#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R2	80834	hgsc.bcm.edu	37	1	19166175	19166175	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:19166175T>C	ENST00000375371.3	-	6	2459	c.2438A>G	c.(2437-2439)tAc>tGc	p.Y813C		NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	813					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GAGGATCATGTAGCACTTGGG	0.597																																					p.Y813C		Atlas-SNP	.											.	TAS1R2	134	.	0			c.A2438G						.						105.0	83.0	91.0					1																	19166175		2203	4300	6503	SO:0001583	missense	80834	exon6			ATCATGTAGCACT		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.2438A>G	chr1.hg19:g.19166175T>C	ENSP00000364520:p.Tyr813Cys	259.0	0.0		266.0	29.0	NM_152232	Q5TZ19	Missense_Mutation	SNP	ENST00000375371.3	hg19	CCDS187.1	.	.	.	.	.	.	.	.	.	.	T	16.71	3.197509	0.58126	.	.	ENSG00000179002	ENST00000375371	D	0.90324	-2.65	5.05	2.66	0.31614	GPCR, family 3, C-terminal (2);	0.323941	0.22278	N	0.062173	D	0.93387	0.7891	M	0.74467	2.265	0.47065	D	0.999308	D	0.89917	1.0	D	0.97110	1.0	D	0.90878	0.4751	10	0.87932	D	0	.	5.6203	0.17453	0.1509:0.0849:0.0:0.7642	.	813	Q8TE23	TS1R2_HUMAN	C	813	ENSP00000364520:Y813C	ENSP00000364520:Y813C	Y	-	2	0	TAS1R2	19038762	1.000000	0.71417	0.981000	0.43875	0.925000	0.55904	1.822000	0.39052	0.254000	0.21573	-0.351000	0.07748	TAC	.	.		0.597	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
HSPG2	3339	hgsc.bcm.edu	37	1	22222416	22222416	+	Splice_Site	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:22222416C>T	ENST00000374695.3	-	3	322	c.243G>A	c.(241-243)atG>atA	p.M81I		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	81	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GCAACTTACCCATCTGGAAGT	0.587																																					p.M81I		Atlas-SNP	.											.	HSPG2	311	.	0			c.G243A						.						53.0	55.0	55.0					1																	22222416		2203	4300	6503	SO:0001630	splice_region_variant	3339	exon3			CTTACCCATCTGG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.244+1G>A	chr1.hg19:g.22222416C>T		108.0	0.0		94.0	18.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203750	0.58234	.	.	ENSG00000142798	ENST00000374695;ENST00000412328;ENST00000439717	T;T;T	0.74947	-0.89;0.56;0.95	4.72	4.72	0.59763	SEA (2);	0.155231	0.30704	N	0.009052	T	0.73281	0.3567	N	0.12182	0.205	0.33492	D	0.588755	D;B	0.67145	0.996;0.022	D;B	0.76071	0.987;0.01	T	0.79070	-0.1954	10	0.42905	T	0.14	.	13.0666	0.59036	0.0:1.0:0.0:0.0	.	60;81	Q5SZI5;P98160	.;PGBM_HUMAN	I	81;60;47	ENSP00000363827:M81I;ENSP00000405412:M60I;ENSP00000395884:M47I	ENSP00000363827:M81I	M	-	3	0	HSPG2	22095003	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.530000	0.53539	2.452000	0.82932	0.643000	0.83706	ATG	.	.		0.587	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	Missense_Mutation
ARID1A	8289	hgsc.bcm.edu	37	1	27099008	27099008	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:27099008C>T	ENST00000324856.7	+	13	3795	c.3424C>T	c.(3424-3426)Cag>Tag	p.Q1142*	ARID1A_ENST00000540690.1_5'Flank|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q759*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1142*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1142					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q1142*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGGATCTATGCAGGGGCCCCA	0.527			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q1142X		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,NS,carcinoma,0,1	ARID1A	842	.	1	Substitution - Nonsense(1)	liver(1)	c.C3424T						.						77.0	75.0	76.0					1																	27099008		2203	4300	6503	SO:0001587	stop_gained	8289	exon13			TCTATGCAGGGGC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3424C>T	chr1.hg19:g.27099008C>T	ENSP00000320485:p.Gln1142*	207.0	0.0		248.0	45.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.328846|9.328846	0.99138|0.99138	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000457599;ENST00000374152	.|.	.|.	.|.	5.16|5.16	5.16|5.16	0.70880|0.70880	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.74786|.	0.3762|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.73180|.	-0.4064|.	4|.	.|0.40728	.|T	.|0.16	-6.7363|-6.7363	18.8418|18.8418	0.92188|0.92188	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	39|1142;1142;759	.|.	.|ENSP00000320485:Q1142X	A|Q	+|+	2|1	0|0	ARID1A|ARID1A	26971595|26971595	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.320000|7.320000	0.79064|0.79064	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	GCA|CAG	.	.		0.527	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
GNL2	29889	hgsc.bcm.edu	37	1	38034740	38034740	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:38034740G>T	ENST00000373062.3	-	13	1678	c.1580C>A	c.(1579-1581)aCa>aAa	p.T527K	GNL2_ENST00000462812.1_5'UTR	NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	527					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				CCGAACTCGTGTGAGAATCTG	0.473																																					p.T527K		Atlas-SNP	.											.	GNL2	58	.	0			c.C1580A						.						169.0	154.0	159.0					1																	38034740		2203	4300	6503	SO:0001583	missense	29889	exon13			ACTCGTGTGAGAA	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1580C>A	chr1.hg19:g.38034740G>T	ENSP00000362153:p.Thr527Lys	344.0	0.0		369.0	15.0	NM_013285	Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	hg19	CCDS421.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.773041	0.31411	.	.	ENSG00000134697	ENST00000373062	T	0.20881	2.04	6.17	6.17	0.99709	.	0.311804	0.39407	N	0.001367	T	0.10809	0.0264	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22452	-1.0216	10	0.05959	T	0.93	-11.4385	20.8794	0.99867	0.0:0.0:1.0:0.0	.	527	Q13823	NOG2_HUMAN	K	527	ENSP00000362153:T527K	ENSP00000362153:T527K	T	-	2	0	GNL2	37807327	0.997000	0.39634	0.152000	0.22495	0.952000	0.60782	7.722000	0.84778	2.941000	0.99782	0.655000	0.94253	ACA	.	.		0.473	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	
PTPRF	5792	hgsc.bcm.edu	37	1	44069658	44069658	+	Silent	SNP	C	C	T	rs368237069		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:44069658C>T	ENST00000359947.4	+	16	3175	c.2835C>T	c.(2833-2835)aaC>aaT	p.N945N	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372413.3_Silent_p.N936N|PTPRF_ENST00000372414.3_Silent_p.N945N|PTPRF_ENST00000422171.2_Silent_p.N293N|PTPRF_ENST00000438120.1_Silent_p.N936N	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	945	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGGAGAGGAACGGGCGCATCA	0.597																																					p.N945N		Atlas-SNP	.											.	PTPRF	172	.	0			c.C2835T						.	C	,	0,4406		0,0,2203	87.0	73.0	78.0		2835,2808	-3.5	0.6	1		78	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PTPRF	NM_002840.3,NM_130440.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	945/1908,936/1899	44069658	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5792	exon16			GAGGAACGGGCGC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2835C>T	chr1.hg19:g.44069658C>T		117.0	0.0		119.0	28.0	NM_002840	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Silent	SNP	ENST00000359947.4	hg19	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.152|0.152	-1.090406|-1.090406	0.01873|0.01873	0.0|0.0	1.16E-4|1.16E-4	ENSG00000142949|ENSG00000142949	ENST00000414879|ENST00000429895	.|.	.|.	.|.	5.19|5.19	-3.5|-3.5	0.04710|0.04710	.|.	.|.	.|.	.|.	.|.	T|T	0.65923|0.65923	0.2738|0.2738	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.62742|0.62742	-0.6790|-0.6790	4|4	.|.	.|.	.|.	.|.	16.0217|16.0217	0.80503|0.80503	0.0:0.402:0.0:0.598|0.0:0.402:0.0:0.598	.|.	.|.	.|.	.|.	W|M	359|591	.|.	.|.	R|T	+|+	1|2	2|0	PTPRF|PTPRF	43842245|43842245	0.004000|0.004000	0.15560|0.15560	0.636000|0.636000	0.29352|0.29352	0.179000|0.179000	0.23085|0.23085	-1.164000|-1.164000	0.03135|0.03135	-1.372000|-1.372000	0.02137|0.02137	-2.048000|-2.048000	0.00412|0.00412	CGG|ACG	.	.		0.597	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019710.1		
SH3GLB1	51100	hgsc.bcm.edu	37	1	87189994	87189994	+	Splice_Site	SNP	A	A	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:87189994A>G	ENST00000370558.4	+	5	801		c.e5-1		SH3GLB1_ENST00000482504.1_Splice_Site|SH3GLB1_ENST00000535010.1_Splice_Site	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1						'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		CTATATTTATAGAAAGAAAGG	0.299																																					.		Atlas-SNP	.											.	SH3GLB1	57	.	0			c.178-2A>G						.						14.0	17.0	16.0					1																	87189994		2163	4260	6423	SO:0001630	splice_region_variant	51100	exon4			ATTTATAGAAAGA	AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.478-1A>G	chr1.hg19:g.87189994A>G		254.0	0.0		452.0	93.0	NM_001206653	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Splice_Site	SNP	ENST00000370558.4	hg19	CCDS710.1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.355713	0.61293	.	.	ENSG00000097033	ENST00000212369;ENST00000535010;ENST00000482504	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7857	0.78300	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SH3GLB1	86962582	1.000000	0.71417	0.996000	0.52242	0.645000	0.38454	8.618000	0.90932	2.142000	0.66516	0.528000	0.53228	.	.	.		0.299	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028287.2	NM_016009	Intron
LCE1C	353133	hgsc.bcm.edu	37	1	152777757	152777757	+	Silent	SNP	T	T	A	rs565723067		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:152777757T>A	ENST00000607093.1	-	1	197	c.198A>T	c.(196-198)ggA>ggT	p.G66G	LCE1C_ENST00000368768.1_Silent_p.G66G			Q5T751	LCE1C_HUMAN	late cornified envelope 1C	66	Gly-rich.				keratinization (GO:0031424)					NS(1)|lung(4)|prostate(1)|skin(2)|urinary_tract(1)	9	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AACTGCAGCATCCCCCAGAGC	0.672													G|||	1	0.000199681	0.0	0.0	5008	,	,		13167	0.001		0.0	False		,,,				2504	0.0				p.G66G		Atlas-SNP	.											LCE1C,NS,carcinoma,0,3	LCE1C	40	.	0			c.A198T						.						41.0	47.0	45.0					1																	152777757		2203	4300	6503	SO:0001819	synonymous_variant	353133	exon2			GCAGCATCCCCCA		CCDS1026.1	1q21.3	2008-02-05			ENSG00000197084	ENSG00000197084		"""Late cornified envelopes"""	29464	protein-coding gene	gene with protein product		612605				11698679	Standard	NM_001276331		Approved	LEP3	uc001fap.1	Q5T751	OTTHUMG00000012445	ENST00000607093.1:c.198A>T	chr1.hg19:g.152777757T>A		182.0	1.0		150.0	19.0	NM_178351		Silent	SNP	ENST00000607093.1	hg19	CCDS1026.1																																																																																			.	.		0.672	LCE1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034658.2	NM_178351	
OR6Y1	391112	hgsc.bcm.edu	37	1	158517119	158517119	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:158517119C>A	ENST00000302617.3	-	1	776	c.777G>T	c.(775-777)atG>atT	p.M259I		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					TGAAAAGTGTCATGGAATAGA	0.502																																					p.M259I		Atlas-SNP	.											.	OR6Y1	73	.	0			c.G777T						.						196.0	187.0	190.0					1																	158517119		2203	4300	6503	SO:0001583	missense	391112	exon1			AAGTGTCATGGAA	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.777G>T	chr1.hg19:g.158517119C>A	ENSP00000304807:p.Met259Ile	146.0	0.0		184.0	32.0	NM_001005189	Q6IFS0	Missense_Mutation	SNP	ENST00000302617.3	hg19	CCDS30899.1	.	.	.	.	.	.	.	.	.	.	C	10.53	1.376146	0.24857	.	.	ENSG00000197532	ENST00000302617	T	0.00076	8.76	5.34	-10.7	0.00240	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000575	T	0.00012	0.0000	N	0.04355	-0.22	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.54589	-0.8271	10	0.87932	D	0	.	2.1765	0.03864	0.1944:0.2246:0.4023:0.1787	.	259	Q8NGX8	OR6Y1_HUMAN	I	259	ENSP00000304807:M259I	ENSP00000304807:M259I	M	-	3	0	OR6Y1	156783743	0.000000	0.05858	0.015000	0.15790	0.929000	0.56500	-3.880000	0.00343	-3.438000	0.00163	-0.238000	0.12139	ATG	.	.		0.502	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189	
ATP1A2	477	hgsc.bcm.edu	37	1	160104352	160104352	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:160104352G>T	ENST00000361216.3	+	14	1995	c.1906G>T	c.(1906-1908)Gag>Tag	p.E636*	ATP1A2_ENST00000392233.3_Nonsense_Mutation_p.E636*	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	636					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			AGAGGGTAACGAGACTGTGGA	0.557																																					p.E636X		Atlas-SNP	.											.	ATP1A2	167	.	0			c.G1906T						.						149.0	121.0	130.0					1																	160104352		2203	4300	6503	SO:0001587	stop_gained	477	exon14			GGTAACGAGACTG	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1906G>T	chr1.hg19:g.160104352G>T	ENSP00000354490:p.Glu636*	196.0	0.0		223.0	11.0	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Nonsense_Mutation	SNP	ENST00000361216.3	hg19	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	G	38	6.723119	0.97788	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866	.	.	.	5.0	5.0	0.66597	.	0.103551	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	17.4432	0.87570	0.0:0.0:1.0:0.0	.	.	.	.	X	636;636;339	.	ENSP00000354490:E636X	E	+	1	0	ATP1A2	158370976	1.000000	0.71417	0.985000	0.45067	0.366000	0.29705	9.813000	0.99286	2.467000	0.83353	0.561000	0.74099	GAG	.	.		0.557	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
SLC9C2	284525	hgsc.bcm.edu	37	1	173570862	173570863	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:173570862_173570863GC>TT	ENST00000367714.3	-	2	475_476	c.53_54GC>AA	c.(52-54)tGC>tAA	p.C18*	SLC9C2_ENST00000536496.1_Intron|RP3-436N22.3_ENST00000431459.1_RNA	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	18					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										CTGGCTGCCCGCAGAGTAAATC	0.426																																					p.C18X|p.C18Y		Atlas-SNP	.											.	.	.	.	0			c.C54A|c.G53A						.																																			SO:0001587	stop_gained	284525	exon2			CTGCCCGCAGAGT|TGCCCGCAGAGTA	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.53_54delinsTT	chr1.hg19:g.173570862_173570863delinsTT	ENSP00000356687:p.Cys18*	305.0|302.0	0.0		425.0|429.0	66.0|69.0	NM_178527	Q86UF3	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000367714.3	hg19	CCDS1308.1																																																																																			.	.		0.426	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
BRINP2	57795	hgsc.bcm.edu	37	1	177250229	177250229	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:177250229T>A	ENST00000361539.4	+	8	2229	c.1917T>A	c.(1915-1917)ttT>ttA	p.F639L	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	639					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											AGACTTTCTTTGAGACAGTTC	0.498																																					p.F639L		Atlas-SNP	.											.	FAM5B	191	.	0			c.T1917A						.						63.0	63.0	63.0					1																	177250229		2203	4300	6503	SO:0001583	missense	57795	exon8			TTTCTTTGAGACA		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1917T>A	chr1.hg19:g.177250229T>A	ENSP00000354481:p.Phe639Leu	177.0	0.0		259.0	41.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	hg19	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	T	18.81	3.703514	0.68501	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.18338	2.22	5.16	1.63	0.23807	.	0.000000	0.85682	D	0.000000	T	0.35189	0.0923	M	0.69823	2.125	0.58432	D	0.999991	D;D	0.76494	0.999;0.993	D;D	0.80764	0.994;0.956	T	0.04347	-1.0958	10	0.72032	D	0.01	-12.2269	8.3636	0.32374	0.0:0.233:0.0:0.767	.	534;639	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	L	392;639	ENSP00000354481:F639L	ENSP00000354481:F639L	F	+	3	2	FAM5B	175516852	0.989000	0.36119	1.000000	0.80357	0.983000	0.72400	0.180000	0.16860	0.304000	0.22809	0.260000	0.18958	TTT	.	.		0.498	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
SERTAD4	56256	hgsc.bcm.edu	37	1	210415122	210415122	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:210415122C>G	ENST00000367012.3	+	4	741	c.511C>G	c.(511-513)Cct>Gct	p.P171A	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	171						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		TCAAGACTGCCCTTACCGAAA	0.473																																					p.P171A		Atlas-SNP	.											.	SERTAD4	53	.	0			c.C511G						.						185.0	189.0	188.0					1																	210415122		2203	4300	6503	SO:0001583	missense	56256	exon4			GACTGCCCTTACC	BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.511C>G	chr1.hg19:g.210415122C>G	ENSP00000355979:p.Pro171Ala	138.0	0.0		200.0	30.0	NM_019605	B2RD32	Missense_Mutation	SNP	ENST00000367012.3	hg19	CCDS1494.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315944	0.60524	.	.	ENSG00000082497	ENST00000367012	.	.	.	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000001	T	0.68238	0.2979	L	0.29908	0.895	0.43230	D	0.995122	D	0.76494	0.999	D	0.78314	0.991	T	0.70139	-0.4954	9	0.66056	D	0.02	-20.4626	19.861	0.96785	0.0:1.0:0.0:0.0	.	171	Q9NUC0	SRTD4_HUMAN	A	171	.	ENSP00000355979:P171A	P	+	1	0	SERTAD4	208481745	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	5.884000	0.69729	2.767000	0.95098	0.655000	0.94253	CCT	.	.		0.473	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088577.1	NM_019605	
SMYD2	56950	hgsc.bcm.edu	37	1	214501025	214501025	+	Silent	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:214501025G>T	ENST00000366957.5	+	7	685	c.663G>T	c.(661-663)ctG>ctT	p.L221L	SMYD2_ENST00000415093.2_Silent_p.L221L|SMYD2_ENST00000491455.1_3'UTR	NM_020197.2	NP_064582.2	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	221	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|RNA polymerase II core binding (GO:0000993)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		AAGGGACCCTGGCAGAAGTCA	0.483											OREG0004276	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L221L		Atlas-SNP	.											.	SMYD2	40	.	0			c.G663T						.						114.0	114.0	114.0					1																	214501025		2203	4300	6503	SO:0001819	synonymous_variant	56950	exon7			GACCCTGGCAGAA	AF226053	CCDS31022.1	1q32.3	2011-07-01			ENSG00000143499	ENSG00000143499		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20982	protein-coding gene	gene with protein product		610663					Standard	NM_020197		Approved	HSKM-B, ZMYND14, KMT3C	uc021pix.1	Q9NRG4	OTTHUMG00000037066	ENST00000366957.5:c.663G>T	chr1.hg19:g.214501025G>T		149.0	0.0	2221	187.0	65.0	NM_020197	B2R9P9|I6L9H7|Q4V765|Q5VSH9|Q96AI4	Silent	SNP	ENST00000366957.5	hg19	CCDS31022.1																																																																																			.	.		0.483	SMYD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089998.1	NM_020197	
OBSCN	84033	hgsc.bcm.edu	37	1	228465514	228465514	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:228465514T>C	ENST00000422127.1	+	25	6858	c.6814T>C	c.(6814-6816)Ttt>Ctt	p.F2272L	RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000284548.11_Missense_Mutation_p.F2272L|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000359599.6_Missense_Mutation_p.F1119L|OBSCN_ENST00000570156.2_Missense_Mutation_p.F2701L|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2272					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGAGATCCAATTTGTAGCCGA	0.612																																					p.F2701L		Atlas-SNP	.											.	OBSCN	2142	.	0			c.T8101C						.						69.0	71.0	70.0					1																	228465514		1923	4133	6056	SO:0001583	missense	84033	exon30			ATCCAATTTGTAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.6814T>C	chr1.hg19:g.228465514T>C	ENSP00000409493:p.Phe2272Leu	230.0	0.0		328.0	34.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.502149	0.44455	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.63580	0.35;-0.05;0.09	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000001	T	0.77212	0.4097	M	0.83384	2.64	0.80722	D	1	D;D	0.76494	0.986;0.999	D;D	0.85130	0.965;0.997	T	0.76044	-0.3103	10	0.13470	T	0.59	.	13.406	0.60913	0.0:0.0:0.0:1.0	.	2272;2272	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	L	2272;2272;1119	ENSP00000284548:F2272L;ENSP00000409493:F2272L;ENSP00000352613:F1119L	ENSP00000284548:F2272L	F	+	1	0	OBSCN	226532137	1.000000	0.71417	0.857000	0.33713	0.127000	0.20565	5.395000	0.66291	1.754000	0.51921	0.379000	0.24179	TTT	.	.		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
CAPN9	10753	hgsc.bcm.edu	37	1	230914798	230914798	+	Missense_Mutation	SNP	G	G	A	rs145648359	byFrequency	TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:230914798G>A	ENST00000271971.2	+	9	1146	c.1033G>A	c.(1033-1035)Gcg>Acg	p.A345T	CAPN9_ENST00000354537.1_Missense_Mutation_p.A319T|RP11-99J16__A.2_ENST00000412344.1_RNA|RP11-99J16__A.2_ENST00000428480.1_RNA|RP11-99J16__A.2_ENST00000452640.1_RNA|CAPN9_ENST00000366666.2_Missense_Mutation_p.A282T	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	345	Domain III.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.A319T(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				GGAGGAAGACGCGATCCACAA	0.577													G|||	7	0.00139776	0.0	0.0	5008	,	,		16239	0.0		0.0	False		,,,				2504	0.0072				p.A345T		Atlas-SNP	.											CAPN9,colon,carcinoma,0,1	CAPN9	116	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1033A						.	G	THR/ALA,THR/ALA	4,4402	8.1+/-20.4	0,4,2199	84.0	71.0	75.0		1033,955	-2.6	0.0	1	dbSNP_134	75	0,8600		0,0,4300	yes	missense,missense	CAPN9	NM_006615.2,NM_016452.1	58,58	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	benign,benign	345/691,319/665	230914798	4,13002	2203	4300	6503	SO:0001583	missense	10753	exon9			GAAGACGCGATCC	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1033G>A	chr1.hg19:g.230914798G>A	ENSP00000271971:p.Ala345Thr	85.0	1.0		116.0	24.0	NM_006615	B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	ENST00000271971.2	hg19	CCDS1586.1	.	.	.	.	.	.	.	.	.	.	G	0.678	-0.799307	0.02841	9.08E-4	0.0	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	T;T;T	0.15952	2.38;2.38;2.38	5.24	-2.63	0.06133	Peptidase C2, calpain, catalytic domain (1);	0.446021	0.27455	N	0.019297	T	0.06600	0.0169	N	0.10733	0.035	0.22620	N	0.998922	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.08055	0.002;0.003;0.001	T	0.40403	-0.9565	10	0.11485	T	0.65	.	11.9229	0.52801	0.5965:0.0:0.4035:0.0	.	282;319;345	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	T	345;319;282	ENSP00000271971:A345T;ENSP00000346538:A319T;ENSP00000355626:A282T	ENSP00000271971:A345T	A	+	1	0	CAPN9	228981421	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	0.274000	0.18680	-0.278000	0.09180	-0.244000	0.11960	GCG	.	G|1.000;A|0.000		0.577	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	
OR2L13	284521	hgsc.bcm.edu	37	1	248263522	248263522	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:248263522C>A	ENST00000358120.2	+	2	990	c.845C>A	c.(844-846)cCc>cAc	p.P282H	OR2L13_ENST00000366478.2_Missense_Mutation_p.P282H			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			ATCCTTACCCCCATGCTCAAT	0.468																																					p.P282H		Atlas-SNP	.											.	OR2L13	261	.	0			c.C845A						.						78.0	79.0	79.0					1																	248263522		2203	4300	6503	SO:0001583	missense	284521	exon3			TTACCCCCATGCT	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.845C>A	chr1.hg19:g.248263522C>A	ENSP00000350836:p.Pro282His	113.0	0.0		181.0	25.0	NM_175911	Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	hg19	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239329	0.58995	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.00349	7.99;7.99	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000472	T	0.01592	0.0051	H	0.98682	4.3	0.32703	N	0.512541	D	0.89917	1.0	D	0.69479	0.964	T	0.02610	-1.1134	10	0.87932	D	0	.	15.4907	0.75602	0.0:1.0:0.0:0.0	.	282	Q8N349	OR2LD_HUMAN	H	282	ENSP00000355434:P282H;ENSP00000350836:P282H	ENSP00000350836:P282H	P	+	2	0	OR2L13	246330145	0.543000	0.26434	1.000000	0.80357	0.604000	0.37047	4.213000	0.58520	2.138000	0.66242	0.650000	0.86243	CCC	.	.		0.468	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
PXDN	7837	hgsc.bcm.edu	37	2	1664717	1664717	+	Silent	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:1664717G>T	ENST00000252804.4	-	14	1823	c.1773C>A	c.(1771-1773)cgC>cgA	p.R591R		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	591	Ig-like C2-type 4.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CACACTCATAGCGACCTGCGT	0.537																																					p.R591R		Atlas-SNP	.											.	PXDN	255	.	0			c.C1773A						.						96.0	100.0	99.0					2																	1664717		2050	4187	6237	SO:0001819	synonymous_variant	7837	exon14			CTCATAGCGACCT	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1773C>A	chr2.hg19:g.1664717G>T		74.0	0.0		98.0	12.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	hg19	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	G	1.380	-0.583679	0.03827	.	.	ENSG00000130508	ENST00000433670	.	.	.	5.05	0.832	0.18867	.	.	.	.	.	T	0.50854	0.1640	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37244	-0.9714	4	.	.	.	-29.5186	4.9067	0.13802	0.2737:0.0:0.4738:0.2525	.	.	.	.	D	587	.	.	A	-	2	0	PXDN	1643724	0.997000	0.39634	0.998000	0.56505	0.031000	0.12232	0.331000	0.19733	0.249000	0.21456	0.591000	0.81541	GCT	.	.		0.537	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
LTBP1	4052	hgsc.bcm.edu	37	2	33174004	33174004	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:33174004G>C	ENST00000404816.2	+	2	910	c.557G>C	c.(556-558)tGc>tCc	p.C186S	LTBP1_ENST00000354476.3_Missense_Mutation_p.C186S			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	186					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TCCCAGAGGTGCACCAAACGT	0.572																																					p.C186S		Atlas-SNP	.											.	LTBP1	317	.	0			c.G557C						.						150.0	125.0	134.0					2																	33174004		2203	4300	6503	SO:0001583	missense	4052	exon2			AGAGGTGCACCAA		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.557G>C	chr2.hg19:g.33174004G>C	ENSP00000386043:p.Cys186Ser	144.0	0.0		189.0	38.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	hg19	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333177	0.81801	.	.	ENSG00000049323	ENST00000404816;ENST00000354476	D;D	0.91011	-2.76;-2.77	5.7	5.7	0.88788	.	.	.	.	.	D	0.92008	0.7468	N	0.24115	0.695	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	D	0.93154	0.6552	9	0.87932	D	0	.	17.6293	0.88102	0.0:0.0:1.0:0.0	.	186	Q14766-4	.	S	186	ENSP00000386043:C186S;ENSP00000346467:C186S	ENSP00000346467:C186S	C	+	2	0	LTBP1	33027508	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.282000	0.78630	2.683000	0.91414	0.655000	0.94253	TGC	.	.		0.572	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
ARHGEF33	100271715	hgsc.bcm.edu	37	2	39158314	39158314	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:39158314C>T	ENST00000536934.1	+	5	512	c.427C>T	c.(427-429)Cgt>Tgt	p.R143C	ARHGEF33_ENST00000409978.1_Missense_Mutation_p.R143C|ARHGEF33_ENST00000398800.4_Missense_Mutation_p.R143C			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	143							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						AAGTCCTTTTCGTTCTATCAA	0.458																																					p.R143C		Atlas-SNP	.											.	ARHGEF33	34	.	0			c.C427T						.						126.0	111.0	115.0					2																	39158314		692	1591	2283	SO:0001583	missense	100271715	exon5			CCTTTTCGTTCTA		CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.427C>T	chr2.hg19:g.39158314C>T	ENSP00000445586:p.Arg143Cys	174.0	0.0		232.0	38.0	NM_001145451	J3KPX2	Missense_Mutation	SNP	ENST00000536934.1	hg19		.	.	.	.	.	.	.	.	.	.	C	24.0	4.482513	0.84747	.	.	ENSG00000214694	ENST00000409978;ENST00000398800;ENST00000536934	T;T;T	0.51071	0.73;0.73;0.72	5.66	5.66	0.87406	.	0.118580	0.34133	U	0.004235	T	0.56963	0.2021	N	0.24115	0.695	0.48087	D	0.999582	D	0.89917	1.0	D	0.75020	0.985	T	0.60855	-0.7180	10	0.72032	D	0.01	-16.7288	17.9307	0.88996	0.0:1.0:0.0:0.0	.	143	A8MVX0	ARG33_HUMAN	C	143	ENSP00000387020:R143C;ENSP00000381780:R143C;ENSP00000445586:R143C	ENSP00000381780:R143C	R	+	1	0	ARHGEF33	39011818	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	4.549000	0.60726	2.654000	0.90174	0.650000	0.86243	CGT	.	.		0.458	ARHGEF33-202	KNOWN	basic	protein_coding	protein_coding		NM_001145451	
BCL11A	53335	hgsc.bcm.edu	37	2	60688381	60688381	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:60688381G>T	ENST00000335712.6	-	4	1893	c.1666C>A	c.(1666-1668)Cag>Aag	p.Q556K	BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.Q522K|BCL11A_ENST00000358510.4_Missense_Mutation_p.Q522K|BCL11A_ENST00000537768.1_Missense_Mutation_p.Q225K|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Missense_Mutation_p.Q556K	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	556					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CTGAAGTGCTGCATGGAGCTG	0.697			T	IGH@	B-CLL																																p.Q556K		Atlas-SNP	.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A	298	.	0			c.C1666A						.						24.0	23.0	23.0					2																	60688381		2200	4291	6491	SO:0001583	missense	53335	exon4			AGTGCTGCATGGA	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1666C>A	chr2.hg19:g.60688381G>T	ENSP00000338774:p.Gln556Lys	73.0	0.0		58.0	9.0	NM_018014	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	hg19	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018947	0.35606	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.08370	3.1;3.37;3.24;3.4;3.31	5.69	5.69	0.88448	.	0.198852	0.34628	N	0.003804	T	0.11281	0.0275	L	0.58101	1.795	0.80722	D	1	P;B;B;B;P	0.37914	0.554;0.139;0.058;0.01;0.611	B;B;B;B;B	0.30646	0.107;0.038;0.037;0.004;0.118	T	0.05632	-1.0873	10	0.35671	T	0.21	-3.0658	19.4143	0.94688	0.0:0.0:1.0:0.0	.	522;225;522;556;556	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	K	556;581;522;225;556;522	ENSP00000349300:Q556K;ENSP00000438303:Q522K;ENSP00000443712:Q225K;ENSP00000338774:Q556K;ENSP00000351307:Q522K	ENSP00000338774:Q556K	Q	-	1	0	BCL11A	60541885	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.863000	0.87023	2.690000	0.91761	0.555000	0.69702	CAG	.	.		0.697	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
PROM2	150696	hgsc.bcm.edu	37	2	95952937	95952937	+	Silent	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:95952937C>T	ENST00000317620.9	+	19	2284	c.2151C>T	c.(2149-2151)gcC>gcT	p.A717A	PROM2_ENST00000403131.2_Silent_p.A717A|PROM2_ENST00000317668.4_Silent_p.A717A|PROM2_ENST00000542147.1_Silent_p.A668A	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	717					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						AGCTGCCTGCCTGGGCAGCCA	0.602																																					p.A717A		Atlas-SNP	.											.	PROM2	78	.	0			c.C2151T						.						55.0	54.0	54.0					2																	95952937		2203	4300	6503	SO:0001819	synonymous_variant	150696	exon19			GCCTGCCTGGGCA	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.2151C>T	chr2.hg19:g.95952937C>T		85.0	0.0		100.0	23.0	NM_001165977	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Silent	SNP	ENST00000317620.9	hg19	CCDS2012.1																																																																																			.	.		0.602	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
CCDC93	54520	hgsc.bcm.edu	37	2	118716046	118716046	+	Silent	SNP	T	T	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:118716046T>G	ENST00000376300.2	-	12	1037	c.900A>C	c.(898-900)ctA>ctC	p.L300L	CCDC93_ENST00000460781.1_5'UTR|CCDC93_ENST00000319432.5_Silent_p.L299L	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	300										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						CTTCAGCTGATAGCTCAGACT	0.433																																					p.L300L		Atlas-SNP	.											.	CCDC93	70	.	0			c.A900C						.						107.0	97.0	100.0					2																	118716046		2203	4300	6503	SO:0001819	synonymous_variant	54520	exon12			AGCTGATAGCTCA	BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.900A>C	chr2.hg19:g.118716046T>G		282.0	0.0		365.0	73.0	NM_019044	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Silent	SNP	ENST00000376300.2	hg19	CCDS2121.2																																																																																			.	.		0.433	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1	NM_019044	
MBD5	55777	hgsc.bcm.edu	37	2	149247524	149247524	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:149247524C>A	ENST00000407073.1	+	12	4621	c.3624C>A	c.(3622-3624)aaC>aaA	p.N1208K	MBD5_ENST00000404807.1_Missense_Mutation_p.N1441K	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1208					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GGGAGCGAAACAGGTGGAAGT	0.478																																					p.N1208K		Atlas-SNP	.											.	MBD5	164	.	0			c.C3624A						.						112.0	108.0	109.0					2																	149247524		2203	4300	6503	SO:0001583	missense	55777	exon12			GCGAAACAGGTGG	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3624C>A	chr2.hg19:g.149247524C>A	ENSP00000386049:p.Asn1208Lys	107.0	0.0		109.0	11.0	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	hg19	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.878778	0.33162	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.49139	0.83;0.79	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000001	T	0.33876	0.0878	N	0.14661	0.345	0.34009	D	0.651207	B;B	0.27732	0.187;0.11	B;B	0.25140	0.058;0.04	T	0.47623	-0.9103	10	0.62326	D	0.03	-7.5334	15.6336	0.76933	0.0:0.9327:0.0:0.0673	.	1441;1208	E9PHH0;Q9P267	.;MBD5_HUMAN	K	1208;1441	ENSP00000386049:N1208K;ENSP00000384672:N1441K	ENSP00000384672:N1441K	N	+	3	2	MBD5	148963994	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.163000	0.31798	2.860000	0.98153	0.655000	0.94253	AAC	.	.		0.478	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
SLC25A12	8604	hgsc.bcm.edu	37	2	172749745	172749745	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:172749745A>T	ENST00000422440.2	-	2	73	c.36T>A	c.(34-36)gaT>gaA	p.D12E	SLC25A12_ENST00000472748.1_5'UTR|SLC25A12_ENST00000392592.4_5'UTR	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	12					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	ACTCATGAGGATCCCCTCGCT	0.378																																					p.D12E		Atlas-SNP	.											.	SLC25A12	59	.	0			c.T36A						.						138.0	135.0	136.0					2																	172749745		2203	4300	6503	SO:0001583	missense	8604	exon2			ATGAGGATCCCCT	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.36T>A	chr2.hg19:g.172749745A>T	ENSP00000388658:p.Asp12Glu	264.0	0.0		333.0	56.0	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	hg19	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.433694	0.43224	.	.	ENSG00000115840	ENST00000422440	D	0.87179	-2.22	5.48	3.01	0.34805	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.85932	0.5812	M	0.82323	2.585	0.80722	D	1	B	0.15141	0.012	B	0.15484	0.013	T	0.80500	-0.1355	10	0.66056	D	0.02	-14.2562	7.4461	0.27211	0.8246:0.0:0.1754:0.0	.	12	O75746	CMC1_HUMAN	E	12	ENSP00000388658:D12E	ENSP00000263812:D12E	D	-	3	2	SLC25A12	172457991	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.646000	0.37249	0.347000	0.23924	0.533000	0.62120	GAT	.	.		0.378	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
RAPH1	65059	hgsc.bcm.edu	37	2	204354662	204354662	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:204354662T>C	ENST00000319170.5	-	4	676	c.377A>G	c.(376-378)cAt>cGt	p.H126R	RAPH1_ENST00000418114.1_Missense_Mutation_p.H126R|RAPH1_ENST00000419464.1_Missense_Mutation_p.H126R|RAPH1_ENST00000453034.1_Missense_Mutation_p.H126R|RAPH1_ENST00000374489.2_Missense_Mutation_p.H126R|RAPH1_ENST00000457812.1_Missense_Mutation_p.H126R|RAPH1_ENST00000423104.1_Missense_Mutation_p.H126R|RAPH1_ENST00000374488.2_Missense_Mutation_p.H126R|RAPH1_ENST00000308091.4_Missense_Mutation_p.H126R|RAPH1_ENST00000374493.3_Missense_Mutation_p.H126R|RAPH1_ENST00000439222.1_Missense_Mutation_p.H126R	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	126					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTCAATGTATGTCGGCTAAC	0.448																																					p.H126R		Atlas-SNP	.											.	RAPH1	118	.	0			c.A377G						.						244.0	233.0	237.0					2																	204354662		2203	4300	6503	SO:0001583	missense	65059	exon4			AATGTATGTCGGC	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.377A>G	chr2.hg19:g.204354662T>C	ENSP00000316543:p.His126Arg	433.0	0.0		569.0	34.0	NM_213589	Q96Q37|Q9C0I2	Missense_Mutation	SNP	ENST00000319170.5	hg19	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	T	1.353	-0.590863	0.03799	.	.	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201;ENST00000428637	T;T;T;T;T;T;T;T;T;T;T	0.41758	1.01;1.01;1.0;1.02;1.02;0.99;1.02;1.01;1.02;0.99;1.01	5.51	5.51	0.81932	.	0.144549	0.32015	N	0.006717	T	0.21427	0.0516	N	0.14661	0.345	0.24486	N	0.994321	B;B;B	0.20671	0.0;0.008;0.047	B;B;B	0.19148	0.001;0.007;0.024	T	0.18745	-1.0327	10	0.13108	T	0.6	-10.9074	6.1481	0.20296	0.2423:0.0:0.1499:0.6078	.	126;126;126	Q70E73-6;C9K0J5;Q70E73	.;.;RAPH1_HUMAN	R	126	ENSP00000392854:H126R;ENSP00000316543:H126R;ENSP00000363617:H126R;ENSP00000363613:H126R;ENSP00000363612:H126R;ENSP00000311293:H126R;ENSP00000411138:H126R;ENSP00000390578:H126R;ENSP00000397751:H126R;ENSP00000406662:H126R;ENSP00000396711:H126R	ENSP00000311293:H126R	H	-	2	0	RAPH1	204062907	0.976000	0.34144	0.903000	0.35520	0.280000	0.26924	2.211000	0.42825	2.074000	0.62210	0.528000	0.53228	CAT	.	.		0.448	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
CTNNB1	1499	hgsc.bcm.edu	37	3	41274899	41274899	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:41274899G>C	ENST00000349496.5	+	8	1429	c.1149G>C	c.(1147-1149)tgG>tgC	p.W383C	CTNNB1_ENST00000453024.1_Missense_Mutation_p.W376C|CTNNB1_ENST00000396185.3_Missense_Mutation_p.W383C|CTNNB1_ENST00000396183.3_Missense_Mutation_p.W383C|CTNNB1_ENST00000405570.1_Missense_Mutation_p.W383C	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	383					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.W383C(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTGTCTTTGGACTCTCAGGA	0.418		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.W383C	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,malignant_melanoma,0,2	CTNNB1	4904	.	1	Substitution - Missense(1)	liver(1)	c.G1149C						.						105.0	96.0	99.0					3																	41274899		2203	4300	6503	SO:0001583	missense	1499	exon8	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TCTTTGGACTCTC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1149G>C	chr3.hg19:g.41274899G>C	ENSP00000344456:p.Trp383Cys	194.0	0.0		260.0	56.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148323	0.78001	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88	5.72	5.72	0.89469	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85544	0.5721	M	0.76002	2.32	0.80722	D	1	P;D	0.57899	0.93;0.981	P;P	0.62435	0.558;0.902	D	0.85389	0.1124	10	0.52906	T	0.07	-7.7281	19.8737	0.96861	0.0:0.0:1.0:0.0	.	311;383	B4DSW9;P35222	.;CTNB1_HUMAN	C	383;383;383;376;383	ENSP00000385604:W383C;ENSP00000379486:W383C;ENSP00000344456:W383C;ENSP00000411226:W376C;ENSP00000379488:W383C	ENSP00000344456:W383C	W	+	3	0	CTNNB1	41249903	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.687000	0.91594	0.655000	0.94253	TGG	.	.		0.418	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CCDC13	152206	hgsc.bcm.edu	37	3	42787466	42787466	+	Silent	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:42787466C>A	ENST00000310232.6	-	7	857	c.774G>T	c.(772-774)tcG>tcT	p.S258S	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	258										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						AGGTCCCTGGCGAAGATAGGA	0.507																																					p.S258S		Atlas-SNP	.											CCDC13,colon,carcinoma,0,1	CCDC13	71	.	0			c.G774T						.						90.0	88.0	89.0					3																	42787466		2203	4300	6503	SO:0001819	synonymous_variant	152206	exon7			CCCTGGCGAAGAT	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.774G>T	chr3.hg19:g.42787466C>A		77.0	0.0		107.0	14.0	NM_144719		Silent	SNP	ENST00000310232.6	hg19	CCDS2705.1																																																																																			.	.		0.507	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
MAP4	4134	hgsc.bcm.edu	37	3	47957722	47957722	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:47957722T>G	ENST00000360240.6	-	7	2113	c.1595A>C	c.(1594-1596)aAg>aCg	p.K532T	MAP4_ENST00000395734.3_Missense_Mutation_p.K532T|MAP4_ENST00000426837.2_Missense_Mutation_p.K549T|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	532	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	ACATACGTTCTTGATGAGAAC	0.517																																					p.K532T		Atlas-SNP	.											.	MAP4	176	.	0			c.A1595C						.						136.0	124.0	128.0					3																	47957722		2203	4300	6503	SO:0001583	missense	4134	exon7			ACGTTCTTGATGA		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1595A>C	chr3.hg19:g.47957722T>G	ENSP00000353375:p.Lys532Thr	345.0	0.0		393.0	85.0	NM_001134364	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	ENST00000360240.6	hg19	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	T	13.28	2.191320	0.38707	.	.	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	T;T;T	0.08193	3.19;3.12;3.19	3.69	2.53	0.30540	.	.	.	.	.	T	0.23210	0.0561	M	0.75777	2.31	0.21553	N	0.999649	D;D;P	0.89917	0.969;1.0;0.862	P;D;P	0.91635	0.711;0.999;0.451	T	0.05321	-1.0892	9	0.46703	T	0.11	-2.7446	5.2803	0.15673	0.0:0.2304:0.0:0.7696	.	509;532;532	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	T	532;549;532	ENSP00000379083:K532T;ENSP00000407602:K549T;ENSP00000353375:K532T	ENSP00000353375:K532T	K	-	2	0	MAP4	47932726	0.005000	0.15991	0.014000	0.15608	0.286000	0.27126	0.842000	0.27627	0.774000	0.33427	0.460000	0.39030	AAG	.	.		0.517	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375	
DNAH12	201625	hgsc.bcm.edu	37	3	57438657	57438657	+	Silent	SNP	A	A	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:57438657A>G	ENST00000351747.2	-	25	3810	c.3630T>C	c.(3628-3630)aaT>aaC	p.N1210N		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1210	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TTACATTGCAATTAATGATAC	0.373																																					p.N1210N		Atlas-SNP	.											.	DNAH12	182	.	0			c.T3630C						.						170.0	166.0	167.0					3																	57438657		692	1591	2283	SO:0001819	synonymous_variant	201625	exon25			ATTGCAATTAATG	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.3630T>C	chr3.hg19:g.57438657A>G		112.0	0.0		134.0	30.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	ENST00000351747.2	hg19																																																																																				.	.		0.373	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
DNAH12	201625	hgsc.bcm.edu	37	3	57443514	57443514	+	Silent	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:57443514C>T	ENST00000351747.2	-	22	3381	c.3201G>A	c.(3199-3201)aaG>aaA	p.K1067K		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1067	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GAATGAGCCACTTTTCCACAG	0.498																																					p.K1067K		Atlas-SNP	.											.	DNAH12	182	.	0			c.G3201A						.						65.0	60.0	61.0					3																	57443514		692	1591	2283	SO:0001819	synonymous_variant	201625	exon22			GAGCCACTTTTCC	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.3201G>A	chr3.hg19:g.57443514C>T		127.0	0.0		175.0	42.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	ENST00000351747.2	hg19																																																																																				.	.		0.498	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64599095	64599095	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:64599095C>G	ENST00000498707.1	-	22	3622	c.3280G>C	c.(3280-3282)Gag>Cag	p.E1094Q	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.E1066Q	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1094	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		GGCTTGGTCTCAGGGTCACAC	0.488																																					p.E1094Q		Atlas-SNP	.											ADAMTS9,bladder,carcinoma,0,1	ADAMTS9	206	.	0			c.G3280C						.						109.0	105.0	106.0					3																	64599095		2203	4300	6503	SO:0001583	missense	56999	exon22			TGGTCTCAGGGTC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.3280G>C	chr3.hg19:g.64599095C>G	ENSP00000418735:p.Glu1094Gln	153.0	0.0		162.0	34.0	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	hg19	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581437	0.28180	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.55413	0.52;0.52	6.06	5.18	0.71444	.	0.186809	0.37623	N	0.002008	T	0.40979	0.1139	L	0.35644	1.08	0.80722	D	1	B;B;B	0.16166	0.007;0.016;0.015	B;B;B	0.19148	0.024;0.017;0.024	T	0.22556	-1.0213	10	0.14656	T	0.56	.	12.3259	0.55011	0.0:0.8147:0.1202:0.0651	.	1066;1094;1094	B7ZVX9;Q9P2N4-1;Q9P2N4	.;.;ATS9_HUMAN	Q	1066;1094	ENSP00000295903:E1066Q;ENSP00000418735:E1094Q	ENSP00000295903:E1066Q	E	-	1	0	ADAMTS9	64574135	0.978000	0.34361	0.978000	0.43139	0.918000	0.54935	2.148000	0.42235	1.529000	0.49120	0.655000	0.94253	GAG	.	.		0.488	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
GPR149	344758	hgsc.bcm.edu	37	3	154055824	154055824	+	Silent	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:154055824C>T	ENST00000389740.2	-	4	1959	c.1860G>A	c.(1858-1860)gaG>gaA	p.E620E		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	620					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TTTCAAGAACCTCCAAGTGTA	0.413																																					p.E620E		Atlas-SNP	.											.	GPR149	134	.	0			c.G1860A						.						101.0	95.0	97.0					3																	154055824		1873	4120	5993	SO:0001819	synonymous_variant	344758	exon4			AAGAACCTCCAAG	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1860G>A	chr3.hg19:g.154055824C>T		457.0	0.0		513.0	49.0	NM_001038705		Silent	SNP	ENST00000389740.2	hg19	CCDS43162.1																																																																																			.	.		0.413	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	
SLITRK3	22865	hgsc.bcm.edu	37	3	164906413	164906414	+	Missense_Mutation	DNP	CG	CG	TT	rs372406969|rs34531905		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:164906413_164906414CG>TT	ENST00000475390.1	-	2	2648_2649	c.2205_2206CG>AA	c.(2203-2208)ccCGtg>ccAAtg	p.V736M	SLITRK3_ENST00000241274.3_Missense_Mutation_p.V736M			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	736					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						ACATGACCCACGGGAGGGGCCT	0.569										HNSCC(40;0.11)																											p.V736M|p.P735P		Atlas-SNP	.											.	SLITRK3	263	.	0			c.G2206A|c.C2205A						.																																			SO:0001583	missense	22865	exon2			GACCCACGGGAGG|ACCCACGGGAGGG	AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2205_2206delinsTT	chr3.hg19:g.164906413_164906414delinsTT	ENSP00000420091:p.Val736Met	100.0	0.0		109.0|110.0	20.0	NM_014926	Q1RMY6	Missense_Mutation|Silent	SNP	ENST00000475390.1	hg19	CCDS3197.1																																																																																			.	.		0.569	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
PHC3	80012	hgsc.bcm.edu	37	3	169820663	169820663	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:169820663T>A	ENST00000494943.1	-	13	2560	c.2492A>T	c.(2491-2493)aAt>aTt	p.N831I	PHC3_ENST00000467570.1_Missense_Mutation_p.N790I|PHC3_ENST00000495893.2_Missense_Mutation_p.N843I			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	831					multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AAGACTTTGATTATCAGGCTT	0.398																																					p.N843I		Atlas-SNP	.											.	PHC3	113	.	0			c.A2528T						.						53.0	52.0	53.0					3																	169820663		1901	4103	6004	SO:0001583	missense	80012	exon13			CTTTGATTATCAG		CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.2492A>T	chr3.hg19:g.169820663T>A	ENSP00000420271:p.Asn831Ile	248.0	0.0		297.0	44.0	NM_024947	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	ENST00000494943.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.79|16.79	3.221259|3.221259	0.58560|0.58560	.|.	.|.	ENSG00000173889|ENSG00000173889	ENST00000484068|ENST00000494943;ENST00000495893;ENST00000467570	.|T;T	.|0.32988	.|1.43;1.43	5.47|5.47	4.32|4.32	0.51571|0.51571	.|.	.|0.249898	.|0.35349	.|N	.|0.003267	T|T	0.24160|0.24160	0.0585|0.0585	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	.|P;B;B	.|0.40794	.|0.729;0.031;0.318	.|B;B;B	.|0.39531	.|0.302;0.011;0.092	T|T	0.03103|0.03103	-1.1072|-1.1072	5|10	.|0.44086	.|T	.|0.13	-11.691|-11.691	6.117|6.117	0.20132|0.20132	0.0:0.306:0.0:0.694|0.0:0.306:0.0:0.694	.|.	.|790;831;843	.|E7EX82;Q8NDX5;Q8NDX5-7	.|.;PHC3_HUMAN;.	F|I	9|831;843;790	.|ENSP00000420271:N831I;ENSP00000420294:N843I	.|ENSP00000419089:N790I	I|N	-|-	1|2	0|0	PHC3|PHC3	171303357|171303357	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.813000|2.813000	0.48002|0.48002	0.925000|0.925000	0.37094|0.37094	0.528000|0.528000	0.53228|0.53228	ATC|AAT	.	.		0.398	PHC3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000352182.3	NM_024947	
SPATA16	83893	hgsc.bcm.edu	37	3	172835457	172835457	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:172835457A>C	ENST00000351008.3	-	2	248	c.65T>G	c.(64-66)gTt>gGt	p.V22G		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	22					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TATCTTTGGAACAAGCTGATC	0.443																																					p.V22G		Atlas-SNP	.											.	SPATA16	111	.	0			c.T65G						.						207.0	192.0	197.0					3																	172835457		2203	4300	6503	SO:0001583	missense	83893	exon2			TTTGGAACAAGCT	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.65T>G	chr3.hg19:g.172835457A>C	ENSP00000341765:p.Val22Gly	698.0	1.0		783.0	165.0	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	hg19	CCDS3221.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.031980	0.35893	.	.	ENSG00000144962	ENST00000351008	T	0.18960	2.18	5.55	3.23	0.37069	.	0.443465	0.19004	N	0.125255	T	0.10852	0.0265	N	0.24115	0.695	0.41590	D	0.988794	P	0.34724	0.465	B	0.28011	0.085	T	0.09997	-1.0649	10	0.87932	D	0	-5.6764	4.1813	0.10376	0.6402:0.1898:0.17:0.0	.	22	Q9BXB7	SPT16_HUMAN	G	22	ENSP00000341765:V22G	ENSP00000341765:V22G	V	-	2	0	SPATA16	174318151	0.000000	0.05858	1.000000	0.80357	0.909000	0.53808	0.514000	0.22786	2.096000	0.63516	0.528000	0.53228	GTT	.	.		0.443	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
RTP1	132112	hgsc.bcm.edu	37	3	186915400	186915400	+	Missense_Mutation	SNP	A	A	T	rs41469544		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:186915400A>T	ENST00000312295.4	+	1	127	c.97A>T	c.(97-99)Act>Tct	p.T33S	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	33					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		TTCCCTCACTACTGACGAGAC	0.527																																					p.T33S		Atlas-SNP	.											.	RTP1	51	.	0			c.A97T						.						142.0	137.0	138.0					3																	186915400		2203	4300	6503	SO:0001583	missense	132112	exon1			CTCACTACTGACG	BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.97A>T	chr3.hg19:g.186915400A>T	ENSP00000311712:p.Thr33Ser	244.0	0.0		255.0	46.0	NM_153708		Missense_Mutation	SNP	ENST00000312295.4	hg19	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	A	10.88	1.474956	0.26511	.	.	ENSG00000175077	ENST00000312295	T	0.14516	2.5	5.16	-2.65	0.06095	.	0.443969	0.21260	N	0.077491	T	0.03095	0.0091	N	0.00926	-1.1	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.45745	-0.9240	10	0.13853	T	0.58	.	8.8419	0.35146	0.2575:0.6046:0.0:0.1379	.	33	P59025	RTP1_HUMAN	S	33	ENSP00000311712:T33S	ENSP00000311712:T33S	T	+	1	0	RTP1	188398094	0.001000	0.12720	0.661000	0.29709	0.716000	0.41182	-1.007000	0.03667	-0.161000	0.10983	0.533000	0.62120	ACT	.	.		0.527	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708	
MB21D2	151963	hgsc.bcm.edu	37	3	192516896	192516896	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr3:192516896A>T	ENST00000392452.2	-	2	1075	c.755T>A	c.(754-756)cTc>cAc	p.L252H		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	252							protein complex binding (GO:0032403)			endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						GTTCTCCATGAGCCAGCTCTG	0.483																																					p.L252H		Atlas-SNP	.											.	MB21D2	75	.	0			c.T755A						.						75.0	71.0	72.0					3																	192516896		2203	4300	6503	SO:0001583	missense	151963	exon2			TCCATGAGCCAGC	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.755T>A	chr3.hg19:g.192516896A>T	ENSP00000376246:p.Leu252His	107.0	0.0		99.0	19.0	NM_178496	Q86VD8	Missense_Mutation	SNP	ENST00000392452.2	hg19	CCDS3302.2	.	.	.	.	.	.	.	.	.	.	A	18.42	3.620664	0.66787	.	.	ENSG00000180611	ENST00000392452	T	0.09255	3.0	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.29126	0.0724	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.05649	-1.0872	10	0.15499	T	0.54	-17.2311	15.0511	0.71872	1.0:0.0:0.0:0.0	.	252	Q8IYB1	M21D2_HUMAN	H	252	ENSP00000376246:L252H	ENSP00000376246:L252H	L	-	2	0	MB21D2	193999590	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.145000	0.66743	0.533000	0.62120	CTC	.	.		0.483	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496	
EVC2	132884	hgsc.bcm.edu	37	4	5578157	5578157	+	Silent	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr4:5578157G>A	ENST00000344408.5	-	18	3135	c.3082C>T	c.(3082-3084)Ctg>Ttg	p.L1028L	EVC2_ENST00000344938.1_Silent_p.L1028L|EVC2_ENST00000310917.2_Silent_p.L948L	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	1028					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TGGTCCTCCAGCTTCCTCTCC	0.642																																					p.L1028L		Atlas-SNP	.											.	EVC2	202	.	0			c.C3082T						.						20.0	19.0	19.0					4																	5578157		2202	4300	6502	SO:0001819	synonymous_variant	132884	exon18			CCTCCAGCTTCCT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.3082C>T	chr4.hg19:g.5578157G>A		47.0	0.0		54.0	20.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Silent	SNP	ENST00000344408.5	hg19	CCDS3382.2																																																																																			.	.		0.642	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
TRMT44	152992	hgsc.bcm.edu	37	4	8469997	8469997	+	Silent	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr4:8469997G>A	ENST00000389737.4	+	9	1851	c.1851G>A	c.(1849-1851)gcG>gcA	p.A617A	TRMT44_ENST00000513449.2_Silent_p.A376A	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	617					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										TGCAAGTAGCGAATTTACTGT	0.478																																					p.A617A		Atlas-SNP	.											.	TRMT44	7	.	0			c.G1851A						.						71.0	77.0	75.0					4																	8469997		2203	4300	6503	SO:0001819	synonymous_variant	152992	exon9			AGTAGCGAATTTA	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1851G>A	chr4.hg19:g.8469997G>A		138.0	0.0		145.0	13.0	NM_152544	Q8NA95	Silent	SNP	ENST00000389737.4	hg19	CCDS3402.2																																																																																			.	.		0.478	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
WDFY3	23001	hgsc.bcm.edu	37	4	85707240	85707240	+	Silent	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr4:85707240T>C	ENST00000295888.4	-	24	4361	c.3954A>G	c.(3952-3954)ccA>ccG	p.P1318P	WDFY3_ENST00000322366.6_Silent_p.P1318P	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1318					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTTTCTCCTCTGGTACTAATG	0.413																																					p.P1318P		Atlas-SNP	.											.	WDFY3	314	.	0			c.A3954G						.						132.0	120.0	124.0					4																	85707240		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon24			CTCCTCTGGTACT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.3954A>G	chr4.hg19:g.85707240T>C		207.0	0.0		244.0	44.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	hg19	CCDS3609.1																																																																																			.	.		0.413	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
ABCE1	6059	hgsc.bcm.edu	37	4	146029198	146029198	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr4:146029198A>G	ENST00000296577.4	+	4	736	c.221A>G	c.(220-222)aAt>aGt	p.N74S	OTUD4_ENST00000455611.2_5'Flank|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	74	4Fe-4S ferredoxin-type 2. {ECO:0000255|PROSITE-ProRule:PRU00711}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					TCAATTGTCAATCTACCAAGC	0.328																																					p.N74S		Atlas-SNP	.											.	ABCE1	47	.	0			c.A221G						.						86.0	80.0	82.0					4																	146029198		2203	4300	6503	SO:0001583	missense	6059	exon4			TTGTCAATCTACC	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.221A>G	chr4.hg19:g.146029198A>G	ENSP00000296577:p.Asn74Ser	86.0	0.0		152.0	26.0	NM_002940	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	ENST00000296577.4	hg19	CCDS34071.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.343082	0.82022	.	.	ENSG00000164163	ENST00000296577;ENST00000502586	D	0.91180	-2.8	5.31	5.31	0.75309	4Fe-4S ferredoxin, iron-sulpur binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92424	0.7595	L	0.39397	1.21	0.80722	D	1	D	0.67145	0.996	D	0.64595	0.927	D	0.93155	0.6553	10	0.62326	D	0.03	-22.293	15.5552	0.76187	1.0:0.0:0.0:0.0	.	74	P61221	ABCE1_HUMAN	S	74	ENSP00000296577:N74S	ENSP00000296577:N74S	N	+	2	0	ABCE1	146248648	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	9.203000	0.95033	2.131000	0.65755	0.477000	0.44152	AAT	.	.		0.328	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	
SH3D19	152503	hgsc.bcm.edu	37	4	152058972	152058972	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr4:152058972T>A	ENST00000409252.2	-	14	2275	c.1568A>T	c.(1567-1569)tAt>tTt	p.Y523F	SH3D19_ENST00000455740.1_Missense_Mutation_p.Y500F|SH3D19_ENST00000304527.4_Missense_Mutation_p.Y523F|SH3D19_ENST00000424281.1_Missense_Mutation_p.Y464F|SH3D19_ENST00000514152.1_Missense_Mutation_p.Y500F|SH3D19_ENST00000409598.4_Missense_Mutation_p.Y500F|RP11-372K14.2_ENST00000603472.1_RNA|SH3D19_ENST00000427414.2_Missense_Mutation_p.Y464F			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	523	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CTCCAGAAGATAAACAATTTC	0.353																																					p.Y523F		Atlas-SNP	.											.	SH3D19	54	.	0			c.A1568T						.						71.0	69.0	70.0					4																	152058972		2203	4300	6503	SO:0001583	missense	152503	exon15			AGAAGATAAACAA	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.1568A>T	chr4.hg19:g.152058972T>A	ENSP00000386848:p.Tyr523Phe	95.0	0.0		134.0	30.0	NM_001009555	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	hg19	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	T	16.33	3.092865	0.56075	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85;0.85	5.39	5.39	0.77823	Src homology-3 domain (4);	0.740258	0.12576	N	0.456916	T	0.44829	0.1312	L	0.35249	1.045	0.44899	D	0.997913	B;B;B;B	0.30526	0.171;0.142;0.257;0.283	B;B;B;B	0.40329	0.229;0.146;0.103;0.326	T	0.26360	-1.0105	10	0.29301	T	0.29	-11.9087	11.626	0.51145	0.0:0.0715:0.0:0.9285	.	523;500;464;278	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	F	500;523;500;464;464;523;500	ENSP00000387030:Y500F;ENSP00000302913:Y523F;ENSP00000416708:Y500F;ENSP00000404542:Y464F;ENSP00000415694:Y464F;ENSP00000386848:Y523F;ENSP00000423449:Y500F	ENSP00000302913:Y523F	Y	-	2	0	SH3D19	152278422	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.313000	0.43735	2.165000	0.68154	0.528000	0.53228	TAT	.	.		0.353	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
GPM6A	2823	hgsc.bcm.edu	37	4	176556173	176556173	+	Silent	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr4:176556173G>A	ENST00000280187.7	-	8	765	c.720C>T	c.(718-720)gcC>gcT	p.A240A	GPM6A_ENST00000506894.1_Silent_p.A229A|GPM6A_ENST00000393658.2_Silent_p.A240A|GPM6A_ENST00000515090.1_Silent_p.A233A|GPM6A_ENST00000506219.1_5'UTR	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	240					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CTTTCACATAGGCCCAGTTGG	0.438																																					p.A240A		Atlas-SNP	.											.	GPM6A	70	.	0			c.C720T						.						81.0	75.0	77.0					4																	176556173		2203	4300	6503	SO:0001819	synonymous_variant	2823	exon7			CACATAGGCCCAG		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.720C>T	chr4.hg19:g.176556173G>A		141.0	0.0		216.0	41.0	NM_201591	B7Z642|E9PHI5|Q92602	Silent	SNP	ENST00000280187.7	hg19	CCDS3824.1																																																																																			.	.		0.438	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1		
PPIP5K2	23262	hgsc.bcm.edu	37	5	102494240	102494240	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr5:102494240A>T	ENST00000358359.3	+	16	2209	c.1700A>T	c.(1699-1701)gAa>gTa	p.E567V	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.E567V|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.E567V	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	567					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GCCTCTGATGAAGGACGAGTC	0.323																																					p.E567V		Atlas-SNP	.											.	PPIP5K2	98	.	0			c.A1700T						.						132.0	126.0	128.0					5																	102494240		2203	4300	6503	SO:0001583	missense	23262	exon15			CTGATGAAGGACG	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.1700A>T	chr5.hg19:g.102494240A>T	ENSP00000351126:p.Glu567Val	343.0	0.0		544.0	108.0	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	hg19		.	.	.	.	.	.	.	.	.	.	A	25.9	4.689326	0.88735	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T	0.36157	1.27;1.27;1.27	5.28	5.28	0.74379	.	0.158377	0.42964	D	0.000637	T	0.69780	0.3149	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79208	-0.1898	10	0.87932	D	0	.	15.5032	0.75716	1.0:0.0:0.0:0.0	.	567;567	O43314-2;O43314	.;VIP2_HUMAN	V	567	ENSP00000313070:E567V;ENSP00000351126:E567V;ENSP00000416016:E567V	ENSP00000313070:E567V	E	+	2	0	PPIP5K2	102522139	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.901000	0.92560	2.118000	0.64928	0.472000	0.43445	GAA	.	.		0.323	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
PCDHA10	56139	hgsc.bcm.edu	37	5	140237567	140237567	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr5:140237567G>T	ENST00000307360.5	+	1	1934	c.1934G>T	c.(1933-1935)cGc>cTc	p.R645L	PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	645	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACGCCAGCGCCTACTGGTG	0.672																																					p.R645L		Atlas-SNP	.											.	PCDHA10	358	.	0			c.G1934T						.						23.0	29.0	26.0					5																	140237567		1321	2287	3608	SO:0001583	missense	56139	exon1			GCCAGCGCCTACT	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.1934G>T	chr5.hg19:g.140237567G>T	ENSP00000304234:p.Arg645Leu	211.0	0.0		121.0	26.0	NM_031859	A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	ENST00000307360.5	hg19	CCDS54921.1	.	.	.	.	.	.	.	.	.	.	G	7.331	0.618979	0.14129	.	.	ENSG00000250120	ENST00000307360	T	0.52983	0.64	3.49	2.51	0.30379	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45796	0.1360	L	0.42487	1.325	0.22017	N	0.999412	B;B	0.33120	0.209;0.398	B;B	0.43838	0.082;0.433	T	0.45440	-0.9261	9	0.72032	D	0.01	.	6.368	0.21465	0.1534:0.0:0.6774:0.1691	.	645;645	Q9Y5I2-3;Q9Y5I2	.;PCDAA_HUMAN	L	645	ENSP00000304234:R645L	ENSP00000304234:R645L	R	+	2	0	PCDHA10	140217751	0.000000	0.05858	1.000000	0.80357	0.031000	0.12232	0.204000	0.17335	1.932000	0.55993	0.491000	0.48974	CGC	.	.		0.672	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
RANBP17	64901	hgsc.bcm.edu	37	5	170305242	170305242	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr5:170305242G>C	ENST00000523189.1	+	2	324	c.160G>C	c.(160-162)Gga>Cga	p.G54R		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	54					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATTAGAACAAGGAACAGTAAG	0.358			T	TRD@	ALL																																p.G54R		Atlas-SNP	.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	108	.	0			c.G160C						.						96.0	94.0	94.0					5																	170305242		2203	4300	6503	SO:0001583	missense	64901	exon2			GAACAAGGAACAG	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.160G>C	chr5.hg19:g.170305242G>C	ENSP00000427975:p.Gly54Arg	283.0	0.0		304.0	58.0	NM_022897	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	hg19	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134705	0.56828	.	.	ENSG00000204764	ENST00000523189	T	0.67345	-0.26	5.35	5.35	0.76521	Armadillo-type fold (1);Importin-beta, N-terminal (2);	0.000000	0.45867	D	0.000325	D	0.83285	0.5221	M	0.79805	2.47	0.49051	D	0.999741	B;D	0.89917	0.356;1.0	B;D	0.97110	0.248;1.0	D	0.85224	0.1028	10	0.66056	D	0.02	-14.6699	18.6626	0.91477	0.0:0.0:1.0:0.0	.	54;104	Q9H2T7;B4DQG2	RBP17_HUMAN;.	R	54	ENSP00000427975:G54R	ENSP00000373770:G54R	G	+	1	0	RANBP17	170237820	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.478000	0.60230	2.492000	0.84095	0.563000	0.77884	GGA	.	.		0.358	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
PTCHD4	442213	hgsc.bcm.edu	37	6	47846352	47846352	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr6:47846352G>T	ENST00000339488.4	-	3	2261	c.2228C>A	c.(2227-2229)aCc>aAc	p.T743N		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	743						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										TTGTGTTCGGGTGTGCTCAGT	0.408																																					p.T743N		Atlas-SNP	.											.	.	.	.	0			c.C2228A						.						104.0	94.0	98.0					6																	47846352		2203	4300	6503	SO:0001583	missense	442213	exon3			GTTCGGGTGTGCT		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.2228C>A	chr6.hg19:g.47846352G>T	ENSP00000341914:p.Thr743Asn	252.0	0.0		251.0	51.0	NM_001013732	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	hg19	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318435	0.60524	.	.	ENSG00000244694	ENST00000339488	D	0.91843	-2.92	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.88526	0.6460	L	0.59436	1.845	0.80722	D	1	P	0.38729	0.644	B	0.36186	0.219	D	0.87706	0.2563	10	0.39692	T	0.17	.	20.5211	0.99222	0.0:0.0:1.0:0.0	.	743	Q6ZW05	CF138_HUMAN	N	743	ENSP00000341914:T743N	ENSP00000341914:T743N	T	-	2	0	C6orf138	47954311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.861000	0.98227	0.650000	0.86243	ACC	.	.		0.408	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
COL12A1	1303	hgsc.bcm.edu	37	6	75853093	75853093	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr6:75853093T>A	ENST00000322507.8	-	26	5011	c.4702A>T	c.(4702-4704)Aga>Tga	p.R1568*	COL12A1_ENST00000416123.2_Nonsense_Mutation_p.R1568*|COL12A1_ENST00000483888.2_Nonsense_Mutation_p.R1568*|COL12A1_ENST00000345356.6_Nonsense_Mutation_p.R404*	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1568	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCCTGAGGTCTGGGTAAAGGC	0.423																																					p.R1568X		Atlas-SNP	.											.	COL12A1	385	.	0			c.A4702T						.						105.0	96.0	99.0					6																	75853093		1885	4115	6000	SO:0001587	stop_gained	1303	exon26			GAGGTCTGGGTAA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4702A>T	chr6.hg19:g.75853093T>A	ENSP00000325146:p.Arg1568*	128.0	0.0		214.0	32.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Nonsense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	43|43	10.391375|10.391375	0.99396|0.99396	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|.	.|.	.|.	5.81|5.81	-2.39|-2.39	0.06602|0.06602	.|.	.|0.343561	.|0.29775	.|N	.|0.011223	T|.	0.04048|.	0.0113|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.36040|.	-0.9764|.	3|.	.|0.02654	.|T	.|1	.|.	6.2577|6.2577	0.20884|0.20884	0.0:0.2859:0.4523:0.2617|0.0:0.2859:0.4523:0.2617	.|.	.|.	.|.	.|.	L|X	309|1568;1568;404;1568;1568	.|.	.|ENSP00000325146:R1568X	Q|R	-|-	2|1	0|2	COL12A1|COL12A1	75909813|75909813	0.990000|0.990000	0.36364|0.36364	0.953000|0.953000	0.39169|0.39169	0.994000|0.994000	0.84299|0.84299	1.068000|1.068000	0.30629|0.30629	-0.120000|-0.120000	0.11809|0.11809	0.533000|0.533000	0.62120|0.62120	CAG|AGA	.	.		0.423	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
TBX18	9096	hgsc.bcm.edu	37	6	85446949	85446950	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr6:85446949_85446950GG>AT	ENST00000369663.5	-	8	1614_1615	c.1277_1278CC>AT	c.(1276-1278)aCC>aAT	p.T426N	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	426					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		ATCGGTTGAGGGTGAGGCCTGA	0.609																																					p.T426T|p.T426N		Atlas-SNP	.											.	TBX18	131	.	0			c.C1278T|c.C1277A						.																																			SO:0001583	missense	9096	exon8			GTTGAGGGTGAGG|TTGAGGGTGAGGC	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1277_1278delinsAT	chr6.hg19:g.85446949_85446950delinsAT	ENSP00000358677:p.Thr426Asn	195.0	0.0		189.0|192.0	30.0|31.0	NM_001080508	A2RU13|Q7Z6U4|Q9UJI6	Silent|Missense_Mutation	SNP	ENST00000369663.5	hg19	CCDS34495.1																																																																																			.	.		0.609	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041378.2	NM_001080508	
HDAC9	9734	hgsc.bcm.edu	37	7	18833076	18833076	+	Splice_Site	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr7:18833076G>A	ENST00000432645.2	+	16	2313		c.e16+1		HDAC9_ENST00000401921.1_Splice_Site|HDAC9_ENST00000406451.4_Splice_Site|HDAC9_ENST00000441542.2_Splice_Site	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9						B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	AGAGCTGAAGGTGAGGTCCGG	0.512																																					.		Atlas-SNP	.											HDAC9_ENST00000262069,NS,carcinoma,0,2	HDAC9	560	.	0			c.2313+1G>A						.						47.0	49.0	48.0					7																	18833076		2094	4221	6315	SO:0001630	splice_region_variant	9734	exon17			CTGAAGGTGAGGT	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.2313+1G>A	chr7.hg19:g.18833076G>A		155.0	0.0		157.0	33.0	NM_178423	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Splice_Site	SNP	ENST00000432645.2	hg19	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295392	0.60086	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4736	0.94973	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HDAC9	18799601	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.724000	0.84798	2.609000	0.88269	0.655000	0.94253	.	.	.		0.512	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		Intron
STEAP1B	256227	hgsc.bcm.edu	37	7	22533400	22533400	+	Splice_Site	SNP	T	T	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr7:22533400T>A	ENST00000406890.2	-	3	179		c.e3-2		STEAP1B_ENST00000404369.4_Missense_Mutation_p.Q47L	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(2)	4						GGCTGTTTGCTGCAAATGCAA	0.418																																					p.Q47L		Atlas-SNP	.											.	STEAP1B	22	.	0			c.A140T						.						75.0	56.0	62.0					7																	22533400		692	1591	2283	SO:0001630	splice_region_variant	256227	exon3			GTTTGCTGCAAAT		CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.85-2A>T	chr7.hg19:g.22533400T>A		498.0	0.0		574.0	114.0	NM_001164460	B5MCI2	Missense_Mutation	SNP	ENST00000406890.2	hg19	CCDS55094.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	8.812|8.812	0.935492|0.935492	0.18206|0.18206	.|.	.|.	ENSG00000105889|ENSG00000105889	ENST00000406890|ENST00000404369;ENST00000424363;ENST00000439708	.|T;T;T	.|0.11712	.|2.89;2.95;2.75	1.06|1.06	1.06|1.06	0.20224|0.20224	.|.	.|.	.|.	.|.	.|.	.|T	.|0.07863	.|0.0197	L|L	0.40543|0.40543	1.245|1.245	0.19575|0.19575	N|N	0.999965|0.999965	.|B	.|0.28233	.|0.204	.|B	.|0.21151	.|0.033	.|T	.|0.33752	.|-0.9856	.|8	.|.	.|.	.|.	.|0.4639	6.3811|6.3811	0.21536|0.21536	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|47	.|B5MCI2	.|.	.|L	-1|47	.|ENSP00000384370:Q47L;ENSP00000416608:Q47L;ENSP00000408954:Q47L	.|.	.|Q	-|-	.|2	.|0	STEAP1B|STEAP1B	22499925|22499925	1.000000|1.000000	0.71417|0.71417	0.418000|0.418000	0.26571|0.26571	0.098000|0.098000	0.18820|0.18820	2.590000|2.590000	0.46154|0.46154	0.759000|0.759000	0.33084|0.33084	0.102000|0.102000	0.15555|0.15555	.|CAG	.	.		0.418	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326617.2		Intron
PON1	5444	hgsc.bcm.edu	37	7	94947702	94947702	+	Silent	SNP	T	T	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr7:94947702T>G	ENST00000222381.3	-	2	309	c.78A>C	c.(76-78)acA>acC	p.T26T	PON1_ENST00000542556.1_Intron	NM_000446.5	NP_000437.3	P27169	PON1_HUMAN	paraoxonase 1	26					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|dephosphorylation (GO:0016311)|organophosphate catabolic process (GO:0046434)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of binding (GO:0051099)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of transporter activity (GO:0032411)|response to external stimulus (GO:0009605)|response to toxic substance (GO:0009636)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|intracellular membrane-bounded organelle (GO:0043231)|spherical high-density lipoprotein particle (GO:0034366)	aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(11)|pancreas(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	27	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Cefazolin(DB01327)	CATTAAGTCGTGTTCTGTGGG	0.393																																					p.T26T	GBM(119;715 1622 17358 22490 33240)	Atlas-SNP	.											.	PON1	55	.	0			c.A78C						.						78.0	81.0	80.0					7																	94947702		2203	4300	6503	SO:0001819	synonymous_variant	5444	exon2			AAGTCGTGTTCTG	AF539592	CCDS5638.1	7q21.3	2014-03-14			ENSG00000005421	ENSG00000005421	3.1.1.2	"""Paraoxonases"""	9204	protein-coding gene	gene with protein product	"""esterase A"", ""arylesterase 1"""	168820		PON		8661009, 15450851	Standard	NM_000446		Approved	ESA	uc003uns.3	P27169	OTTHUMG00000153894	ENST00000222381.3:c.78A>C	chr7.hg19:g.94947702T>G		148.0	0.0		145.0	26.0	NM_000446	B2RA40|Q16052|Q6B0J6|Q9UCB1	Silent	SNP	ENST00000222381.3	hg19	CCDS5638.1																																																																																			.	.		0.393	PON1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000332865.2	NM_000446	
DLX6	1750	hgsc.bcm.edu	37	7	96639126	96639126	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr7:96639126A>T	ENST00000518156.2	+	3	1079	c.649A>T	c.(649-651)Aac>Tac	p.N217Y	DLX6-AS1_ENST00000430404.2_RNA|DLX6_ENST00000555308.1_Missense_Mutation_p.N89Y|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6_ENST00000007660.5_Missense_Mutation_p.N189Y|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000437331.2_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	99					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					ATGGTTTCAGAACAAACGCTC	0.502																																					p.N217Y		Atlas-SNP	.											.	DLX6	37	.	0			c.A649T						.						99.0	98.0	98.0					7																	96639126		2011	4195	6206	SO:0001583	missense	1750	exon3			TTTCAGAACAAAC		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.649A>T	chr7.hg19:g.96639126A>T	ENSP00000428480:p.Asn217Tyr	190.0	0.0		246.0	33.0	NM_005222	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Missense_Mutation	SNP	ENST00000518156.2	hg19	CCDS47647.2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.447881	0.84101	.	.	ENSG00000006377	ENST00000518156;ENST00000007660;ENST00000555308	D;D;D	0.99369	-5.78;-5.78;-5.78	5.24	5.24	0.73138	.	0.083122	0.85682	D	0.000000	D	0.99684	0.9881	H	0.98936	4.375	0.80722	D	1	D	0.69078	0.997	D	0.72075	0.976	D	0.97232	0.9885	10	0.87932	D	0	-22.1374	15.2972	0.73919	1.0:0.0:0.0:0.0	.	189	P56179-2	.	Y	217;189;89	ENSP00000428480:N217Y;ENSP00000007660:N189Y;ENSP00000451635:N89Y	ENSP00000007660:N189Y	N	+	1	0	DLX6	96477062	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.081000	0.94049	2.206000	0.71126	0.533000	0.62120	AAC	.	.		0.502	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334373.4	NM_005222	
IQUB	154865	hgsc.bcm.edu	37	7	123092919	123092919	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr7:123092919A>T	ENST00000466202.1	-	13	2830	c.2254T>A	c.(2254-2256)Ttt>Att	p.F752I	IQUB_ENST00000324698.6_Missense_Mutation_p.F752I	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	752					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						ACCTGAGAAAAATAGTTCTTA	0.343																																					p.F752I		Atlas-SNP	.											.	IQUB	117	.	0			c.T2254A						.						99.0	94.0	96.0					7																	123092919		2203	4300	6503	SO:0001583	missense	154865	exon13			GAGAAAAATAGTT	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.2254T>A	chr7.hg19:g.123092919A>T	ENSP00000417769:p.Phe752Ile	300.0	0.0		359.0	76.0	NM_178827	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	ENST00000466202.1	hg19	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	A	34	5.398149	0.96030	.	.	ENSG00000164675	ENST00000466202;ENST00000324698	T;T	0.30448	1.53;1.53	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.61602	0.2360	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67772	-0.5584	10	0.87932	D	0	.	16.4197	0.83754	1.0:0.0:0.0:0.0	.	752	Q8NA54	IQUB_HUMAN	I	752	ENSP00000417769:F752I;ENSP00000324882:F752I	ENSP00000324882:F752I	F	-	1	0	IQUB	122880155	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.002000	0.88514	2.278000	0.76064	0.467000	0.42956	TTT	.	.		0.343	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
METTL2B	55798	hgsc.bcm.edu	37	7	128119312	128119312	+	Silent	SNP	T	T	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr7:128119312T>G	ENST00000262432.8	+	3	340	c.303T>G	c.(301-303)ccT>ccG	p.P101P	METTL2B_ENST00000480046.1_Silent_p.P36P|RP11-212P7.3_ENST00000462662.1_RNA	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	101					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						CCGAATTCCCTGAGCTGGCAC	0.388																																					p.P101P		Atlas-SNP	.											.	METTL2B	34	.	0			c.T303G						.						60.0	61.0	61.0					7																	128119312		2203	4300	6503	SO:0001819	synonymous_variant	55798	exon3			ATTCCCTGAGCTG	AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.303T>G	chr7.hg19:g.128119312T>G		565.0	0.0		713.0	130.0	NM_018396	B4DZ68|Q0IJ54|Q3B7J1	Silent	SNP	ENST00000262432.8	hg19	CCDS5803.2																																																																																			.	.		0.388	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
HTR5A	3361	hgsc.bcm.edu	37	7	154862969	154862969	+	Silent	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr7:154862969C>T	ENST00000287907.2	+	1	936	c.360C>T	c.(358-360)tgC>tgT	p.C120C	HTR5A-AS1_ENST00000395731.2_Silent_p.S15S|HTR5A-AS1_ENST00000543018.1_Silent_p.S15S|HTR5A-AS1_ENST00000493904.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	120					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	GGATCGCGTGCGACGTGCTTT	0.667																																					p.C120C		Atlas-SNP	.											.	HTR5A	114	.	0			c.C360T						.						63.0	49.0	53.0					7																	154862969		2203	4300	6503	SO:0001819	synonymous_variant	3361	exon1			CGCGTGCGACGTG		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.360C>T	chr7.hg19:g.154862969C>T		33.0	0.0		40.0	8.0	NM_024012	Q2M2D2	Silent	SNP	ENST00000287907.2	hg19	CCDS5936.1																																																																																			.	.		0.667	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
STC1	6781	hgsc.bcm.edu	37	8	23712004	23712004	+	Silent	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr8:23712004C>T	ENST00000290271.2	-	1	316	c.33G>A	c.(31-33)ctG>ctA	p.L11L	STC1_ENST00000524323.1_5'Flank	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	11					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		CACTGATCACCAGCACCAGAA	0.512																																					p.L11L		Atlas-SNP	.											.	STC1	49	.	0			c.G33A						.						130.0	136.0	134.0					8																	23712004		2203	4300	6503	SO:0001819	synonymous_variant	6781	exon1			GATCACCAGCACC		CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.33G>A	chr8.hg19:g.23712004C>T		233.0	0.0		273.0	67.0	NM_003155	B4DN22|Q71UE5	Silent	SNP	ENST00000290271.2	hg19	CCDS6043.1																																																																																			.	.		0.512	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215143.1		
IMPAD1	54928	hgsc.bcm.edu	37	8	57876515	57876515	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr8:57876515G>C	ENST00000262644.4	-	5	1175	c.917C>G	c.(916-918)gCc>gGc	p.A306G		NM_017813.4	NP_060283.3	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	306					chondrocyte development (GO:0002063)|chondroitin sulfate metabolic process (GO:0030204)|embryonic digit morphogenesis (GO:0042733)|endochondral ossification (GO:0001958)|inositol biosynthetic process (GO:0006021)|phosphatidylinositol phosphorylation (GO:0046854)|post-embryonic development (GO:0009791)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|3'-nucleotidase activity (GO:0008254)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)	p.A306G(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				TTTTAAGATGGCATTACCAGC	0.433																																					p.A306G		Atlas-SNP	.											IMPAD1,colon,carcinoma,0,1	IMPAD1	27	.	1	Substitution - Missense(1)	large_intestine(1)	c.C917G						.						68.0	63.0	65.0					8																	57876515		2203	4300	6503	SO:0001583	missense	54928	exon5			AAGATGGCATTAC		CCDS6169.1	8q12.1	2013-05-16			ENSG00000104331	ENSG00000104331			26019	protein-coding gene	gene with protein product		614010				21549340	Standard	NM_017813		Approved	FLJ20421, IMPA3, gPAPP	uc003xte.4	Q9NX62	OTTHUMG00000164415	ENST00000262644.4:c.917C>G	chr8.hg19:g.57876515G>C	ENSP00000262644:p.Ala306Gly	260.0	0.0		320.0	69.0	NM_017813	Q6NVY7	Missense_Mutation	SNP	ENST00000262644.4	hg19	CCDS6169.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.595039	0.86953	.	.	ENSG00000104331	ENST00000262644	T	0.57107	0.42	5.32	5.32	0.75619	Inositol monophosphatase, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.76990	0.4065	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80238	-0.1465	10	0.54805	T	0.06	-27.5718	17.9675	0.89103	0.0:0.0:1.0:0.0	.	306	Q9NX62	IMPA3_HUMAN	G	306	ENSP00000262644:A306G	ENSP00000262644:A306G	A	-	2	0	IMPAD1	58039069	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.336000	0.96533	2.480000	0.83734	0.585000	0.79938	GCC	.	.		0.433	IMPAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378665.1	NM_017813	
NCOA2	10499	hgsc.bcm.edu	37	8	71068895	71068895	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr8:71068895T>C	ENST00000452400.2	-	11	1886	c.1705A>G	c.(1705-1707)Atg>Gtg	p.M569V	NCOA2_ENST00000524223.1_5'UTR	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	569					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GGAGGATTCATATTAACTGGG	0.507			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.M569V		Atlas-SNP	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.A1705G						.						97.0	96.0	96.0					8																	71068895		1879	4123	6002	SO:0001583	missense	10499	exon11			GATTCATATTAAC	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1705A>G	chr8.hg19:g.71068895T>C	ENSP00000399968:p.Met569Val	153.0	0.0		164.0	28.0	NM_006540	Q14CD2	Missense_Mutation	SNP	ENST00000452400.2	hg19	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.477833	0.26511	.	.	ENSG00000140396	ENST00000452400	T	0.01474	4.85	5.93	4.71	0.59529	.	0.084489	0.85682	D	0.000000	T	0.01870	0.0059	N	0.25647	0.755	0.80722	D	1	B	0.13145	0.007	B	0.08055	0.003	T	0.58713	-0.7588	10	0.41790	T	0.15	.	12.874	0.57980	0.0:0.0:0.1356:0.8644	.	569	Q15596	NCOA2_HUMAN	V	569	ENSP00000399968:M569V	ENSP00000399968:M569V	M	-	1	0	NCOA2	71231449	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.139000	0.58024	2.263000	0.75096	0.533000	0.62120	ATG	.	.		0.507	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
PKHD1L1	93035	hgsc.bcm.edu	37	8	110432768	110432768	+	Missense_Mutation	SNP	C	C	A	rs547689763		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr8:110432768C>A	ENST00000378402.5	+	23	2650	c.2546C>A	c.(2545-2547)cCt>cAt	p.P849H		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	849					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AGAAGACTTCCTGCATTAGCA	0.333										HNSCC(38;0.096)																											p.P849H		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.C2546A						.						65.0	58.0	60.0					8																	110432768		1798	4076	5874	SO:0001583	missense	93035	exon23			GACTTCCTGCATT	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2546C>A	chr8.hg19:g.110432768C>A	ENSP00000367655:p.Pro849His	176.0	0.0		334.0	107.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	hg19	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876361	0.51801	.	.	ENSG00000205038	ENST00000378402	D	0.87103	-2.21	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.85902	0.5805	M	0.69823	2.125	0.30531	N	0.767401	B	0.27951	0.195	B	0.18561	0.022	D	0.85213	0.1022	10	0.87932	D	0	.	14.9728	0.71246	0.0:1.0:0.0:0.0	.	849	Q86WI1	PKHL1_HUMAN	H	849	ENSP00000367655:P849H	ENSP00000367655:P849H	P	+	2	0	PKHD1L1	110501944	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.944000	0.56629	2.610000	0.88304	0.585000	0.79938	CCT	.	.		0.333	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
HAS2	3037	hgsc.bcm.edu	37	8	122627257	122627257	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr8:122627257A>T	ENST00000303924.4	-	4	1288	c.751T>A	c.(751-753)Tgg>Agg	p.W251R		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	251					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			AATGAGATCCAGGAATCGTAC	0.378																																					p.W251R		Atlas-SNP	.											.	HAS2	87	.	0			c.T751A						.						61.0	60.0	60.0					8																	122627257		2203	4300	6503	SO:0001583	missense	3037	exon4			AGATCCAGGAATC	U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.751T>A	chr8.hg19:g.122627257A>T	ENSP00000306991:p.Trp251Arg	94.0	0.0		174.0	28.0	NM_005328	Q32MM3	Missense_Mutation	SNP	ENST00000303924.4	hg19	CCDS6335.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.151941	0.57151	.	.	ENSG00000170961	ENST00000303924;ENST00000443194	T	0.59083	0.29	5.73	5.73	0.89815	.	0.049569	0.85682	D	0.000000	T	0.78622	0.4312	M	0.86343	2.81	0.80722	D	1	D	0.63046	0.992	D	0.66497	0.944	T	0.82557	-0.0398	10	0.72032	D	0.01	-9.8245	16.3143	0.82909	1.0:0.0:0.0:0.0	.	251	Q92819	HAS2_HUMAN	R	251	ENSP00000306991:W251R	ENSP00000306991:W251R	W	-	1	0	HAS2	122696438	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.275000	0.95738	2.313000	0.78055	0.454000	0.30748	TGG	.	.		0.378	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381150.2	NM_005328	
HHLA1	10086	hgsc.bcm.edu	37	8	133090141	133090141	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr8:133090141C>T	ENST00000414222.1	-	11	1002	c.1003G>A	c.(1003-1005)Gct>Act	p.A335T	OC90_ENST00000262283.5_Missense_Mutation_p.A77T|HHLA1_ENST00000434736.2_Missense_Mutation_p.A371T	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	335						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						ATGGTCTGAGCCCAGGGCACG	0.542																																					p.A335T		Atlas-SNP	.											.	HHLA1	35	.	0			c.G1003A						.						83.0	78.0	80.0					8																	133090141		692	1591	2283	SO:0001583	missense	10086	exon11			TCTGAGCCCAGGG	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.1003G>A	chr8.hg19:g.133090141C>T	ENSP00000388322:p.Ala335Thr	130.0	0.0		220.0	23.0	NM_001145095		Missense_Mutation	SNP	ENST00000414222.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.51	3.144888	0.57044	.	.	ENSG00000258417;ENSG00000132297;ENSG00000132297	ENST00000262283;ENST00000414222;ENST00000434736	T	0.33865	1.39	4.52	-1.71	0.08133	.	.	.	.	.	T	0.16471	0.0396	N	0.17082	0.46	0.09310	N	1	B;B	0.18461	0.002;0.028	B;B	0.17433	0.007;0.018	T	0.32481	-0.9905	9	0.10902	T	0.67	-2.6407	4.9483	0.14000	0.0:0.3347:0.1703:0.495	.	335;192	C9JL84;C9JL84-2	HHLA1_HUMAN;.	T	77;335;371	ENSP00000262283:A77T	ENSP00000388322:A335T	A	-	1	0	RP11-240B13.2;HHLA1	133159323	0.000000	0.05858	0.006000	0.13384	0.086000	0.17979	-1.026000	0.03596	-0.239000	0.09710	-1.050000	0.02344	GCT	.	.		0.542	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XR_017860	
FAM83H	286077	hgsc.bcm.edu	37	8	144812668	144812668	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr8:144812668G>A	ENST00000388913.3	-	2	210	c.85C>T	c.(85-87)Cgc>Tgc	p.R29C	MIR4664_ENST00000583819.1_RNA	NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	29					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACCGCCAGGCGGTAGTACTCT	0.672																																					p.R29C		Atlas-SNP	.											.	FAM83H	68	.	0			c.C85T						.						23.0	25.0	24.0					8																	144812668		1994	4148	6142	SO:0001583	missense	286077	exon2			CCAGGCGGTAGTA	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.85C>T	chr8.hg19:g.144812668G>A	ENSP00000373565:p.Arg29Cys	30.0	0.0		29.0	11.0	NM_198488	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	hg19	CCDS6410.2	.	.	.	.	.	.	.	.	.	.	g	19.47	3.833196	0.71258	.	.	ENSG00000180921	ENST00000388913	T	0.35421	1.31	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.67534	0.2903	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76465	-0.2949	10	0.87932	D	0	.	16.8086	0.85712	0.0:0.0:1.0:0.0	.	29	Q6ZRV2	FA83H_HUMAN	C	29	ENSP00000373565:R29C	ENSP00000373565:R29C	R	-	1	0	FAM83H	144884656	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	6.340000	0.72973	2.285000	0.76669	0.478000	0.44815	CGC	.	.		0.672	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
RANBP6	26953	hgsc.bcm.edu	37	9	6012698	6012698	+	Silent	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr9:6012698G>T	ENST00000259569.5	-	1	2920	c.2910C>A	c.(2908-2910)acC>acA	p.T970T	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	970					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K971fs*1(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		CATTTTTTTTGGTTTTGGAAT	0.368																																					p.T970T		Atlas-SNP	.											.	RANBP6	127	.	1	Insertion - Frameshift(1)	NS(1)	c.C2910A						.						108.0	101.0	104.0					9																	6012698		2203	4300	6503	SO:0001819	synonymous_variant	26953	exon1			TTTTTTGGTTTTG	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2910C>A	chr9.hg19:g.6012698G>T		252.0	0.0		313.0	13.0	NM_012416	Q5T7X4|Q7Z3V2|Q96E78	Silent	SNP	ENST00000259569.5	hg19	CCDS6467.1																																																																																			.	.		0.368	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
ACO1	48	hgsc.bcm.edu	37	9	32418350	32418350	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr9:32418350A>G	ENST00000309951.6	+	6	637	c.499A>G	c.(499-501)Atg>Gtg	p.M167V	ACO1_ENST00000379923.1_Missense_Mutation_p.M167V|ACO1_ENST00000541043.1_Missense_Mutation_p.M68V	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	167					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TTTTCACAACATGCGGATTAT	0.463																																					p.M167V		Atlas-SNP	.											.	ACO1	149	.	0			c.A499G						.						74.0	77.0	76.0					9																	32418350		2203	4300	6503	SO:0001583	missense	48	exon6			CACAACATGCGGA	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.499A>G	chr9.hg19:g.32418350A>G	ENSP00000309477:p.Met167Val	365.0	0.0		379.0	62.0	NM_002197	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	hg19	CCDS6525.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.034436	0.35893	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.15603	2.41;2.41;2.41	6.16	6.16	0.99307	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (3);	0.000000	0.85682	D	0.000000	T	0.12135	0.0295	N	0.11560	0.145	0.80722	D	1	B;B	0.20052	0.041;0.006	B;B	0.20384	0.029;0.008	T	0.09079	-1.0691	10	0.87932	D	0	-13.5172	15.7887	0.78332	1.0:0.0:0.0:0.0	.	203;167	Q59FI0;P21399	.;ACOC_HUMAN	V	203;167;167;167;68	ENSP00000309477:M167V;ENSP00000369255:M167V;ENSP00000438733:M68V	ENSP00000309477:M167V	M	+	1	0	ACO1	32408350	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.770000	0.55310	2.367000	0.80283	0.528000	0.53228	ATG	.	.		0.463	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
ANKRD18A	253650	hgsc.bcm.edu	37	9	38596174	38596174	+	Nonsense_Mutation	SNP	G	G	T	rs528054598		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr9:38596174G>T	ENST00000399703.5	-	9	1537	c.1163C>A	c.(1162-1164)tCg>tAg	p.S388*		NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	388										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						AAGCTGTTGCGAATACCGGGC	0.343																																					p.S388X		Atlas-SNP	.											.	ANKRD18A	49	.	0			c.C1163A						.						120.0	91.0	100.0					9																	38596174		692	1591	2283	SO:0001587	stop_gained	253650	exon9			TGTTGCGAATACC	AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.1163C>A	chr9.hg19:g.38596174G>T	ENSP00000382610:p.Ser388*	698.0	1.0		1008.0	189.0	NM_147195	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Nonsense_Mutation	SNP	ENST00000399703.5	hg19	CCDS55311.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761965	0.89932	.	.	ENSG00000180071	ENST00000399703	.	.	.	1.47	-2.95	0.05564	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.8053	0.13317	0.0:0.1995:0.313:0.4875	.	.	.	.	X	388	.	ENSP00000382610:S388X	S	-	2	0	ANKRD18A	38586174	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.673000	0.05239	-2.213000	0.00735	-0.849000	0.03036	TCG	.	.		0.343	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052506.3		
C10orf71	118461	hgsc.bcm.edu	37	10	50533357	50533357	+	Silent	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr10:50533357C>A	ENST00000374144.3	+	3	3055	c.2767C>A	c.(2767-2769)Cgg>Agg	p.R923R	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	923										endometrium(1)	1						CACTAACACACGGGGCACACG	0.592																																					p.R923R		Atlas-SNP	.											.	C10orf71	179	.	0			c.C2767A						.						18.0	17.0	17.0					10																	50533357		692	1591	2283	SO:0001819	synonymous_variant	118461	exon3			AACACACGGGGCA	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.2767C>A	chr10.hg19:g.50533357C>A		75.0	0.0		90.0	22.0	NM_001135196	A0AVL8	Silent	SNP	ENST00000374144.3	hg19	CCDS44387.1																																																																																			.	.		0.592	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
PRF1	5551	hgsc.bcm.edu	37	10	72358776	72358776	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr10:72358776G>T	ENST00000441259.1	-	3	861	c.701C>A	c.(700-702)tCg>tAg	p.S234*	PRF1_ENST00000373209.2_Nonsense_Mutation_p.S234*	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	234	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						AGTGAGGGCCGATATGCGGCC	0.652			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.S234X		Atlas-SNP	.	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	PRF1	64	.	0			c.C701A						.						62.0	54.0	57.0					10																	72358776		2203	4300	6503	SO:0001587	stop_gained	5551	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AGGGCCGATATGC	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.701C>A	chr10.hg19:g.72358776G>T	ENSP00000398568:p.Ser234*	98.0	0.0		77.0	11.0	NM_001083116	B2R6X4|Q59F57|Q86WX7	Nonsense_Mutation	SNP	ENST00000441259.1	hg19	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	G	37	6.189954	0.97362	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	.	.	.	5.76	3.91	0.45181	.	0.761983	0.12600	N	0.454757	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-2.7514	9.6964	0.40161	0.0777:0.142:0.7803:0.0	.	.	.	.	X	234	.	ENSP00000316746:S234X	S	-	2	0	PRF1	72028782	0.000000	0.05858	0.004000	0.12327	0.739000	0.42172	0.434000	0.21494	0.768000	0.33290	0.655000	0.94253	TCG	.	.		0.652	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
ADAMTS14	140766	hgsc.bcm.edu	37	10	72468471	72468471	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr10:72468471C>G	ENST00000373207.1	+	4	807	c.807C>G	c.(805-807)gaC>gaG	p.D269E	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.D269E	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	269	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TGGTGGACGACTCGGTGGTTC	0.612																																					p.D269E		Atlas-SNP	.											.	ADAMTS14	148	.	0			c.C807G						.						146.0	116.0	126.0					10																	72468471		2203	4300	6503	SO:0001583	missense	140766	exon4			GGACGACTCGGTG	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.807C>G	chr10.hg19:g.72468471C>G	ENSP00000362303:p.Asp269Glu	130.0	0.0		123.0	31.0	NM_080722	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	ENST00000373207.1	hg19	CCDS7306.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951517	0.73787	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	D;D	0.86432	-2.12;-2.12	4.48	3.57	0.40892	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.85695	0.5756	N	0.25647	0.755	0.39518	D	0.968479	D;D	0.64830	0.987;0.994	P;D	0.67231	0.9;0.95	T	0.81256	-0.1015	10	0.15499	T	0.54	.	9.4147	0.38514	0.0:0.8244:0.0:0.1756	.	269;269	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	E	269	ENSP00000362304:D269E;ENSP00000362303:D269E	ENSP00000362303:D269E	D	+	3	2	ADAMTS14	72138477	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.168000	0.50801	1.094000	0.41399	0.491000	0.48974	GAC	.	.		0.612	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
MGEA5	10724	hgsc.bcm.edu	37	10	103550822	103550822	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr10:103550822A>T	ENST00000361464.3	-	14	2680	c.2285T>A	c.(2284-2286)cTc>cAc	p.L762H	MGEA5_ENST00000439817.1_Missense_Mutation_p.L709H|MGEA5_ENST00000482611.1_5'UTR|MGEA5_ENST00000357797.5_Missense_Mutation_p.L695H	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	762					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		ATCCAGGCTGAGGGAAAGCAG	0.418																																					p.L762H		Atlas-SNP	.											.	MGEA5	53	.	0			c.T2285A						.						73.0	72.0	72.0					10																	103550822		2203	4300	6503	SO:0001583	missense	10724	exon14			AGGCTGAGGGAAA	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.2285T>A	chr10.hg19:g.103550822A>T	ENSP00000354850:p.Leu762His	234.0	0.0		289.0	60.0	NM_012215	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	ENST00000361464.3	hg19	CCDS7520.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.104450	0.56291	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797	T;T;T	0.54866	0.55;0.55;0.55	5.77	5.77	0.91146	Acyl-CoA N-acyltransferase (2);	0.066272	0.64402	D	0.000008	T	0.46132	0.1377	L	0.45285	1.41	0.80722	D	1	B;B;B	0.27932	0.016;0.028;0.194	B;B;B	0.28385	0.007;0.026;0.089	T	0.48258	-0.9051	10	0.87932	D	0	-6.3828	11.4753	0.50295	0.8658:0.0:0.0:0.1342	.	709;695;762	E9PGF9;O60502-2;O60502	.;.;NCOAT_HUMAN	H	709;762;695	ENSP00000409973:L709H;ENSP00000354850:L762H;ENSP00000350445:L695H	ENSP00000350445:L695H	L	-	2	0	MGEA5	103540812	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.904000	0.75708	2.326000	0.78906	0.533000	0.62120	CTC	.	.		0.418	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
INPP5F	22876	hgsc.bcm.edu	37	10	121556404	121556404	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr10:121556404C>T	ENST00000361976.2	+	7	1013	c.847C>T	c.(847-849)Cgc>Tgc	p.R283C	INPP5F_ENST00000369083.3_Missense_Mutation_p.R283C	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		TCTCATTTCACGCCGAAGTAG	0.483																																					p.R283C		Atlas-SNP	.											.	INPP5F	112	.	0			c.C847T						.						61.0	55.0	57.0					10																	121556404		2203	4300	6503	SO:0001583	missense	22876	exon7			ATTTCACGCCGAA	AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.847C>T	chr10.hg19:g.121556404C>T	ENSP00000354519:p.Arg283Cys	211.0	0.0		319.0	67.0	NM_014937	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000361976.2	hg19	CCDS7616.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490270	0.84962	.	.	ENSG00000198825	ENST00000361976;ENST00000369083	T;T	0.77358	-1.09;-1.09	5.7	5.7	0.88788	Synaptojanin, N-terminal (2);	0.099000	0.64402	D	0.000002	D	0.92662	0.7668	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.94539	0.7743	10	0.87932	D	0	-5.5853	19.8339	0.96646	0.0:1.0:0.0:0.0	.	283	Q9Y2H2	SAC2_HUMAN	C	283	ENSP00000354519:R283C;ENSP00000358079:R283C	ENSP00000354519:R283C	R	+	1	0	INPP5F	121546394	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.426000	0.66476	2.701000	0.92244	0.655000	0.94253	CGC	.	.		0.483	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050679.1	NM_014937	
TACC2	10579	hgsc.bcm.edu	37	10	123843041	123843041	+	Silent	SNP	G	G	T	rs201912981	byFrequency	TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr10:123843041G>T	ENST00000369005.1	+	4	1366	c.1026G>T	c.(1024-1026)ccG>ccT	p.P342P	TACC2_ENST00000453444.2_Silent_p.P342P|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515273.1_Silent_p.P342P|TACC2_ENST00000515603.1_Silent_p.P342P|TACC2_ENST00000334433.3_Silent_p.P342P	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	342					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CATATCTGCCGCACGCAGAGC	0.632																																					p.P342P		Atlas-SNP	.											.	TACC2	271	.	0			c.G1026T						.						31.0	37.0	35.0					10																	123843041		2199	4297	6496	SO:0001819	synonymous_variant	10579	exon4			TCTGCCGCACGCA	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.1026G>T	chr10.hg19:g.123843041G>T		83.0	0.0		80.0	18.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	ENST00000369005.1	hg19	CCDS7626.1																																																																																			.	G|0.999;A|0.001		0.632	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
KIF18A	81930	hgsc.bcm.edu	37	11	28116264	28116264	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr11:28116264T>G	ENST00000263181.6	-	3	699	c.409A>C	c.(409-411)Atg>Ctg	p.M137L		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	137	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						AGGTGTAACATTGTTAGATAC	0.388																																					p.M137L		Atlas-SNP	.											.	KIF18A	92	.	0			c.A409C						.						193.0	172.0	179.0					11																	28116264		2202	4299	6501	SO:0001583	missense	81930	exon3			GTAACATTGTTAG	AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.409A>C	chr11.hg19:g.28116264T>G	ENSP00000263181:p.Met137Leu	226.0	0.0		277.0	46.0	NM_031217	Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	ENST00000263181.6	hg19	CCDS7867.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.355496	0.61293	.	.	ENSG00000121621	ENST00000263181	T	0.72282	-0.64	5.58	4.43	0.53597	Kinesin, motor domain (4);	0.034657	0.85682	N	0.000000	T	0.59676	0.2211	L	0.33293	1	0.80722	D	1	B	0.21381	0.055	B	0.26969	0.075	T	0.52200	-0.8607	10	0.27082	T	0.32	.	11.9799	0.53113	0.13:0.0:0.0:0.87	.	137	Q8NI77	KI18A_HUMAN	L	137	ENSP00000263181:M137L	ENSP00000263181:M137L	M	-	1	0	KIF18A	28072840	1.000000	0.71417	0.988000	0.46212	0.950000	0.60333	5.139000	0.64801	0.929000	0.37192	0.529000	0.55759	ATG	.	.		0.388	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388328.3	NM_031217	
EI24	9538	hgsc.bcm.edu	37	11	125448940	125448940	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr11:125448940G>T	ENST00000278903.6	+	7	779	c.537G>T	c.(535-537)ttG>ttT	p.L179F	EI24_ENST00000530985.1_3'UTR|STT3A-AS1_ENST00000532714.1_RNA|STT3A-AS1_ENST00000530526.1_RNA|EI24_ENST00000343678.4_Missense_Mutation_p.L179F	NM_004879.3	NP_004870.3	O14681	EI24_HUMAN	etoposide induced 2.4	179					apoptotic process (GO:0006915)|autophagy (GO:0006914)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of cell growth (GO:0030308)|neuromuscular process controlling balance (GO:0050885)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|response to drug (GO:0042493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(1)|lung(9)|ovary(1)	11	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		TCAACCTTTTGCTGCAGGCTC	0.438																																					p.L179F		Atlas-SNP	.											.	EI24	33	.	0			c.G537T						.						68.0	57.0	61.0					11																	125448940		1863	4107	5970	SO:0001583	missense	9538	exon7			CCTTTTGCTGCAG	AF010313	CCDS73410.1	11q24.2	2012-11-19	2012-11-16		ENSG00000149547	ENSG00000149547			13276	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 4 homolog (C. elegans)"""	605170	"""etoposide induced 2.4 mRNA"""			10594026, 9305847	Standard	NM_001290135		Approved	PIG8, TP53I8, EPG4	uc001qcb.3	O14681	OTTHUMG00000165851	ENST00000278903.6:c.537G>T	chr11.hg19:g.125448940G>T	ENSP00000278903:p.Leu179Phe	152.0	0.0		179.0	15.0	NM_001007277	A8K7D6|B4DKL6|Q9BUQ1	Missense_Mutation	SNP	ENST00000278903.6	hg19		.	.	.	.	.	.	.	.	.	.	G	18.77	3.693754	0.68386	.	.	ENSG00000149547	ENST00000278903;ENST00000343678;ENST00000527842	.	.	.	5.25	4.32	0.51571	.	0.065455	0.64402	D	0.000007	T	0.77452	0.4132	M	0.79693	2.465	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.993;0.999;0.999	D;D;D;D	0.91635	0.999;0.992;0.998;0.999	T	0.79361	-0.1835	9	0.72032	D	0.01	-5.9291	10.3522	0.43943	0.1498:0.0:0.8502:0.0	.	165;179;179;179	B4DKL6;E9PM05;A6NES3;O14681	.;.;.;EI24_HUMAN	F	179	.	ENSP00000278903:L179F	L	+	3	2	EI24	124954150	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	0.577000	0.23758	2.615000	0.88500	0.650000	0.86243	TTG	.	.		0.438	EI24-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_004879	
A2ML1	144568	hgsc.bcm.edu	37	12	9027104	9027104	+	Silent	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr12:9027104C>T	ENST00000299698.7	+	34	4485	c.4305C>T	c.(4303-4305)gtC>gtT	p.V1435V	A2ML1_ENST00000539547.1_Silent_p.V944V	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CCATCAAGGTCTATGACTACT	0.468																																					p.V1435V		Atlas-SNP	.											.	A2ML1	199	.	0			c.C4305T						.						118.0	115.0	116.0					12																	9027104		2009	4169	6178	SO:0001819	synonymous_variant	144568	exon34			CAAGGTCTATGAC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.4305C>T	chr12.hg19:g.9027104C>T		92.0	0.0		97.0	26.0	NM_144670		Silent	SNP	ENST00000299698.7	hg19	CCDS8596.2																																																																																			.	.		0.468	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
WBP11	51729	hgsc.bcm.edu	37	12	14943652	14943652	+	Silent	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr12:14943652T>C	ENST00000261167.2	-	10	1280	c.1047A>G	c.(1045-1047)gtA>gtG	p.V349V		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	349					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						AAAATTCCTCTACTTCCCGTC	0.403																																					p.V349V		Atlas-SNP	.											.	WBP11	66	.	0			c.A1047G						.						144.0	136.0	139.0					12																	14943652		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon10			TTCCTCTACTTCC	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1047A>G	chr12.hg19:g.14943652T>C		308.0	0.0		372.0	67.0	NM_016312	Q96AY8	Silent	SNP	ENST00000261167.2	hg19	CCDS8666.1																																																																																			.	.		0.403	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400850.1	NM_016312	
SYT10	341359	hgsc.bcm.edu	37	12	33592365	33592365	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr12:33592365C>T	ENST00000228567.3	-	1	389	c.93G>A	c.(91-93)tgG>tgA	p.W31*	SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	31					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					AGCACTTCTCCCACTCCACCT	0.652																																					p.W31X		Atlas-SNP	.											.	SYT10	109	.	0			c.G93A						.						176.0	164.0	168.0					12																	33592365		2203	4300	6503	SO:0001587	stop_gained	341359	exon1			CTTCTCCCACTCC	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.93G>A	chr12.hg19:g.33592365C>T	ENSP00000228567:p.Trp31*	130.0	0.0		144.0	12.0	NM_198992	Q495U2	Nonsense_Mutation	SNP	ENST00000228567.3	hg19	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	C	41	8.953365	0.99016	.	.	ENSG00000110975	ENST00000228567	.	.	.	4.41	4.41	0.53225	.	0.210963	0.24117	U	0.041392	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	16.4521	0.83994	0.0:1.0:0.0:0.0	.	.	.	.	X	31	.	ENSP00000228567:W31X	W	-	3	0	SYT10	33483632	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.118000	0.50414	2.376000	0.81061	0.655000	0.94253	TGG	.	.		0.652	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992	
PRICKLE1	144165	hgsc.bcm.edu	37	12	42858905	42858905	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr12:42858905C>G	ENST00000455697.1	-	7	1216	c.931G>C	c.(931-933)Gac>Cac	p.D311H	PRICKLE1_ENST00000345127.3_Missense_Mutation_p.D311H|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.D311H|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.D311H|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.D311H	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	311	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		GCATGGACGTCTTCACCAAGA	0.507																																					p.D311H		Atlas-SNP	.											.	PRICKLE1	105	.	0			c.G931C						.						111.0	109.0	110.0					12																	42858905		2203	4300	6503	SO:0001583	missense	144165	exon7			GGACGTCTTCACC	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.931G>C	chr12.hg19:g.42858905C>G	ENSP00000401060:p.Asp311His	148.0	0.0		150.0	40.0	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	hg19	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572585	0.86542	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.33	5.33	0.75918	Zinc finger, LIM-type (1);	0.000000	0.85682	D	0.000000	T	0.78842	0.4347	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.80233	-0.1467	10	0.72032	D	0.01	-7.7765	19.3834	0.94546	0.0:1.0:0.0:0.0	.	311	Q96MT3	PRIC1_HUMAN	H	311	ENSP00000401060:D311H;ENSP00000398947:D311H;ENSP00000448359:D311H;ENSP00000345064:D311H;ENSP00000449819:D311H	ENSP00000345064:D311H	D	-	1	0	PRICKLE1	41145172	1.000000	0.71417	0.995000	0.50966	0.847000	0.48162	7.776000	0.85560	2.641000	0.89580	0.650000	0.86243	GAC	.	.		0.507	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
KIAA1033	23325	hgsc.bcm.edu	37	12	105538197	105538197	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr12:105538197C>A	ENST00000332180.5	+	21	2230	c.2143C>A	c.(2143-2145)Cca>Aca	p.P715T		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						CTCTCTGAATCCAATTCGGTT	0.373																																					p.P715T		Atlas-SNP	.											.	KIAA1033	83	.	0			c.C2143A						.						121.0	117.0	118.0					12																	105538197		1804	4078	5882	SO:0001583	missense	23325	exon21			CTGAATCCAATTC	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.2143C>A	chr12.hg19:g.105538197C>A	ENSP00000328062:p.Pro715Thr	367.0	0.0		422.0	75.0	NM_015275		Missense_Mutation	SNP	ENST00000332180.5	hg19	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	C	33	5.272716	0.95429	.	.	ENSG00000136051	ENST00000332180	T	0.49720	0.77	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.69949	0.3168	M	0.81614	2.55	0.80722	D	1	D;D	0.59767	0.986;0.986	P;P	0.59761	0.863;0.863	T	0.71758	-0.4496	10	0.72032	D	0.01	.	20.5934	0.99428	0.0:1.0:0.0:0.0	.	716;715	B7ZKT9;Q2M389	.;WASH7_HUMAN	T	715	ENSP00000328062:P715T	ENSP00000328062:P715T	P	+	1	0	KIAA1033	104062327	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.749000	0.85096	2.872000	0.98467	0.650000	0.86243	CCA	.	.		0.373	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
PAN3	255967	hgsc.bcm.edu	37	13	28794510	28794510	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr13:28794510C>T	ENST00000380958.3	+	6	1147	c.995C>T	c.(994-996)gCg>gTg	p.A332V	PAN3_ENST00000399613.1_Missense_Mutation_p.A132V	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GCTGGATTAGCGCCAGGTAAG	0.423																																					p.A332V		Atlas-SNP	.											.	PAN3	123	.	0			c.C995T						.						162.0	163.0	163.0					13																	28794510		2203	4300	6503	SO:0001583	missense	255967	exon6			GATTAGCGCCAGG	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.995C>T	chr13.hg19:g.28794510C>T	ENSP00000370345:p.Ala332Val	86.0	0.0		127.0	27.0	NM_175854		Missense_Mutation	SNP	ENST00000380958.3	hg19	CCDS9329.2	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740449	0.69304	.	.	ENSG00000152520	ENST00000380958;ENST00000399613	T;T	0.47869	0.83;0.87	5.6	5.6	0.85130	.	0.050294	0.85682	D	0.000000	T	0.35098	0.0920	N	0.19112	0.55	0.80722	D	1	P;P;B	0.51791	0.948;0.669;0.44	B;B;B	0.39503	0.301;0.036;0.016	T	0.11567	-1.0582	10	0.29301	T	0.29	-13.567	19.6153	0.95632	0.0:1.0:0.0:0.0	.	332;332;278	Q58A45-4;Q58A45;Q58A45-3	.;PAN3_HUMAN;.	V	332;132	ENSP00000370345:A332V;ENSP00000382522:A132V	ENSP00000370345:A332V	A	+	2	0	PAN3	27692510	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	5.642000	0.67888	2.630000	0.89119	0.555000	0.69702	GCG	.	.		0.423	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	
OR4N5	390437	hgsc.bcm.edu	37	14	20612277	20612277	+	Missense_Mutation	SNP	G	G	A	rs139546094		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr14:20612277G>A	ENST00000333629.1	+	1	383	c.383G>A	c.(382-384)cGg>cAg	p.R128Q	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		GCCATCTGCCGGCCTTTACAC	0.488																																					p.R128Q		Atlas-SNP	.											.	OR4N5	72	.	0			c.G383A						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	165.0	161.0	163.0		383	-0.2	0.0	14	dbSNP_134	163	0,8600		0,0,4300	no	missense	OR4N5	NM_001004724.1	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	128/309	20612277	1,13005	2203	4300	6503	SO:0001583	missense	390437	exon1			TCTGCCGGCCTTT		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.383G>A	chr14.hg19:g.20612277G>A	ENSP00000332110:p.Arg128Gln	347.0	0.0		416.0	100.0	NM_001004724	Q6IF11	Missense_Mutation	SNP	ENST00000333629.1	hg19	CCDS32031.1	.	.	.	.	.	.	.	.	.	.	G	4.710	0.131999	0.08981	2.27E-4	0.0	ENSG00000184394	ENST00000333629	T	0.00392	7.58	4.0	-0.184	0.13280	GPCR, rhodopsin-like superfamily (1);	0.597438	0.13923	N	0.353453	T	0.00210	0.0006	L	0.28014	0.82	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.34104	-0.9842	10	0.54805	T	0.06	.	7.4878	0.27443	0.5469:0.0:0.4531:0.0	.	128	Q8IXE1	OR4N5_HUMAN	Q	128	ENSP00000332110:R128Q	ENSP00000332110:R128Q	R	+	2	0	OR4N5	19682117	0.000000	0.05858	0.000000	0.03702	0.158000	0.22134	-0.209000	0.09358	-0.147000	0.11254	-0.136000	0.14681	CGG	.	G|1.000;A|0.000		0.488	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1		
ADAM10	102	hgsc.bcm.edu	37	15	58902701	58902701	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr15:58902701C>A	ENST00000260408.3	-	14	2263	c.1820G>T	c.(1819-1821)tGt>tTt	p.C607F	ADAM10_ENST00000396140.2_Missense_Mutation_p.C306F|ADAM10_ENST00000402627.1_Intron|ADAM10_ENST00000561288.1_Intron	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	607	Cys-rich.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		TGTACTGGCACAAGTTGATGG	0.438																																					p.C607F		Atlas-SNP	.											.	ADAM10	59	.	0			c.G1820T						.						60.0	58.0	59.0					15																	58902701		2192	4292	6484	SO:0001583	missense	102	exon14			CTGGCACAAGTTG	AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.1820G>T	chr15.hg19:g.58902701C>A	ENSP00000260408:p.Cys607Phe	96.0	0.0		115.0	23.0	NM_001110	B4DU28|Q10742|Q92650	Missense_Mutation	SNP	ENST00000260408.3	hg19	CCDS10167.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592056	0.86953	.	.	ENSG00000137845	ENST00000260408;ENST00000396136;ENST00000396140	T;T	0.33654	1.4;2.82	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.69233	0.3088	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.75921	-0.3147	10	0.87932	D	0	-18.8648	19.4747	0.94982	0.0:1.0:0.0:0.0	.	306;426;607	B4DU28;A8MY20;O14672	.;.;ADA10_HUMAN	F	607;426;306	ENSP00000260408:C607F;ENSP00000379444:C306F	ENSP00000260408:C607F	C	-	2	0	ADAM10	56689993	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.666000	0.90696	0.655000	0.94253	TGT	.	.		0.438	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255880.2	NM_001110	
CSPG4	1464	hgsc.bcm.edu	37	15	75983035	75983035	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr15:75983035G>A	ENST00000308508.5	-	3	463	c.371C>T	c.(370-372)tCa>tTa	p.S124L		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	124	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CCCATCGACTGACAACGTGGC	0.632																																					p.S124L		Atlas-SNP	.											.	CSPG4	175	.	0			c.C371T						.						64.0	65.0	65.0					15																	75983035		2197	4294	6491	SO:0001583	missense	1464	exon3			TCGACTGACAACG	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.371C>T	chr15.hg19:g.75983035G>A	ENSP00000312506:p.Ser124Leu	225.0	0.0		260.0	58.0	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	hg19	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	15.27	2.783403	0.49891	.	.	ENSG00000173546	ENST00000308508	T	0.78126	-1.15	4.76	2.73	0.32206	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.348037	0.23646	N	0.045972	T	0.64746	0.2626	L	0.38838	1.175	0.37045	D	0.897329	B	0.02656	0.0	B	0.08055	0.003	T	0.61168	-0.7117	10	0.31617	T	0.26	.	8.3308	0.32184	0.0889:0.1572:0.7538:0.0	.	124	Q6UVK1	CSPG4_HUMAN	L	124	ENSP00000312506:S124L	ENSP00000312506:S124L	S	-	2	0	CSPG4	73770090	0.999000	0.42202	0.198000	0.23420	0.011000	0.07611	2.949000	0.49074	0.998000	0.38996	0.555000	0.69702	TCA	.	.		0.632	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
LRRC28	123355	hgsc.bcm.edu	37	15	99796167	99796167	+	Missense_Mutation	SNP	C	C	T	rs539126226		TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr15:99796167C>T	ENST00000301981.3	+	2	245	c.5C>T	c.(4-6)gCg>gTg	p.A2V	LRRC28_ENST00000442993.2_Missense_Mutation_p.A2V|LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000422500.2_Missense_Mutation_p.A2V|LRRC28_ENST00000447360.2_Missense_Mutation_p.A2V|LRRC28_ENST00000558879.1_Missense_Mutation_p.A2V|AC022819.1_ENST00000581052.1_RNA|LRRC28_ENST00000331450.5_Missense_Mutation_p.A2V	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	2										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			TCAGTCATGGCGTCCGAACTT	0.378																																					p.A2V		Atlas-SNP	.											.	LRRC28	38	.	0			c.C5T						.						92.0	87.0	88.0					15																	99796167		2197	4297	6494	SO:0001583	missense	123355	exon2			TCATGGCGTCCGA	AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.5C>T	chr15.hg19:g.99796167C>T	ENSP00000304923:p.Ala2Val	141.0	0.0		191.0	19.0	NM_144598	A8KA22|Q6UY49|Q6ZSS6	Missense_Mutation	SNP	ENST00000301981.3	hg19	CCDS10380.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155429	0.78114	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500;ENST00000442993;ENST00000331450	T;T;T;T	0.53206	0.78;0.63;1.45;0.86	5.78	5.78	0.91487	.	0.050961	0.85682	D	0.000000	T	0.56587	0.1995	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.76071	0.986;0.987;0.981;0.98	T	0.58498	-0.7626	10	0.51188	T	0.08	.	19.0086	0.92863	0.0:1.0:0.0:0.0	.	2;2;2;2	B4DHL3;Q8WUS2;Q86X40-2;Q86X40	.;.;.;LRC28_HUMAN	V	2	ENSP00000304923:A2V;ENSP00000404520:A2V;ENSP00000398606:A2V;ENSP00000404206:A2V	ENSP00000304923:A2V	A	+	2	0	LRRC28	97613690	1.000000	0.71417	0.953000	0.39169	0.798000	0.45092	5.554000	0.67294	2.729000	0.93468	0.650000	0.86243	GCG	.	.		0.378	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313546.1	NM_144598	
JMJD8	339123	hgsc.bcm.edu	37	16	732214	732214	+	3'UTR	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr16:732214T>C	ENST00000293882.4	-	0	1584				JMJD8_ENST00000609261.1_3'UTR|JMJD8_ENST00000412368.2_3'UTR|LA16c-313D11.9_ENST00000571933.1_RNA|STUB1_ENST00000564370.1_Missense_Mutation_p.M168T|STUB1_ENST00000219548.4_Missense_Mutation_p.M240T|JMJD8_ENST00000454700.1_3'UTR|STUB1_ENST00000565677.1_Missense_Mutation_p.M168T|LA16c-313D11.9_ENST00000567091.1_RNA			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						TTTGAGCTGATGCGGGAGCCG	0.637																																					p.M240T		Atlas-SNP	.											.	STUB1	26	.	0			c.T719C						.						87.0	76.0	79.0					16																	732214		2201	4297	6498	SO:0001624	3_prime_UTR_variant	10273	exon6			AGCTGATGCGGGA		CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.*580A>G	chr16.hg19:g.732214T>C		96.0	0.0		56.0	22.0	NM_005861	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Missense_Mutation	SNP	ENST00000293882.4	hg19		.	.	.	.	.	.	.	.	.	.	T	18.29	3.590335	0.66105	.	.	ENSG00000103266	ENST00000219548	T	0.34859	1.34	4.3	4.3	0.51218	Zinc finger, RING/FYVE/PHD-type (1);U box domain (2);	0.000000	0.85682	D	0.000000	T	0.68824	0.3043	H	0.94658	3.565	0.80722	D	1	D	0.69078	0.997	D	0.87578	0.998	T	0.78560	-0.2157	10	0.87932	D	0	-32.0609	13.1338	0.59397	0.0:0.0:0.0:1.0	.	240	Q9UNE7	CHIP_HUMAN	T	240	ENSP00000219548:M240T	ENSP00000219548:M240T	M	+	2	0	STUB1	672215	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.775000	0.85489	1.947000	0.56498	0.449000	0.29647	ATG	.	.		0.637	JMJD8-201	KNOWN	basic	protein_coding	protein_coding		NM_001005920	
DNAH3	55567	hgsc.bcm.edu	37	16	21031159	21031159	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr16:21031159C>T	ENST00000261383.3	-	41	5808	c.5809G>A	c.(5809-5811)Gaa>Aaa	p.E1937K	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1937					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TCACCTAATTCCATTTCCTCC	0.483																																					p.E1937K		Atlas-SNP	.											.	DNAH3	1142	.	0			c.G5809A						.						85.0	79.0	81.0					16																	21031159		2201	4300	6501	SO:0001583	missense	55567	exon41			CTAATTCCATTTC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5809G>A	chr16.hg19:g.21031159C>T	ENSP00000261383:p.Glu1937Lys	481.0	0.0		434.0	93.0	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	hg19	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	9.251	1.040814	0.19669	.	.	ENSG00000158486	ENST00000261383	T	0.26957	1.7	5.46	5.46	0.80206	.	0.640158	0.15150	N	0.277762	T	0.16471	0.0396	N	0.16790	0.44	0.80722	D	1	P	0.37781	0.608	B	0.35413	0.202	T	0.07578	-1.0765	10	0.09338	T	0.73	.	16.8701	0.86038	0.0:1.0:0.0:0.0	.	1937	Q8TD57	DYH3_HUMAN	K	1937	ENSP00000261383:E1937K	ENSP00000261383:E1937K	E	-	1	0	DNAH3	20938660	0.875000	0.30112	0.065000	0.19835	0.078000	0.17371	2.276000	0.43408	2.597000	0.87782	0.558000	0.71614	GAA	.	.		0.483	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
POLR2A	5430	hgsc.bcm.edu	37	17	7404887	7404887	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:7404887G>T	ENST00000322644.6	+	14	2587	c.2188G>T	c.(2188-2190)Ggg>Tgg	p.G730W		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	730					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				GCCCACCCCAGGGAACACTCT	0.537																																					p.G730W		Atlas-SNP	.											.	POLR2A	157	.	0			c.G2188T						.						71.0	70.0	70.0					17																	7404887		2203	4300	6503	SO:0001583	missense	5430	exon14			ACCCCAGGGAACA			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2188G>T	chr17.hg19:g.7404887G>T	ENSP00000314949:p.Gly730Trp	88.0	0.0		96.0	34.0	NM_000937	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	hg19	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879958	0.72294	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.79653	-1.29	6.17	4.21	0.49690	RNA polymerase Rpb1, domain 4 (1);	0.000000	0.85682	D	0.000000	D	0.94162	0.8127	H	0.99634	4.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95088	0.8219	10	0.87932	D	0	-12.5474	12.2619	0.54655	0.1385:0.0:0.8615:0.0	.	730	P24928	RPB1_HUMAN	W	686;730	ENSP00000314949:G730W	ENSP00000314949:G730W	G	+	1	0	SLC35G6	7345611	1.000000	0.71417	0.935000	0.37517	0.935000	0.57460	9.639000	0.98448	0.955000	0.37878	-0.140000	0.14226	GGG	.	.		0.537	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
TEKT3	64518	hgsc.bcm.edu	37	17	15211984	15211984	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:15211984A>T	ENST00000395930.1	-	8	1439	c.1253T>A	c.(1252-1254)cTa>cAa	p.L418Q	TEKT3_ENST00000338696.2_Missense_Mutation_p.L418Q|TEKT3_ENST00000462175.1_5'Flank|RNU6-799P_ENST00000363567.1_RNA	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	418					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		ACCTTACCGTAGCTGAGCCAT	0.592																																					p.L418Q		Atlas-SNP	.											.	TEKT3	64	.	0			c.T1253A						.						162.0	130.0	141.0					17																	15211984		2203	4300	6503	SO:0001583	missense	64518	exon8			TACCGTAGCTGAG	AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.1253T>A	chr17.hg19:g.15211984A>T	ENSP00000379263:p.Leu418Gln	163.0	0.0		110.0	20.0	NM_031898	B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	ENST00000395930.1	hg19	CCDS11169.1	.	.	.	.	.	.	.	.	.	.	A	4.479	0.088802	0.08583	.	.	ENSG00000125409	ENST00000395930;ENST00000338696	T;T	0.02472	4.28;4.28	5.31	5.31	0.75309	.	0.180261	0.49916	D	0.000126	T	0.07098	0.0180	L	0.42245	1.32	0.09310	N	0.999999	P	0.52463	0.953	P	0.54431	0.752	T	0.33752	-0.9856	10	0.28530	T	0.3	.	14.7337	0.69402	1.0:0.0:0.0:0.0	.	418	Q9BXF9	TEKT3_HUMAN	Q	418	ENSP00000379263:L418Q;ENSP00000343995:L418Q	ENSP00000343995:L418Q	L	-	2	0	TEKT3	15152709	0.931000	0.31567	0.040000	0.18447	0.008000	0.06430	8.241000	0.89816	2.142000	0.66516	0.533000	0.62120	CTA	.	.		0.592	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130385.2	NM_031898	
NAGLU	4669	hgsc.bcm.edu	37	17	40696106	40696106	+	Silent	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:40696106G>A	ENST00000225927.2	+	6	2183	c.2082G>A	c.(2080-2082)caG>caA	p.Q694Q	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	694					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	CTTTCCAACAGCACCAGTTTG	0.602																																					p.Q694Q		Atlas-SNP	.											.	NAGLU	36	.	0			c.G2082A						.						50.0	46.0	47.0					17																	40696106		2203	4300	6503	SO:0001819	synonymous_variant	4669	exon6			CCAACAGCACCAG		CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.2082G>A	chr17.hg19:g.40696106G>A		70.0	0.0		63.0	16.0	NM_000263		Silent	SNP	ENST00000225927.2	hg19	CCDS11427.1																																																																																			.	.		0.602	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
RSAD1	55316	hgsc.bcm.edu	37	17	48557383	48557383	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:48557383C>G	ENST00000258955.2	+	3	497	c.412C>G	c.(412-414)Ccg>Gcg	p.P138A		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	138					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TACTTCAGCTCCGGGCTCCAG	0.617											OREG0024566	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P138A		Atlas-SNP	.											.	RSAD1	36	.	0			c.C412G						.						60.0	66.0	64.0					17																	48557383		2203	4300	6503	SO:0001583	missense	55316	exon3			TCAGCTCCGGGCT	AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.412C>G	chr17.hg19:g.48557383C>G	ENSP00000258955:p.Pro138Ala	144.0	0.0	955	131.0	20.0	NM_018346	B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Missense_Mutation	SNP	ENST00000258955.2	hg19	CCDS11569.1	.	.	.	.	.	.	.	.	.	.	C	6.757	0.508464	0.12883	.	.	ENSG00000136444	ENST00000258955	T	0.22539	1.95	4.64	1.29	0.21616	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);Radical SAM (1);	0.455201	0.23424	N	0.048323	T	0.07683	0.0193	N	0.03983	-0.305	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.14023	0.01;0.001	T	0.22417	-1.0217	10	0.62326	D	0.03	-1.4563	3.8695	0.09030	0.2145:0.3296:0.3721:0.0837	.	138;138	B4DEV9;Q9HA92	.;RSAD1_HUMAN	A	138	ENSP00000258955:P138A	ENSP00000258955:P138A	P	+	1	0	RSAD1	45912382	0.033000	0.19621	0.658000	0.29665	0.026000	0.11368	1.111000	0.31159	0.544000	0.28883	0.491000	0.48974	CCG	.	.		0.617	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367413.1	NM_018346	
MRC2	9902	hgsc.bcm.edu	37	17	60744895	60744895	+	Splice_Site	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:60744895G>T	ENST00000303375.5	+	6	1519		c.e6+1			NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						ACCCCTCCAGGTGAGCCAGGG	0.687																																					.		Atlas-SNP	.											.	MRC2	126	.	0			c.1117+1G>T						.						39.0	36.0	37.0					17																	60744895		2203	4300	6503	SO:0001630	splice_region_variant	9902	exon6			CTCCAGGTGAGCC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.1117+1G>T	chr17.hg19:g.60744895G>T		34.0	0.0		32.0	7.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Splice_Site	SNP	ENST00000303375.5	hg19	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686684	0.88639	.	.	ENSG00000011028	ENST00000303375	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9212	0.70838	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRC2	58098627	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.534000	0.90620	2.425000	0.82216	0.462000	0.41574	.	.	.		0.687	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		Intron
STRADA	92335	hgsc.bcm.edu	37	17	61788154	61788154	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:61788154C>A	ENST00000336174.6	-	7	503	c.391G>T	c.(391-393)Gtg>Ttg	p.V131L	STRADA_ENST00000447001.3_Missense_Mutation_p.V87L|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000245865.5_Missense_Mutation_p.V73L|STRADA_ENST00000582137.1_Missense_Mutation_p.V102L|STRADA_ENST00000392950.4_Missense_Mutation_p.V94L|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000579340.1_Missense_Mutation_p.V73L|STRADA_ENST00000375840.4_Missense_Mutation_p.V73L	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	131	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						CGATATGGCACGATATTGGGA	0.483																																					p.V131L		Atlas-SNP	.											.	STRADA	27	.	0			c.G391T						.						150.0	120.0	130.0					17																	61788154		2203	4300	6503	SO:0001583	missense	92335	exon7			ATGGCACGATATT	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.391G>T	chr17.hg19:g.61788154C>A	ENSP00000336655:p.Val131Leu	127.0	0.0		156.0	28.0	NM_001003787	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	hg19	CCDS32703.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.014291	0.35511	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000447001;ENST00000392950;ENST00000245865	T;T;T;T	0.70164	-0.46;-0.46;-0.46;1.24	4.97	1.9	0.25705	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.446177	0.23635	N	0.046087	T	0.39784	0.1091	N	0.11023	0.085	0.37101	D	0.8999	B;B;B;B;B;B;B	0.14438	0.0;0.003;0.004;0.0;0.001;0.01;0.001	B;B;B;B;B;B;B	0.16289	0.001;0.005;0.009;0.002;0.001;0.015;0.005	T	0.37244	-0.9714	10	0.05436	T	0.98	.	10.8638	0.46842	0.0:0.6327:0.2905:0.0768	.	102;87;73;73;94;94;131	B4DW17;B4DDE3;Q5JPI2;Q86YC8;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;.;.;.;STRAA_HUMAN	L	131;73;87;94;93	ENSP00000336655:V131L;ENSP00000365000:V73L;ENSP00000398841:V87L;ENSP00000376677:V94L	ENSP00000245865:V93L	V	-	1	0	STRADA	59141886	1.000000	0.71417	0.971000	0.41717	0.949000	0.60115	2.178000	0.42519	0.295000	0.22570	0.561000	0.74099	GTG	.	.		0.483	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1		
SCN4A	6329	hgsc.bcm.edu	37	17	62018994	62018994	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:62018994G>T	ENST00000435607.1	-	24	4724	c.4648C>A	c.(4648-4650)Ccc>Acc	p.P1550T	SCN4A_ENST00000578147.1_Missense_Mutation_p.P1550T	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1550					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGTCTGGGGGCCCGCTGTTG	0.602																																					p.P1550T		Atlas-SNP	.											.	SCN4A	205	.	0			c.C4648A						.						30.0	35.0	34.0					17																	62018994		2125	4249	6374	SO:0001583	missense	6329	exon24			CTGGGGGCCCGCT	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.4648C>A	chr17.hg19:g.62018994G>T	ENSP00000396320:p.Pro1550Thr	115.0	0.0		92.0	21.0	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	hg19	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	g	16.51	3.144501	0.57044	.	.	ENSG00000007314	ENST00000435607	D	0.97279	-4.32	3.9	3.9	0.45041	Ion transport (1);	0.165679	0.53938	D	0.000044	D	0.98210	0.9408	M	0.88979	2.995	0.52501	D	0.999958	D	0.63880	0.993	P	0.58928	0.848	D	0.98956	1.0796	10	0.66056	D	0.02	.	15.4266	0.75055	0.0:0.0:1.0:0.0	.	1550	P35499	SCN4A_HUMAN	T	1550	ENSP00000396320:P1550T	ENSP00000396320:P1550T	P	-	1	0	SCN4A	59372726	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	4.067000	0.57527	2.177000	0.69029	0.556000	0.70494	CCC	.	.		0.602	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
RPTOR	57521	hgsc.bcm.edu	37	17	78704429	78704429	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr17:78704429G>A	ENST00000306801.3	+	5	939	c.577G>A	c.(577-579)Gtc>Atc	p.V193I	RPTOR_ENST00000544334.2_Missense_Mutation_p.V193I|RPTOR_ENST00000570891.1_Missense_Mutation_p.V193I|RPTOR_ENST00000537330.1_Missense_Mutation_p.V8I	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	193					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.V193I(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GTCGATCTTCGTCTACGACTG	0.537																																					p.V193I		Atlas-SNP	.											RPTOR,caecum,carcinoma,-1,1	RPTOR	122	.	1	Substitution - Missense(1)	lung(1)	c.G577A						.						136.0	98.0	111.0					17																	78704429		2203	4300	6503	SO:0001583	missense	57521	exon5			ATCTTCGTCTACG		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.577G>A	chr17.hg19:g.78704429G>A	ENSP00000307272:p.Val193Ile	134.0	0.0		131.0	16.0	NM_001163034	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	hg19	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	18.78	3.697643	0.68386	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	T;T	0.57436	0.4;0.5	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000001	T	0.69115	0.3075	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	0.981;0.995;1.0	D;P;D	0.65010	0.931;0.686;0.927	T	0.66172	-0.5990	10	0.25106	T	0.35	.	17.9664	0.89100	0.0:0.0:1.0:0.0	.	193;8;193	F5H7J5;F5GXV9;Q8N122	.;.;RPTOR_HUMAN	I	8;193;193	ENSP00000307272:V193I;ENSP00000442479:V193I	ENSP00000307272:V193I	V	+	1	0	RPTOR	76319024	1.000000	0.71417	0.978000	0.43139	0.373000	0.29922	9.534000	0.98061	2.445000	0.82738	0.655000	0.94253	GTC	.	.		0.537	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
EPG5	57724	hgsc.bcm.edu	37	18	43532588	43532588	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr18:43532588T>C	ENST00000282041.5	-	3	1064	c.1030A>G	c.(1030-1032)Aaa>Gaa	p.K344E		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	344					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CTGAAAACTTTCACTTGATCT	0.413																																					p.K344E		Atlas-SNP	.											.	EPG5	199	.	0			c.A1030G						.						88.0	86.0	86.0					18																	43532588		1893	4118	6011	SO:0001583	missense	57724	exon3			AAACTTTCACTTG	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.1030A>G	chr18.hg19:g.43532588T>C	ENSP00000282041:p.Lys344Glu	341.0	0.0		430.0	71.0	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	hg19	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.883644	0.91740	.	.	ENSG00000152223	ENST00000282041	T	0.80824	-1.42	5.59	5.59	0.84812	.	0.257192	0.45126	D	0.000391	D	0.87669	0.6235	L	0.56769	1.78	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.87245	0.2269	10	0.44086	T	0.13	-19.4113	16.065	0.80865	0.0:0.0:0.0:1.0	.	344;344	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	E	344	ENSP00000282041:K344E	ENSP00000282041:K344E	K	-	1	0	EPG5	41786586	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.782000	0.68973	2.257000	0.74773	0.460000	0.39030	AAA	.	.		0.413	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
LRG1	116844	hgsc.bcm.edu	37	19	4538064	4538064	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr19:4538064T>C	ENST00000306390.6	-	2	1392	c.932A>G	c.(931-933)tAt>tGt	p.Y311C	PLIN5_ENST00000381848.3_5'Flank|CTB-50L17.14_ENST00000586020.1_Intron|PLIN5_ENST00000586133.1_5'Flank|LRG1_ENST00000586883.1_5'Flank	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	311	LRRCT.				brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGCCAACGATAGAGGTCGCT	0.602																																					p.Y311C		Atlas-SNP	.											.	LRG1	25	.	0			c.A932G						.						74.0	68.0	70.0					19																	4538064		2203	4300	6503	SO:0001583	missense	116844	exon2			CAACGATAGAGGT		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.932A>G	chr19.hg19:g.4538064T>C	ENSP00000302621:p.Tyr311Cys	91.0	0.0		101.0	15.0	NM_052972	Q8N4F5|Q96QZ4	Missense_Mutation	SNP	ENST00000306390.6	hg19	CCDS12130.1	.	.	.	.	.	.	.	.	.	.	.	9.954	1.221030	0.22457	.	.	ENSG00000171236	ENST00000306390;ENST00000538589	T	0.02323	4.34	5.24	-8.8	0.00817	Cysteine-rich flanking region, C-terminal (1);	1.160920	0.06603	N	0.754204	T	0.01661	0.0053	N	0.25201	0.72	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44682	-0.9312	10	0.38643	T	0.18	2.0E-4	2.1433	0.03780	0.5087:0.2058:0.1036:0.1819	.	311	P02750	A2GL_HUMAN	C	311;294	ENSP00000302621:Y311C	ENSP00000302621:Y311C	Y	-	2	0	LRG1	4489064	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.425000	0.02446	-2.408000	0.00573	-0.301000	0.09380	TAT	.	.		0.602	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458654.2	NM_052972	
MUC16	94025	hgsc.bcm.edu	37	19	9020787	9020787	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr19:9020787C>A	ENST00000397910.4	-	20	37518	c.37315G>T	c.(37315-37317)Ggc>Tgc	p.G12439C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12441	SEA 3. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGTCTGCAGCCAGAGTACAGA	0.547																																					p.G12439C		Atlas-SNP	.											.	MUC16	4315	.	0			c.G37315T						.						169.0	146.0	153.0					19																	9020787		2017	4175	6192	SO:0001583	missense	94025	exon20			TGCAGCCAGAGTA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37315G>T	chr19.hg19:g.9020787C>A	ENSP00000381008:p.Gly12439Cys	325.0	0.0		327.0	71.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	.	9.665	1.145184	0.21288	.	.	ENSG00000181143	ENST00000397910	T	0.39997	1.05	3.19	2.1	0.27182	.	.	.	.	.	T	0.64594	0.2612	M	0.86953	2.85	.	.	.	D	0.89917	1.0	D	0.79108	0.992	T	0.73525	-0.3955	8	0.87932	D	0	.	8.8964	0.35467	0.0:0.7699:0.2301:0.0	.	12439	B5ME49	.	C	12439	ENSP00000381008:G12439C	ENSP00000381008:G12439C	G	-	1	0	MUC16	8881787	0.010000	0.17322	0.133000	0.22050	0.290000	0.27261	0.228000	0.17814	0.573000	0.29400	0.455000	0.32223	GGC	.	.		0.547	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NOTCH3	4854	hgsc.bcm.edu	37	19	15297927	15297927	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr19:15297927G>T	ENST00000263388.2	-	11	1904	c.1829C>A	c.(1828-1830)tCt>tAt	p.S610Y		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	610	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGTGGTCCCAGAAGGGCAGCG	0.652																																					p.S610Y		Atlas-SNP	.											.	NOTCH3	340	.	0			c.C1829A						.						28.0	28.0	28.0					19																	15297927		2203	4300	6503	SO:0001583	missense	4854	exon11			GTCCCAGAAGGGC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1829C>A	chr19.hg19:g.15297927G>T	ENSP00000263388:p.Ser610Tyr	217.0	0.0		173.0	35.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	hg19	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544100	0.45280	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.91894	-2.93	4.51	3.45	0.39498	EGF (1);EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.89921	0.6855	L	0.46670	1.46	0.42160	D	0.991598	B;B	0.28178	0.202;0.043	B;B	0.40410	0.328;0.128	D	0.88658	0.3187	9	0.87932	D	0	.	6.5569	0.22466	0.0956:0.0:0.7233:0.1811	.	613;610	Q59FL3;Q9UM47	.;NOTC3_HUMAN	Y	610;612	ENSP00000263388:S610Y	ENSP00000263388:S610Y	S	-	2	0	NOTCH3	15158927	0.000000	0.05858	0.962000	0.40283	0.968000	0.65278	0.318000	0.19504	2.215000	0.71742	0.655000	0.94253	TCT	.	.		0.652	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
CD22	933	hgsc.bcm.edu	37	19	35823581	35823581	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr19:35823581T>C	ENST00000085219.5	+	3	232	c.166T>C	c.(166-168)Ttc>Ctc	p.F56L	CD22_ENST00000536635.2_Missense_Mutation_p.F56L|CD22_ENST00000544992.2_Missense_Mutation_p.F56L|CD22_ENST00000270311.6_5'UTR|CD22_ENST00000594250.1_Missense_Mutation_p.F56L|CD22_ENST00000341773.6_Missense_Mutation_p.F56L|CD22_ENST00000419549.2_5'UTR|U62631.5_ENST00000597110.1_RNA|CD22_ENST00000595419.1_3'UTR	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	56	Ig-like V-type.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCTGGAAAGCTTCATCCTGTT	0.507																																					p.F56L	Ovarian(42;1009 1133 23674 26041)	Atlas-SNP	.											.	CD22	129	.	0			c.T166C						.						87.0	86.0	86.0					19																	35823581		2203	4300	6503	SO:0001583	missense	933	exon3			GAAAGCTTCATCC	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.166T>C	chr19.hg19:g.35823581T>C	ENSP00000085219:p.Phe56Leu	165.0	0.0		230.0	44.0	NM_001185100	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	ENST00000085219.5	hg19	CCDS12457.1	.	.	.	.	.	.	.	.	.	.	T	6.397	0.441309	0.12164	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.42	-5.26	0.02772	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.128640	0.06779	N	0.784875	T	0.08846	0.0219	N	0.02721	-0.515	0.09310	N	0.999992	B;B;B;B	0.18968	0.0;0.032;0.0;0.001	B;B;B;B	0.20767	0.001;0.031;0.001;0.001	T	0.24764	-1.0151	10	0.12103	T	0.63	.	1.1372	0.01758	0.2629:0.4005:0.1254:0.2112	.	56;56;56;56	F5GYU4;F5H7U3;P20273;P20273-2	.;.;CD22_HUMAN;.	L	56	ENSP00000085219:F56L;ENSP00000442279:F56L;ENSP00000339349:F56L;ENSP00000441237:F56L	ENSP00000085219:F56L	F	+	1	0	CD22	40515421	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.830000	0.00744	-1.149000	0.02843	-0.461000	0.05368	TTC	.	.		0.507	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466099.1	NM_001771	
WDR87	83889	hgsc.bcm.edu	37	19	38378259	38378259	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr19:38378259C>A	ENST00000303868.5	-	6	6159	c.5935G>T	c.(5935-5937)Gag>Tag	p.E1979*	WDR87_ENST00000447313.2_Nonsense_Mutation_p.E2018*	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1979	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TCTTTTCCCTCAACCAGTCTC	0.408																																					p.E1979X		Atlas-SNP	.											.	WDR87	191	.	0			c.G5935T						.						59.0	45.0	49.0					19																	38378259		692	1591	2283	SO:0001587	stop_gained	83889	exon6			TTCCCTCAACCAG	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5935G>T	chr19.hg19:g.38378259C>A	ENSP00000368025:p.Glu1979*	628.0	1.0		799.0	152.0	NM_031951	Q9BWV9	Nonsense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	C	44	10.604849	0.99436	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	.	.	.	4.84	-3.88	0.04205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	3.6193	0.08089	0.1262:0.203:0.4871:0.1837	.	.	.	.	X	2018;1979	.	ENSP00000368025:E1979X	E	-	1	0	WDR87	43070099	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.878000	0.28126	-0.263000	0.09378	0.637000	0.83480	GAG	.	.		0.408	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
ZNF221	7638	hgsc.bcm.edu	37	19	44471487	44471487	+	Silent	SNP	A	A	C			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr19:44471487A>C	ENST00000251269.5	+	6	2161	c.1833A>C	c.(1831-1833)ctA>ctC	p.L611L	ZNF221_ENST00000592350.1_Silent_p.L611L|ZNF221_ENST00000587682.1_Silent_p.L611L	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	611					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				CAGTAAGTCTATGTGGGAGAA	0.438																																					p.L611L		Atlas-SNP	.											.	ZNF221	59	.	0			c.A1833C						.						60.0	61.0	61.0					19																	44471487		2203	4300	6503	SO:0001819	synonymous_variant	7638	exon6			AAGTCTATGTGGG	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1833A>C	chr19.hg19:g.44471487A>C		66.0	0.0		98.0	18.0	NM_013359	B2RAI6|Q2M2H2|Q9P1U8	Silent	SNP	ENST00000251269.5	hg19	CCDS12633.1																																																																																			.	.		0.438	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
LILRB4	11006	hgsc.bcm.edu	37	19	55175420	55175420	+	Silent	SNP	A	A	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr19:55175420A>T	ENST00000391736.1	+	5	594	c.279A>T	c.(277-279)gcA>gcT	p.A93A	LILRB4_ENST00000391734.3_Silent_p.A93A|LILRB4_ENST00000270452.2_Silent_p.A93A|LILRB4_ENST00000430952.2_Silent_p.A93A|LILRB4_ENST00000391733.3_Silent_p.A93A	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	93	Ig-like C2-type 1.				immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		AGGACTATGCAGGGAGATACC	0.572																																					p.A93A		Atlas-SNP	.											LILRB4,NS,carcinoma,+1,1	LILRB4	86	.	0			c.A279T						.						283.0	246.0	259.0					19																	55175420		2203	4300	6503	SO:0001819	synonymous_variant	11006	exon3			CTATGCAGGGAGA	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.279A>T	chr19.hg19:g.55175420A>T		557.0	0.0		549.0	102.0	NM_006847	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Silent	SNP	ENST00000391736.1	hg19	CCDS12902.1																																																																																			.	.		0.572	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
SLC13A3	64849	hgsc.bcm.edu	37	20	45194931	45194931	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr20:45194931G>T	ENST00000279027.4	-	11	1449	c.1431C>A	c.(1429-1431)ttC>ttA	p.F477L	SLC13A3_ENST00000435032.1_Missense_Mutation_p.F62L|SLC13A3_ENST00000396360.1_Missense_Mutation_p.F395L|SLC13A3_ENST00000472148.1_Missense_Mutation_p.F395L|SLC13A3_ENST00000290317.5_Missense_Mutation_p.F430L|SLC13A3_ENST00000413164.2_Missense_Mutation_p.F427L|SLC13A3_ENST00000495082.1_Missense_Mutation_p.F430L	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	477					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ACTCAGTGAAGAAGGCGATGA	0.617																																					p.F477L		Atlas-SNP	.											.	SLC13A3	88	.	0			c.C1431A						.						113.0	113.0	113.0					20																	45194931		2203	4300	6503	SO:0001583	missense	64849	exon11			AGTGAAGAAGGCG	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1431C>A	chr20.hg19:g.45194931G>T	ENSP00000279027:p.Phe477Leu	140.0	0.0		139.0	19.0	NM_022829	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	hg19	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383865	0.25031	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000435032;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082	T;T;T;T;T;T;T	0.02472	4.28;4.28;4.28;4.28;4.28;4.28;4.28	5.09	5.09	0.68999	.	0.158141	0.64402	D	0.000020	T	0.02418	0.0074	N	0.20766	0.605	0.80722	D	1	B;B;B;B;B;B	0.13594	0.002;0.004;0.004;0.002;0.005;0.008	B;B;B;B;B;B	0.18871	0.013;0.022;0.009;0.014;0.023;0.015	T	0.56444	-0.7978	10	0.23891	T	0.37	-21.8466	10.668	0.45741	0.0:0.2046:0.6644:0.131	.	427;62;395;430;379;477	B4DIR8;B4E181;Q8WWT9-3;F6WI18;B4DF27;Q8WWT9	.;.;.;.;.;S13A3_HUMAN	L	430;395;62;477;395;427;430	ENSP00000290317:F430L;ENSP00000379648:F395L;ENSP00000403394:F62L;ENSP00000279027:F477L;ENSP00000420177:F395L;ENSP00000415852:F427L;ENSP00000419621:F430L	ENSP00000279027:F477L	F	-	3	2	SLC13A3	44628338	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	2.992000	0.49417	2.365000	0.80145	0.561000	0.74099	TTC	.	.		0.617	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
URB1	9875	hgsc.bcm.edu	37	21	33691583	33691583	+	Silent	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr21:33691583G>A	ENST00000382751.3	-	36	5851	c.5736C>T	c.(5734-5736)gcC>gcT	p.A1912A		NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	1912						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						CCAGGTGCAGGGCAAGCCGCT	0.612																																					p.A1912A		Atlas-SNP	.											.	URB1	176	.	0			c.C5736T						.						34.0	41.0	39.0					21																	33691583		692	1591	2283	SO:0001819	synonymous_variant	9875	exon36			GTGCAGGGCAAGC	AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.5736C>T	chr21.hg19:g.33691583G>A		114.0	0.0		99.0	26.0	NM_014825	D3DSE5|Q96NX1|Q9NYQ1	Silent	SNP	ENST00000382751.3	hg19	CCDS46645.1																																																																																			.	.		0.612	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139400.2		
SFI1	9814	hgsc.bcm.edu	37	22	31979928	31979928	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr22:31979928C>A	ENST00000400288.2	+	13	1421	c.1316C>A	c.(1315-1317)cCc>cAc	p.P439H	SFI1_ENST00000432498.1_Missense_Mutation_p.P408H|SFI1_ENST00000443326.1_Missense_Mutation_p.P357H|SFI1_ENST00000400289.1_Missense_Mutation_p.P357H|SFI1_ENST00000443011.1_Missense_Mutation_p.P286H|SFI1_ENST00000540643.1_Missense_Mutation_p.P384H|SFI1_ENST00000414585.1_Missense_Mutation_p.P286H	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	439					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GAGCTGCTCCCCTTACTGCAT	0.512																																					p.P439H		Atlas-SNP	.											.	SFI1	78	.	0			c.C1316A						.						142.0	144.0	144.0					22																	31979928		1995	4173	6168	SO:0001583	missense	9814	exon13			TGCTCCCCTTACT	AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.1316C>A	chr22.hg19:g.31979928C>A	ENSP00000383145:p.Pro439His	109.0	0.0		151.0	29.0	NM_001007467	A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	ENST00000400288.2	hg19	CCDS43004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.01|16.01	3.002487|3.002487	0.54254|0.54254	.|.	.|.	ENSG00000198089|ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682|ENST00000425671	T;T;T;T;T;T;T;T|.	0.58940|.	2.98;3.0;0.3;0.3;0.3;0.3;0.3;2.44|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.406771|0.406771	0.27096|0.27096	N|N	0.020949|0.020949	T|T	0.33206|0.33206	0.0855|0.0855	N|N	0.08118|0.08118	0|0	0.19945|0.19945	N|N	0.999944|0.999944	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.91635|.	0.982;0.972;0.999;0.982;0.999;0.996|.	T|T	0.41324|0.41324	-0.9515|-0.9515	10|7	0.72032|0.87932	D|D	0.01|0	.|.	15.9221|15.9221	0.79583|0.79583	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	384;357;357;408;439;415|.	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3;A8K8P3-5|.	.;.;.;.;SFI1_HUMAN;.|.	H|T	408;384;357;415;286;286;357;439;54|13	ENSP00000402679:P408H;ENSP00000443025:P384H;ENSP00000416469:P357H;ENSP00000397148:P286H;ENSP00000401199:P286H;ENSP00000383146:P357H;ENSP00000383145:P439H;ENSP00000398871:P54H|.	ENSP00000383145:P439H|ENSP00000416931:P13T	P|P	+|+	2|1	0|0	SFI1|SFI1	30309928|30309928	0.055000|0.055000	0.20627|0.20627	0.466000|0.466000	0.27168|0.27168	0.227000|0.227000	0.25037|0.25037	4.205000|4.205000	0.58466|0.58466	2.832000|2.832000	0.97577|0.97577	0.655000|0.655000	0.94253|0.94253	CCC|CCT	.	.		0.512	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337180.3	NM_014775	
MED14	9282	hgsc.bcm.edu	37	X	40572166	40572166	+	Splice_Site	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chrX:40572166C>T	ENST00000324817.1	-	6	899	c.781G>A	c.(781-783)Gat>Aat	p.D261N		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	261	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TATGATTTACCTCCTGTTTCC	0.373																																					p.D261N		Atlas-SNP	.											.	MED14	108	.	0			c.G781A						.						69.0	54.0	59.0					X																	40572166		2203	4300	6503	SO:0001630	splice_region_variant	9282	exon6			ATTTACCTCCTGT	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.781+1G>A	chrX.hg19:g.40572166C>T		268.0	0.0		357.0	140.0	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	hg19	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968760	0.74131	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.53594	0.1806	L	0.38953	1.18	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.47824	-0.9087	8	.	.	.	.	18.1915	0.89808	0.0:1.0:0.0:0.0	.	261	O60244	MED14_HUMAN	N	261	.	.	D	-	1	0	MED14	40457110	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.397000	0.79903	2.321000	0.78463	0.594000	0.82650	GAT	.	.		0.373	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	Missense_Mutation
JADE3	9767	hgsc.bcm.edu	37	X	46844301	46844301	+	Silent	SNP	A	A	G			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chrX:46844301A>G	ENST00000218343.4	+	2	304	c.6A>G	c.(4-6)aaA>aaG	p.K2K	PHF16_ENST00000397189.1_Silent_p.K2K	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						CCAGGATGAAACGCCATAGGC	0.483																																					p.K2K		Atlas-SNP	.											.	PHF16	72	.	0			c.A6G						.						138.0	118.0	125.0					X																	46844301		2203	4300	6503	SO:0001819	synonymous_variant	9767	exon2			GATGAAACGCCAT																												ENST00000218343.4:c.6A>G	chrX.hg19:g.46844301A>G		209.0	0.0		215.0	67.0	NM_001077445		Silent	SNP	ENST00000218343.4	hg19	CCDS14271.1																																																																																			.	.		0.483	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1		
RPS4Y2	140032	hgsc.bcm.edu	37	Y	22941543	22941543	+	Silent	SNP	C	C	T			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chrY:22941543C>T	ENST00000288666.5	+	6	681	c.681C>T	c.(679-681)gtC>gtT	p.V227V		NM_001039567.2	NP_001034656.1	Q8TD47	RS4Y2_HUMAN	ribosomal protein S4, Y-linked 2	227					translation (GO:0006412)	ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			lung(2)	2						ACATTTTTGTCATTGGCAATG	0.418																																					p.V227V		Atlas-SNP	.											.	RPS4Y2	3	.	0			c.C681T						.						134.0	126.0	128.0					Y																	22941543		618	1974	2592	SO:0001819	synonymous_variant	140032	exon6			TTTTGTCATTGGC	AF497481	CCDS44028.1	Yq11.223	2006-02-22	2006-02-22	2006-02-22	ENSG00000157828	ENSG00000157828		"""S ribosomal proteins"""	18501	protein-coding gene	gene with protein product		400030	"""ribosomal protein S4, Y-linked 2 pseudogene"""	RPS4Y2P		12815422	Standard	NM_001039567		Approved		uc011nbb.2	Q8TD47	OTTHUMG00000036540	ENST00000288666.5:c.681C>T	chrY.hg19:g.22941543C>T		339.0	0.0		305.0	128.0	NM_001039567	A6NIR6	Silent	SNP	ENST00000288666.5	hg19	CCDS44028.1																																																																																			.	.		0.418	RPS4Y2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088873.1		
MT-ND5	4540	hgsc.bcm.edu	37	M	12442	12442	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chrM:12442G>A	ENST00000361567.2	+	1	106	c.106G>A	c.(106-108)Gta>Ata	p.V36I	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	36					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ACCCCCATTATGTAAAATCCA	0.428																																					p.V36M		Atlas-SNP	.											.	.	.	.	0			c.G106A						.																																			SO:0001583	missense	0	exon1			CATTATGTAAAAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.106G>A	chrM.hg19:g.12442G>A	ENSP00000354813:p.Val36Ile	417.0	0.0		456.0	374.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
CPS1	1373	hgsc.bcm.edu	37	2	211456588	211456589	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr2:211456588_211456589insA	ENST00000233072.5	+	10	1177_1178	c.981_982insA	c.(982-984)aaafs	p.K328fs	CPS1_ENST00000430249.2_Frame_Shift_Ins_p.K334fs|CPS1_ENST00000451903.2_5'Flank	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	328	Glutamine amidotransferase type-1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ATATCACAAACAAACAGGCTTT	0.396																																					p.N333fs		Atlas-Indel,Pindel	.											.	CPS1	485	.	0			c.999_1000insA						.																																			SO:0001589	frameshift_variant	1373	exon11			.	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.984dupA	chr2.hg19:g.211456591_211456591dupA	ENSP00000233072:p.Lys328fs	179.0	0.0		261.0	50.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Frame_Shift_Ins	INS	ENST00000233072.5	hg19	CCDS2393.1																																																																																			.	.		0.396	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
ELMOD1	55531	hgsc.bcm.edu	37	11	107518278	107518278	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr11:107518278delC	ENST00000265840.7	+	7	770	c.505delC	c.(505-507)cctfs	p.P169fs	ELMOD1_ENST00000443271.2_Frame_Shift_Del_p.P169fs|ELMOD1_ENST00000531234.1_Frame_Shift_Del_p.P163fs	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	169	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		AGGTGATGATCCTAAAACAGA	0.403																																					p.D168fs		Atlas-Indel,Pindel	.											.	ELMOD1	40	.	0			c.504delT						.						128.0	122.0	124.0					11																	107518278		1854	4109	5963	SO:0001589	frameshift_variant	55531	exon7			.	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.505delC	chr11.hg19:g.107518278delC	ENSP00000265840:p.Pro169fs	153.0	0.0		173.0	41.0	NM_018712	B4E167|G5E9S5|Q9NPW3	Frame_Shift_Del	DEL	ENST00000265840.7	hg19	CCDS44723.1																																																																																			.	.		0.403	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	NM_018712	
TESK2	10420	hgsc.bcm.edu	37	1	45810698	45810699	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr1:45810698_45810699insTG	ENST00000372086.3	-	11	1929_1930	c.1529_1530insCA	c.(1528-1530)catfs	p.H510fs	TESK2_ENST00000538496.1_Frame_Shift_Ins_p.H427fs|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_Frame_Shift_Ins_p.H481fs|TESK2_ENST00000341771.6_Frame_Shift_Ins_p.H481fs	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	510					actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					CCATAGCCTCATGGGCTTGAGC	0.569																																					p.H510fs		Atlas-Indel,Pindel	.											.	TESK2	60	.	0			c.1530_1531insCA						.																																			SO:0001589	frameshift_variant	10420	exon11			.	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.1528_1529dupCA	chr1.hg19:g.45810699_45810700dupTG	ENSP00000361158:p.His510fs	148.0	0.0		151.0	21.0	NM_007170	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Frame_Shift_Ins	INS	ENST00000372086.3	hg19	CCDS41323.1																																																																																			.	.		0.569	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020523.1	NM_007170	
RWDD2A	112611	hgsc.bcm.edu	37	6	83904246	83904249	+	Frame_Shift_Del	DEL	CAAG	CAAG	-			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	CAAG	CAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr6:83904246_83904249delCAAG	ENST00000369724.4	+	2	281_284	c.76_79delCAAG	c.(76-81)caaggafs	p.QG26fs	RWDD2A_ENST00000539997.1_Splice_Site|PGM3_ENST00000283977.4_5'Flank|PGM3_ENST00000506587.1_5'Flank|PGM3_ENST00000513973.1_5'Flank|PGM3_ENST00000512866.1_5'Flank	NM_033411.3	NP_219479.2	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A	26	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									cervix(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	5		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		GTTTCCTAACCAAGGAGAAGTAAA	0.441																																					p.25_26del		Atlas-Indel,Pindel	.											.	RWDD2A	12	.	0			c.75_78del						.																																			SO:0001589	frameshift_variant	112611	exon2			.	BC010930	CCDS4998.1	6q15	2012-12-07	2007-07-17	2007-07-17	ENSG00000013392	ENSG00000013392			21385	protein-coding gene	gene with protein product			"""RWD domain containing 2"""	RWDD2			Standard	NM_033411		Approved	MGC13523, dJ747H23.2	uc003pjx.4	Q9UIY3	OTTHUMG00000015109	ENST00000369724.4:c.76_79delCAAG	chr6.hg19:g.83904246_83904249delCAAG	ENSP00000358739:p.Gln26fs	123.0	0.0		130.0	16.0	NM_033411	B4DIQ3|E1P548|Q2M3R3|Q96FH1	Frame_Shift_Del	DEL	ENST00000369724.4	hg19	CCDS4998.1																																																																																			.	.		0.441	RWDD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041348.2	NM_033411	
KIAA1958	158405	hgsc.bcm.edu	37	9	115336637	115336638	+	Frame_Shift_Ins	INS	-	-	AGACACAGACTAGCCCTGTTGAA			TCGA-CC-5262-01A-01D-A12Z-10	TCGA-CC-5262-10B-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	93083c92-9303-48e6-aa25-4bb4ba6764b5	48faa33d-3094-4b3b-8c61-d29f392591ff	g.chr9:115336637_115336638insAGACACAGACTAGCCCTGTTGAA	ENST00000337530.6	+	2	573_574	c.277_278insAGACACAGACTAGCCCTGTTGAA	c.(277-279)gagfs	p.E93fs	KIAA1958_ENST00000374244.3_Frame_Shift_Ins_p.E93fs|KIAA1958_ENST00000536272.1_Frame_Shift_Ins_p.E93fs	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	93										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						GGTGCCCTCTGAGACACAGACT	0.49																																					p.E93fs		Pindel	.											.	KIAA1958	52	.	0			c.277_278insAGACACAGACTAGCCCTGTTGAA						.																																			SO:0001589	frameshift_variant	158405	exon2			.	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.278_300dupAGACACAGACTAGCCCTGTTGAA	chr9.hg19:g.115336637_115336638insAGACACAGACTAGCCCTGTTGAA	ENSP00000336940:p.Glu93fs	136.0	0.0		140.0	15.0	NM_133465	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Frame_Shift_Ins	INS	ENST00000337530.6	hg19	CCDS35108.1																																																																																			.	.		0.490	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053690.1	NM_133465	
