#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NRAS	4893	hgsc.bcm.edu	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K		Atlas-SNP	.		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,0,4	NRAS	3766	.	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A						.						180.0	156.0	164.0					1																	115256530		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CTTCTTGTCCAGC	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	chr1.hg19:g.115256530G>T	ENSP00000358548:p.Gln61Lys	100.0	0.0		75.0	8.0	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	hg19	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA	.	.		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
ITGA10	8515	hgsc.bcm.edu	37	1	145533439	145533439	+	Missense_Mutation	SNP	G	G	T	rs149835959		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr1:145533439G>T	ENST00000369304.3	+	12	1497	c.1322G>T	c.(1321-1323)cGg>cTg	p.R441L	ITGA10_ENST00000539363.1_Missense_Mutation_p.R298L|ITGA10_ENST00000538811.1_Missense_Mutation_p.R310L	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	441					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ATGCTTTTGCGGGGTGGACGC	0.517																																					p.R441L		Atlas-SNP	.											.	ITGA10	131	.	0			c.G1322T						.						126.0	140.0	136.0					1																	145533439		2203	4300	6503	SO:0001583	missense	8515	exon12			TTTTGCGGGGTGG	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1322G>T	chr1.hg19:g.145533439G>T	ENSP00000358310:p.Arg441Leu	37.0	0.0		77.0	8.0	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	hg19	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	7.337	0.620130	0.14193	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.71461	-0.57;-0.57;-0.57	5.04	-2.87	0.05700	.	0.474289	0.20350	N	0.094065	T	0.28200	0.0696	N	0.25992	0.78	0.29511	N	0.854225	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.13407	0.009;0.004;0.001;0.002	T	0.12066	-1.0562	10	0.30078	T	0.28	.	6.0533	0.19796	0.085:0.4521:0.3421:0.1208	.	407;310;298;441	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	L	441;407;298;310	ENSP00000358310:R441L;ENSP00000439894:R298L;ENSP00000440011:R310L	ENSP00000358310:R441L	R	+	2	0	ITGA10	144244796	0.055000	0.20627	0.874000	0.34290	0.991000	0.79684	0.211000	0.17474	-0.245000	0.09625	-0.150000	0.13652	CGG	.	G|1.000;A|0.000		0.517	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
PAPPA2	60676	hgsc.bcm.edu	37	1	176759013	176759013	+	Missense_Mutation	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr1:176759013G>A	ENST00000367662.3	+	18	5948	c.4784G>A	c.(4783-4785)tGt>tAt	p.C1595Y		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1595	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCTGTGGTGTGTGAGCCACCC	0.478																																					p.C1595Y		Atlas-SNP	.											.	PAPPA2	665	.	0			c.G4784A						.						120.0	122.0	121.0					1																	176759013		2008	4168	6176	SO:0001583	missense	60676	exon18			TGGTGTGTGAGCC	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4784G>A	chr1.hg19:g.176759013G>A	ENSP00000356634:p.Cys1595Tyr	136.0	0.0		156.0	44.0	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	hg19	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873071	0.72180	.	.	ENSG00000116183	ENST00000367662	D	0.84298	-1.83	5.51	5.51	0.81932	Complement control module (1);Sushi/SCR/CCP (2);	0.000000	0.85682	D	0.000000	D	0.93006	0.7774	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93836	0.7132	10	0.87932	D	0	-13.0656	16.3531	0.83224	0.0:0.0:1.0:0.0	.	1595	Q9BXP8	PAPP2_HUMAN	Y	1595	ENSP00000356634:C1595Y	ENSP00000356634:C1595Y	C	+	2	0	PAPPA2	175025636	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	6.743000	0.74848	2.582000	0.87167	0.557000	0.71058	TGT	.	.		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
CRB1	23418	hgsc.bcm.edu	37	1	197297620	197297620	+	Missense_Mutation	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr1:197297620G>T	ENST00000367400.3	+	2	274	c.139G>T	c.(139-141)Gat>Tat	p.D47Y	CRB1_ENST00000535699.1_5'UTR|CRB1_ENST00000367399.2_Missense_Mutation_p.D47Y|CRB1_ENST00000538660.1_Missense_Mutation_p.D47Y	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	47	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TACATGCAAAGATTTTTCAAA	0.348																																					p.D47Y		Atlas-SNP	.											.	CRB1	284	.	0			c.G139T						.						59.0	60.0	60.0					1																	197297620		2203	4300	6503	SO:0001583	missense	23418	exon2			TGCAAAGATTTTT		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.139G>T	chr1.hg19:g.197297620G>T	ENSP00000356370:p.Asp47Tyr	104.0	0.0		173.0	7.0	NM_001257966	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	hg19	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	10.50	1.366945	0.24771	.	.	ENSG00000134376	ENST00000538660;ENST00000367400;ENST00000367399	D;D;D	0.92805	-3.11;-1.79;-2.29	5.43	-1.2	0.09554	Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.93051	0.7788	M	0.82923	2.615	0.09310	N	1	B;D;P;P	0.63046	0.087;0.992;0.468;0.744	B;P;B;B	0.56042	0.099;0.79;0.115;0.24	D	0.84706	0.0731	9	0.72032	D	0.01	.	2.8843	0.05657	0.3794:0.1059:0.4111:0.1036	.	47;47;47;72	B7Z5T2;P82279-3;P82279;Q59H36	.;.;CRUM1_HUMAN;.	Y	47	ENSP00000438091:D47Y;ENSP00000356370:D47Y;ENSP00000356369:D47Y	ENSP00000356369:D47Y	D	+	1	0	CRB1	195564243	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.152000	0.16302	-0.408000	0.07565	-0.140000	0.14226	GAT	.	.		0.348	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
IPO9	55705	hgsc.bcm.edu	37	1	201827625	201827625	+	Silent	SNP	A	A	C			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr1:201827625A>C	ENST00000361565.4	+	12	1341	c.1272A>C	c.(1270-1272)gcA>gcC	p.A424A		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	424					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TGGCTGCTGCAGCCACTCGAC	0.458																																					p.A424A		Atlas-SNP	.											.	IPO9	98	.	0			c.A1272C						.						71.0	84.0	79.0					1																	201827625		2202	4300	6502	SO:0001819	synonymous_variant	55705	exon12			TGCTGCAGCCACT	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.1272A>C	chr1.hg19:g.201827625A>C		210.0	0.0		246.0	72.0	NM_018085	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Silent	SNP	ENST00000361565.4	hg19	CCDS1415.1																																																																																			.	.		0.458	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
TMCC2	9911	hgsc.bcm.edu	37	1	205238236	205238236	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr1:205238236G>A	ENST00000358024.3	+	3	1295	c.906G>A	c.(904-906)caG>caA	p.Q302Q	TMCC2_ENST00000330675.7_Silent_p.Q77Q|TMCC2_ENST00000329800.7_Silent_p.Q62Q|TMCC2_ENST00000545499.1_Silent_p.Q224Q|TMCC2_ENST00000495538.1_3'UTR	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	302						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TCACCGAGCAGATCAAGATTG	0.597																																					p.Q302Q		Atlas-SNP	.											.	TMCC2	89	.	0			c.G906A						.						64.0	56.0	59.0					1																	205238236		2203	4300	6503	SO:0001819	synonymous_variant	9911	exon3			CGAGCAGATCAAG	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.906G>A	chr1.hg19:g.205238236G>A		367.0	0.0		491.0	82.0	NM_014858	A2RRH3|B7Z1P7|Q6ZN09	Silent	SNP	ENST00000358024.3	hg19	CCDS30984.1																																																																																			.	.		0.597	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858	
PGBD5	79605	hgsc.bcm.edu	37	1	230468774	230468774	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr1:230468774G>A	ENST00000525115.1	-	5	905	c.882C>T	c.(880-882)tgC>tgT	p.C294C	PGBD5_ENST00000530424.1_5'UTR|PGBD5_ENST00000321327.2_Silent_p.C393C|PGBD5_ENST00000391860.1_Silent_p.C248C			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	294						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GGAGCAAGCCGCAGCAGTAAA	0.657																																					p.C363C		Atlas-SNP	.											PGBD5,NS,carcinoma,0,1	PGBD5	73	.	0			c.C1089T						.						32.0	34.0	33.0					1																	230468774		2201	4299	6500	SO:0001819	synonymous_variant	79605	exon5			CAAGCCGCAGCAG	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.882C>T	chr1.hg19:g.230468774G>A		44.0	0.0		57.0	34.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	ENST00000525115.1	hg19																																																																																				.	.		0.657	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
ITSN2	50618	hgsc.bcm.edu	37	2	24535152	24535152	+	Missense_Mutation	SNP	T	T	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr2:24535152T>A	ENST00000355123.4	-	5	724	c.281A>T	c.(280-282)cAg>cTg	p.Q94L	ITSN2_ENST00000407704.1_5'UTR|ITSN2_ENST00000361999.3_Missense_Mutation_p.Q94L|ITSN2_ENST00000406921.3_Missense_Mutation_p.Q94L	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	94	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACAGGCAACTGTTGGCCTTG	0.398																																					p.Q94L		Atlas-SNP	.											.	ITSN2	224	.	0			c.A281T						.						182.0	154.0	163.0					2																	24535152		2203	4300	6503	SO:0001583	missense	50618	exon5			GGCAACTGTTGGC	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.281A>T	chr2.hg19:g.24535152T>A	ENSP00000347244:p.Gln94Leu	299.0	0.0		308.0	62.0	NM_147152	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	hg19	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	T	12.71	2.019421	0.35606	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011;ENST00000443927	T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54	5.07	2.68	0.31781	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.207467	0.23474	U	0.047797	T	0.27169	0.0666	L	0.43152	1.355	0.22305	N	0.999216	P;P;P;B	0.35793	0.521;0.521;0.521;0.109	B;B;B;B	0.40285	0.325;0.325;0.325;0.146	T	0.12734	-1.0536	10	0.52906	T	0.07	.	7.4711	0.27349	0.0:0.0781:0.3963:0.5256	.	94;94;94;94	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	L	94;94;94;93;94;94;80	ENSP00000354561:Q94L;ENSP00000347244:Q94L;ENSP00000370250:Q94L;ENSP00000384499:Q94L;ENSP00000391224:Q94L;ENSP00000391715:Q80L	ENSP00000347244:Q94L	Q	-	2	0	ITSN2	24388656	0.380000	0.25131	0.992000	0.48379	0.801000	0.45260	0.097000	0.15168	1.030000	0.39839	0.533000	0.62120	CAG	.	.		0.398	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
TMEM247	388946	hgsc.bcm.edu	37	2	46707702	46707702	+	Silent	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr2:46707702G>T	ENST00000434431.1	+	2	276	c.276G>T	c.(274-276)ctG>ctT	p.L92L		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	92						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CCGCAGAGCTGCCCCCGACCC	0.637																																					p.L92L		Atlas-SNP	.											.	.	.	.	0			c.G276T						.						37.0	51.0	47.0					2																	46707702		692	1591	2283	SO:0001819	synonymous_variant	388946	exon2			AGAGCTGCCCCCG		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.276G>T	chr2.hg19:g.46707702G>T		132.0	0.0		145.0	78.0	NM_001145051		Silent	SNP	ENST00000434431.1	hg19	CCDS56117.1																																																																																			.	.		0.637	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
SPTBN1	6711	hgsc.bcm.edu	37	2	54753649	54753649	+	Missense_Mutation	SNP	A	A	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr2:54753649A>T	ENST00000356805.4	+	2	375	c.94A>T	c.(94-96)Aat>Tat	p.N32Y	AC092839.3_ENST00000433475.1_RNA	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	32	Actin-binding.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CGACTGGGACAATGAGAACAG	0.532																																					p.N32Y		Atlas-SNP	.											.	SPTBN1	378	.	0			c.A94T						.						153.0	137.0	142.0					2																	54753649		2203	4300	6503	SO:0001583	missense	6711	exon2			TGGGACAATGAGA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.94A>T	chr2.hg19:g.54753649A>T	ENSP00000349259:p.Asn32Tyr	137.0	0.0		128.0	64.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.997650	0.93227	.	.	ENSG00000115306	ENST00000356805;ENST00000389980	T;T	0.24723	1.84;1.84	5.77	5.77	0.91146	Calponin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.35101	-0.9802	10	0.30078	T	0.28	.	16.1043	0.81209	1.0:0.0:0.0:0.0	.	32	Q01082	SPTB2_HUMAN	Y	32	ENSP00000349259:N32Y;ENSP00000374630:N32Y	ENSP00000349259:N32Y	N	+	1	0	SPTBN1	54607153	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	9.310000	0.96267	2.201000	0.70794	0.528000	0.53228	AAT	.	.		0.532	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
WDR33	55339	hgsc.bcm.edu	37	2	128477498	128477498	+	Missense_Mutation	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr2:128477498G>T	ENST00000322313.4	-	16	2259	c.2101C>A	c.(2101-2103)Cct>Act	p.P701T		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	701	Collagen-like.				mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TGACCTTGAGGACCAGAACTA	0.642																																					p.P701T		Atlas-SNP	.											.	WDR33	136	.	0			c.C2101A						.						68.0	76.0	73.0					2																	128477498		2203	4300	6503	SO:0001583	missense	55339	exon16			CTTGAGGACCAGA		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2101C>A	chr2.hg19:g.128477498G>T	ENSP00000325377:p.Pro701Thr	52.0	0.0		33.0	13.0	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	hg19	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582560	0.46006	.	.	ENSG00000136709	ENST00000322313	D	0.93366	-3.21	5.37	3.54	0.40534	.	0.000000	0.64402	D	0.000002	D	0.91164	0.7217	M	0.72624	2.21	0.80722	D	1	B	0.21520	0.057	B	0.22386	0.039	D	0.86195	0.1615	10	0.30854	T	0.27	-6.0816	10.4611	0.44581	0.0699:0.0:0.7958:0.1343	.	701	Q9C0J8	WDR33_HUMAN	T	701	ENSP00000325377:P701T	ENSP00000325377:P701T	P	-	1	0	WDR33	128193968	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	5.551000	0.67274	0.729000	0.32403	0.585000	0.79938	CCT	.	.		0.642	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
TTN	7273	hgsc.bcm.edu	37	2	179441674	179441674	+	Missense_Mutation	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr2:179441674G>T	ENST00000591111.1	-	274	64689	c.64465C>A	c.(64465-64467)Cct>Act	p.P21489T	TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P14257T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P23130T|TTN_ENST00000342992.6_Missense_Mutation_p.P20562T|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P14190T|TTN_ENST00000460472.2_Missense_Mutation_p.P14065T|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21489	Fibronectin type-III 55. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTTGACAGGTTCAGACTGT	0.403																																					p.P23130T		Atlas-SNP	.											.	TTN	18412	.	0			c.C69388A						.						202.0	197.0	199.0					2																	179441674		1907	4111	6018	SO:0001583	missense	7273	exon324			TGACAGGTTCAGA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.64465C>A	chr2.hg19:g.179441674G>T	ENSP00000465570:p.Pro21489Thr	121.0	0.0		132.0	38.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.95	2.092455	0.36952	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.65916	-0.18;0.01;-0.04;-0.05	5.72	4.83	0.62350	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71745	0.3376	M	0.82517	2.595	0.58432	D	0.999999	D;D;D;P	0.55605	0.972;0.972;0.972;0.949	P;P;P;P	0.48304	0.573;0.573;0.573;0.476	T	0.78597	-0.2142	9	0.87932	D	0	.	15.4216	0.75015	0.0676:0.0:0.9324:0.0	.	14065;14190;14257;21489	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	20562;14065;14257;14190;14063	ENSP00000343764:P20562T;ENSP00000434586:P14065T;ENSP00000340554:P14257T;ENSP00000352154:P14190T	ENSP00000340554:P14257T	P	-	1	0	TTN	179149920	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	6.582000	0.74049	1.533000	0.49186	0.655000	0.94253	CCT	.	.		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179485580	179485580	+	Missense_Mutation	SNP	A	A	G			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr2:179485580A>G	ENST00000591111.1	-	197	41058	c.40834T>C	c.(40834-40836)Tac>Cac	p.Y13612H	TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Y6380H|TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Y15253H|TTN_ENST00000342992.6_Missense_Mutation_p.Y12685H|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Y6313H|TTN_ENST00000460472.2_Missense_Mutation_p.Y6188H|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13612	Ig-like 92.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAATGATGTATTTTGAACTA	0.388																																					p.Y15253H		Atlas-SNP	.											.	TTN	18412	.	0			c.T45757C						.						159.0	154.0	155.0					2																	179485580		1870	4087	5957	SO:0001583	missense	7273	exon247			TGATGTATTTTGA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40834T>C	chr2.hg19:g.179485580A>G	ENSP00000465570:p.Tyr13612His	99.0	0.0		170.0	36.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	13.73	2.324146	0.41197	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80171	0.4574	M	0.66560	2.04	0.45995	D	0.998808	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.68483	0.958;0.958;0.958;0.958	T	0.82248	-0.0551	9	0.87932	D	0	.	16.1968	0.82036	1.0:0.0:0.0:0.0	.	6188;6313;6380;13612	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	12685;6188;6380;6313;6188	ENSP00000343764:Y12685H;ENSP00000434586:Y6188H;ENSP00000340554:Y6380H;ENSP00000352154:Y6313H	ENSP00000340554:Y6380H	Y	-	1	0	TTN	179193825	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.281000	0.95811	2.225000	0.72522	0.533000	0.62120	TAC	.	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ABCA12	26154	hgsc.bcm.edu	37	2	215862522	215862522	+	Missense_Mutation	SNP	C	C	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr2:215862522C>A	ENST00000272895.7	-	23	3410	c.3191G>T	c.(3190-3192)aGt>aTt	p.S1064I	ABCA12_ENST00000389661.4_Missense_Mutation_p.S746I	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1064					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATAAGAGACACTGGTTAGGAA	0.363																																					p.S1064I	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.G3191T						.						76.0	74.0	75.0					2																	215862522		2203	4300	6503	SO:0001583	missense	26154	exon23			GAGACACTGGTTA	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3191G>T	chr2.hg19:g.215862522C>A	ENSP00000272895:p.Ser1064Ile	188.0	0.0		220.0	83.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.601698	0.66445	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.83075	-1.68;-1.68	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.87989	0.6317	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.77004	0.989;0.974	T	0.80558	-0.1329	10	0.06625	T	0.88	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1064;746	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	I	1064;746	ENSP00000272895:S1064I;ENSP00000374312:S746I	ENSP00000272895:S1064I	S	-	2	0	ABCA12	215570767	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.755000	0.68750	2.941000	0.99782	0.655000	0.94253	AGT	.	.		0.363	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
FGD5	152273	hgsc.bcm.edu	37	3	14964028	14964028	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:14964028G>A	ENST00000285046.5	+	15	3890	c.3780G>A	c.(3778-3780)cgG>cgA	p.R1260R	FGD5-AS1_ENST00000430166.1_RNA|FGD5_ENST00000476851.1_3'UTR|FGD5_ENST00000543601.1_Silent_p.R1019R	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1260					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						TCACCCTGCGGCGTCATCACT	0.657																																					p.R1260R		Atlas-SNP	.											.	FGD5	248	.	0			c.G3780A						.						31.0	35.0	34.0					3																	14964028		2116	4222	6338	SO:0001819	synonymous_variant	152273	exon15			CCTGCGGCGTCAT	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3780G>A	chr3.hg19:g.14964028G>A		90.0	0.0		113.0	18.0	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	ENST00000285046.5	hg19	CCDS46767.1																																																																																			.	.		0.657	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
ITGA9	3680	hgsc.bcm.edu	37	3	37574884	37574884	+	Missense_Mutation	SNP	G	G	A	rs369791724		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:37574884G>A	ENST00000264741.5	+	14	1709	c.1453G>A	c.(1453-1455)Gga>Aga	p.G485R	ITGA9_ENST00000422441.1_Missense_Mutation_p.G485R	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	485					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		GTGTCACGACGGACAGCAGCC	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		19891	0.001		0.0	False		,,,				2504	0.0				p.G485R		Atlas-SNP	.											.	ITGA9	98	.	0			c.G1453A						.						104.0	75.0	85.0					3																	37574884		2203	4300	6503	SO:0001583	missense	3680	exon14			CACGACGGACAGC	L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.1453G>A	chr3.hg19:g.37574884G>A	ENSP00000264741:p.Gly485Arg	169.0	0.0		175.0	72.0	NM_002207	Q14638	Missense_Mutation	SNP	ENST00000264741.5	hg19	CCDS2669.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870787	0.91587	.	.	ENSG00000144668	ENST00000422441;ENST00000264741	T;T	0.68765	-0.35;-0.35	6.07	6.07	0.98685	Integrin alpha-2 (1);	0.052596	0.85682	D	0.000000	T	0.75953	0.3920	L	0.56769	1.78	0.80722	D	1	P;D	0.63046	0.904;0.992	B;P	0.57960	0.37;0.83	T	0.76550	-0.2918	10	0.62326	D	0.03	.	15.7396	0.77882	0.0666:0.0:0.9334:0.0	.	485;485	Q13797;E9PDS3	ITA9_HUMAN;.	R	485	ENSP00000397258:G485R;ENSP00000264741:G485R	ENSP00000264741:G485R	G	+	1	0	ITGA9	37549888	1.000000	0.71417	0.485000	0.27403	0.985000	0.73830	6.637000	0.74304	2.884000	0.98904	0.655000	0.94253	GGA	.	.		0.567	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253361.1	NM_002207	
EPHA3	2042	hgsc.bcm.edu	37	3	89456488	89456488	+	Missense_Mutation	SNP	T	T	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:89456488T>A	ENST00000336596.2	+	8	1889	c.1664T>A	c.(1663-1665)cTc>cAc	p.L555H	EPHA3_ENST00000494014.1_Missense_Mutation_p.L555H	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	555					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GCAATTATTCTCCTCACTGTT	0.418										TSP Lung(6;0.00050)																											p.L555H		Atlas-SNP	.											.	EPHA3	501	.	0			c.T1664A						.						202.0	168.0	180.0					3																	89456488		2203	4300	6503	SO:0001583	missense	2042	exon8			TTATTCTCCTCAC	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1664T>A	chr3.hg19:g.89456488T>A	ENSP00000337451:p.Leu555His	178.0	0.0		142.0	74.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	hg19	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.335977	0.60853	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.15017	2.46;2.46	5.89	5.89	0.94794	.	0.057950	0.64402	D	0.000001	T	0.33962	0.0881	M	0.87547	2.89	0.80722	D	1	D	0.57257	0.979	P	0.46362	0.514	T	0.38802	-0.9644	9	.	.	.	.	16.3127	0.82898	0.0:0.0:0.0:1.0	.	555	P29320	EPHA3_HUMAN	H	555	ENSP00000337451:L555H;ENSP00000419190:L555H	.	L	+	2	0	EPHA3	89539178	1.000000	0.71417	0.998000	0.56505	0.215000	0.24574	7.677000	0.84024	2.246000	0.74042	0.533000	0.62120	CTC	.	.		0.418	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
HHLA2	11148	hgsc.bcm.edu	37	3	108076864	108076864	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:108076864C>T	ENST00000357759.5	+	6	1273	c.859C>T	c.(859-861)Cga>Tga	p.R287*	HHLA2_ENST00000489514.2_Nonsense_Mutation_p.R287*|HHLA2_ENST00000491820.1_Nonsense_Mutation_p.R287*|HHLA2_ENST00000467761.1_Nonsense_Mutation_p.R287*|HHLA2_ENST00000467562.1_Nonsense_Mutation_p.R223*	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	287	Ig-like V-type 2.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)		p.R287R(2)		endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						CAATGAATCCCGATTCTCATG	0.378																																					p.R287X		Atlas-SNP	.											.	HHLA2	95	.	2	Substitution - coding silent(2)	lung(2)	c.C859T						.						154.0	150.0	151.0					3																	108076864		1846	4097	5943	SO:0001587	stop_gained	11148	exon6			GAATCCCGATTCT	AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.859C>T	chr3.hg19:g.108076864C>T	ENSP00000350402:p.Arg287*	159.0	0.0		116.0	63.0	NM_007072	B4DKN2|D3DN60|Q9NWQ6	Nonsense_Mutation	SNP	ENST00000357759.5	hg19	CCDS46883.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.460156|4.460156	0.84317|0.84317	.|.	.|.	ENSG00000114455|ENSG00000114455	ENST00000482099|ENST00000491820;ENST00000467562;ENST00000357759;ENST00000467761;ENST00000489514	.|.	.|.	.|.	5.31|5.31	0.291|0.291	0.15732|0.15732	.|.	.|0.727246	.|0.10700	.|N	.|0.644162	T|.	0.16428|.	0.0395|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.40590|.	-0.9555|.	3|.	.|0.02654	.|T	.|1	.|.	8.0163|8.0163	0.30383|0.30383	0.0:0.5511:0.0:0.4489|0.0:0.5511:0.0:0.4489	.|.	.|.	.|.	.|.	L|X	189|287;223;287;287;287	.|.	.|ENSP00000350402:R287X	P|R	+|+	2|1	0|2	HHLA2|HHLA2	109559554|109559554	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.021000|0.021000	0.10359|0.10359	-0.171000|-0.171000	0.09883|0.09883	-0.169000|-0.169000	0.10834|0.10834	-0.142000|-0.142000	0.14014|0.14014	CCG|CGA	.	.		0.378	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353924.1	NM_007072	
ZBED2	79413	hgsc.bcm.edu	37	3	111312778	111312778	+	Missense_Mutation	SNP	C	C	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:111312778C>A	ENST00000317012.4	-	2	1279	c.271G>T	c.(271-273)Gtc>Ttc	p.V91F	CD96_ENST00000438817.2_Intron|CD96_ENST00000352690.4_Intron|CD96_ENST00000283285.5_Intron	NM_024508.4	NP_078784.2	Q9BTP6	ZBED2_HUMAN	zinc finger, BED-type containing 2	91							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(1)|skin(2)	6						CCCACGTTGACCCCAGGGCCA	0.612																																					p.V91F		Atlas-SNP	.											.	ZBED2	22	.	0			c.G271T						.						66.0	65.0	66.0					3																	111312778		2203	4300	6503	SO:0001583	missense	79413	exon2			CGTTGACCCCAGG	BC003536	CCDS2960.2	3p13-q13.2	2013-05-03			ENSG00000177494	ENSG00000177494		"""Zinc fingers, BED-type"""	20710	protein-coding gene	gene with protein product		615246				23533661	Standard	NM_024508		Approved	MGC10796	uc003dxy.3	Q9BTP6	OTTHUMG00000074061	ENST00000317012.4:c.271G>T	chr3.hg19:g.111312778C>A	ENSP00000321370:p.Val91Phe	38.0	0.0		38.0	21.0	NM_024508	D3DN62	Missense_Mutation	SNP	ENST00000317012.4	hg19	CCDS2960.2	.	.	.	.	.	.	.	.	.	.	C	4.512	0.094990	0.08681	.	.	ENSG00000177494	ENST00000317012	.	.	.	4.66	2.72	0.32119	Zinc finger, BED-type predicted (3);	0.187693	0.24925	U	0.034509	T	0.10294	0.0252	N	0.01874	-0.695	0.09310	N	1	P	0.37985	0.613	B	0.39590	0.304	T	0.33727	-0.9857	9	0.02654	T	1	-11.6599	9.8009	0.40764	0.3683:0.6317:0.0:0.0	.	91	Q9BTP6	ZBED2_HUMAN	F	91	.	ENSP00000321370:V91F	V	-	1	0	ZBED2	112795468	0.626000	0.27120	0.339000	0.25562	0.927000	0.56198	0.390000	0.20768	1.134000	0.42165	0.467000	0.42956	GTC	.	.		0.612	ZBED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157228.2	NM_024508	
KIAA2018	205717	hgsc.bcm.edu	37	3	113375328	113375328	+	Missense_Mutation	SNP	C	C	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:113375328C>A	ENST00000478658.1	-	5	5218	c.5201G>T	c.(5200-5202)tGt>tTt	p.C1734F	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.C1734F			Q68DE3	K2018_HUMAN	KIAA2018	1734						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AAACGTCTGACAATCAGAAAG	0.408																																					p.C1734F		Atlas-SNP	.											.	KIAA2018	180	.	0			c.G5201T						.						113.0	107.0	109.0					3																	113375328		1867	4115	5982	SO:0001583	missense	205717	exon7			GTCTGACAATCAG	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5201G>T	chr3.hg19:g.113375328C>A	ENSP00000420721:p.Cys1734Phe	225.0	0.0		179.0	22.0	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	hg19	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233052	0.58777	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.44881	0.91;0.91	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.58411	-0.7641	10	0.87932	D	0	-8.1223	20.0313	0.97540	0.0:1.0:0.0:0.0	.	1734	Q68DE3	K2018_HUMAN	F	1734	ENSP00000320794:C1734F;ENSP00000420721:C1734F	ENSP00000320794:C1734F	C	-	2	0	KIAA2018	114858018	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.824000	0.75288	2.746000	0.94184	0.655000	0.94253	TGT	.	.		0.408	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
ADCY5	111	hgsc.bcm.edu	37	3	123033087	123033087	+	Missense_Mutation	SNP	C	C	T	rs372853437		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:123033087C>T	ENST00000462833.1	-	12	3649	c.2437G>A	c.(2437-2439)Gta>Ata	p.V813I	ADCY5_ENST00000491190.1_Missense_Mutation_p.V446I|ADCY5_ENST00000309879.5_Missense_Mutation_p.V463I	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	813					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CTCACCTTTACGCAGGAGTAG	0.572																																					p.V813I		Atlas-SNP	.											.	ADCY5	169	.	0			c.G2437A						.	C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	107.0	82.0	90.0		1387,2437	1.7	1.0	3		90	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADCY5	NM_001199642.1,NM_183357.2	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	463/912,813/1262	123033087	1,13005	2203	4300	6503	SO:0001583	missense	111	exon12			CCTTTACGCAGGA	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.2437G>A	chr3.hg19:g.123033087C>T	ENSP00000419361:p.Val813Ile	458.0	1.0		301.0	95.0	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	hg19	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357009	0.24598	0.0	1.16E-4	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.64	1.67	0.24075	.	0.089397	0.47852	D	0.000202	T	0.27798	0.0684	N	0.26042	0.785	0.30553	N	0.765301	B;B	0.11235	0.004;0.001	B;B	0.08055	0.003;0.001	T	0.13845	-1.0494	10	0.22109	T	0.4	.	5.7627	0.18209	0.0:0.5899:0.1289:0.2812	.	813;446	O95622;B3KWA8	ADCY5_HUMAN;.	I	813;446;463;372	ENSP00000419361:V813I;ENSP00000418537:V446I;ENSP00000308685:V463I;ENSP00000420082:V372I	ENSP00000308685:V463I	V	-	1	0	ADCY5	124515777	0.997000	0.39634	0.997000	0.53966	0.890000	0.51754	1.114000	0.31196	0.335000	0.23614	-0.448000	0.05591	GTA	.	.		0.572	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
CHST2	9435	hgsc.bcm.edu	37	3	142840620	142840620	+	Missense_Mutation	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:142840620C>T	ENST00000309575.3	+	2	2346	c.962C>T	c.(961-963)cCg>cTg	p.P321L		NM_004267.4	NP_004258.2	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2	321					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|multicellular organismal development (GO:0007275)|N-acetylglucosamine metabolic process (GO:0006044)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(2)	22						CTGCGAGACCCGGCCCTGGAC	0.652																																					p.P321L		Atlas-SNP	.											CHST2,colon,carcinoma,0,1	CHST2	67	.	0			c.C962T						.						19.0	21.0	21.0					3																	142840620		2201	4298	6499	SO:0001583	missense	9435	exon2			GAGACCCGGCCCT	BC042160	CCDS3129.1	3q24	2007-03-14			ENSG00000175040	ENSG00000175040		"""Sulfotransferases, membrane-bound"""	1970	protein-coding gene	gene with protein product		603798				10049591	Standard	NM_004267		Approved	C6ST	uc003evm.3	Q9Y4C5	OTTHUMG00000159351	ENST00000309575.3:c.962C>T	chr3.hg19:g.142840620C>T	ENSP00000307911:p.Pro321Leu	48.0	0.0		39.0	28.0	NM_004267	D3DNG5|Q2M370|Q9GZN5|Q9UED5|Q9Y6F2	Missense_Mutation	SNP	ENST00000309575.3	hg19	CCDS3129.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132158	0.77662	.	.	ENSG00000175040	ENST00000309575	D	0.83506	-1.73	4.38	4.38	0.52667	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000001	D	0.92811	0.7714	M	0.91354	3.2	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94527	0.7732	10	0.72032	D	0.01	-12.6312	17.1075	0.86667	0.0:1.0:0.0:0.0	.	321	Q9Y4C5	CHST2_HUMAN	L	321	ENSP00000307911:P321L	ENSP00000307911:P321L	P	+	2	0	CHST2	144323310	1.000000	0.71417	0.997000	0.53966	0.599000	0.36880	7.638000	0.83328	2.269000	0.75478	0.407000	0.27541	CCG	.	.		0.652	CHST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354850.1	NM_004267	
SLC33A1	9197	hgsc.bcm.edu	37	3	155571528	155571528	+	Missense_Mutation	SNP	T	T	C			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:155571528T>C	ENST00000392845.3	-	1	639	c.259A>G	c.(259-261)Att>Gtt	p.I87V	SLC33A1_ENST00000460729.1_5'Flank|SLC33A1_ENST00000359479.3_Missense_Mutation_p.I87V			O00400	ACATN_HUMAN	solute carrier family 33 (acetyl-CoA transporter), member 1	87					acetyl-CoA transport (GO:0015876)|cell death (GO:0008219)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	acetyl-CoA transporter activity (GO:0008521)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	22			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CCCAGGGGAATACCCTGAAGC	0.493																																					p.I87V		Atlas-SNP	.											.	SLC33A1	57	.	0			c.A259G						.						55.0	58.0	57.0					3																	155571528		2203	4300	6503	SO:0001583	missense	9197	exon1			GGGGAATACCCTG	D88152	CCDS3173.1	3q25.31	2013-05-22		2002-12-06	ENSG00000169359	ENSG00000169359		"""Solute carriers"""	95	protein-coding gene	gene with protein product		603690	"""acetyl-Coenzyme A transporter"", ""spastic paraplegia 42 (autosomal dominant)"""	ACATN, SPG42		9096318, 19061983	Standard	NM_004733		Approved	AT-1, AT1	uc003fao.2	O00400	OTTHUMG00000158481	ENST00000392845.3:c.259A>G	chr3.hg19:g.155571528T>C	ENSP00000376587:p.Ile87Val	117.0	0.0		101.0	60.0	NM_004733	B2R5Q2|D3DNK4	Missense_Mutation	SNP	ENST00000392845.3	hg19	CCDS3173.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.077772	0.76528	.	.	ENSG00000169359	ENST00000392845;ENST00000359479	T;T	0.71341	-0.56;-0.56	5.57	5.57	0.84162	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.72162	0.3426	L	0.43554	1.36	0.80722	D	1	P	0.35894	0.526	P	0.47786	0.557	T	0.66814	-0.5828	10	0.18276	T	0.48	-20.143	16.0862	0.81056	0.0:0.0:0.0:1.0	.	87	O00400	ACATN_HUMAN	V	87	ENSP00000376587:I87V;ENSP00000352456:I87V	ENSP00000352456:I87V	I	-	1	0	SLC33A1	157054222	1.000000	0.71417	0.993000	0.49108	0.955000	0.61496	6.013000	0.70776	2.251000	0.74343	0.529000	0.55759	ATT	.	.		0.493	SLC33A1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351130.3	NM_004733	
NAALADL2	254827	hgsc.bcm.edu	37	3	174951769	174951769	+	Missense_Mutation	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:174951769G>T	ENST00000454872.1	+	3	722	c.594G>T	c.(592-594)aaG>aaT	p.K198N	NAALADL2-AS2_ENST00000424690.1_RNA|NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	198						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		AAATTTCAAAGAAGATTAAGA	0.343																																					p.K198N		Atlas-SNP	.											.	NAALADL2	86	.	0			c.G594T						.						67.0	63.0	64.0					3																	174951769		1851	4098	5949	SO:0001583	missense	254827	exon3			TTCAAAGAAGATT		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.594G>T	chr3.hg19:g.174951769G>T	ENSP00000404705:p.Lys198Asn	69.0	0.0		64.0	16.0	NM_207015	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	ENST00000454872.1	hg19	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353996	0.41700	.	.	ENSG00000177694	ENST00000454872;ENST00000316366	T	0.39406	1.08	5.87	4.96	0.65561	.	0.111451	0.40469	N	0.001089	T	0.28764	0.0713	N	0.24115	0.695	0.32796	N	0.500579	B;P	0.39216	0.053;0.664	B;B	0.36885	0.061;0.235	T	0.33777	-0.9855	10	0.20519	T	0.43	-16.9894	14.0831	0.64937	0.076:0.0:0.924:0.0	.	181;198	Q58DX5-2;Q58DX5	.;NADL2_HUMAN	N	198;5	ENSP00000404705:K198N	ENSP00000314951:K5N	K	+	3	2	NAALADL2	176434463	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	3.215000	0.51169	1.411000	0.46957	-0.355000	0.07637	AAG	.	.		0.343	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
CCDC39	339829	hgsc.bcm.edu	37	3	180361989	180361989	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr3:180361989G>A	ENST00000442201.2	-	12	1703	c.1584C>T	c.(1582-1584)tcC>tcT	p.S528S	CCDC39_ENST00000273654.4_Silent_p.S612S	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	528					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TGGTCATAAGGGACTGTTTTT	0.294																																					p.S528S		Atlas-SNP	.											.	CCDC39	242	.	0			c.C1584T						.						147.0	130.0	135.0					3																	180361989		1627	3637	5264	SO:0001819	synonymous_variant	339829	exon12			CATAAGGGACTGT	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1584C>T	chr3.hg19:g.180361989G>A		29.0	0.0		20.0	7.0	NM_181426	B4E2H1	Silent	SNP	ENST00000442201.2	hg19	CCDS46964.1																																																																																			.	.		0.294	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
TMPRSS11D	9407	hgsc.bcm.edu	37	4	68691558	68691558	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr4:68691558G>A	ENST00000283916.6	-	9	1085	c.987C>T	c.(985-987)gtC>gtT	p.V329V	TMPRSS11D_ENST00000545541.1_Silent_p.V212V|UBA6-AS1_ENST00000500538.2_RNA	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	329	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						TTATTATTCTGACCTGTCCTT	0.403																																					p.V329V		Atlas-SNP	.											.	TMPRSS11D	68	.	0			c.C987T						.						214.0	187.0	196.0					4																	68691558		2203	4300	6503	SO:0001819	synonymous_variant	9407	exon9			TATTCTGACCTGT	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.987C>T	chr4.hg19:g.68691558G>A		141.0	0.0		130.0	31.0	NM_004262	Q08AF6	Silent	SNP	ENST00000283916.6	hg19	CCDS3518.1	.	.	.	.	.	.	.	.	.	.	G	8.381	0.837554	0.16891	.	.	ENSG00000153802	ENST00000514868	.	.	.	5.88	3.98	0.46160	.	.	.	.	.	T	0.55721	0.1938	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52909	-0.8512	4	.	.	.	.	6.4866	0.22093	0.1025:0.3111:0.5864:0.0	.	.	.	.	L	54	.	.	S	-	2	0	TMPRSS11D	68374153	0.848000	0.29623	0.413000	0.26509	0.314000	0.28054	1.265000	0.33027	1.407000	0.46875	0.555000	0.69702	TCA	.	.		0.403	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251430.3	NM_004262	
MMRN1	22915	hgsc.bcm.edu	37	4	90816255	90816256	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr4:90816255_90816256CC>AA	ENST00000394980.1	+	2	452_453	c.133_134CC>AA	c.(133-135)CCt>AAt	p.P45N	MMRN1_ENST00000264790.2_Missense_Mutation_p.P45N|MMRN1_ENST00000394981.1_Missense_Mutation_p.P45N			Q13201	MMRN1_HUMAN	multimerin 1	45					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TGCTTCAGTTCCTCCAAATAAA	0.45																																					p.P45T|p.P45H		Atlas-SNP	.											MMRN1,NS,carcinoma,0,1|.	MMRN1	174	.	0			c.C133A|c.C134A						.																																			SO:0001583	missense	22915	exon1			TCAGTTCCTCCAA|CAGTTCCTCCAAA	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	Exception_encountered	chr4.hg19:g.90816255_90816256delinsAA	ENSP00000378431:p.Pro45Asn	76.0|77.0	0.0		32.0	21.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	hg19	CCDS3635.1																																																																																			.	.		0.450	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
KIAA1109	84162	hgsc.bcm.edu	37	4	123193335	123193335	+	Missense_Mutation	SNP	C	C	G			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr4:123193335C>G	ENST00000264501.4	+	48	8594	c.8221C>G	c.(8221-8223)Cca>Gca	p.P2741A	KIAA1109_ENST00000455637.1_Missense_Mutation_p.P2741A|KIAA1109_ENST00000388738.3_Missense_Mutation_p.P2741A			Q2LD37	K1109_HUMAN	KIAA1109	2741					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CCCTACAGAGCCAACATGTAA	0.373																																					p.P2741A		Atlas-SNP	.											.	KIAA1109	424	.	0			c.C8221G						.						81.0	76.0	78.0					4																	123193335		1887	4108	5995	SO:0001583	missense	84162	exon46			ACAGAGCCAACAT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.8221C>G	chr4.hg19:g.123193335C>G	ENSP00000264501:p.Pro2741Ala	182.0	0.0		102.0	34.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.41|15.41|15.41	2.825378|2.825378|2.825378	0.50739|0.50739|0.50739	.|.|.	.|.|.	ENSG00000138688|ENSG00000138688|ENSG00000138688	ENST00000419325|ENST00000264501;ENST00000388738;ENST00000455637|ENST00000446180	.|T;T;T|.	.|0.22743|.	.|2.53;2.53;1.94|.	5.87|5.87|5.87	5.0|5.0|5.0	0.66597|0.66597|0.66597	.|.|.	.|0.150088|.	.|0.44285|.	.|D|.	.|0.000476|.	T|T|T	0.62405|0.62405|0.62405	0.2425|0.2425|0.2425	L|L|L	0.43152|0.43152|0.43152	1.355|1.355|1.355	0.45837|0.45837|0.45837	D|D|D	0.998701|0.998701|0.998701	.|B;B;B|.	.|0.32507|.	.|0.373;0.001;0.0|.	.|B;B;B|.	.|0.33121|.	.|0.158;0.002;0.001|.	T|T|T	0.57015|0.57015|0.57015	-0.7883|-0.7883|-0.7883	5|10|5	.|0.27082|.	.|T|.	.|0.32|.	.|.|.	17.0681|17.0681|17.0681	0.86564|0.86564|0.86564	0.0:0.8735:0.1265:0.0|0.0:0.8735:0.1265:0.0|0.0:0.8735:0.1265:0.0	.|.|.	.|2741;2740;2741|.	.|Q2LD37-6;Q2LD37-2;Q2LD37|.	.|.;.;K1109_HUMAN|.	G|A|R	698|2741|1313	.|ENSP00000264501:P2741A;ENSP00000373390:P2741A;ENSP00000389925:P2741A|.	.|ENSP00000264501:P2741A|.	A|P|S	+|+|+	2|1|3	0|0|2	KIAA1109|KIAA1109|KIAA1109	123412785|123412785|123412785	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	2.948000|2.948000|2.948000	0.49066|0.49066|0.49066	2.785000|2.785000|2.785000	0.95823|0.95823|0.95823	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCC|CCA|AGC	.	.		0.373	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
HPGD	3248	hgsc.bcm.edu	37	4	175439184	175439184	+	Missense_Mutation	SNP	A	A	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr4:175439184A>T	ENST00000296522.6	-	3	708	c.262T>A	c.(262-264)Ttg>Atg	p.L88M	HPGD_ENST00000422112.2_Intron|HPGD_ENST00000542498.1_Missense_Mutation_p.L88M|HPGD_ENST00000296521.7_Missense_Mutation_p.L88M|HPGD_ENST00000504433.1_Missense_Mutation_p.L88M|HPGD_ENST00000541923.1_Intron|HPGD_ENST00000510901.1_De_novo_Start_InFrame	NM_000860.5|NM_001145816.2|NM_001256301.1|NM_001256307.1	NP_000851.2|NP_001139288.1|NP_001243230.1|NP_001243236.1	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	88					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|ductus arteriosus closure (GO:0097070)|female pregnancy (GO:0007565)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|ovulation (GO:0030728)|parturition (GO:0007567)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|thrombin receptor signaling pathway (GO:0070493)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|catalytic activity (GO:0003824)|NAD binding (GO:0051287)|NAD+ binding (GO:0070403)|prostaglandin E receptor activity (GO:0004957)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(3)|prostate(3)	7		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)		TTATTGACCAAAATGTCCAGT	0.279																																					p.L88M		Atlas-SNP	.											.	HPGD	19	.	0			c.T262A						.						66.0	65.0	65.0					4																	175439184		2202	4293	6495	SO:0001583	missense	3248	exon3			TGACCAAAATGTC		CCDS3821.1, CCDS54821.1, CCDS58933.1, CCDS58934.1, CCDS58935.1	4q34-q35	2011-09-14			ENSG00000164120	ENSG00000164120	1.1.1.141	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	5154	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 36C, member 1"""	601688				19027726	Standard	NM_000860		Approved	SDR36C1	uc003itu.3	P15428	OTTHUMG00000160772	ENST00000296522.6:c.262T>A	chr4.hg19:g.175439184A>T	ENSP00000296522:p.Leu88Met	129.0	0.0		86.0	7.0	NM_000860	B4DTA4|B4DU74|B4DV57|D3DP43|E7EV11|O00749|Q06F08|Q12998	Missense_Mutation	SNP	ENST00000296522.6	hg19	CCDS3821.1	.	.	.	.	.	.	.	.	.	.	A	15.91	2.972067	0.53614	.	.	ENSG00000164120	ENST00000296522;ENST00000296521;ENST00000542498;ENST00000504433	D;D;D;D	0.90133	-2.05;-2.62;-2.62;-2.62	5.98	4.8	0.61643	NAD(P)-binding domain (1);	0.209202	0.40144	N	0.001173	D	0.92113	0.7500	M	0.64567	1.98	0.39808	D	0.972665	D;P;B;P;B	0.52996	0.957;0.884;0.401;0.551;0.401	P;P;B;B;P	0.57468	0.821;0.725;0.416;0.351;0.521	D	0.91946	0.5567	10	0.66056	D	0.02	.	8.4713	0.32986	0.8486:0.0:0.1514:0.0	.	88;88;88;88;88	O00749;E9PBZ2;Q12998;B4DV57;P15428	.;.;.;.;PGDH_HUMAN	M	88	ENSP00000296522:L88M;ENSP00000296521:L88M;ENSP00000443644:L88M;ENSP00000420892:L88M	ENSP00000296521:L88M	L	-	1	2	HPGD	175675759	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.602000	0.36783	1.086000	0.41228	0.482000	0.46254	TTG	.	.		0.279	HPGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362228.3		
GPR98	84059	hgsc.bcm.edu	37	5	90000211	90000211	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr5:90000211G>A	ENST00000405460.2	+	36	8388	c.8292G>A	c.(8290-8292)tcG>tcA	p.S2764S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2764	Calx-beta 19. {ECO:0000305|PubMed:11606593}.		S -> L (in dbSNP:rs16869016). {ECO:0000269|PubMed:14740321}.		detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CATAGGGGTCGTTGAATACAA	0.363																																					p.S2764S		Atlas-SNP	.											.	GPR98	605	.	0			c.G8292A						.						152.0	130.0	137.0					5																	90000211		1851	4096	5947	SO:0001819	synonymous_variant	84059	exon36			GGGGTCGTTGAAT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.8292G>A	chr5.hg19:g.90000211G>A		224.0	0.0		239.0	16.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	0.058	-1.231959	0.01505	.	.	ENSG00000164199	ENST00000509621	.	.	.	4.89	-5.82	0.02333	.	.	.	.	.	T	0.15869	0.0382	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.28427	-1.0044	4	.	.	.	.	0.8004	0.01074	0.2652:0.3195:0.2073:0.208	.	.	.	.	H	330	.	.	R	+	2	0	GPR98	90035967	0.000000	0.05858	0.077000	0.20336	0.055000	0.15305	-1.032000	0.03574	-0.598000	0.05806	-0.290000	0.09829	CGT	.	.		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
C5orf52	100190949	hgsc.bcm.edu	37	5	157106849	157106849	+	Splice_Site	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr5:157106849G>T	ENST00000409999.3	+	3	384	c.322G>T	c.(322-324)Gtg>Ttg	p.V108L		NM_001145132.1	NP_001138604.1	A6NGY3	CE052_HUMAN	chromosome 5 open reading frame 52	108										endometrium(2)|lung(1)	3						TTTTTGTAAGGTGAGCGCTTT	0.458																																					p.V108L		Atlas-SNP	.											.	C5orf52	17	.	0			c.G322T						.						57.0	53.0	54.0					5																	157106849		692	1591	2283	SO:0001630	splice_region_variant	100190949	exon3			TGTAAGGTGAGCG	BG721329	CCDS47329.1	5q33.3	2012-02-24			ENSG00000187658	ENSG00000187658			35121	protein-coding gene	gene with protein product							Standard	NM_001145132		Approved		uc011ddt.2	A6NGY3	OTTHUMG00000154518	ENST00000409999.3:c.322-1G>T	chr5.hg19:g.157106849G>T		291.0	0.0		256.0	102.0	NM_001145132		Missense_Mutation	SNP	ENST00000409999.3	hg19	CCDS47329.1	.	.	.	.	.	.	.	.	.	.	G	7.200	0.593357	0.13875	.	.	ENSG00000187658	ENST00000409999	T	0.31769	1.48	3.15	-1.58	0.08479	.	.	.	.	.	T	0.12433	0.0302	N	0.14661	0.345	0.09310	N	0.999993	B	0.21606	0.058	B	0.19391	0.025	T	0.29640	-1.0005	8	.	.	.	-1.8779	0.2122	0.00158	0.3745:0.2351:0.1591:0.2312	.	108	A6NGY3	CE052_HUMAN	L	108	ENSP00000387027:V108L	.	V	+	1	0	C5orf52	157039427	0.005000	0.15991	0.203000	0.23512	0.145000	0.21501	-0.232000	0.09055	-0.025000	0.13918	-0.471000	0.05019	GTG	.	.		0.458	C5orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335664.1	NM_001145132	Missense_Mutation
CLK4	57396	hgsc.bcm.edu	37	5	178039797	178039797	+	Splice_Site	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr5:178039797C>T	ENST00000316308.4	-	8	1089	c.921G>A	c.(919-921)atG>atA	p.M307I		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	307	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TTTAACTTACCATTTTAGAAT	0.279																																					p.M307I		Atlas-SNP	.											.	CLK4	103	.	0			c.G921A						.						49.0	56.0	53.0					5																	178039797		2194	4285	6479	SO:0001630	splice_region_variant	57396	exon8			ACTTACCATTTTA	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.921+1G>A	chr5.hg19:g.178039797C>T		116.0	0.0		119.0	6.0	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	hg19	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522495	0.44866	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.66280	-0.2	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.159072	0.64402	D	0.000002	T	0.52240	0.1722	L	0.33245	0.995	0.80722	D	1	B;B;B	0.21381	0.055;0.001;0.001	B;B;B	0.23150	0.044;0.006;0.006	T	0.45308	-0.9270	9	.	.	.	.	16.7018	0.85351	0.0:1.0:0.0:0.0	.	307;307;307	B7ZL31;B9EG64;Q9HAZ1	.;.;CLK4_HUMAN	I	307	ENSP00000316948:M307I	.	M	-	3	0	CLK4	177972403	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.949000	0.70257	2.527000	0.85204	0.650000	0.86243	ATG	.	.		0.279	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		Missense_Mutation
DSP	1832	hgsc.bcm.edu	37	6	7580848	7580848	+	Silent	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr6:7580848C>T	ENST00000379802.3	+	23	4766	c.4425C>T	c.(4423-4425)acC>acT	p.T1475T	DSP_ENST00000418664.2_Intron	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1475	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CTGCCAAAACCATCCAGGATA	0.423																																					p.T1475T		Atlas-SNP	.											.	DSP	306	.	0			c.C4425T						.						100.0	96.0	97.0					6																	7580848		2203	4300	6503	SO:0001819	synonymous_variant	1832	exon23			CAAAACCATCCAG	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.4425C>T	chr6.hg19:g.7580848C>T		180.0	0.0		224.0	81.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	ENST00000379802.3	hg19	CCDS4501.1																																																																																			.	.		0.423	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
DHX16	8449	hgsc.bcm.edu	37	6	30638843	30638843	+	Missense_Mutation	SNP	T	T	G			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr6:30638843T>G	ENST00000376442.3	-	2	611	c.416A>C	c.(415-417)gAg>gCg	p.E139A		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	139					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CTCAGAAGCCTCTTCCTCCTC	0.502																																					p.E139A		Atlas-SNP	.											.	DHX16	119	.	0			c.A416C						.						207.0	167.0	182.0					6																	30638843		1511	2709	4220	SO:0001583	missense	8449	exon2			GAAGCCTCTTCCT	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.416A>C	chr6.hg19:g.30638843T>G	ENSP00000365625:p.Glu139Ala	155.0	0.0		197.0	17.0	NM_003587	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	hg19	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.448304	0.43429	.	.	ENSG00000204560	ENST00000376442;ENST00000415603	T;T	0.65364	-0.15;2.03	4.66	1.79	0.24919	.	0.234953	0.41500	D	0.000867	T	0.19366	0.0465	N	0.14661	0.345	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.04781	-1.0927	10	0.24483	T	0.36	.	5.4915	0.16779	0.1798:0.0:0.1607:0.6594	.	79;139	B4DZ28;O60231	.;DHX16_HUMAN	A	139;79	ENSP00000365625:E139A;ENSP00000399101:E79A	ENSP00000365625:E139A	E	-	2	0	DHX16	30746822	0.039000	0.19947	0.932000	0.37286	0.953000	0.61014	0.660000	0.25009	0.646000	0.30693	0.455000	0.32223	GAG	.	.		0.502	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
MDC1	9656	hgsc.bcm.edu	37	6	30672574	30672574	+	Missense_Mutation	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr6:30672574G>T	ENST00000376406.3	-	10	5033	c.4386C>A	c.(4384-4386)gaC>gaA	p.D1462E	MDC1_ENST00000376405.2_Missense_Mutation_p.D1198E|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1462	Interaction with the PRKDC complex.|Pro-rich.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TAACAGGCTGGTCTGTGGAGG	0.572								Other conserved DNA damage response genes																													p.D1462E		Atlas-SNP	.											.	MDC1	218	.	0			c.C4386A						.						114.0	126.0	122.0					6																	30672574		2203	4299	6502	SO:0001583	missense	9656	exon10			AGGCTGGTCTGTG	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4386C>A	chr6.hg19:g.30672574G>T	ENSP00000365588:p.Asp1462Glu	126.0	0.0		158.0	52.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	hg19	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	G	9.412	1.080756	0.20309	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.16597	2.33;2.33	4.46	-2.91	0.05631	.	.	.	.	.	T	0.04048	0.0113	L	0.47716	1.5	0.09310	N	1	P;B	0.35575	0.51;0.003	B;B	0.42738	0.396;0.01	T	0.35076	-0.9803	9	0.10111	T	0.7	0.1944	0.8896	0.01252	0.1925:0.1513:0.2357:0.4205	.	1198;1462	Q14676-2;Q14676	.;MDC1_HUMAN	E	1462;1198;1175;1028	ENSP00000365588:D1462E;ENSP00000365587:D1198E	ENSP00000365587:D1198E	D	-	3	2	MDC1	30780553	0.001000	0.12720	0.015000	0.15790	0.045000	0.14185	0.045000	0.14013	-0.321000	0.08627	0.449000	0.29647	GAC	.	.		0.572	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
TMEM184A	202915	hgsc.bcm.edu	37	7	1594988	1594988	+	Missense_Mutation	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr7:1594988C>T	ENST00000297477.5	-	2	449	c.133G>A	c.(133-135)Gcc>Acc	p.A45T		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	45					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		AGCCAGGGGGCCCCCTGGGAG	0.706																																					p.A45T		Atlas-SNP	.											.	TMEM184A	35	.	0			c.G133A						.						20.0	29.0	26.0					7																	1594988		1936	4104	6040	SO:0001583	missense	202915	exon2			AGGGGGCCCCCTG		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.133G>A	chr7.hg19:g.1594988C>T	ENSP00000297477:p.Ala45Thr	53.0	0.0		58.0	32.0	NM_001097620	Q8TBQ6	Missense_Mutation	SNP	ENST00000297477.5	hg19	CCDS43537.1	.	.	.	.	.	.	.	.	.	.	C	2.199	-0.383394	0.04966	.	.	ENSG00000164855	ENST00000297477;ENST00000319010;ENST00000414730;ENST00000441933;ENST00000431208	T;T;T;T;T	0.46819	1.49;0.86;0.89;0.88;0.88	4.45	1.5	0.22942	.	891.613000	0.01644	U	0.024206	T	0.29882	0.0747	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.13899	-1.0492	10	0.14656	T	0.56	-9.0747	5.3605	0.16085	0.0:0.5298:0.1503:0.32	.	45	Q6ZMB5	T184A_HUMAN	T	45	ENSP00000297477:A45T;ENSP00000325945:A45T;ENSP00000398382:A45T;ENSP00000389092:A45T;ENSP00000403499:A45T	ENSP00000297477:A45T	A	-	1	0	TMEM184A	1561514	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-1.959000	0.01518	0.415000	0.25817	0.462000	0.41574	GCC	.	.		0.706	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239229.4	NM_152689	
STEAP1B	256227	hgsc.bcm.edu	37	7	22532994	22532994	+	Silent	SNP	G	G	A	rs571881121		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr7:22532994G>A	ENST00000406890.2	-	3	583	c.489C>T	c.(487-489)taC>taT	p.Y163Y	STEAP1B_ENST00000404369.4_Silent_p.Y182Y	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B	163						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(2)	4						GCCTCATTGCGTAAGACAGAG	0.388													g|||	1	0.000199681	0.0	0.0	5008	,	,		19769	0.0		0.0	False		,,,				2504	0.001				p.Y182Y		Atlas-SNP	.											STEAP1B,colon,carcinoma,0,2	STEAP1B	22	.	0			c.C546T						.						153.0	121.0	131.0					7																	22532994		692	1591	2283	SO:0001819	synonymous_variant	256227	exon3			CATTGCGTAAGAC		CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.489C>T	chr7.hg19:g.22532994G>A		156.0	0.0		189.0	18.0	NM_001164460	B5MCI2	Silent	SNP	ENST00000406890.2	hg19	CCDS55094.1																																																																																			.	.		0.388	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326617.2		
ABCA13	154664	hgsc.bcm.edu	37	7	48567919	48567919	+	Missense_Mutation	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr7:48567919G>A	ENST00000435803.1	+	55	14356	c.14332G>A	c.(14332-14334)Gct>Act	p.A4778T	ABCA13_ENST00000544596.1_Missense_Mutation_p.A508T	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4778	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTCAGGACATGCTATCATCAG	0.438																																					p.A4778T		Atlas-SNP	.											.	ABCA13	1192	.	0			c.G14332A						.						78.0	72.0	74.0					7																	48567919		1969	4181	6150	SO:0001583	missense	154664	exon55			GGACATGCTATCA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14332G>A	chr7.hg19:g.48567919G>A	ENSP00000411096:p.Ala4778Thr	69.0	0.0		77.0	14.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875737	0.33162	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.93906	-3.31;-3.31;-3.31	5.73	2.94	0.34122	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.262385	0.26927	N	0.021788	D	0.90823	0.7118	M	0.74467	2.265	0.09310	N	1	B;P;P	0.38129	0.089;0.558;0.619	B;B;B	0.33890	0.073;0.128;0.172	T	0.83164	-0.0097	10	0.56958	D	0.05	.	9.4262	0.38581	0.2215:0.0:0.7785:0.0	.	508;2480;4778	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	T	4778;551;508	ENSP00000411096:A4778T;ENSP00000391042:A551T;ENSP00000442634:A508T	ENSP00000391042:A551T	A	+	1	0	ABCA13	48538465	0.649000	0.27322	0.001000	0.08648	0.005000	0.04900	2.880000	0.48530	0.334000	0.23590	0.655000	0.94253	GCT	.	.		0.438	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
CCDC132	55610	hgsc.bcm.edu	37	7	92926471	92926471	+	Missense_Mutation	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr7:92926471G>T	ENST00000305866.5	+	16	1405	c.1277G>T	c.(1276-1278)gGa>gTa	p.G426V	CCDC132_ENST00000541136.1_Missense_Mutation_p.G237V|CCDC132_ENST00000317751.6_Missense_Mutation_p.G157V|CCDC132_ENST00000544910.1_Missense_Mutation_p.G396V|CCDC132_ENST00000535481.1_Missense_Mutation_p.G146V	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	426						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			ATGCAAGTTGGAGAAGAATTT	0.318																																					p.G426V		Atlas-SNP	.											.	CCDC132	136	.	0			c.G1277T						.						78.0	74.0	75.0					7																	92926471		1804	4069	5873	SO:0001583	missense	55610	exon16			AAGTTGGAGAAGA	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1277G>T	chr7.hg19:g.92926471G>T	ENSP00000307666:p.Gly426Val	90.0	0.0		94.0	4.0	NM_017667	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	hg19	CCDS43617.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.455281|4.455281	0.84209|0.84209	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000458707|ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751	.|T	.|0.70282	.|-0.47	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.85392	.|0.5686	M|M	0.82056|0.82056	2.57|2.57	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.998;0.998;0.994	.|D	.|0.87385	.|0.2359	.|10	.|0.87932	.|D	.|0	-14.4067|-14.4067	18.8207|18.8207	0.92096|0.92096	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|146;396;426	.|B4DS55;F5H5U7;Q96JG6	.|.;.;CC132_HUMAN	X|V	213|426;396;237;146;157	.|ENSP00000325582:G157V	.|ENSP00000307666:G426V	E|G	+|+	1|2	0|0	CCDC132|CCDC132	92764407|92764407	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.711000|9.711000	0.98735|0.98735	2.525000|2.525000	0.85131|0.85131	0.557000|0.557000	0.71058|0.71058	GAG|GGA	.	.		0.318	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
SLC26A3	1811	hgsc.bcm.edu	37	7	107423494	107423494	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr7:107423494G>A	ENST00000340010.5	-	10	1348	c.1164C>T	c.(1162-1164)ttC>ttT	p.F388F	SLC26A3_ENST00000422236.2_Silent_p.F353F	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	388					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						CAAATCCTCTGAATACTCCAC	0.463																																					p.F388F		Atlas-SNP	.											.	SLC26A3	120	.	0			c.C1164T						.						129.0	123.0	125.0					7																	107423494		2203	4300	6503	SO:0001819	synonymous_variant	1811	exon10			TCCTCTGAATACT	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1164C>T	chr7.hg19:g.107423494G>A		179.0	0.0		166.0	64.0	NM_000111		Silent	SNP	ENST00000340010.5	hg19	CCDS5748.1																																																																																			.	.		0.463	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111	
ASAP1	50807	hgsc.bcm.edu	37	8	131181257	131181257	+	Missense_Mutation	SNP	A	A	C			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr8:131181257A>C	ENST00000518721.1	-	10	1030	c.803T>G	c.(802-804)cTg>cGg	p.L268R	ASAP1_ENST00000357668.1_Missense_Mutation_p.L268R	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	268					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						ATCAGCAGCCAGTTTTTCAAT	0.279																																					p.L268R		Atlas-SNP	.											.	ASAP1	133	.	0			c.T803G						.						61.0	67.0	65.0					8																	131181257		2200	4292	6492	SO:0001583	missense	50807	exon10			GCAGCCAGTTTTT	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.803T>G	chr8.hg19:g.131181257A>C	ENSP00000429900:p.Leu268Arg	94.0	0.0		96.0	34.0	NM_018482	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	hg19	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.313543	0.81358	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721;ENST00000524367	T;T;T	0.08102	3.13;3.13;3.13	5.91	5.91	0.95273	.	0.167754	0.40818	N	0.001007	T	0.32010	0.0815	M	0.81497	2.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.975;0.975;0.998	T	0.04522	-1.0945	10	0.87932	D	0	.	15.1723	0.72884	1.0:0.0:0.0:0.0	.	268;268;268	B2RNV3;Q9ULH1;Q9ULH1-2	.;ASAP1_HUMAN;.	R	268;268;268;238	ENSP00000350297:L268R;ENSP00000429900:L268R;ENSP00000430588:L238R	ENSP00000344591:L268R	L	-	2	0	ASAP1	131250439	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.533000	0.90617	2.254000	0.74563	0.533000	0.62120	CTG	.	.		0.279	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
SMARCA2	6595	hgsc.bcm.edu	37	9	2039815	2039815	+	Silent	SNP	G	G	A	rs574062756	byFrequency	TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr9:2039815G>A	ENST00000382203.1	+	4	914	c.705G>A	c.(703-705)caG>caA	p.Q235Q	RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000349721.2_Silent_p.Q235Q|SMARCA2_ENST00000357248.2_Silent_p.Q235Q|SMARCA2_ENST00000491574.1_3'UTR|SMARCA2_ENST00000382194.1_Silent_p.Q235Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	235	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		agcagcagcagcaacagcagc	0.587													G|||	41	0.0081869	0.0151	0.0029	5008	,	,		10366	0.0089		0.0	False		,,,				2504	0.0102				p.Q235Q		Atlas-SNP	.											.	SMARCA2	313	.	0			c.G705A						.						10.0	13.0	12.0					9																	2039815		2161	4205	6366	SO:0001819	synonymous_variant	6595	exon4			GCAGCAGCAACAG	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.705G>A	chr9.hg19:g.2039815G>A		35.0	0.0		27.0	5.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	ENST00000382203.1	hg19	CCDS34977.1																																																																																			.	.		0.587	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
TEX10	54881	hgsc.bcm.edu	37	9	103092435	103092435	+	Missense_Mutation	SNP	C	C	G			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr9:103092435C>G	ENST00000374902.4	-	6	1443	c.1267G>C	c.(1267-1269)Gtt>Ctt	p.V423L	TEX10_ENST00000535814.1_Missense_Mutation_p.V426L|TEX10_ENST00000537512.1_Missense_Mutation_p.V358L	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	423						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TTGGAGAGAACTGTGCAATGC	0.378																																					p.V426L		Atlas-SNP	.											.	TEX10	99	.	0			c.G1276C						.						130.0	125.0	127.0					9																	103092435		2203	4300	6503	SO:0001583	missense	54881	exon6			AGAGAACTGTGCA	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1267G>C	chr9.hg19:g.103092435C>G	ENSP00000364037:p.Val423Leu	72.0	0.0		65.0	29.0	NM_001161584	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	hg19	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	C	2.350	-0.349090	0.05208	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730;ENST00000429235;ENST00000537512	T;T;T	0.64085	-0.08;-0.08;-0.08	5.18	2.87	0.33458	Armadillo-type fold (1);	0.436379	0.26481	N	0.024128	T	0.40719	0.1128	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.12630	0.0;0.0;0.006;0.0	B;B;B;B	0.13407	0.0;0.001;0.009;0.0	T	0.17806	-1.0357	10	0.11485	T	0.65	-1.5738	4.1519	0.10242	0.1489:0.1667:0.0:0.6843	.	358;426;291;423	B7Z9D5;B4DYV2;E7ERG2;Q9NXF1	.;.;.;TEX10_HUMAN	L	426;423;291;68;358	ENSP00000444555:V426L;ENSP00000364037:V423L;ENSP00000438120:V358L	ENSP00000364037:V423L	V	-	1	0	TEX10	102132256	0.006000	0.16342	0.763000	0.31416	0.928000	0.56348	0.091000	0.15046	0.403000	0.25479	-0.302000	0.09304	GTT	.	.		0.378	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	
NOTCH1	4851	hgsc.bcm.edu	37	9	139395193	139395193	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr9:139395193G>A	ENST00000277541.6	-	31	5820	c.5745C>T	c.(5743-5745)taC>taT	p.Y1915Y		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1915					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TGGCGCCCTGGTAGATGAAGT	0.692			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.Y1915Y		Atlas-SNP	.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1	1980	.	0			c.C5745T						.						56.0	70.0	65.0					9																	139395193		2134	4259	6393	SO:0001819	synonymous_variant	4851	exon31			GCCCTGGTAGATG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5745C>T	chr9.hg19:g.139395193G>A		5.0	0.0		8.0	5.0	NM_017617	Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	hg19	CCDS43905.1																																																																																			.	.		0.692	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
ASB13	79754	hgsc.bcm.edu	37	10	5683746	5683746	+	Silent	SNP	G	G	A	rs144206251		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr10:5683746G>A	ENST00000357700.6	-	5	722	c.696C>T	c.(694-696)ttC>ttT	p.F232F	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	232	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		CGTAGTACTCGAAGCACTTGG	0.637																																					p.F232F		Atlas-SNP	.											ASB13,NS,carcinoma,0,1	ASB13	26	.	0			c.C696T						.						69.0	67.0	68.0					10																	5683746		2203	4300	6503	SO:0001819	synonymous_variant	79754	exon5			GTACTCGAAGCAC	AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.696C>T	chr10.hg19:g.5683746G>A		117.0	1.0		92.0	59.0	NM_024701	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Silent	SNP	ENST00000357700.6	hg19	CCDS7070.1																																																																																			.	G|1.000;T|0.000		0.637	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046564.1		
GHITM	27069	hgsc.bcm.edu	37	10	85902445	85902445	+	Missense_Mutation	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr10:85902445G>A	ENST00000372134.3	+	3	357	c.164G>A	c.(163-165)cGt>cAt	p.R55H	RP11-338I21.1_ENST00000606511.1_RNA	NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	55					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						GGGATCCGGCGTGGGAGAACT	0.393																																					p.R55H		Atlas-SNP	.											GHITM,NS,adenocarcinoma,0,1	GHITM	30	.	0			c.G164A						.						90.0	93.0	92.0					10																	85902445		1893	4119	6012	SO:0001583	missense	27069	exon3			TCCGGCGTGGGAG	AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.164G>A	chr10.hg19:g.85902445G>A	ENSP00000361207:p.Arg55His	96.0	0.0		128.0	8.0	NM_014394	A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Missense_Mutation	SNP	ENST00000372134.3	hg19	CCDS41542.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815186	0.70912	.	.	ENSG00000165678	ENST00000372134;ENST00000538477;ENST00000436406;ENST00000339736	.	.	.	5.86	5.86	0.93980	.	0.046469	0.85682	D	0.000000	T	0.77811	0.4186	M	0.79258	2.445	0.58432	D	0.999993	D	0.76494	0.999	P	0.59643	0.861	T	0.77048	-0.2732	9	0.44086	T	0.13	-17.4394	18.9591	0.92671	0.0:0.0:1.0:0.0	.	55	Q9H3K2	GHITM_HUMAN	H	55;42;55;55	.	ENSP00000342214:R55H	R	+	2	0	GHITM	85892425	1.000000	0.71417	0.979000	0.43373	0.990000	0.78478	6.477000	0.73591	2.765000	0.95021	0.655000	0.94253	CGT	.	.		0.393	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049125.1	NM_014394	
FEN1	2237	hgsc.bcm.edu	37	11	61563319	61563319	+	Silent	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr11:61563319C>T	ENST00000305885.2	+	2	899	c.486C>T	c.(484-486)agC>agT	p.S162S	FADS2_ENST00000574708.1_Intron	NM_004111.5	NP_004102.1			flap structure-specific endonuclease 1											endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						CAGAGGCCAGCTGTGCTGCCC	0.572								Editing and processing nucleases																													p.S162S		Atlas-SNP	.											.	FEN1	15	.	0			c.C486T						.						62.0	62.0	62.0					11																	61563319		2202	4299	6501	SO:0001819	synonymous_variant	2237	exon2			GGCCAGCTGTGCT	L37374	CCDS8010.1	11q12	2013-05-08			ENSG00000168496	ENSG00000168496			3650	protein-coding gene	gene with protein product	"""maturation factor-1"", ""DNase IV"""	600393		RAD2		7774922	Standard	NM_004111		Approved	FEN-1, MF1	uc001nsg.3	P39748	OTTHUMG00000168162	ENST00000305885.2:c.486C>T	chr11.hg19:g.61563319C>T		94.0	0.0		69.0	23.0	NM_004111		Silent	SNP	ENST00000305885.2	hg19	CCDS8010.1																																																																																			.	.		0.572	FEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398526.1	NM_004111	
CNIH2	254263	hgsc.bcm.edu	37	11	66050237	66050239	+	Missense_Mutation	TNP	TGC	TGC	CTT			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	T|G|C	T|G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr11:66050237_66050239TGC>CTT	ENST00000311445.6	+	3	442_444	c.184_186TGC>CTT	c.(184-186)TGC>CTT	p.C62L	CNIH2_ENST00000528852.1_Missense_Mutation_p.C62L|YIF1A_ENST00000526497.1_5'Flank|CNIH2_ENST00000530519.1_3'UTR	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	62					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						ACGCATCTGCTGCCTCCTGAGGA	0.635											OREG0021100	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C62R|p.C62F|p.C62C		Atlas-SNP	.											.	CNIH2	15	.	0			c.T184C|c.G185T|c.C186T						.																																			SO:0001583	missense	254263	exon3			ATCTGCTGCCTCC|TCTGCTGCCTCCT|CTGCTGCCTCCTG	BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.184_186TGC>CTT	chr11.hg19:g.66050237TGC>CTT	ENSP00000310003:p.Cys62Leu	156.0|154.0|154.0	0.0	1088	68.0|68.0|69.0	10.0	NM_182553		Missense_Mutation|Missense_Mutation|Silent	SNP	ENST00000311445.6	hg19	CCDS8131.1																																																																																			.	.		0.635	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391892.1	NM_182553	
PGR	5241	hgsc.bcm.edu	37	11	100996842	100996842	+	Nonsense_Mutation	SNP	A	A	C			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr11:100996842A>C	ENST00000325455.5	-	2	3138	c.1685T>G	c.(1684-1686)tTa>tGa	p.L562*	PGR_ENST00000534013.1_De_novo_Start_OutOfFrame|PGR_ENST00000263463.5_Nonsense_Mutation_p.L562*	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	562	Modulating, Pro-Rich.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CTTCTGAGGTAATGACTCGAA	0.433																																					p.L562X	Pancreas(124;2271 2354 21954 22882)	Atlas-SNP	.											.	PGR	115	.	0			c.T1685G						.						84.0	72.0	76.0					11																	100996842		2203	4300	6503	SO:0001587	stop_gained	5241	exon2			TGAGGTAATGACT	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.1685T>G	chr11.hg19:g.100996842A>C	ENSP00000325120:p.Leu562*	112.0	0.0		102.0	19.0	NM_000926	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Nonsense_Mutation	SNP	ENST00000325455.5	hg19	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	A	37	6.158621	0.97334	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	.	.	.	5.55	5.55	0.83447	.	0.085158	0.47852	D	0.000217	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7017	0.77547	1.0:0.0:0.0:0.0	.	.	.	.	X	562	.	ENSP00000263463:L562X	L	-	2	0	PGR	100502052	0.983000	0.35010	0.720000	0.30636	0.280000	0.26924	7.553000	0.82203	2.096000	0.63516	0.528000	0.53228	TTA	.	.		0.433	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
APOA5	116519	hgsc.bcm.edu	37	11	116661338	116661338	+	Missense_Mutation	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr11:116661338C>T	ENST00000227665.4	-	3	641	c.607G>A	c.(607-609)Ggg>Agg	p.G203R	APOA5_ENST00000542499.1_Missense_Mutation_p.G203R|ZNF259_ENST00000227322.3_5'Flank			Q6Q788	APOA5_HUMAN	apolipoprotein A-V	203					acylglycerol homeostasis (GO:0055090)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|organ regeneration (GO:0031100)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)	chylomicron (GO:0042627)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|lipase activator activity (GO:0060229)|lipase binding (GO:0035473)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|lipoprotein particle receptor binding (GO:0070325)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylcholine binding (GO:0031210)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	14	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		ACGTGGCGCCCGATGCCGCTC	0.697																																					p.G203R		Atlas-SNP	.											.	APOA5	34	.	0			c.G607A						.						14.0	18.0	17.0					11																	116661338		2181	4258	6439	SO:0001583	missense	116519	exon4			GGCGCCCGATGCC	AF202889	CCDS8376.2	11q23	2013-01-24			ENSG00000110243	ENSG00000110243		"""Apolipoproteins"""	17288	protein-coding gene	gene with protein product		606368				11588264, 11577099	Standard	NM_001166598		Approved	RAP3, APOA-V	uc009yzf.3	Q6Q788	OTTHUMG00000046116	ENST00000227665.4:c.607G>A	chr11.hg19:g.116661338C>T	ENSP00000227665:p.Gly203Arg	7.0	0.0		5.0	4.0	NM_001166598	B0YIV9|Q3MIK6|Q6UWK9|Q9UBJ3	Missense_Mutation	SNP	ENST00000227665.4	hg19	CCDS8376.2	.	.	.	.	.	.	.	.	.	.	C	17.60	3.429703	0.62844	.	.	ENSG00000110243	ENST00000227665;ENST00000542499	T;T	0.73789	-0.78;-0.78	4.84	1.92	0.25849	Apolipoprotein/apolipophorin (1);	0.268049	0.26727	N	0.022812	T	0.68174	0.2972	M	0.78223	2.4	0.30936	N	0.726384	B;B	0.27971	0.196;0.068	B;B	0.23852	0.049;0.049	T	0.60712	-0.7209	10	0.14656	T	0.56	-16.5259	9.2766	0.37703	0.0:0.506:0.415:0.079	.	200;203	B0YIW1;Q6Q788	.;APOA5_HUMAN	R	203	ENSP00000227665:G203R;ENSP00000445002:G203R	ENSP00000227665:G203R	G	-	1	0	APOA5	116166548	0.969000	0.33509	0.987000	0.45799	0.916000	0.54674	1.766000	0.38491	0.234000	0.21139	-0.172000	0.13284	GGG	.	.		0.697	APOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106285.2		
AQP5	362	hgsc.bcm.edu	37	12	50358790	50358790	+	Missense_Mutation	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr12:50358790C>T	ENST00000293599.6	+	4	776	c.628C>T	c.(628-630)Ccc>Tcc	p.P210S	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550214.1_RNA|AQP6_ENST00000551733.1_5'Flank|RP11-469H8.6_ENST00000550530.1_RNA	NM_001651.2	NP_001642.1	P55064	AQP5_HUMAN	aquaporin 5	210					camera-type eye morphogenesis (GO:0048593)|carbon dioxide transport (GO:0015670)|excretion (GO:0007588)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	water channel activity (GO:0015250)			large_intestine(1)|lung(3)	4						CTGGGTAGGGCCCATCGTGGG	0.617																																					p.P210S		Atlas-SNP	.											.	AQP5	19	.	0			c.C628T						.						82.0	84.0	83.0					12																	50358790		2203	4300	6503	SO:0001583	missense	362	exon4			GTAGGGCCCATCG	U46569	CCDS8793.1	12q13	2013-09-10				ENSG00000161798		"""Ion channels / Aquaporins"""	638	protein-coding gene	gene with protein product		600442				8621489, 23830519	Standard	NM_001651		Approved		uc001rvo.3	P55064	OTTHUMG00000169710	ENST00000293599.6:c.628C>T	chr12.hg19:g.50358790C>T	ENSP00000293599:p.Pro210Ser	151.0	0.0		82.0	49.0	NM_001651	Q6FGW8	Missense_Mutation	SNP	ENST00000293599.6	hg19	CCDS8793.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452005	0.63290	.	.	ENSG00000161798	ENST00000293599	D	0.96522	-4.04	5.03	5.03	0.67393	Aquaporin-like (2);	0.094674	0.45867	D	0.000340	D	0.98792	0.9593	H	0.99325	4.515	0.54753	D	0.999989	P	0.48503	0.911	P	0.56474	0.799	D	0.99445	1.0939	10	0.87932	D	0	9.2576	16.2949	0.82765	0.0:1.0:0.0:0.0	.	210	P55064	AQP5_HUMAN	S	210	ENSP00000293599:P210S	ENSP00000293599:P210S	P	+	1	0	AQP5	48645057	1.000000	0.71417	0.996000	0.52242	0.869000	0.49853	5.116000	0.64661	2.536000	0.85505	0.555000	0.69702	CCC	.	.		0.617	AQP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405542.2	NM_001651	
FLT1	2321	hgsc.bcm.edu	37	13	28964106	28964106	+	Missense_Mutation	SNP	G	G	C			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr13:28964106G>C	ENST00000282397.4	-	13	2047	c.1796C>G	c.(1795-1797)aCa>aGa	p.T599R	FLT1_ENST00000541932.1_Missense_Mutation_p.T599R	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	599	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTAGTGCATTGTTCTGTTATT	0.418																																					p.T599R		Atlas-SNP	.											.	FLT1	393	.	0			c.C1796G						.						281.0	238.0	253.0					13																	28964106		2203	4300	6503	SO:0001583	missense	2321	exon13			TGCATTGTTCTGT	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1796C>G	chr13.hg19:g.28964106G>C	ENSP00000282397:p.Thr599Arg	230.0	0.0		238.0	27.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	hg19	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003303	0.35320	.	.	ENSG00000102755	ENST00000282397;ENST00000541932	T;T	0.75477	-0.94;-0.38	6.06	5.21	0.72293	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.255299	0.39834	N	0.001243	T	0.72938	0.3523	M	0.66939	2.045	0.80722	D	1	B;B;B	0.31209	0.313;0.313;0.02	B;B;B	0.32090	0.14;0.14;0.018	T	0.69409	-0.5153	10	0.17832	T	0.49	.	17.4133	0.87493	0.0:0.1246:0.8754:0.0	.	599;599;599	P17948-3;P17948-2;P17948	.;.;VGFR1_HUMAN	R	599	ENSP00000282397:T599R;ENSP00000437631:T599R	ENSP00000282397:T599R	T	-	2	0	FLT1	27862106	1.000000	0.71417	0.528000	0.27938	0.963000	0.63663	5.072000	0.64389	1.545000	0.49373	0.650000	0.86243	ACA	.	.		0.418	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
MGA	23269	hgsc.bcm.edu	37	15	42054412	42054412	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr15:42054412G>A	ENST00000570161.1	+	21	7596	c.7596G>A	c.(7594-7596)aaG>aaA	p.K2532K	MGA_ENST00000389936.4_Silent_p.K2493K|MGA_ENST00000545763.1_Silent_p.K2323K|MGA_ENST00000219905.7_Silent_p.K2532K|MGA_ENST00000566586.1_Silent_p.K2323K			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAAAAAAGAAGATGGGATCAG	0.373																																					p.K2532K		Atlas-SNP	.											.	MGA	264	.	0			c.G7596A						.						72.0	71.0	72.0					15																	42054412		1872	4113	5985	SO:0001819	synonymous_variant	23269	exon22			AAAGAAGATGGGA	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7596G>A	chr15.hg19:g.42054412G>A		188.0	1.0		170.0	94.0	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	hg19	CCDS55959.1																																																																																			.	.		0.373	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
DUOX2	50506	hgsc.bcm.edu	37	15	45387780	45387780	+	Missense_Mutation	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr15:45387780C>T	ENST00000603300.1	-	31	4296	c.4094G>A	c.(4093-4095)gGa>gAa	p.G1365E	DUOX2_ENST00000389039.6_Missense_Mutation_p.G1365E	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1365	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TCCAAACGGTCCATCAAGGTA	0.567																																					p.G1365E		Atlas-SNP	.											.	DUOX2	137	.	0			c.G4094A						.						74.0	71.0	72.0					15																	45387780		2198	4298	6496	SO:0001583	missense	50506	exon31			AACGGTCCATCAA	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.4094G>A	chr15.hg19:g.45387780C>T	ENSP00000475084:p.Gly1365Glu	127.0	0.0		87.0	39.0	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	hg19	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	C	32	5.139334	0.94560	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.84	5.84	0.93424	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.90065	0.6897	H	0.96720	3.87	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.92740	0.6207	9	0.87932	D	0	-8.9646	19.116	0.93340	0.0:1.0:0.0:0.0	.	1365	Q9NRD8	DUOX2_HUMAN	E	1365	.	ENSP00000373691:G1365E	G	-	2	0	DUOX2	43175072	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.811000	0.86092	2.768000	0.95171	0.561000	0.74099	GGA	.	.		0.567	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
SCAPER	49855	hgsc.bcm.edu	37	15	77025616	77025616	+	Missense_Mutation	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr15:77025616C>T	ENST00000563290.1	-	16	2071	c.1976G>A	c.(1975-1977)cGt>cAt	p.R659H	SCAPER_ENST00000538941.2_Missense_Mutation_p.R413H|SCAPER_ENST00000324767.7_Missense_Mutation_p.R659H			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	659	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TCTTCTCTGACGCTCTTCCTG	0.393																																					p.R659H		Atlas-SNP	.											SCAPER,colon,carcinoma,0,1	SCAPER	160	.	0			c.G1976A						.						129.0	116.0	120.0					15																	77025616		1903	4136	6039	SO:0001583	missense	49855	exon15			CTCTGACGCTCTT	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1976G>A	chr15.hg19:g.77025616C>T	ENSP00000454973:p.Arg659His	117.0	0.0		109.0	44.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	34	5.298994	0.95574	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.48201	0.91;0.82	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.71048	0.3294	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.73081	-0.4095	10	0.72032	D	0.01	.	19.7152	0.96115	0.0:1.0:0.0:0.0	.	680;413	Q9BY12-2;F5H7X8	.;.	H	659;413;681	ENSP00000326924:R659H;ENSP00000442190:R413H	ENSP00000303560:R681H	R	-	2	0	SCAPER	74812671	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.657000	0.67996	2.653000	0.90120	0.650000	0.86243	CGT	.	.		0.393	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
AXIN1	8312	hgsc.bcm.edu	37	16	347721	347721	+	Splice_Site	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr16:347721C>T	ENST00000262320.3	-	6	2156		c.e6+1		AXIN1_ENST00000354866.3_Splice_Site|AXIN1_ENST00000481769.1_5'Flank	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1						activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CGCACGCTCACCTGTGGGCGA	0.642																																					.		Atlas-SNP	.											.	AXIN1	290	.	0			c.1784+1G>A						.						19.0	20.0	19.0					16																	347721		2201	4297	6498	SO:0001630	splice_region_variant	8312	exon7			CGCTCACCTGTGG	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1784+1G>A	chr16.hg19:g.347721C>T		16.0	0.0		7.0	7.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Splice_Site	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981479	0.34942	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5709	0.91135	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AXIN1	287722	1.000000	0.71417	0.999000	0.59377	0.173000	0.22820	4.880000	0.63107	2.477000	0.83638	0.472000	0.43445	.	.	.		0.642	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		Intron
SLX4	84464	hgsc.bcm.edu	37	16	3642739	3642739	+	Missense_Mutation	SNP	G	G	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr16:3642739G>T	ENST00000294008.3	-	11	2928	c.2288C>A	c.(2287-2289)cCt>cAt	p.P763H		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	763	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						AAGGCCAGGAGGAAGGCCAGT	0.602								Direct reversal of damage																													p.P763H		Atlas-SNP	.											.	SLX4	173	.	0			c.C2288A						.						61.0	56.0	57.0					16																	3642739		2197	4300	6497	SO:0001583	missense	84464	exon11			CCAGGAGGAAGGC	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2288C>A	chr16.hg19:g.3642739G>T	ENSP00000294008:p.Pro763His	131.0	0.0		54.0	4.0	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	hg19	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855052	0.51376	.	.	ENSG00000188827	ENST00000294008	T	0.23147	1.92	5.61	5.61	0.85477	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.431990	0.23826	N	0.044192	T	0.60637	0.2284	M	0.89715	3.055	0.22199	N	0.99929	D	0.89917	1.0	D	0.77557	0.99	T	0.60419	-0.7267	10	0.87932	D	0	.	18.196	0.89822	0.0:0.0:1.0:0.0	.	763	Q8IY92	SLX4_HUMAN	H	763	ENSP00000294008:P763H	ENSP00000294008:P763H	P	-	2	0	SLX4	3582740	0.400000	0.25295	0.012000	0.15200	0.006000	0.05464	2.817000	0.48034	2.652000	0.90054	0.655000	0.94253	CCT	.	.		0.602	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
CNTNAP4	85445	hgsc.bcm.edu	37	16	76482022	76482022	+	Missense_Mutation	SNP	G	G	C			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr16:76482022G>C	ENST00000476707.1	+	4	800	c.661G>C	c.(661-663)Gat>Cat	p.D221H	CNTNAP4_ENST00000377504.4_Missense_Mutation_p.D217H|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.D217H|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.D193H			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	218	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CATGCAGAGTGATGGGATTCT	0.363																																					p.D193H		Atlas-SNP	.											.	CNTNAP4	600	.	0			c.G577C						.						87.0	88.0	87.0					16																	76482022		2198	4300	6498	SO:0001583	missense	85445	exon5			CAGAGTGATGGGA	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.661G>C	chr16.hg19:g.76482022G>C	ENSP00000417628:p.Asp221His	146.0	0.0		77.0	70.0	NM_138994	E9PFZ6|Q86YZ7	Missense_Mutation	SNP	ENST00000476707.1	hg19		.	.	.	.	.	.	.	.	.	.	G	19.68	3.873469	0.72180	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	5.11	5.11	0.69529	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.41396	D	0.000885	D	0.89248	0.6661	.	.	.	0.41837	D	0.990101	P;D;P;P	0.56521	0.755;0.976;0.755;0.924	P;P;P;D	0.63192	0.489;0.872;0.507;0.912	D	0.90583	0.4531	9	0.87932	D	0	.	18.7371	0.91759	0.0:0.0:1.0:0.0	.	193;221;193;218	E9PFZ6;E9PDN6;Q96M80;Q9C0A0	.;.;.;CNTP4_HUMAN	H	217;217;193;221	ENSP00000306893:D217H;ENSP00000439733:D217H;ENSP00000418741:D193H;ENSP00000417628:D221H	ENSP00000306893:D217H	D	+	1	0	CNTNAP4	75039523	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.291000	0.43540	2.654000	0.90174	0.563000	0.77884	GAT	.	.		0.363	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000348216.1	NM_033401	
MYO15A	51168	hgsc.bcm.edu	37	17	18055202	18055202	+	Missense_Mutation	SNP	T	T	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr17:18055202T>A	ENST00000205890.5	+	41	8168	c.7830T>A	c.(7828-7830)caT>caA	p.H2610Q	MYO15A_ENST00000418233.3_5'Flank|MYO15A_ENST00000585180.1_5'Flank	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2610	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CAGACCCTCATGAGGAGGCCC	0.592																																					p.H2610Q		Atlas-SNP	.											.	MYO15A	268	.	0			c.T7830A						.						40.0	44.0	43.0					17																	18055202		1989	4166	6155	SO:0001583	missense	51168	exon40			CCCTCATGAGGAG	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.7830T>A	chr17.hg19:g.18055202T>A	ENSP00000205890:p.His2610Gln	183.0	0.0		139.0	39.0	NM_016239	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	hg19	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159376	0.57368	.	.	ENSG00000091536	ENST00000205890	D	0.88896	-2.44	5.24	-3.08	0.05347	.	.	.	.	.	D	0.90748	0.7096	M	0.61703	1.905	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	D	0.88022	0.2769	9	0.56958	D	0.05	.	12.6386	0.56696	0.0:0.4057:0.0:0.5943	.	2610	Q9UKN7	MYO15_HUMAN	Q	2610	ENSP00000205890:H2610Q	ENSP00000205890:H2610Q	H	+	3	2	MYO15A	17995927	0.000000	0.05858	0.865000	0.33974	0.964000	0.63967	-2.442000	0.01014	-1.109000	0.02996	-0.215000	0.12644	CAT	.	.		0.592	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
SOST	50964	hgsc.bcm.edu	37	17	41836014	41836014	+	Missense_Mutation	SNP	A	A	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr17:41836014A>T	ENST00000301691.2	-	1	142	c.96T>A	c.(94-96)gaT>gaA	p.D32E		NM_025237.2	NP_079513.1	Q9BQB4	SOST_HUMAN	sclerostin	32					cellular response to parathyroid hormone stimulus (GO:0071374)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|response to mechanical stimulus (GO:0009612)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(3)|prostate(1)	6		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		TTTCCGTGGCATCATTCTTGA	0.627																																					p.D32E		Atlas-SNP	.											.	SOST	19	.	0			c.T96A						.						91.0	82.0	85.0					17																	41836014		2203	4300	6503	SO:0001583	missense	50964	exon1			CGTGGCATCATTC	AF326736	CCDS11468.1	17q12-q21	2014-06-28	2010-04-28			ENSG00000167941			13771	protein-coding gene	gene with protein product		605740	"""sclerosteosis"""			11179006, 11181578	Standard	NM_025237		Approved	VBCH	uc002iec.1	Q9BQB4		ENST00000301691.2:c.96T>A	chr17.hg19:g.41836014A>T	ENSP00000301691:p.Asp32Glu	100.0	0.0		71.0	25.0	NM_025237	Q495N9	Missense_Mutation	SNP	ENST00000301691.2	hg19	CCDS11468.1	.	.	.	.	.	.	.	.	.	.	A	19.73	3.881328	0.72294	.	.	ENSG00000167941	ENST00000301691	D	0.83506	-1.73	4.36	-1.16	0.09678	.	0.000000	0.85682	D	0.000000	D	0.87067	0.6085	M	0.68317	2.08	0.44214	D	0.997045	D	0.62365	0.991	D	0.74023	0.982	D	0.84361	0.0538	10	0.87932	D	0	-4.4389	9.5227	0.39145	0.5418:0.0:0.4582:0.0	.	32	Q9BQB4	SOST_HUMAN	E	32	ENSP00000301691:D32E	ENSP00000301691:D32E	D	-	3	2	SOST	39191540	0.951000	0.32395	0.955000	0.39395	0.965000	0.64279	0.206000	0.17375	-0.452000	0.07087	0.454000	0.30748	GAT	.	.		0.627	SOST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453502.1	NM_025237	
DTNA	1837	hgsc.bcm.edu	37	18	32428268	32428268	+	Missense_Mutation	SNP	A	A	G	rs374916548		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr18:32428268A>G	ENST00000399113.3	+	13	1274	c.1274A>G	c.(1273-1275)gAg>gGg	p.E425G	DTNA_ENST00000597674.1_Missense_Mutation_p.E47G|DTNA_ENST00000595022.1_Missense_Mutation_p.E365G|DTNA_ENST00000269190.7_Missense_Mutation_p.E426G|DTNA_ENST00000556414.3_Missense_Mutation_p.E77G|DTNA_ENST00000399121.5_Missense_Mutation_p.E365G|DTNA_ENST00000399097.3_Missense_Mutation_p.E73G|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000348997.5_Missense_Mutation_p.E422G|DTNA_ENST00000599844.1_Missense_Mutation_p.E47G|DTNA_ENST00000601125.1_Missense_Mutation_p.E47G|DTNA_ENST00000598334.1_Missense_Mutation_p.E365G|DTNA_ENST00000598774.1_Missense_Mutation_p.E368G|DTNA_ENST00000591182.1_Missense_Mutation_p.E73G|DTNA_ENST00000444659.1_Missense_Mutation_p.E425G|DTNA_ENST00000283365.9_Missense_Mutation_p.E368G|DTNA_ENST00000269191.6_Missense_Mutation_p.E425G|DTNA_ENST00000598142.1_Missense_Mutation_p.E368G|DTNA_ENST00000269192.7_Missense_Mutation_p.E134G|DTNA_ENST00000597599.1_Missense_Mutation_p.E365G			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	425	Syntrophin-binding region.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						AGCATGCTTGAGAGTTCAAAC	0.438																																					p.E425G		Atlas-SNP	.											.	DTNA	321	.	0			c.A1274G						.	A	,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU,GLY/GLU	0,4406		0,0,2203	105.0	97.0	100.0		,140,218,1103,1265,1103,1274,1274,230,344,401,1094,1094,1094,1094	5.4	1.0	18		100	2,8598	2.2+/-6.3	0,2,4298	no	intron,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	DTNA	NM_001198945.1,NM_032981.4,NM_032980.3,NM_032979.4,NM_032978.6,NM_032975.3,NM_001391.5,NM_001390.4,NM_001198944.1,NM_001198943.1,NM_001198942.1,NM_001198941.1,NM_001198940.1,NM_001198939.1,NM_001198938.1	,98,98,98,98,98,98,98,98,98,98,98,98,98,98	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	,47/193,73/392,368/514,422/568,368/687,425/571,425/744,77/396,115/434,134/453,365/511,365/684,365/691,365/725	32428268	2,13004	2203	4300	6503	SO:0001583	missense	1837	exon13			TGCTTGAGAGTTC	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1274A>G	chr18.hg19:g.32428268A>G	ENSP00000382064:p.Glu425Gly	87.0	0.0		45.0	42.0	NM_001390	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	hg19	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.563243	0.65538	0.0	2.33E-4	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000399114;ENST00000269190;ENST00000399097;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113;ENST00000269192;ENST00000450377;ENST00000556414	D;D;D;D;D;D;D;D;D	0.83163	-1.64;-1.69;-1.69;-1.66;-1.69;-1.69;-1.69;-1.69;-1.64	5.39	5.39	0.77823	.	0.287902	0.38897	N	0.001537	T	0.74038	0.3664	L	0.33485	1.01	0.47819	D	0.999527	B;B;B;P;B;B;B;B;B;P;B;B;B;B	0.41008	0.057;0.375;0.007;0.735;0.05;0.246;0.0;0.0;0.246;0.454;0.0;0.136;0.001;0.081	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.35727	0.096;0.197;0.01;0.209;0.089;0.138;0.001;0.004;0.157;0.138;0.001;0.04;0.004;0.046	T	0.73672	-0.3909	10	0.27785	T	0.31	-6.0175	15.4146	0.74956	1.0:0.0:0.0:0.0	.	77;134;115;47;425;425;365;368;73;422;365;376;368;368	B4DIU8;B4DIR0;B7Z3X3;Q9Y4J8-8;Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-6;Q9Y4J8-4;E9PEH8;Q59GK7;Q9Y4J8-2;Q9Y4J8-5	.;.;.;.;DTNA_HUMAN;.;.;.;.;.;.;.;.;.	G	368;368;365;426;73;422;425;425;425;425;134;73;77	ENSP00000283365:E368G;ENSP00000269190:E426G;ENSP00000336682:E422G;ENSP00000382072:E425G;ENSP00000405819:E425G;ENSP00000269191:E425G;ENSP00000382064:E425G;ENSP00000269192:E134G;ENSP00000452255:E77G	ENSP00000269190:E426G	E	+	2	0	DTNA	30682266	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.490000	0.90464	2.048000	0.60808	0.528000	0.53228	GAG	.	.		0.438	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
GTF2F1	2962	hgsc.bcm.edu	37	19	6381584	6381584	+	Silent	SNP	C	C	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr19:6381584C>T	ENST00000394456.5	-	8	1343	c.879G>A	c.(877-879)caG>caA	p.Q293Q	PSPN_ENST00000597721.1_5'Flank|GTF2F1_ENST00000429701.2_Silent_p.Q208Q	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	293	Glu-rich.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						CCTCCTCCTGCTGCGGCGCCT	0.677																																					p.Q293Q		Atlas-SNP	.											.	GTF2F1	39	.	0			c.G879A						.						43.0	45.0	44.0					19																	6381584		2202	4300	6502	SO:0001819	synonymous_variant	2962	exon8			CTCCTGCTGCGGC		CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.879G>A	chr19.hg19:g.6381584C>T		15.0	0.0		9.0	6.0	NM_002096	B2RCS0|Q9BWN0	Silent	SNP	ENST00000394456.5	hg19	CCDS12165.1																																																																																			.	.		0.677	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398033.1	NM_002096	
MEGF8	1954	hgsc.bcm.edu	37	19	42839240	42839240	+	Silent	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr19:42839240G>A	ENST00000251268.6	+	4	612	c.612G>A	c.(610-612)ctG>ctA	p.L204L	MEGF8_ENST00000334370.4_Silent_p.L204L	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	204					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCTGTGACCTGCACCTGTGGG	0.627																																					p.L204L		Atlas-SNP	.											.	MEGF8	358	.	0			c.G612A						.						33.0	38.0	36.0					19																	42839240		2050	4198	6248	SO:0001819	synonymous_variant	1954	exon4			TGACCTGCACCTG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.612G>A	chr19.hg19:g.42839240G>A		104.0	0.0		54.0	8.0	NM_001271938	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	hg19																																																																																				.	.		0.627	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
ZNF321P	399669	hgsc.bcm.edu	37	19	53432442	53432442	+	Missense_Mutation	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr19:53432442G>A	ENST00000391777.3	-	4	537	c.416C>T	c.(415-417)aCa>aTa	p.T139I	ZNF816_ENST00000549216.1_Missense_Mutation_p.T70I|ZNF816_ENST00000434371.2_Missense_Mutation_p.T139I|ZNF816-ZNF321P_ENST00000313956.4_RNA			Q8N8H1	ZN321_HUMAN	zinc finger protein 321, pseudogene	70										endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						ATGTCGGTCTGTACTACCAGT	0.423																																					p.T139I		Atlas-SNP	.											.	.	.	.	0			c.C416T						.						191.0	189.0	190.0					19																	53432442		2203	4300	6503	SO:0001583	missense	100529240	exon4			CGGTCTGTACTAC	AK096828		19q13.4	2013-01-08	2011-04-19	2011-04-19	ENSG00000221874	ENSG00000221874			13827	pseudogene	pseudogene			"""zinc finger protein 321"""	ZNF321			Standard	NR_037805		Approved	MGC35402		Q8N8H1	OTTHUMG00000167760	ENST00000391777.3:c.416C>T	chr19.hg19:g.53432442G>A	ENSP00000375656:p.Thr139Ile	174.0	0.0		148.0	72.0	NM_001202473	B7ZB38|Q68DZ0|Q86SS5	Missense_Mutation	SNP	ENST00000391777.3	hg19	CCDS56101.1	.	.	.	.	.	.	.	.	.	.	g	6.659	0.490103	0.12702	.	.	ENSG00000180257;ENSG00000180257;ENSG00000221874	ENST00000549216;ENST00000434371;ENST00000391777	T;T;T	0.01947	4.54;5.79;5.79	1.66	-3.13	0.05266	.	.	.	.	.	T	0.02380	0.0073	L	0.54323	1.7	0.09310	N	1	B	0.34161	0.439	B	0.35727	0.209	T	0.40496	-0.9560	9	0.35671	T	0.21	.	2.7181	0.05193	0.0:0.3377:0.2635:0.3988	.	70	Q8N8H1	ZN321_HUMAN	I	70;139;139	ENSP00000449832:T70I;ENSP00000438519:T139I;ENSP00000375656:T139I	ENSP00000375656:T139I	T	-	2	0	ZNF321P;ZNF816	58124254	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-2.623000	0.00876	-0.438000	0.07232	0.134000	0.15878	ACA	.	.		0.423	ZNF321P-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000396130.1	NR_037805	
DSCAM	1826	hgsc.bcm.edu	37	21	41427743	41427743	+	Silent	SNP	C	C	A	rs374386822		TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr21:41427743C>A	ENST00000400454.1	-	29	5421	c.4944G>T	c.(4942-4944)acG>acT	p.T1648T		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1648					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GCTTGCTTAACGTATCTGAAG	0.448																																					p.T1648T	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.G4944T						.						194.0	187.0	189.0					21																	41427743		1938	4133	6071	SO:0001819	synonymous_variant	1826	exon29			GCTTAACGTATCT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.4944G>T	chr21.hg19:g.41427743C>A		225.0	0.0		152.0	79.0	NM_001271534	O60468	Silent	SNP	ENST00000400454.1	hg19	CCDS42929.1																																																																																			.	.		0.448	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
BCORL1	63035	hgsc.bcm.edu	37	X	129147853	129147853	+	Missense_Mutation	SNP	A	A	G			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chrX:129147853A>G	ENST00000218147.7	+	4	1302	c.1105A>G	c.(1105-1107)Acc>Gcc	p.T369A	BCORL1_ENST00000303743.5_Missense_Mutation_p.T369A|BCORL1_ENST00000540052.1_Missense_Mutation_p.T369A|BCORL1_ENST00000359304.2_Missense_Mutation_p.T369A			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	369	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						cccaccttctacccccaccct	0.677																																					p.T369A		Atlas-SNP	.											.	BCORL1	213	.	0			c.A1105G						.						25.0	23.0	23.0					X																	129147853		2055	4017	6072	SO:0001583	missense	63035	exon3			CCTTCTACCCCCA	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.1105A>G	chrX.hg19:g.129147853A>G	ENSP00000218147:p.Thr369Ala	32.0	0.0		21.0	12.0	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	hg19	CCDS14616.1	.	.	.	.	.	.	.	.	.	.	A	11.60	1.685650	0.29962	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052	T;T;T;T	0.39592	1.07;1.44;1.07;1.07	4.34	3.19	0.36642	.	0.000000	0.34484	N	0.003931	T	0.17323	0.0416	N	0.08118	0	0.20873	N	0.999839	B;B	0.16603	0.018;0.005	B;B	0.10450	0.005;0.001	T	0.09037	-1.0693	9	.	.	.	-15.7686	3.5577	0.07870	0.4758:0.3139:0.2103:0.0	.	369;369	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	A	369	ENSP00000218147:T369A;ENSP00000307541:T369A;ENSP00000352253:T369A;ENSP00000437775:T369A	.	T	+	1	0	BCORL1	128975534	0.000000	0.05858	0.870000	0.34147	0.922000	0.55478	0.013000	0.13310	1.715000	0.51383	0.425000	0.28330	ACC	.	.		0.677	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
BCORL1	63035	hgsc.bcm.edu	37	X	129162763	129162763	+	Missense_Mutation	SNP	A	A	T			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chrX:129162763A>T	ENST00000218147.7	+	8	4429	c.4232A>T	c.(4231-4233)gAa>gTa	p.E1411V	BCORL1_ENST00000303743.5_Missense_Mutation_p.E1411V|BCORL1_ENST00000540052.1_Missense_Mutation_p.E1411V|BCORL1_ENST00000359304.2_Missense_Mutation_p.E1281V			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1411					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GCCTGCCTTGAAAATTCAGAA	0.488											OREG0019921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E1411V		Atlas-SNP	.											.	BCORL1	213	.	0			c.A4232T						.						83.0	78.0	80.0					X																	129162763		2203	4300	6503	SO:0001583	missense	63035	exon7			GCCTTGAAAATTC	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4232A>T	chrX.hg19:g.129162763A>T	ENSP00000218147:p.Glu1411Val	199.0	0.0	1570	174.0	91.0	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	hg19	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.89|17.89	3.498805|3.498805	0.64298|0.64298	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.48836|.	0.8;1.2;0.92;0.8;1.26|.	5.89|5.89	3.19|3.19	0.36642|0.36642	.|.	0.000000|.	0.37857|.	N|.	0.001919|.	T|.	0.41119|.	0.1145|.	L|L	0.46819|0.46819	1.47|1.47	0.09310|0.09310	N|N	0.999999|0.999999	P;D;D|.	0.71674|.	0.718;0.998;0.997|.	B;D;D|.	0.66351|.	0.346;0.943;0.939|.	T|.	0.23154|.	-1.0196|.	10|.	0.62326|.	D|.	0.03|.	-5.8609|-5.8609	9.3443|9.3443	0.38098|0.38098	0.8197:0.0:0.1803:0.0|0.8197:0.0:0.1803:0.0	.|.	1281;1411;1411|.	Q5H9F3-2;Q5H9F3-3;Q5H9F3|.	.;.;BCORL_HUMAN|.	V|C	1411;1411;1281;1411;1011|716	ENSP00000218147:E1411V;ENSP00000307541:E1411V;ENSP00000352253:E1281V;ENSP00000437775:E1411V;ENSP00000399483:E1011V|.	ENSP00000218147:E1411V|.	E|X	+|+	2|3	0|0	BCORL1|BCORL1	128990444|128990444	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.996000|0.996000	0.88848|0.88848	2.822000|2.822000	0.48073|0.48073	0.838000|0.838000	0.34948|0.34948	0.486000|0.486000	0.48141|0.48141	GAA|TGA	.	.		0.488	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
MT-ATP6	4508	hgsc.bcm.edu	37	M	9010	9010	+	Missense_Mutation	SNP	G	G	A			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chrM:9010G>A	ENST00000361899.2	+	1	484	c.484G>A	c.(484-486)Gct>Act	p.A162T	MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	162					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						TACGCCTAACCGCTAACATTA	0.468																																					p.A162T		Atlas-SNP	.											.	.	.	.	0			c.G484A						.																																			SO:0001583	missense	0	exon1			CTAACCGCTAACA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.484G>A	chrM.hg19:g.9010G>A	ENSP00000354632:p.Ala162Thr	44.0	0.0		8.0	7.0	ENST00000361899	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	hg19																																																																																				.	.		0.468	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024031	
KIAA1147	57189	hgsc.bcm.edu	37	7	141373871	141373872	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr7:141373871_141373872insTC	ENST00000536163.1	-	4	675_676	c.676_677insGA	c.(676-678)atgfs	p.M226fs	KIAA1147_ENST00000482493.1_Frame_Shift_Ins_p.M135fs	NM_001080392.1	NP_001073861.1	A4D1U4	LCHN_HUMAN	KIAA1147	226										breast(3)|endometrium(4)|kidney(2)|large_intestine(1)|ovary(1)|skin(1)	12	Melanoma(164;0.0171)					CCTCACCTTCATCTCAGGGTAC	0.465																																					p.M226fs		Atlas-INDEL	.											.	KIAA1147	32	.	0			c.677_678insGA						.																																			SO:0001589	frameshift_variant	57189	exon4			.	AB032973	CCDS47726.1	7q34	2012-10-04			ENSG00000257093	ENSG00000257093			29472	protein-coding gene	gene with protein product							Standard	NM_001080392		Approved	LCHN	uc003vwk.3	A4D1U4	OTTHUMG00000157539	ENST00000536163.1:c.675_676dupGA	chr7.hg19:g.141373874_141373875dupTC	ENSP00000445768:p.Met226fs	129.0	0.0		128.0	60.0	NM_001080392	Q9ULS3	Frame_Shift_Ins	INS	ENST00000536163.1	hg19	CCDS47726.1																																																																																			.	.		0.465	KIAA1147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349104.1		
COL2A1	1280	hgsc.bcm.edu	37	12	48389497	48389498	+	In_Frame_Ins	INS	-	-	CACCAGGTT			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr12:48389497_48389498insCACCAGGTT	ENST00000380518.3	-	10	867_868	c.703_704insAACCTGGTG	c.(703-705)gtc>gAACCTGGTGtc	p.234_235insEPG	COL2A1_ENST00000337299.6_In_Frame_Ins_p.165_166insEPG	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	234	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	ACTCACAGAGAcaccaggttca	0.525																																					p.V235delinsEPGV		Atlas-INDEL	.											.	COL2A1	368	.	0			c.704_705insAACCTGGTG						.																																			SO:0001652	inframe_insertion	1280	exon10			.	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.695_703dupAACCTGGTG	chr12.hg19:g.48389498_48389506dupCACCAGGTT	ENSP00000369889:p.Glu232_Gly234dup	291.0	0.0		217.0	19.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	In_Frame_Ins	INS	ENST00000380518.3	hg19	CCDS41778.1																																																																																			.	.		0.525	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
KRTAP5-7	440050	hgsc.bcm.edu	37	11	71238736	71238762	+	In_Frame_Del	DEL	CTGCTGTTCCTCAGGCTGTGGGTCATC	CTGCTGTTCCTCAGGCTGTGGGTCATC	-	rs533945918|rs79842834	byFrequency	TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	CTGCTGTTCCTCAGGCTGTGGGTCATC	CTGCTGTTCCTCAGGCTGTGGGTCATC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr11:71238736_71238762delCTGCTGTTCCTCAGGCTGTGGGTCATC	ENST00000398536.4	+	1	424_450	c.390_416delCTGCTGTTCCTCAGGCTGTGGGTCATC	c.(388-417)tgctgctgttcctcaggctgtgggtcatcc>tgc	p.CCSSGCGSS131del		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	131	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G137W(1)		breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						gtaagccctgctgctgttcctcaggctgtgggtcatcctgctgccag	0.604																																					p.130_139del		Atlas-INDEL	.											.	KRTAP5-7	23	.	1	Substitution - Missense(1)	lung(1)	c.389_415del						.																																			SO:0001651	inframe_deletion	440050	exon1			.	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.390_416delCTGCTGTTCCTCAGGCTGTGGGTCATC	chr11.hg19:g.71238736_71238762delCTGCTGTTCCTCAGGCTGTGGGTCATC	ENSP00000417330:p.Cys131_Ser139del	174.0	0.0		147.0	13.0	NM_001012503	B2RNM3|Q701N5	In_Frame_Del	DEL	ENST00000398536.4	hg19	CCDS41682.1																																																																																			.	.		0.604	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1		
OR10G8	219869	hgsc.bcm.edu	37	11	123900967	123900967	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BW-A5NP-01A-11D-A27I-10	TCGA-BW-A5NP-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1c00925b-7328-4db0-b930-04aab2d80719	600ba105-b0f1-4fba-b1ec-0bbfe622e6cf	g.chr11:123900967delT	ENST00000431524.1	+	1	671	c.638delT	c.(637-639)atafs	p.I213fs		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TTTGTCCTGATAGTGCTGTCC	0.552																																					p.I213X		Pindel	.											.	OR10G8	132	.	0			c.637delA						.						188.0	163.0	172.0					11																	123900967		2201	4299	6500	SO:0001589	frameshift_variant	219869	exon1			.	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.638delT	chr11.hg19:g.123900967delT	ENSP00000389072:p.Ile213fs	352.0	0.0		295.0	35.0	NM_001004464	B2RNJ3|Q6IEV2	Frame_Shift_Del	DEL	ENST00000431524.1	hg19	CCDS31704.1																																																																																			.	.		0.552	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
