5_ENST00000452513.2_Frame_Shift_Del_p.G15fs|RFX5_ENST00000452671.2_Frame_Shift_Del_p.G15fs|RFX5_ENST00000368870.2_Frame_Shift_Del_p.G15fs|RP11-126K1.6_ENST00000455503.1_RNA|RFX5_ENST00000478564.1_5'UTR	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	15					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGGGGCCCTTCCCCCAGTCTT	0.557																																					p.G15fs		Atlas-INDEL	.											.	RFX5	69	.	0			c.45delA						.						85.0	89.0	88.0					1																	151318753		2203	4300	6503	SO:0001589	frameshift_variant	5993	exon3			.		CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.44delG	chr1.hg19:g.151318753delC	ENSP00000290524:p.Gly15fs	118.0	0.0		247.0	16.0	NM_000449	B7Z848|D3DV19|E9PFU4|Q5VWC3	Frame_Shift_Del	DEL	ENST00000290524.4	hg19	CCDS994.1																																																																																			.	.		0.557	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034892.6	NM_000449	
QARS	5859	hgsc.bcm.edu	37	3	49140816	49140816	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:49140816delC	ENST00000306125.6	-	5	815	c.478delG	c.(478-480)gcafs	p.A160fs	QARS_ENST00000420147.2_Frame_Shift_Del_p.A178fs|QARS_ENST00000470225.1_5'Flank|QARS_ENST00000414533.1_Frame_Shift_Del_p.A149fs			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	160					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	TTGCCATCTGCCCACTTCAGC	0.517																																					p.A160fs		Atlas-INDEL	.											.	QARS	55	.	0			c.479delC						.						140.0	125.0	130.0					3																	49140816		2203	4300	6503	SO:0001589	frameshift_variant	5859	exon5			.	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.478delG	chr3.hg19:g.49140816delC	ENSP00000307567:p.Ala160fs	122.0	0.0		140.0	12.0	NM_005051	B4DWJ2	Frame_Shift_Del	DEL	ENST00000306125.6	hg19	CCDS2788.1																																																																																			.	.		0.517	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345689.2	NM_005051	
KIAA1551	55196	hgsc.bcm.edu	37	12	32138119	32138119	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:32138119delT	ENST00000312561.4	+	4	4644	c.4230delT	c.(4228-4230)tctfs	p.S1410fs	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1410																	TAGGTGACTCTTTGTCAAACC	0.348																																					p.S1410fs		Atlas-INDEL	.											.	.	.	.	0			c.4229delC						.						80.0	84.0	82.0					12																	32138119		2203	4299	6502	SO:0001589	frameshift_variant	55196	exon4			.	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.4230delT	chr12.hg19:g.32138119delT	ENSP00000310338:p.Ser1410fs	153.0	0.0		161.0	10.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Frame_Shift_Del	DEL	ENST00000312561.4	hg19	CCDS8725.2																																																																																			.	.		0.348	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
CDC123	8872	hgsc.bcm.edu	37	10	12259467	12259470	+	Splice_Site	DEL	GTAA	GTAA	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	GTAA	GTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:12259467_12259470delGTAA	ENST00000281141.4	+	6	720		c.e6+1		CDC123_ENST00000378900.2_Splice_Site|CDC123_ENST00000455773.3_Splice_Site	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)		p.?(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						TCACTCAGCCGTAAGTATCTCTTA	0.343																																					p.147_147del		Atlas-Indel,Pindel	.											.	CDC123	34	.	1	Unknown(1)	endometrium(1)	c.440_440del						.			1,4263		0,1,2131						5.0	1.0			82	1,8253		0,1,4126	no	splice-5	CDC123	NM_006023.2		0,2,6257	A1A1,A1R,RR		0.0121,0.0235,0.016				2,12516				SO:0001630	splice_region_variant	8872	exon6			.	BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.440+1GTAA>-	chr10.hg19:g.12259467_12259470delGTAA		107.0	0.0		73.0	24.0	NM_006023	A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	Frame_Shift_Del	DEL	ENST00000281141.4	hg19	CCDS7090.1																																																																																			.	.		0.343	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046801.1	NM_006023	Intron
HNRNPK	3190	hgsc.bcm.edu	37	9	86591918	86591918	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:86591918delG	ENST00000376264.2	-	5	463	c.205delC	c.(205-207)cgtfs	p.R69fs	RP11-575L7.8_ENST00000448389.1_RNA|HNRNPK_ENST00000376281.4_Frame_Shift_Del_p.R69fs|HNRNPK_ENST00000351839.3_Frame_Shift_Del_p.R69fs|HNRNPK_ENST00000376263.3_Frame_Shift_Del_p.R69fs|HNRNPK_ENST00000360384.5_Frame_Shift_Del_p.R69fs	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	69	2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|Interaction with ASFV p30.|KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with DDX1.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)	p.R69S(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						ACGTCTGTACGGAGAGCCTTA	0.328																																					p.R69fs		Atlas-INDEL	.											.	HNRNPK	49	.	1	Substitution - Missense(1)	lung(1)	c.206delG						.						86.0	85.0	85.0					9																	86591918		2203	4300	6503	SO:0001589	frameshift_variant	3190	exon5			.		CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.205delC	chr9.hg19:g.86591918delG	ENSP00000365440:p.Arg69fs	100.0	0.0		136.0	10.0	NM_031263	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Frame_Shift_Del	DEL	ENST00000376264.2	hg19	CCDS6667.1																																																																																			.	.		0.328	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052846.2		
HNRNPH3	3189	hgsc.bcm.edu	37	10	70101436	70101436	+	Splice_Site	DEL	G	G	-	rs146848138		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:70101436delG	ENST00000265866.7	+	8	1035	c.870delG	c.(868-870)atg>at	p.M290fs	HNRNPH3_ENST00000469172.1_3'UTR|HNRNPH3_ENST00000354695.5_Splice_Site_p.M275fs|HNRNPH3_ENST00000441000.2_Splice_Site_p.M182fs	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)	290	Gly-rich.				epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						GAGATGGAATGGGTATGTAAA	0.388																																					p.M290fs		Atlas-INDEL	.											.	HNRNPH3	33	.	0			c.869delT						.						107.0	113.0	111.0					10																	70101436		2203	4300	6503	SO:0001630	splice_region_variant	3189	exon8			.		CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349	ENST00000265866.7:c.871+1G>-	chr10.hg19:g.70101436delG		132.0	0.0		115.0	10.0	NM_012207	A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	Frame_Shift_Del	DEL	ENST00000265866.7	hg19	CCDS7278.1																																																																																			.	.		0.388	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090165.1		Frame_Shift_Del
MAP1B	4131	hgsc.bcm.edu	37	5	71493243	71493243	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:71493243delA	ENST00000296755.7	+	5	4359	c.4061delA	c.(4060-4062)gaafs	p.E1354fs		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1354					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GAAGTCATTGAAAAACCACCA	0.483																																					p.E1354fs	Melanoma(17;367 822 11631 31730 47712)	Atlas-INDEL	.											.	MAP1B	243	.	0			c.4060delG						.						77.0	79.0	78.0					5																	71493243		2203	4300	6503	SO:0001589	frameshift_variant	4131	exon5			.	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4061delA	chr5.hg19:g.71493243delA	ENSP00000296755:p.Glu1354fs	133.0	0.0		139.0	10.0	NM_005909	A2BDK5	Frame_Shift_Del	DEL	ENST00000296755.7	hg19	CCDS4012.1																																																																																			.	.		0.483	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
WDR70	55100	hgsc.bcm.edu	37	5	37752658	37752658	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:37752658delA	ENST00000265107.4	+	18	2104	c.1948delA	c.(1948-1950)aaafs	p.K651fs		NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	651							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCCAGAATGGAAAAAACGTAA	0.373																																					p.W649X		Atlas-INDEL	.											.	WDR70	76	.	0			c.1947delG						.						79.0	77.0	78.0					5																	37752658		2203	4300	6503	SO:0001589	frameshift_variant	55100	exon18			.	BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1948delA	chr5.hg19:g.37752658delA	ENSP00000265107:p.Lys651fs	83.0	0.0		180.0	11.0	NM_018034	Q9H053	Frame_Shift_Del	DEL	ENST00000265107.4	hg19	CCDS34147.1																																																																																			.	.		0.373	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368294.1	NM_018034	
RHBDF2	79651	hgsc.bcm.edu	37	17	74473785	74473787	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:74473785_74473787delTCC	ENST00000313080.4	-	7	1113_1115	c.840_842delGGA	c.(838-843)gaggat>gat	p.E280del	RHBDF2_ENST00000592378.1_5'Flank|RHBDF2_ENST00000389760.4_In_Frame_Del_p.E251del|RHBDF2_ENST00000591885.1_In_Frame_Del_p.E251del	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	280					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						ATCGACCACATCCTCCTCCAGGA	0.64																																					p.281_281del		Atlas-Indel,Pindel	.											.	RHBDF2	57	.	0			c.841_843del						.																																			SO:0001651	inframe_deletion	79651	exon7			.	BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.840_842delGGA	chr17.hg19:g.74473791_74473793delTCC	ENSP00000322775:p.Glu280del	88.0	0.0		38.0	28.0	NM_024599	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	In_Frame_Del	DEL	ENST00000313080.4	hg19	CCDS32743.1																																																																																			.	.		0.640	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73020687	73020687	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:73020687delC	ENST00000263674.3	+	1	1354	c.1004delC	c.(1003-1005)gccfs	p.A335fs	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	335					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						TCTCCAAGAGCCCCTAGAGAA	0.592																																					p.A335fs		Atlas-INDEL	.											.	ARHGEF17	117	.	0			c.1003delG						.						47.0	57.0	54.0					11																	73020687		2176	4249	6425	SO:0001589	frameshift_variant	9828	exon1			.	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1004delC	chr11.hg19:g.73020687delC	ENSP00000263674:p.Ala335fs	97.0	0.0		133.0	10.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Frame_Shift_Del	DEL	ENST00000263674.3	hg19	CCDS8221.1																																																																																			.	.		0.592	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
NFASC	23114	hgsc.bcm.edu	37	1	204971735	204971735	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:204971735delA	ENST00000401399.1	+	26	3347	c.3148delA	c.(3148-3150)aaafs	p.K1051fs	NFASC_ENST00000367172.4_Frame_Shift_Del_p.K1158fs|NFASC_ENST00000404076.1_Intron|NFASC_ENST00000339876.6_Frame_Shift_Del_p.K1051fs|NFASC_ENST00000338586.6_Frame_Shift_Del_p.K1035fs|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000367171.4_Frame_Shift_Del_p.K1143fs|NFASC_ENST00000360049.4_Intron|NFASC_ENST00000367170.4_Frame_Shift_Del_p.K1079fs|NFASC_ENST00000539706.1_Intron|NFASC_ENST00000404907.1_Intron|NFASC_ENST00000513543.1_Intron|NFASC_ENST00000338515.6_Intron			O94856	NFASC_HUMAN	neurofascin	1158	Thr-rich.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CAACCATACGAAAAAAACTGT	0.537																																					p.T1049fs		Atlas-INDEL	.											.	NFASC	396	.	0			c.3147delG						.						59.0	55.0	56.0					1																	204971735		1567	3582	5149	SO:0001589	frameshift_variant	23114	exon27			.	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3148delA	chr1.hg19:g.204971735delA	ENSP00000385637:p.Lys1051fs	112.0	0.0		212.0	16.0	NM_001005388	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Frame_Shift_Del	DEL	ENST00000401399.1	hg19	CCDS53460.1																																																																																			.	.		0.537	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
ACSS1	84532	hgsc.bcm.edu	37	20	25002140	25002140	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:25002140delA	ENST00000323482.4	-	6	1072	c.993delT	c.(991-993)tttfs	p.F331fs	ACSS1_ENST00000542618.1_Frame_Shift_Del_p.F210fs|ACSS1_ENST00000432802.2_Frame_Shift_Del_p.F331fs|ACSS1_ENST00000537502.1_Frame_Shift_Del_p.F248fs	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	331					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCACACAGCCAAAGATGTCAC	0.557																																					p.G332fs		Atlas-INDEL	.											.	ACSS1	46	.	0			c.994delG						.						92.0	77.0	82.0					20																	25002140		2203	4300	6503	SO:0001589	frameshift_variant	84532	exon6			.		CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.993delT	chr20.hg19:g.25002140delA	ENSP00000316924:p.Phe331fs	176.0	0.0		166.0	10.0	NM_001252677	B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Frame_Shift_Del	DEL	ENST00000323482.4	hg19	CCDS13167.1																																																																																			.	.		0.557	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078386.2	NM_032501	
C9orf72	203228	hgsc.bcm.edu	37	9	27566850	27566850	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:27566850delT	ENST00000380003.3	-	2	332	c.269delA	c.(268-270)aagfs	p.K90fs	C9orf72_ENST00000379997.3_Frame_Shift_Del_p.K90fs|C9orf72_ENST00000488117.1_5'UTR	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	90					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		AATCACTCCCTTTTCAGACAA	0.373																																					p.K90fs		Atlas-INDEL	.											.	C9orf72	48	.	0			c.270delG						.						97.0	93.0	94.0					9																	27566850		2203	4300	6503	SO:0001589	frameshift_variant	203228	exon2			.	AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.269delA	chr9.hg19:g.27566850delT	ENSP00000369339:p.Lys90fs	182.0	0.0		179.0	13.0	NM_018325	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Frame_Shift_Del	DEL	ENST00000380003.3	hg19	CCDS6522.1																																																																																			.	.		0.373	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
C10orf107	219621	hgsc.bcm.edu	37	10	63441027	63441027	+	Frame_Shift_Del	DEL	A	A	-	rs12359246		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:63441027delA	ENST00000330194.2	+	2	332	c.27delA	c.(25-27)tcafs	p.S9fs		NM_173554.2	NP_775825.1	Q8IVU9	CJ107_HUMAN	chromosome 10 open reading frame 107	9										breast(1)|kidney(1)|lung(4)|prostate(1)|skin(1)	8	Prostate(12;0.016)					TTCAGTATTCAAAATTTATGA	0.274																																					p.S9X		Atlas-INDEL	.											.	C10orf107	24	.	0			c.26delC						.						80.0	84.0	83.0					10																	63441027		2199	4273	6472	SO:0001589	frameshift_variant	219621	exon2			.	BC041932	CCDS7262.1	10q21.3	2012-06-01			ENSG00000183346	ENSG00000183346			28678	protein-coding gene	gene with protein product						12477932	Standard	NM_173554		Approved	bA63A2.1, Em:AC022398.2, MGC44593	uc010qik.2	Q8IVU9	OTTHUMG00000018295	ENST00000330194.2:c.27delA	chr10.hg19:g.63441027delA	ENSP00000328698:p.Ser9fs	75.0	0.0		102.0	10.0	NM_173554	Q5T1B8	Frame_Shift_Del	DEL	ENST00000330194.2	hg19	CCDS7262.1																																																																																			.	.		0.274	C10orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048228.2	NM_173554	
PRDM1	639	hgsc.bcm.edu	37	6	106553568	106553568	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:106553568delC	ENST00000369096.4	+	5	1767	c.1533delC	c.(1531-1533)agcfs	p.S511fs	PRDM1_ENST00000369089.3_Frame_Shift_Del_p.S377fs|PRDM1_ENST00000369091.2_Frame_Shift_Del_p.S475fs	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	511					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		AGGCCTGTAGCCCCACAAGCG	0.677			"""D, N, Mis, F, S"""		DLBCL																																p.S511fs		Atlas-INDEL	.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	195	.	0			c.1532delG						.						24.0	29.0	27.0					6																	106553568		2192	4279	6471	SO:0001589	frameshift_variant	639	exon5			.		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1533delC	chr6.hg19:g.106553568delC	ENSP00000358092:p.Ser511fs	118.0	0.0		145.0	10.0	NM_001198	B2REA6|E1P5E0|Q86WM7	Frame_Shift_Del	DEL	ENST00000369096.4	hg19	CCDS5054.2																																																																																			.	.		0.677	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
ZMIZ2	83637	hgsc.bcm.edu	37	7	44796547	44796547	+	Splice_Site	DEL	T	T	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:44796547delT	ENST00000309315.4	+	4	290	c.167delT	c.(166-168)gtt>gt	p.V56fs	ZMIZ2_ENST00000441627.1_Splice_Site_p.V56fs|ZMIZ2_ENST00000413916.1_Intron|ZMIZ2_ENST00000433667.1_Intron|ZMIZ2_ENST00000265346.7_Splice_Site_p.V56fs	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	56	Gly-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TCCTCATAGGTTTTGGGGAAC	0.592																																					p.V56fs	NSCLC(20;604 852 1948 16908 50522)	Atlas-INDEL	.											.	ZMIZ2	82	.	0			c.166delG						.						113.0	115.0	114.0					7																	44796547		1973	4147	6120	SO:0001630	splice_region_variant	83637	exon3			.	AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.166-1T>-	chr7.hg19:g.44796547delT		165.0	0.0		151.0	10.0	NM_174929	A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Frame_Shift_Del	DEL	ENST00000309315.4	hg19	CCDS43576.1																																																																																			.	.		0.592	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341790.1	NM_031449	Frame_Shift_Del
