#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EIF4G3	8672	hgsc.bcm.edu	37	1	21231426	21231426	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:21231426G>A	ENST00000264211.8	-	9	1728	c.1534C>T	c.(1534-1536)Cca>Tca	p.P512S	EIF4G3_ENST00000374937.3_Missense_Mutation_p.P518S|EIF4G3_ENST00000374933.3_5'UTR|EIF4G3_ENST00000602326.1_Missense_Mutation_p.P518S|EIF4G3_ENST00000400422.1_Missense_Mutation_p.P512S|EIF4G3_ENST00000544689.1_Missense_Mutation_p.P55S|EIF4G3_ENST00000374935.3_Missense_Mutation_p.P232S|EIF4G3_ENST00000536266.1_Missense_Mutation_p.P116S	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	512					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		CGATCTTTTGGTTTCTTCCAT	0.408																																					p.P518S		Atlas-SNP	.											.	EIF4G3	300	.	0			c.C1552T						.						240.0	209.0	220.0					1																	21231426		2203	4300	6503	SO:0001583	missense	8672	exon13			CTTTTGGTTTCTT	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1534C>T	chr1.hg19:g.21231426G>A	ENSP00000264211:p.Pro512Ser	372.0	0.0		393.0	144.0	NM_001198802	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	hg19	CCDS214.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427611	0.62733	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000374937;ENST00000536266;ENST00000374933;ENST00000544689	T;T;T;T;T;D	0.87029	2.06;2.06;2.21;2.06;2.06;-2.2	5.44	4.5	0.54988	.	0.053329	0.85682	D	0.000000	T	0.74114	0.3674	N	0.08118	0	0.80722	D	1	P;B;B;P;B	0.48589	0.847;0.278;0.04;0.912;0.232	B;B;B;B;B	0.37480	0.219;0.057;0.029;0.251;0.108	T	0.78743	-0.2085	10	0.52906	T	0.07	-5.6273	15.4333	0.75121	0.0:0.0:0.8557:0.1442	.	707;232;116;518;512	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	S	512;708;512;232;518;116;55;55	ENSP00000264211:P512S;ENSP00000383274:P512S;ENSP00000364071:P232S;ENSP00000364073:P518S;ENSP00000444693:P116S;ENSP00000444401:P55S	ENSP00000264211:P512S	P	-	1	0	EIF4G3	21104013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.553000	0.67287	1.371000	0.46172	0.557000	0.71058	CCA	.	.		0.408	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
CYP4A22	284541	hgsc.bcm.edu	37	1	47610101	47610101	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:47610101A>G	ENST00000371891.3	+	7	894	c.863A>G	c.(862-864)cAc>cGc	p.H288R	CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000371890.3_Silent_p.A236A|CYP4A22_ENST00000294337.3_Missense_Mutation_p.H288R|CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	288						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGGAAGAGGCACTTGGATTTT	0.507																																					p.H288R	Pancreas(88;1240 1470 2099 14214 37557)	Atlas-SNP	.											.	CYP4A22	60	.	0			c.A863G						.						165.0	156.0	159.0					1																	47610101		2203	4300	6503	SO:0001583	missense	284541	exon7			AGAGGCACTTGGA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.863A>G	chr1.hg19:g.47610101A>G	ENSP00000360958:p.His288Arg	325.0	1.0		435.0	176.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	hg19	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	a	8.716	0.913237	0.17907	.	.	ENSG00000162365	ENST00000371891;ENST00000294337	T;T	0.66280	-0.2;-0.2	1.51	1.51	0.23008	.	0.394484	0.30704	N	0.009050	T	0.29882	0.0747	N	0.02275	-0.615	0.30176	N	0.800886	B	0.13594	0.008	B	0.20577	0.03	T	0.15492	-1.0435	10	0.26408	T	0.33	.	5.6291	0.17499	0.8494:0.0:0.1506:0.0	.	288	Q5TCH4	CP4AM_HUMAN	R	288	ENSP00000360958:H288R;ENSP00000294337:H288R	ENSP00000294337:H288R	H	+	2	0	CYP4A22	47382688	0.988000	0.35896	0.620000	0.29132	0.329000	0.28539	4.808000	0.62583	0.702000	0.31825	0.163000	0.16589	CAC	.	.		0.507	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
PTGER3	5733	hgsc.bcm.edu	37	1	71512812	71512812	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:71512812G>A	ENST00000306666.5	-	1	659	c.449C>T	c.(448-450)gCc>gTc	p.A150V	PTGER3_ENST00000460330.1_Missense_Mutation_p.A150V|PTGER3_ENST00000370924.4_Missense_Mutation_p.A150V|PTGER3_ENST00000356595.4_Missense_Mutation_p.A150V|PTGER3_ENST00000351052.5_Missense_Mutation_p.A150V|PTGER3_ENST00000354608.5_Missense_Mutation_p.A150V|PTGER3_ENST00000370932.2_Missense_Mutation_p.A150V|PTGER3_ENST00000370931.3_Missense_Mutation_p.A150V|PTGER3_ENST00000414819.1_Missense_Mutation_p.A150V|ZRANB2-AS1_ENST00000450461.1_RNA	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	150					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	GACGGCCATGGCGCTGGCGAT	0.662																																					p.A150V		Atlas-SNP	.											.	PTGER3	246	.	0			c.C449T						.						14.0	15.0	14.0					1																	71512812		2194	4281	6475	SO:0001583	missense	5733	exon1			GCCATGGCGCTGG	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.449C>T	chr1.hg19:g.71512812G>A	ENSP00000302313:p.Ala150Val	24.0	0.0		51.0	24.0	NM_001126044	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000306666.5	hg19	CCDS657.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146958	0.77888	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14;1.14	4.9	3.99	0.46301	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.41282	0.1152	L	0.59912	1.85	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.997;0.997;0.997;0.999;0.999;0.993;0.996;0.997	D;D;D;D;D;P;P;D	0.70487	0.943;0.943;0.962;0.969;0.969;0.906;0.906;0.943	T	0.22173	-1.0224	10	0.28530	T	0.3	-18.8832	13.4836	0.61353	0.0758:0.0:0.9242:0.0	.	150;150;150;150;150;150;150;150	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	V	150	ENSP00000359969:A150V;ENSP00000359970:A150V;ENSP00000280208:A150V;ENSP00000418073:A150V;ENSP00000346624:A150V;ENSP00000349003:A150V;ENSP00000401423:A150V;ENSP00000302313:A150V;ENSP00000359962:A150V	ENSP00000302313:A150V	A	-	2	0	PTGER3	71285400	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.371000	0.66150	1.282000	0.44496	0.462000	0.41574	GCC	.	.		0.662	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026076.1	NM_000957	
STXBP3	6814	hgsc.bcm.edu	37	1	109340799	109340799	+	Silent	SNP	G	G	T	rs374868665		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:109340799G>T	ENST00000370008.3	+	16	1439	c.1389G>T	c.(1387-1389)cgG>cgT	p.R463R		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	463					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GAAAGGATCGGTCTGCAGAAG	0.333																																					p.R463R		Atlas-SNP	.											.	STXBP3	44	.	0			c.G1389T						.						113.0	123.0	119.0					1																	109340799		2203	4300	6503	SO:0001819	synonymous_variant	6814	exon16			GGATCGGTCTGCA	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1389G>T	chr1.hg19:g.109340799G>T		536.0	1.0		598.0	245.0	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Silent	SNP	ENST00000370008.3	hg19	CCDS790.1																																																																																			.	.		0.333	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
SYT6	148281	hgsc.bcm.edu	37	1	114646254	114646254	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:114646254G>T	ENST00000610222.1	-	4	1307	c.1161C>A	c.(1159-1161)aaC>aaA	p.N387K	SYT6_ENST00000609117.1_Missense_Mutation_p.N302K|SYT6_ENST00000607941.1_Missense_Mutation_p.N302K|SYT6_ENST00000369547.1_Missense_Mutation_p.N302K|SYT6_ENST00000393296.1_Missense_Mutation_p.N387K			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	387	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCGCCTTGAGGTTCCGACACT	0.537																																					p.N302K		Atlas-SNP	.											.	SYT6	66	.	0			c.C906A						.						144.0	113.0	124.0					1																	114646254		2203	4300	6503	SO:0001583	missense	148281	exon4			CTTGAGGTTCCGA		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1161C>A	chr1.hg19:g.114646254G>T	ENSP00000476396:p.Asn387Lys	76.0	0.0		83.0	39.0	NM_205848	B1AMB8|B3KPK1	Missense_Mutation	SNP	ENST00000610222.1	hg19		.	.	.	.	.	.	.	.	.	.	G	19.53	3.844182	0.71488	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.71	3.82	0.43975	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.75488	0.3856	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	T	0.77600	-0.2527	10	0.87932	D	0	.	6.7243	0.23348	0.4015:0.0:0.5985:0.0	.	387	Q5T7P8	SYT6_HUMAN	K	302;387;302;387	ENSP00000358560:N302K;ENSP00000376974:N387K;ENSP00000358559:N302K;ENSP00000358558:N387K	ENSP00000358558:N387K	N	-	3	2	SYT6	114447777	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.247000	0.43151	0.738000	0.32606	0.561000	0.74099	AAC	.	.		0.537	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848	
NUP210L	91181	hgsc.bcm.edu	37	1	154033436	154033436	+	Silent	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:154033436A>G	ENST00000368559.3	-	19	2801	c.2730T>C	c.(2728-2730)taT>taC	p.Y910Y	NUP210L_ENST00000271854.3_Silent_p.Y910Y	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	910					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CAGGGTGGTTATAGATGGTGG	0.358																																					p.Y910Y		Atlas-SNP	.											.	NUP210L	181	.	0			c.T2730C						.						107.0	101.0	103.0					1																	154033436		1869	4114	5983	SO:0001819	synonymous_variant	91181	exon19			GTGGTTATAGATG	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2730T>C	chr1.hg19:g.154033436A>G		262.0	0.0		324.0	118.0	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	ENST00000368559.3	hg19	CCDS41399.1																																																																																			.	.		0.358	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
PMVK	10654	hgsc.bcm.edu	37	1	154904884	154904884	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:154904884C>G	ENST00000368467.3	-	2	408	c.103G>C	c.(103-105)Gct>Cct	p.A35P		NM_006556.3	NP_006547.1	Q15126	PMVK_HUMAN	phosphomevalonate kinase	35					cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|response to cholesterol (GO:0070723)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|phosphomevalonate kinase activity (GO:0004631)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.142)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CAGACATCAGCTCCAAGTCTG	0.562																																					p.A35P		Atlas-SNP	.											.	PMVK	17	.	0			c.G103C						.						102.0	91.0	95.0					1																	154904884		2203	4300	6503	SO:0001583	missense	10654	exon2			CATCAGCTCCAAG	L77213	CCDS1073.1	1q21.3	2012-09-20			ENSG00000163344	ENSG00000163344	2.7.4.2		9141	protein-coding gene	gene with protein product		607622				8663599, 10191291	Standard	NM_006556		Approved	PMK, PMKA, HUMPMKI	uc001ffq.3	Q15126	OTTHUMG00000037415	ENST00000368467.3:c.103G>C	chr1.hg19:g.154904884C>G	ENSP00000357452:p.Ala35Pro	179.0	0.0		259.0	14.0	NM_006556	Q5TZW9	Missense_Mutation	SNP	ENST00000368467.3	hg19	CCDS1073.1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.580194	0.46006	.	.	ENSG00000163344	ENST00000368467	T	0.45276	0.9	4.59	2.71	0.32032	.	0.312350	0.31404	N	0.007710	T	0.10121	0.0248	N	0.21097	0.63	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16808	-1.0390	10	0.30854	T	0.27	-0.5485	6.3066	0.21141	0.0:0.7829:0.0:0.2171	.	35	Q15126	PMVK_HUMAN	P	35	ENSP00000357452:A35P	ENSP00000357452:A35P	A	-	1	0	PMVK	153171508	0.005000	0.15991	0.009000	0.14445	0.846000	0.48090	0.682000	0.25335	1.283000	0.44513	0.561000	0.74099	GCT	.	.		0.562	PMVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091088.1	NM_006556	
MNDA	4332	hgsc.bcm.edu	37	1	158817665	158817665	+	Missense_Mutation	SNP	C	C	A	rs139902913		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:158817665C>A	ENST00000368141.4	+	6	1396	c.1135C>A	c.(1135-1137)Cgc>Agc	p.R379S		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	379	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AACAGTTGACCGCAAGCTGAA	0.443																																					p.R379S		Atlas-SNP	.											.	MNDA	147	.	0			c.C1135A						.						130.0	123.0	125.0					1																	158817665		2203	4300	6503	SO:0001583	missense	4332	exon6			GTTGACCGCAAGC	BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.1135C>A	chr1.hg19:g.158817665C>A	ENSP00000357123:p.Arg379Ser	127.0	0.0		145.0	58.0	NM_002432		Missense_Mutation	SNP	ENST00000368141.4	hg19	CCDS1177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.250|0.250	-1.007183|-1.007183	0.02112|0.02112	.|.	.|.	ENSG00000163563|ENSG00000163563	ENST00000438394|ENST00000368141	.|T	.|0.21543	.|2.0	3.76|3.76	-7.52|-7.52	0.01341|0.01341	.|HIN-200/IF120x (1);Nucleic acid-binding, OB-fold (1);	.|3.094270	.|0.01403	.|N	.|0.013692	T|T	0.01870|0.01870	0.0059|0.0059	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	.|P	.|0.34724	.|0.465	.|B	.|0.28849	.|0.095	T|T	0.30119|0.30119	-0.9989|-0.9989	5|10	.|0.10902	.|T	.|0.67	9.6375|9.6375	1.2349|1.2349	0.01951|0.01951	0.2408:0.3124:0.2874:0.1594|0.2408:0.3124:0.2874:0.1594	.|.	.|379	.|P41218	.|MNDA_HUMAN	Q|S	84|379	.|ENSP00000357123:R379S	.|ENSP00000357123:R379S	P|R	+|+	2|1	0|0	MNDA|MNDA	157084289|157084289	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	-2.155000|-2.155000	0.01284|0.01284	-2.488000|-2.488000	0.00518|0.00518	-0.440000|-0.440000	0.05779|0.05779	CCG|CGC	.	C|1.000;T|0.000		0.443	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432	
TBX19	9095	hgsc.bcm.edu	37	1	168262484	168262484	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:168262484T>C	ENST00000367821.3	+	3	622	c.571T>C	c.(571-573)Ttc>Ctc	p.F191L		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	191					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					TGAAACCCAGTTCATAGCCGT	0.468																																					p.F191L		Atlas-SNP	.											.	TBX19	68	.	0			c.T571C						.						91.0	70.0	77.0					1																	168262484		2203	4300	6503	SO:0001583	missense	9095	exon3			ACCCAGTTCATAG	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.571T>C	chr1.hg19:g.168262484T>C	ENSP00000356795:p.Phe191Leu	67.0	0.0		126.0	52.0	NM_005149	Q52M53	Missense_Mutation	SNP	ENST00000367821.3	hg19	CCDS1272.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.122564|5.122564	0.94429|0.94429	.|.	.|.	ENSG00000143178|ENSG00000143178	ENST00000367821;ENST00000367828|ENST00000431969	D|.	0.93189|.	-3.18|.	5.02|5.02	5.02|5.02	0.67125|0.67125	p53-like transcription factor, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86422|0.86422	0.5929|0.5929	H|H	0.98199|0.98199	4.17|4.17	0.49582|.	D|.	0.999803|.	D;D|.	0.71674|.	0.998;0.99|.	D;P|.	0.64877|.	0.93;0.841|.	D|D	0.91584|0.91584	0.5281|0.5281	9|4	0.72032|.	D|.	0.01|.	.|.	14.4281|14.4281	0.67230|0.67230	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	191;122|.	O60806;B3KRD9|.	TBX19_HUMAN;.|.	L|A	191;131|123	ENSP00000356795:F191L|.	ENSP00000356795:F191L|.	F|V	+|+	1|2	0|0	TBX19|TBX19	166529108|166529108	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.507000|7.507000	0.81676|0.81676	1.884000|1.884000	0.54569|0.54569	0.460000|0.460000	0.39030|0.39030	TTC|GTT	.	.		0.468	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
TDRD5	163589	hgsc.bcm.edu	37	1	179603595	179603595	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:179603595A>T	ENST00000367614.1	+	8	1489	c.1130A>T	c.(1129-1131)cAg>cTg	p.Q377L	TDRD5_ENST00000294848.8_Missense_Mutation_p.Q377L|TDRD5_ENST00000444136.1_Missense_Mutation_p.Q377L	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	377					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TGTTTAGTTCAGTCAGATAAG	0.383																																					p.Q377L		Atlas-SNP	.											.	TDRD5	149	.	0			c.A1130T						.						101.0	101.0	101.0					1																	179603595		2203	4300	6503	SO:0001583	missense	163589	exon8			TAGTTCAGTCAGA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1130A>T	chr1.hg19:g.179603595A>T	ENSP00000356586:p.Gln377Leu	183.0	0.0		183.0	73.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	A	9.612	1.131531	0.21041	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.12774	2.65;2.65;2.83	5.24	2.72	0.32119	.	0.626135	0.16158	N	0.226908	T	0.12689	0.0308	L	0.54323	1.7	0.29136	N	0.879299	B;B	0.12013	0.005;0.002	B;B	0.09377	0.004;0.002	T	0.12344	-1.0551	10	0.27785	T	0.31	-2.8607	8.2597	0.31777	0.687:0.0:0.0:0.313	.	377;377	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	L	377	ENSP00000356586:Q377L;ENSP00000294848:Q377L;ENSP00000406052:Q377L	ENSP00000294848:Q377L	Q	+	2	0	TDRD5	177870218	0.997000	0.39634	0.996000	0.52242	0.864000	0.49448	1.718000	0.38001	0.910000	0.36722	0.533000	0.62120	CAG	.	.		0.383	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
KIF26B	55083	hgsc.bcm.edu	37	1	245847619	245847619	+	Silent	SNP	G	G	A	rs201075952		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:245847619G>A	ENST00000407071.2	+	11	2783	c.2343G>A	c.(2341-2343)gcG>gcA	p.A781A	KIF26B_ENST00000366518.4_Silent_p.A400A	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	781	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TCTCGGCCGCGGTCGGGAGCT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18869	0.0		0.001	False		,,,				2504	0.0				p.A781A		Atlas-SNP	.											.	KIF26B	343	.	0			c.G2343A						.						56.0	61.0	59.0					1																	245847619		2060	4183	6243	SO:0001819	synonymous_variant	55083	exon11			GGCCGCGGTCGGG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2343G>A	chr1.hg19:g.245847619G>A		68.0	0.0		124.0	42.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	hg19	CCDS44342.1																																																																																			.	G|0.999;A|0.001		0.577	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
SCCPDH	51097	hgsc.bcm.edu	37	1	246923373	246923373	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:246923373A>T	ENST00000366510.3	+	8	1304	c.928A>T	c.(928-930)Ata>Tta	p.I310L		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	310						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		GCAACTTCTCATAAAAGTAAG	0.308																																					p.I310L		Atlas-SNP	.											.	SCCPDH	37	.	0			c.A928T						.						175.0	162.0	167.0					1																	246923373		2203	4300	6503	SO:0001583	missense	51097	exon8			CTTCTCATAAAAG		CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.928A>T	chr1.hg19:g.246923373A>T	ENSP00000355467:p.Ile310Leu	854.0	1.0		934.0	323.0	NM_016002	Q8TAR0|Q9Y363	Missense_Mutation	SNP	ENST00000366510.3	hg19	CCDS31084.1	.	.	.	.	.	.	.	.	.	.	A	4.955	0.177422	0.09443	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	T	0.43688	0.94	5.43	1.28	0.21552	.	0.216134	0.53938	D	0.000052	T	0.15262	0.0368	N	0.01529	-0.815	0.46298	D	0.998973	B	0.06786	0.001	B	0.14578	0.011	T	0.05068	-1.0908	10	0.26408	T	0.33	.	9.7998	0.40757	0.7365:0.0:0.2635:0.0	.	310	Q8NBX0	SCPDL_HUMAN	L	310;141	ENSP00000355467:I310L	ENSP00000355466:I141L	I	+	1	0	SCCPDH	244989996	0.988000	0.35896	1.000000	0.80357	0.998000	0.95712	1.425000	0.34859	0.396000	0.25283	0.533000	0.62120	ATA	.	.		0.308	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096902.2	NM_016002	
TET3	200424	hgsc.bcm.edu	37	2	74327943	74327943	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:74327943A>T	ENST00000409262.3	+	9	3623	c.3623A>T	c.(3622-3624)cAg>cTg	p.Q1208L		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1208					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTGCCCAGCCAGGCTGTTCCC	0.642																																					p.Q1208L		Atlas-SNP	.											.	TET3	101	.	0			c.A3623T						.						20.0	23.0	22.0					2																	74327943		2075	4210	6285	SO:0001583	missense	200424	exon9			CCAGCCAGGCTGT		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.3623A>T	chr2.hg19:g.74327943A>T	ENSP00000386869:p.Gln1208Leu	46.0	0.0		69.0	27.0	NM_144993	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	ENST00000409262.3	hg19	CCDS46339.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.871563	0.33069	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.12039	2.72	4.91	3.74	0.42951	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.364872	0.23811	N	0.044329	T	0.14830	0.0358	L	0.41961	1.31	0.37416	D	0.913455	B	0.31413	0.322	B	0.37198	0.243	T	0.09596	-1.0667	10	0.51188	T	0.08	.	10.5629	0.45156	0.6928:0.3072:0.0:0.0	.	1208	O43151	TET3_HUMAN	L	1208	ENSP00000386869:Q1208L	ENSP00000233310:Q1208L	Q	+	2	0	TET3	74181451	0.829000	0.29322	1.000000	0.80357	0.986000	0.74619	2.472000	0.45136	0.977000	0.38444	0.533000	0.62120	CAG	.	.		0.642	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
NR4A2	4929	hgsc.bcm.edu	37	2	157186659	157186659	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:157186659C>T	ENST00000339562.4	-	3	402	c.40G>A	c.(40-42)Gga>Aga	p.G14R	NR4A2_ENST00000409108.2_Missense_Mutation_p.G14R|NR4A2_ENST00000429376.1_Intron|NR4A2_ENST00000409572.1_Missense_Mutation_p.G14R|NR4A2_ENST00000426264.1_Intron|NR4A2_ENST00000539077.1_Missense_Mutation_p.G25R	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	14					adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						GGGCTGGCTCCTTGAGGCGAG	0.517																																					p.G14R		Atlas-SNP	.											.	NR4A2	82	.	0			c.G40A						.						48.0	51.0	50.0					2																	157186659		2203	4300	6503	SO:0001583	missense	4929	exon3			TGGCTCCTTGAGG	X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.40G>A	chr2.hg19:g.157186659C>T	ENSP00000344479:p.Gly14Arg	122.0	0.0		147.0	38.0	NM_006186	Q16311|Q53RZ2|Q6NXU0	Missense_Mutation	SNP	ENST00000339562.4	hg19	CCDS2201.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003131	0.74932	.	.	ENSG00000153234	ENST00000339562;ENST00000409572;ENST00000539077;ENST00000409108;ENST00000424077	D;D;D;D;D	0.93859	-3.04;-3.04;-3.02;-3.3;-1.75	5.43	5.43	0.79202	.	0.214284	0.48286	D	0.000187	D	0.95007	0.8384	L	0.42245	1.32	0.80722	D	1	D	0.63880	0.993	D	0.64237	0.923	D	0.95066	0.8200	10	0.66056	D	0.02	.	19.0129	0.92881	0.0:1.0:0.0:0.0	.	14	P43354	NR4A2_HUMAN	R	14;14;25;14;14	ENSP00000344479:G14R;ENSP00000386747:G14R;ENSP00000444925:G25R;ENSP00000386993:G14R;ENSP00000406808:G14R	ENSP00000344479:G14R	G	-	1	0	NR4A2	156894905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.825000	0.97269	0.655000	0.94253	GGA	.	.		0.517	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254909.2		
HOXD4	3233	hgsc.bcm.edu	37	2	177017653	177017653	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:177017653G>C	ENST00000306324.3	+	2	1163	c.751G>C	c.(751-753)Gac>Cac	p.D251H	HOXD3_ENST00000468418.3_5'UTR|MIR10B_ENST00000385011.1_RNA	NM_014621.2	NP_055436.2	P09016	HXD4_HUMAN	homeobox D4	251					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		CCACCACACGGACCTGACGAC	0.627																																					p.D251H		Atlas-SNP	.											.	HOXD4	32	.	0			c.G751C						.						70.0	77.0	75.0					2																	177017653		2203	4300	6503	SO:0001583	missense	3233	exon2			CACACGGACCTGA		CCDS2269.1	2q31.1	2011-06-20	2005-12-22		ENSG00000170166	ENSG00000170166		"""Homeoboxes / ANTP class : HOXL subclass"""	5138	protein-coding gene	gene with protein product		142981	"""homeo box D4"""	HOX4B, HOX4		1973146, 1358459	Standard	NM_014621		Approved		uc002uks.3	P09016	OTTHUMG00000132515	ENST00000306324.3:c.751G>C	chr2.hg19:g.177017653G>C	ENSP00000302548:p.Asp251His	86.0	0.0		138.0	52.0	NM_014621	B2R9R3|Q96AU0	Missense_Mutation	SNP	ENST00000306324.3	hg19	CCDS2269.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988556	0.74589	.	.	ENSG00000170166	ENST00000306324	D	0.91011	-2.77	5.67	5.67	0.87782	.	1.924890	0.02868	N	0.131199	D	0.95529	0.8547	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	D	0.85832	0.1392	10	0.87932	D	0	.	19.7626	0.96329	0.0:0.0:1.0:0.0	.	251	P09016	HXD4_HUMAN	H	251	ENSP00000302548:D251H	ENSP00000302548:D251H	D	+	1	0	HOXD4	176725899	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.914000	0.87478	2.676000	0.91093	0.561000	0.74099	GAC	.	.		0.627	HOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255697.2		
TTN	7273	hgsc.bcm.edu	37	2	179419703	179419703	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:179419703G>A	ENST00000591111.1	-	281	83784	c.83560C>T	c.(83560-83562)Ctc>Ttc	p.L27854F	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L20622F|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L29495F|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L20555F|TTN_ENST00000460472.2_Missense_Mutation_p.L20430F|TTN_ENST00000342992.6_Missense_Mutation_p.L26927F|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27854	Ig-like 130.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAGATGCGAGGTCCGTGGTA	0.438																																					p.L29495F		Atlas-SNP	.											.	TTN	18412	.	0			c.C88483T						.						86.0	81.0	82.0					2																	179419703		1915	4125	6040	SO:0001583	missense	7273	exon331			ATGCGAGGTCCGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83560C>T	chr2.hg19:g.179419703G>A	ENSP00000465570:p.Leu27854Phe	150.0	0.0		198.0	79.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	17.36	3.370558	0.61624	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.66	4.76	0.60689	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49184	0.1542	N	0.25144	0.715	0.31858	N	0.62137	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.003;0.003;0.003	T	0.54057	-0.8350	9	0.87932	D	0	.	4.5974	0.12336	0.1759:0.0:0.6327:0.1914	.	20430;20555;20622;27854	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	F	26927;20430;20622;20555;20427	ENSP00000343764:L26927F;ENSP00000434586:L20430F;ENSP00000340554:L20622F;ENSP00000352154:L20555F	ENSP00000340554:L20622F	L	-	1	0	TTN	179127949	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.150000	0.64869	1.462000	0.47948	0.655000	0.94253	CTC	.	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NCL	4691	hgsc.bcm.edu	37	2	232325414	232325414	+	Missense_Mutation	SNP	T	T	A	rs540030591|rs139777351|rs371359723|rs199689485|rs527711138|rs368566589	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr2:232325414T>A	ENST00000322723.4	-	4	1017	c.777A>T	c.(775-777)gaA>gaT	p.E259D	SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin	259	Asp/Glu-rich (acidic).				angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CCtcatcatcttcatcatcat	0.438																																					p.E259D		Atlas-SNP	.											.	NCL	80	.	0			c.A777T						.						229.0	194.0	206.0					2																	232325414		2203	4300	6503	SO:0001583	missense	4691	exon4			ATCATCTTCATCA		CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.777A>T	chr2.hg19:g.232325414T>A	ENSP00000318195:p.Glu259Asp	350.0	0.0		432.0	44.0	NM_005381	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	Missense_Mutation	SNP	ENST00000322723.4	hg19	CCDS33397.1	.	.	.	.	.	.	.	.	.	.	T	0.028	-1.357543	0.01245	.	.	ENSG00000115053	ENST00000322723;ENST00000392033	T	0.23552	1.9	4.93	-9.86	0.00473	.	1.633390	0.02710	N	0.112777	T	0.06554	0.0168	N	0.03608	-0.345	0.19945	N	0.999949	B	0.02656	0.0	B	0.08055	0.003	T	0.26677	-1.0096	10	0.02654	T	1	0.5096	0.6058	0.00752	0.2352:0.1751:0.2128:0.3769	.	259	P19338	NUCL_HUMAN	D	259;151	ENSP00000318195:E259D	ENSP00000318195:E259D	E	-	3	2	NCL	232033658	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.197000	0.00276	-4.228000	0.00063	-3.370000	0.00041	GAA	.	.		0.438	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332731.1	NM_005381	
TTC21A	199223	hgsc.bcm.edu	37	3	39171742	39171742	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr3:39171742G>T	ENST00000431162.2	+	17	2367	c.2233G>T	c.(2233-2235)Gag>Tag	p.E745*	TTC21A_ENST00000440121.1_Nonsense_Mutation_p.E697*|TTC21A_ENST00000301819.6_Nonsense_Mutation_p.E746*			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	745										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CCACCAGCCCGAGAAGGCCCT	0.582																																					p.E745X		Atlas-SNP	.											.	TTC21A	96	.	0			c.G2233T						.						44.0	45.0	45.0					3																	39171742		1914	4118	6032	SO:0001587	stop_gained	199223	exon17			CAGCCCGAGAAGG	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.2233G>T	chr3.hg19:g.39171742G>T	ENSP00000398211:p.Glu745*	77.0	0.0		63.0	42.0	NM_145755	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Nonsense_Mutation	SNP	ENST00000431162.2	hg19	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	G	38	7.162369	0.98107	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	.	.	.	4.85	4.85	0.62838	.	0.159354	0.38217	N	0.001765	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-28.9477	17.1263	0.86715	0.0:0.0:1.0:0.0	.	.	.	.	X	746;728;745;697	.	ENSP00000301819:E746X	E	+	1	0	TTC21A	39146746	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.872000	0.75536	2.414000	0.81942	0.563000	0.77884	GAG	.	.		0.582	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
ZIC4	84107	hgsc.bcm.edu	37	3	147120535	147120535	+	Missense_Mutation	SNP	C	C	G	rs148365070		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr3:147120535C>G	ENST00000383075.3	-	2	562	c.50G>C	c.(49-51)cGa>cCa	p.R17P	ZIC4_ENST00000484399.1_Missense_Mutation_p.R17P|ZIC4_ENST00000491672.1_Missense_Mutation_p.R17P|ZIC4_ENST00000425731.3_Missense_Mutation_p.R55P|ZIC4_ENST00000525172.2_Missense_Mutation_p.R67P|ZIC4_ENST00000473123.1_Missense_Mutation_p.R17P	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	17						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AAGAGTGTTTCGGTAAAGCCG	0.353																																					p.R67P		Atlas-SNP	.											ZIC4_ENST00000525172,NS,carcinoma,0,4	ZIC4	174	.	0			c.G200C						.						152.0	139.0	143.0					3																	147120535		1854	4089	5943	SO:0001583	missense	84107	exon2			GTGTTTCGGTAAA	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.50G>C	chr3.hg19:g.147120535C>G	ENSP00000372553:p.Arg17Pro	181.0	0.0		191.0	65.0	NM_001168378	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	ENST00000383075.3	hg19	CCDS43160.1	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825324	0.71143	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000491672;ENST00000462748;ENST00000484586;ENST00000463250	T;T;T;T;T;T;T	0.38077	2.63;2.43;2.39;2.63;2.63;1.16;2.48	6.06	5.19	0.71726	.	0.670270	0.12134	N	0.496457	T	0.33411	0.0862	L	0.27053	0.805	0.80722	D	1	P;P	0.43094	0.766;0.799	P;B	0.44811	0.461;0.423	T	0.08330	-1.0727	10	0.87932	D	0	.	11.3963	0.49843	0.0:0.8625:0.0:0.1375	.	67;17	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	P	17;55;67;17;17;17;17;17;17	ENSP00000372553:R17P;ENSP00000397695:R55P;ENSP00000435509:R67P;ENSP00000417855:R17P;ENSP00000420775:R17P;ENSP00000418277:R17P;ENSP00000420627:R17P	ENSP00000372553:R17P	R	-	2	0	ZIC4	148603225	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.965000	0.40471	1.576000	0.49790	0.655000	0.94253	CGA	.	C|0.999;T|0.001		0.353	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355504.1		
ABCC5	10057	hgsc.bcm.edu	37	3	183667834	183667834	+	Silent	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr3:183667834T>A	ENST00000334444.6	-	21	3264	c.3024A>T	c.(3022-3024)gcA>gcT	p.A1008A	ABCC5_ENST00000265586.6_Silent_p.A1008A	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1008	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GGAAGACTCCTGCGATCATTC	0.517																																					p.A1008A		Atlas-SNP	.											.	ABCC5	142	.	0			c.A3024T						.						59.0	67.0	64.0					3																	183667834		2067	4220	6287	SO:0001819	synonymous_variant	10057	exon21			GACTCCTGCGATC	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3024A>T	chr3.hg19:g.183667834T>A		105.0	0.0		143.0	45.0	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	hg19	CCDS43176.1																																																																																			.	.		0.517	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
CEP135	9662	hgsc.bcm.edu	37	4	56846403	56846403	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:56846403A>T	ENST00000257287.4	+	12	1692	c.1568A>T	c.(1567-1569)cAg>cTg	p.Q523L		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	523					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GAAGATATACAGTCCAATGTT	0.289																																					p.Q523L		Atlas-SNP	.											.	CEP135	115	.	0			c.A1568T						.						71.0	74.0	73.0					4																	56846403		2203	4296	6499	SO:0001583	missense	9662	exon12			ATATACAGTCCAA	AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.1568A>T	chr4.hg19:g.56846403A>T	ENSP00000257287:p.Gln523Leu	502.0	0.0		432.0	168.0	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	ENST00000257287.4	hg19	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.387832	0.82902	.	.	ENSG00000174799	ENST00000257287	T	0.57273	0.41	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.73187	0.3555	M	0.78801	2.425	0.58432	D	0.999995	D	0.89917	1.0	D	0.80764	0.994	T	0.74553	-0.3627	10	0.46703	T	0.11	.	16.2813	0.82687	1.0:0.0:0.0:0.0	.	523	Q66GS9	CP135_HUMAN	L	523	ENSP00000257287:Q523L	ENSP00000257287:Q523L	Q	+	2	0	CEP135	56541160	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.121000	0.71602	2.244000	0.73946	0.533000	0.62120	CAG	.	.		0.289	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
KIAA1109	84162	hgsc.bcm.edu	37	4	123274094	123274094	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:123274094G>A	ENST00000264501.4	+	81	14258	c.13885G>A	c.(13885-13887)Gta>Ata	p.V4629I	KIAA1109_ENST00000388738.3_Missense_Mutation_p.V4629I			Q2LD37	K1109_HUMAN	KIAA1109	4629					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTGGCCTGGAGTATTGAAGGT	0.418																																					p.V4629I		Atlas-SNP	.											.	KIAA1109	424	.	0			c.G13885A						.						163.0	156.0	158.0					4																	123274094		1998	4182	6180	SO:0001583	missense	84162	exon79			CCTGGAGTATTGA	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.13885G>A	chr4.hg19:g.123274094G>A	ENSP00000264501:p.Val4629Ile	121.0	0.0		152.0	52.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	hg19	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.741024	0.89573	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.50277	0.75;0.75;0.75	5.98	5.98	0.97165	Fragile site-associated protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.79108	0.98;0.992	T	0.55939	-0.8061	10	0.32370	T	0.25	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	4628;4629	Q2LD37-4;Q2LD37	.;K1109_HUMAN	I	4629;4629;1298;230	ENSP00000264501:V4629I;ENSP00000373390:V4629I;ENSP00000410874:V1298I	ENSP00000264501:V4629I	V	+	1	0	KIAA1109	123493544	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	9.869000	0.99810	2.835000	0.97688	0.650000	0.86243	GTA	.	.		0.418	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
GRIA2	2891	hgsc.bcm.edu	37	4	158262498	158262499	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:158262498_158262499GC>AA	ENST00000264426.9	+	12	2206_2207	c.1927_1928GC>AA	c.(1927-1929)GCc>AAc	p.A643N	GRIA2_ENST00000393815.2_Missense_Mutation_p.A596N|GRIA2_ENST00000507898.1_Missense_Mutation_p.A596N|GRIA2_ENST00000449365.1_Missense_Mutation_p.A596N|GRIA2_ENST00000296526.7_Missense_Mutation_p.A643N	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	643					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TAACTTAGCTGCCTTCCTGACT	0.455																																					p.A643T|p.A643D		Atlas-SNP	.											.	GRIA2	358	.	0			c.G1927A|c.C1928A						.																																			SO:0001583	missense	2891	exon12			TTAGCTGCCTTCC|TAGCTGCCTTCCT		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	Exception_encountered	chr4.hg19:g.158262498_158262499delinsAA	ENSP00000264426:p.Ala643Asn	639.0|634.0	1.0|2.0		608.0|600.0	231.0|227.0	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	hg19	CCDS43274.1																																																																																			.	.		0.455	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
SLC1A3	6507	hgsc.bcm.edu	37	5	36684073	36684073	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:36684073C>T	ENST00000265113.4	+	9	1873	c.1397C>T	c.(1396-1398)aCg>aTg	p.T466M	SLC1A3_ENST00000381918.3_Intron|CTD-2353F22.1_ENST00000510740.1_RNA	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	466					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GACGACATCACGCTCATCATC	0.597																																					p.T466M		Atlas-SNP	.											.	SLC1A3	88	.	0			c.C1397T						.						171.0	143.0	153.0					5																	36684073		2203	4300	6503	SO:0001583	missense	6507	exon9			ACATCACGCTCAT		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.1397C>T	chr5.hg19:g.36684073C>T	ENSP00000265113:p.Thr466Met	173.0	0.0		383.0	87.0	NM_004172	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	hg19	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732405	0.89482	.	.	ENSG00000079215	ENST00000265113;ENST00000427100	T	0.59502	0.26	5.74	5.74	0.90152	.	0.047302	0.85682	D	0.000000	T	0.80592	0.4652	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.83127	-0.0115	10	0.87932	D	0	-17.5109	19.9326	0.97124	0.0:1.0:0.0:0.0	.	466	P43003	EAA1_HUMAN	M	466;414	ENSP00000265113:T466M	ENSP00000265113:T466M	T	+	2	0	SLC1A3	36719830	1.000000	0.71417	0.993000	0.49108	0.975000	0.68041	5.969000	0.70422	2.720000	0.93068	0.650000	0.86243	ACG	.	.		0.597	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
EGFLAM	133584	hgsc.bcm.edu	37	5	38427282	38427282	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:38427282T>A	ENST00000354891.3	+	14	2328	c.1982T>A	c.(1981-1983)tTc>tAc	p.F661Y	EGFLAM_ENST00000336740.6_Missense_Mutation_p.F427Y|EGFLAM-AS1_ENST00000508986.1_RNA|EGFLAM_ENST00000397202.2_Missense_Mutation_p.F27Y|EGFLAM_ENST00000322350.5_Missense_Mutation_p.F661Y	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	661	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGCAAAGACTTCCTGTCCATC	0.537																																					p.F661Y	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.T1982A						.						154.0	153.0	153.0					5																	38427282		2203	4300	6503	SO:0001583	missense	133584	exon14			AAGACTTCCTGTC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1982T>A	chr5.hg19:g.38427282T>A	ENSP00000346964:p.Phe661Tyr	104.0	0.0		165.0	43.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	hg19	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	T	29.4	5.004289	0.93287	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.31	5.76	5.76	0.90799	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.88804	0.6536	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.993	D;D;D	0.91635	0.999;0.999;0.946	D	0.88418	0.3026	10	0.42905	T	0.14	-10.3947	16.0677	0.80897	0.0:0.0:0.0:1.0	.	427;661;661	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	Y	661;661;427;27;427	ENSP00000346964:F661Y;ENSP00000313084:F661Y;ENSP00000337607:F427Y;ENSP00000380385:F27Y	ENSP00000313084:F661Y	F	+	2	0	EGFLAM	38463039	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.635000	0.83286	2.201000	0.70794	0.533000	0.62120	TTC	.	.		0.537	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
GPR98	84059	hgsc.bcm.edu	37	5	89910835	89910835	+	Splice_Site	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr5:89910835C>A	ENST00000405460.2	+	2	302	c.206C>A	c.(205-207)tCg>tAg	p.S69*		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	69	Calx-beta 1. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GCAATTGTATCGGTAAGAAAT	0.308																																					p.S69X		Atlas-SNP	.											.	GPR98	605	.	0			c.C206A						.						46.0	41.0	43.0					5																	89910835		1804	4056	5860	SO:0001630	splice_region_variant	84059	exon2			TTGTATCGGTAAG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.207+1C>A	chr5.hg19:g.89910835C>A		227.0	0.0		109.0	63.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Nonsense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.034704	0.93575	.	.	ENSG00000164199	ENST00000508842;ENST00000405460;ENST00000296619;ENST00000399043	.	.	.	5.98	5.98	0.97165	.	0.167402	0.48286	D	0.000194	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	15.2005	0.73132	0.1408:0.8592:0.0:0.0	.	.	.	.	X	73;69;69;69	.	ENSP00000296619:S69X	S	+	2	0	GPR98	89946591	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.714000	0.47202	2.838000	0.97847	0.591000	0.81541	TCG	.	.		0.308	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	Nonsense_Mutation
RNF182	221687	hgsc.bcm.edu	37	6	13977395	13977395	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:13977395T>C	ENST00000488300.1	+	3	568	c.45T>C	c.(43-45)tcT>tcC	p.S15S	RNF182_ENST00000537663.1_Silent_p.S15S|RNF182_ENST00000537388.1_Silent_p.S15S|RNF182_ENST00000544682.1_Silent_p.S15S	NM_152737.3	NP_689950.1	Q8N6D2	RN182_HUMAN	ring finger protein 182	15					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|large_intestine(7)|liver(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(50;0.00405)|Ovarian(93;0.0964)	all_hematologic(90;0.135)	Epithelial(50;0.195)			CTCAGGCCTCTGATGAGCTGG	0.463																																					p.S15S		Atlas-SNP	.											.	RNF182	51	.	0			c.T45C						.						113.0	114.0	114.0					6																	13977395		2203	4300	6503	SO:0001819	synonymous_variant	221687	exon4			GGCCTCTGATGAG	AK090576	CCDS4531.1	6p23	2013-01-09			ENSG00000180537	ENSG00000180537		"""RING-type (C3HC4) zinc fingers"""	28522	protein-coding gene	gene with protein product						12477932	Standard	NM_152737		Approved	MGC33993	uc003nbg.3	Q8N6D2	OTTHUMG00000014280	ENST00000488300.1:c.45T>C	chr6.hg19:g.13977395T>C		113.0	0.0		193.0	85.0	NM_001165032	B2RDG2|Q8NBG3	Silent	SNP	ENST00000488300.1	hg19	CCDS4531.1																																																																																			.	.		0.463	RNF182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039911.2	NM_152737	
FILIP1	27145	hgsc.bcm.edu	37	6	76024218	76024218	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:76024218T>A	ENST00000237172.7	-	5	1660	c.1330A>T	c.(1330-1332)Aag>Tag	p.K444*	FILIP1_ENST00000393004.2_Nonsense_Mutation_p.K444*|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Nonsense_Mutation_p.K345*	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	444										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GATTTACTCTTGCTAAATGCT	0.408																																					p.K444X		Atlas-SNP	.											.	FILIP1	173	.	0			c.A1330T						.						141.0	142.0	142.0					6																	76024218		2203	4300	6503	SO:0001587	stop_gained	27145	exon5			TACTCTTGCTAAA	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.1330A>T	chr6.hg19:g.76024218T>A	ENSP00000237172:p.Lys444*	457.0	1.0		662.0	328.0	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Nonsense_Mutation	SNP	ENST00000237172.7	hg19	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	T	38	6.803656	0.97849	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	.	.	.	5.65	3.07	0.35406	.	0.221173	0.45867	D	0.000329	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.2141	12.2983	0.54860	0.0:0.0:0.2768:0.7232	.	.	.	.	X	444;444;345	.	ENSP00000237172:K444X	K	-	1	0	FILIP1	76080938	0.800000	0.28916	1.000000	0.80357	0.942000	0.58702	0.942000	0.29017	1.057000	0.40506	0.533000	0.62120	AAG	.	.		0.408	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
CITED2	10370	hgsc.bcm.edu	37	6	139694674	139694675	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:139694674_139694675CG>TT	ENST00000367651.2	-	2	622_623	c.407_408CG>AA	c.(406-408)cCG>cAA	p.P136Q	CITED2_ENST00000536159.1_Missense_Mutation_p.P136Q|CITED2_ENST00000537332.1_Missense_Mutation_p.P136Q	NM_006079.4	NP_006070.2	Q99967	CITE2_HUMAN	Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2	136					adrenal cortex formation (GO:0035802)|bone morphogenesis (GO:0060349)|cardiac neural crest cell development involved in heart development (GO:0061308)|cell aging (GO:0007569)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|cranial nerve morphogenesis (GO:0021602)|decidualization (GO:0046697)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endocardial cushion development (GO:0003197)|erythrocyte development (GO:0048821)|granulocyte differentiation (GO:0030851)|heart development (GO:0007507)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|left/right axis specification (GO:0070986)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|peripheral nervous system development (GO:0007422)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of gene expression (GO:0010628)|positive regulation of male gonad development (GO:2000020)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|pulmonary artery morphogenesis (GO:0061156)|regulation of organ formation (GO:0003156)|regulation of RNA biosynthetic process (GO:2001141)|response to estrogen (GO:0043627)|response to fluid shear stress (GO:0034405)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sex determination (GO:0007530)|skeletal muscle cell differentiation (GO:0035914)|spleen development (GO:0048536)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|LBD domain binding (GO:0050693)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			large_intestine(1)|lung(4)	5	Breast(32;0.226)			GBM - Glioblastoma multiforme(68;0.000171)|OV - Ovarian serous cystadenocarcinoma(155;0.00134)		GGTGCAAATCCGGCATGTAGTG	0.624																																					p.P141P|p.P141Q	NSCLC(98;1219 1550 33720 43229 49330)	Atlas-SNP	.											.	CITED2	16	.	0			c.G423A|c.C422A						.																																			SO:0001583	missense	10370	exon2			CAAATCCGGCATG|AAATCCGGCATGT	U65093	CCDS5195.1, CCDS75530.1	6q23.3	2008-08-29			ENSG00000164442	ENSG00000164442			1987	protein-coding gene	gene with protein product		602937				8901575, 10552932	Standard	NM_006079		Approved	MRG1	uc021zfz.2	Q99967	OTTHUMG00000015691	ENST00000367651.2:c.407_408delinsTT	chr6.hg19:g.139694674_139694675delinsTT	ENSP00000356623:p.Pro136Gln	154.0	0.0		288.0|291.0	141.0|145.0	NM_001168389	O95426|Q5VTF4	Silent|Missense_Mutation	SNP	ENST00000367651.2	hg19	CCDS5195.1																																																																																			.	.		0.624	CITED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042463.1		
SASH1	23328	hgsc.bcm.edu	37	6	148867236	148867236	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:148867236T>A	ENST00000367467.3	+	19	3909	c.3434T>A	c.(3433-3435)aTg>aAg	p.M1145K		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1145					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GCCGCCAACATGGACCAGATC	0.602																																					p.M1145K		Atlas-SNP	.											.	SASH1	123	.	0			c.T3434A						.						71.0	64.0	66.0					6																	148867236		2203	4300	6503	SO:0001583	missense	23328	exon19			CCAACATGGACCA	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.3434T>A	chr6.hg19:g.148867236T>A	ENSP00000356437:p.Met1145Lys	57.0	0.0		104.0	51.0	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	hg19	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.028284	0.75390	.	.	ENSG00000111961	ENST00000367467;ENST00000537769	T	0.41065	1.01	5.46	5.46	0.80206	.	0.229371	0.64402	D	0.000020	T	0.17195	0.0413	N	0.24115	0.695	0.51767	D	0.999936	P	0.36048	0.534	B	0.28553	0.091	T	0.11084	-1.0602	10	0.87932	D	0	-18.4612	15.5466	0.76108	0.0:0.0:0.0:1.0	.	1145	O94885	SASH1_HUMAN	K	1145;555	ENSP00000356437:M1145K	ENSP00000356437:M1145K	M	+	2	0	SASH1	148908929	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.519000	0.81809	2.077000	0.62373	0.533000	0.62120	ATG	.	.		0.602	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
NOX3	50508	hgsc.bcm.edu	37	6	155718096	155718096	+	Splice_Site	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:155718096G>T	ENST00000159060.2	-	13	1683	c.1581C>A	c.(1579-1581)agC>agA	p.S527R		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	527					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CAATACTGCTGCTGCAGTAGG	0.458																																					p.S527R		Atlas-SNP	.											.	NOX3	93	.	0			c.C1581A						.						60.0	62.0	61.0					6																	155718096		2203	4300	6503	SO:0001630	splice_region_variant	50508	exon13			ACTGCTGCTGCAG	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.1581-1C>A	chr6.hg19:g.155718096G>T		77.0	0.0		159.0	38.0	NM_015718	Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	hg19	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899972	0.33535	.	.	ENSG00000074771	ENST00000159060	D	0.95001	-3.58	5.53	5.53	0.82687	Ferric reductase, NAD binding (1);	0.089605	0.48767	D	0.000164	D	0.91637	0.7357	L	0.27975	0.815	0.46149	D	0.998891	D	0.56746	0.977	P	0.62298	0.9	D	0.89533	0.3787	10	0.21540	T	0.41	.	12.0236	0.53358	0.0788:0.0:0.9212:0.0	.	527	Q9HBY0	NOX3_HUMAN	R	527	ENSP00000159060:S527R	ENSP00000159060:S527R	S	-	3	2	NOX3	155759788	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	3.888000	0.56204	2.608000	0.88229	0.561000	0.74099	AGC	.	.		0.458	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		Missense_Mutation
IGF2R	3482	hgsc.bcm.edu	37	6	160454027	160454027	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:160454027G>T	ENST00000356956.1	+	9	1247	c.1099G>T	c.(1099-1101)Gga>Tga	p.G367*		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	367					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GAATGTCTGTGGAGAAACTGA	0.338																																					p.G367X		Atlas-SNP	.											.	IGF2R	251	.	0			c.G1099T						.						92.0	97.0	96.0					6																	160454027		2203	4300	6503	SO:0001587	stop_gained	3482	exon9			GTCTGTGGAGAAA	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1099G>T	chr6.hg19:g.160454027G>T	ENSP00000349437:p.Gly367*	143.0	0.0		197.0	59.0	NM_000876	Q7Z7G9|Q96PT5	Nonsense_Mutation	SNP	ENST00000356956.1	hg19	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	36	5.629446	0.96671	.	.	ENSG00000197081	ENST00000356956	.	.	.	4.81	4.81	0.61882	.	0.113164	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-17.0764	16.4499	0.83976	0.0:0.0:1.0:0.0	.	.	.	.	X	367	.	ENSP00000349437:G367X	G	+	1	0	IGF2R	160374017	1.000000	0.71417	0.459000	0.27081	0.120000	0.20174	4.843000	0.62838	2.386000	0.81285	0.655000	0.94253	GGA	.	.		0.338	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
PDE10A	10846	hgsc.bcm.edu	37	6	165846593	165846593	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr6:165846593C>G	ENST00000366882.1	-	8	686	c.532G>C	c.(532-534)Gga>Cga	p.G178R	PDE10A_ENST00000539869.2_Missense_Mutation_p.G188R|PDE10A_ENST00000354448.4_Missense_Mutation_p.G178R			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	178	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	GATTCCAGTCCAGTACCTCTT	0.388																																					p.G188R	Esophageal Squamous(22;308 615 5753 12038 40624)	Atlas-SNP	.											.	PDE10A	154	.	0			c.G562C						.						94.0	90.0	91.0					6																	165846593		2203	4300	6503	SO:0001583	missense	10846	exon7			CCAGTCCAGTACC	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.532G>C	chr6.hg19:g.165846593C>G	ENSP00000355847:p.Gly178Arg	231.0	0.0		323.0	84.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	hg19		.	.	.	.	.	.	.	.	.	.	C	27.8	4.867217	0.91511	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.69435	-0.4;-0.4	5.89	5.89	0.94794	GAF (2);	0.000000	0.85682	D	0.000000	T	0.79364	0.4433	M	0.68952	2.095	0.80722	D	1	D;P	0.89917	1.0;0.86	D;P	0.97110	1.0;0.643	T	0.79475	-0.1788	10	0.72032	D	0.01	.	20.2508	0.98407	0.0:1.0:0.0:0.0	.	188;178	Q9ULW9;Q9Y233	.;PDE10_HUMAN	R	178;206;188;178;177	ENSP00000355847:G178R;ENSP00000346435:G178R	ENSP00000341187:G188R	G	-	1	0	PDE10A	165766583	1.000000	0.71417	0.927000	0.36925	0.842000	0.47809	7.538000	0.82048	2.788000	0.95919	0.585000	0.79938	GGA	.	.		0.388	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
AOAH	313	hgsc.bcm.edu	37	7	36633945	36633945	+	Splice_Site	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:36633945C>T	ENST00000258749.5	-	12	1337	c.938G>A	c.(937-939)gGa>gAa	p.G313E	AOAH_ENST00000535891.1_Splice_Site_p.G281E|AOAH_ENST00000538464.1_Splice_Site_p.G35E|AOAH_ENST00000431169.1_Splice_Site_p.G313E	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	313					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						AGACACTTACCCAACAGTGGA	0.448																																					p.G313E		Atlas-SNP	.											.	AOAH	79	.	0			c.G938A						.						133.0	127.0	129.0					7																	36633945		2203	4300	6503	SO:0001630	splice_region_variant	313	exon12			ACTTACCCAACAG	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.938+1G>A	chr7.hg19:g.36633945C>T		146.0	0.0		213.0	12.0	NM_001637	A4D1Y5|B7Z490|Q53F13	Missense_Mutation	SNP	ENST00000258749.5	hg19	CCDS5448.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741165	0.30865	.	.	ENSG00000136250	ENST00000538464;ENST00000535891;ENST00000258749;ENST00000431169;ENST00000544647	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.05	4.17	0.49024	Esterase, SGNH hydrolase-type (1);Lipase, GDSL (1);	0.736603	0.12841	N	0.434811	T	0.26666	0.0652	.	.	.	0.39287	D	0.964669	P;P;B	0.51057	0.849;0.941;0.166	P;P;B	0.49192	0.602;0.577;0.138	T	0.03315	-1.1049	8	.	.	.	-9.2314	9.0872	0.36587	0.0:0.9015:0.0:0.0985	.	281;313;313	B7Z490;C9J8T1;P28039	.;.;AOAH_HUMAN	E	35;281;313;313;313	ENSP00000439283:G35E;ENSP00000441101:G281E;ENSP00000258749:G313E;ENSP00000405683:G313E	.	G	-	2	0	AOAH	36600470	0.966000	0.33281	0.779000	0.31741	0.003000	0.03518	2.282000	0.43461	1.360000	0.45960	0.557000	0.71058	GGA	.	.		0.448	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637	Missense_Mutation
TPST1	8460	hgsc.bcm.edu	37	7	65751568	65751568	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:65751568A>G	ENST00000304842.5	+	3	1341	c.916A>G	c.(916-918)Ata>Gta	p.I306V	TPST1_ENST00000480281.1_3'UTR	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	306					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GGTTGGGAAGATACCGCCAGA	0.413																																					p.I306V		Atlas-SNP	.											.	TPST1	25	.	0			c.A916G						.						140.0	124.0	130.0					7																	65751568		2203	4300	6503	SO:0001583	missense	8460	exon3			GGGAAGATACCGC	AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.916A>G	chr7.hg19:g.65751568A>G	ENSP00000302413:p.Ile306Val	139.0	0.0		147.0	68.0	NM_003596	A4D2M0|Q6FGM7	Missense_Mutation	SNP	ENST00000304842.5	hg19	CCDS5533.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370232	0.61624	.	.	ENSG00000169902	ENST00000304842;ENST00000544114	T	0.45276	0.9	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.55033	0.1895	M	0.86740	2.835	0.80722	D	1	P;P	0.40834	0.73;0.467	B;B	0.43445	0.42;0.175	T	0.61108	-0.7129	10	0.42905	T	0.14	-21.5617	14.8826	0.70545	1.0:0.0:0.0:0.0	.	306;306	F5H7U7;O60507	.;TPST1_HUMAN	V	306	ENSP00000302413:I306V	ENSP00000302413:I306V	I	+	1	0	TPST1	65389003	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	8.266000	0.89871	2.123000	0.65237	0.383000	0.25322	ATA	.	.		0.413	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251705.2	NM_003596	
CALN1	83698	hgsc.bcm.edu	37	7	71571275	71571275	+	Silent	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:71571275G>T	ENST00000329008.5	-	3	421	c.123C>A	c.(121-123)atC>atA	p.I41I	CALN1_ENST00000405452.2_Silent_p.I41I|CALN1_ENST00000412588.1_Silent_p.I83I|CALN1_ENST00000395276.2_Silent_p.I41I|CALN1_ENST00000431984.1_Silent_p.I41I|CALN1_ENST00000395275.2_Silent_p.I83I	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	41	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AGGCCTCTCGGATTTCTACAA	0.522																																					p.I83I		Atlas-SNP	.											.	CALN1	92	.	0			c.C249A						.						48.0	50.0	49.0					7																	71571275		2203	4300	6503	SO:0001819	synonymous_variant	83698	exon4			CTCTCGGATTTCT	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.123C>A	chr7.hg19:g.71571275G>T		45.0	0.0		56.0	20.0	NM_031468	J3KQA7	Silent	SNP	ENST00000329008.5	hg19	CCDS5541.1																																																																																			.	.		0.522	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320044.2	NM_031468	
YWHAG	7532	hgsc.bcm.edu	37	7	75959524	75959524	+	Silent	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:75959524C>G	ENST00000307630.3	-	2	336	c.114G>C	c.(112-114)tcG>tcC	p.S38S		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	38					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						GTTCCTCATTCGACAGTGGCT	0.502																																					p.S38S		Atlas-SNP	.											.	YWHAG	24	.	0			c.G114C						.						76.0	58.0	64.0					7																	75959524		2203	4300	6503	SO:0001819	synonymous_variant	7532	exon2			CTCATTCGACAGT	AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.114G>C	chr7.hg19:g.75959524C>G		36.0	0.0		56.0	27.0	NM_012479	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Silent	SNP	ENST00000307630.3	hg19	CCDS5584.1																																																																																			.	.		0.502	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253002.1	NM_012479	
MCM7	4176	hgsc.bcm.edu	37	7	99693701	99693701	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr7:99693701C>A	ENST00000303887.5	-	11	1936	c.1291G>T	c.(1291-1293)Ggt>Tgt	p.G431C	MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Missense_Mutation_p.G255C|MIR25_ENST00000384816.1_RNA|MIR93_ENST00000385024.1_RNA|MIR106B_ENST00000385301.1_RNA	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	431	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGGGCCCCACCCTCTAAGGTC	0.607																																					p.G431C		Atlas-SNP	.											.	MCM7	136	.	0			c.G1291T						.						57.0	54.0	55.0					7																	99693701		2203	4300	6503	SO:0001583	missense	4176	exon11			CCCCACCCTCTAA		CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1291G>T	chr7.hg19:g.99693701C>A	ENSP00000307288:p.Gly431Cys	69.0	0.0		94.0	35.0	NM_005916	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	ENST00000303887.5	hg19	CCDS5683.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254289	0.80135	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	T;T	0.11495	2.77;2.77	5.02	4.13	0.48395	ATPase, AAA+ type, core (1);	0.109029	0.64402	D	0.000007	T	0.48909	0.1526	H	0.98370	4.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67821	-0.5571	10	0.87932	D	0	-23.2828	12.4978	0.55937	0.1682:0.8318:0.0:0.0	.	431	P33993	MCM7_HUMAN	C	431;368;324;255	ENSP00000307288:G431C;ENSP00000346171:G255C	ENSP00000307288:G431C	G	-	1	0	MCM7	99531637	1.000000	0.71417	0.988000	0.46212	0.914000	0.54420	7.604000	0.82830	1.302000	0.44855	0.655000	0.94253	GGT	.	.		0.607	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336534.3		
FGF20	26281	hgsc.bcm.edu	37	8	16853235	16853235	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr8:16853235G>T	ENST00000180166.5	-	2	467	c.319C>A	c.(319-321)Ctg>Atg	p.L107M		NM_019851.2	NP_062825.1	Q9NP95	FGF20_HUMAN	fibroblast growth factor 20	107					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of cardiac muscle cell proliferation (GO:0060043)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	11				Colorectal(111;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		ATACTGACCAGTCCCACTGCC	0.338																																					p.L107M		Atlas-SNP	.											.	FGF20	16	.	0			c.C319A						.						113.0	107.0	109.0					8																	16853235		2203	4300	6503	SO:0001583	missense	26281	exon2			TGACCAGTCCCAC	AB030648	CCDS5998.1	8p22	2008-05-15			ENSG00000078579	ENSG00000078579			3677	protein-coding gene	gene with protein product		605558				10913340	Standard	NM_019851		Approved		uc003wxc.1	Q9NP95	OTTHUMG00000096964	ENST00000180166.5:c.319C>A	chr8.hg19:g.16853235G>T	ENSP00000180166:p.Leu107Met	152.0	0.0		103.0	56.0	NM_019851	B2RPH5	Missense_Mutation	SNP	ENST00000180166.5	hg19	CCDS5998.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.97|17.97	3.518782|3.518782	0.64634|0.64634	.|.	.|.	ENSG00000078579|ENSG00000078579	ENST00000180166|ENST00000381981	T|.	0.68479|.	-0.33|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67088|0.67088	0.2856|0.2856	L|L	0.58302|0.58302	1.8|1.8	0.58432|0.58432	D|D	0.999998|0.999998	B|.	0.32693|.	0.38|.	B|.	0.39971|.	0.315|.	T|T	0.68511|0.68511	-0.5389|-0.5389	10|6	0.66056|0.87932	D|D	0.02|0	.|.	13.4923|13.4923	0.61402|0.61402	0.0714:0.0:0.9286:0.0|0.0714:0.0:0.9286:0.0	.|.	107|.	Q9NP95|.	FGF20_HUMAN|.	M|N	107|75	ENSP00000180166:L107M|.	ENSP00000180166:L107M|ENSP00000371411:T75N	L|T	-|-	1|2	2|0	FGF20|FGF20	16897606|16897606	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	3.808000|3.808000	0.55598|0.55598	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CTG|ACT	.	.		0.338	FGF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214030.1		
PPP2R4	5524	hgsc.bcm.edu	37	9	131909700	131909700	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr9:131909700A>G	ENST00000337738.1	+	11	1301	c.1034A>G	c.(1033-1035)aAg>aGg	p.K345R	PPP2R4_ENST00000348141.5_Missense_Mutation_p.K316R|PPP2R4_ENST00000434095.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000347048.4_Missense_Mutation_p.K91R|PPP2R4_ENST00000419582.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000393370.2_Missense_Mutation_p.K310R|PPP2R4_ENST00000355007.3_Missense_Mutation_p.K268R|PPP2R4_ENST00000357197.4_Missense_Mutation_p.K281R|PPP2R4_ENST00000358994.4_Missense_Mutation_p.K310R|PPP2R4_ENST00000423100.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000435132.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000414510.1_Missense_Mutation_p.K48R|PPP2R4_ENST00000432651.1_Missense_Mutation_p.K48R	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	345					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		CAGCACTTCAAGTTCGGGAGC	0.632																																					p.K345R	Colon(158;2158 2504 4450 20433)	Atlas-SNP	.											.	PPP2R4	32	.	0			c.A1034G						.						90.0	71.0	78.0					9																	131909700		2203	4300	6503	SO:0001583	missense	5524	exon11			ACTTCAAGTTCGG	X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.1034A>G	chr9.hg19:g.131909700A>G	ENSP00000337448:p.Lys345Arg	43.0	0.0		87.0	44.0	NM_178001	A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Missense_Mutation	SNP	ENST00000337738.1	hg19		.	.	.	.	.	.	.	.	.	.	A	13.87	2.365001	0.41902	.	.	ENSG00000119383	ENST00000358994;ENST00000393370;ENST00000337738;ENST00000348141;ENST00000347048;ENST00000357197;ENST00000355007;ENST00000423100;ENST00000414510;ENST00000419582;ENST00000432651;ENST00000435132;ENST00000434095	T;T;T;T;T;T;T;T;T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61;1.61	5.16	4.02	0.46733	.	0.045098	0.85682	D	0.000000	T	0.19765	0.0475	N	0.17248	0.465	0.80722	D	1	B;B;B;B;B	0.15473	0.0;0.013;0.001;0.001;0.001	B;B;B;B;B	0.28465	0.005;0.09;0.004;0.012;0.002	T	0.05305	-1.0893	10	0.25106	T	0.35	.	9.9436	0.41596	0.9199:0.0:0.0801:0.0	.	281;91;268;345;310	Q15257-3;Q68CR8;Q15257-4;Q15257;Q15257-2	.;.;.;PTPA_HUMAN;.	R	310;310;345;316;91;281;268;48;48;48;48;48;48	ENSP00000351885:K310R;ENSP00000377036:K310R;ENSP00000337448:K345R;ENSP00000335200:K316R;ENSP00000337412:K91R;ENSP00000349726:K281R;ENSP00000347109:K268R;ENSP00000408316:K48R;ENSP00000408726:K48R;ENSP00000394001:K48R;ENSP00000416661:K48R;ENSP00000387726:K48R;ENSP00000411604:K48R	ENSP00000337448:K345R	K	+	2	0	PPP2R4	130949521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.960000	0.76036	0.812000	0.34326	0.459000	0.35465	AAG	.	.		0.632	PPP2R4-201	KNOWN	basic	protein_coding	protein_coding		NM_021131	
MASTL	84930	hgsc.bcm.edu	37	10	27459791	27459791	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr10:27459791A>T	ENST00000375940.4	+	8	1960	c.1903A>T	c.(1903-1905)Atg>Ttg	p.M635L	MASTL_ENST00000342386.6_Missense_Mutation_p.M635L|MASTL_ENST00000375946.4_Missense_Mutation_p.M635L|MASTL_ENST00000477034.1_3'UTR			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	635	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TAACCAAAAAATGTTAGGTCC	0.383																																					p.M635L		Atlas-SNP	.											.	MASTL	81	.	0			c.A1903T						.						63.0	61.0	62.0					10																	27459791		2203	4300	6503	SO:0001583	missense	84930	exon8			CAAAAAATGTTAG	BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.1903A>T	chr10.hg19:g.27459791A>T	ENSP00000365107:p.Met635Leu	110.0	0.0		139.0	49.0	NM_032844	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	ENST00000375940.4	hg19	CCDS53502.1	.	.	.	.	.	.	.	.	.	.	A	7.795	0.712418	0.15306	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.21734	1.99;1.99;1.99	5.28	2.83	0.33086	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.539261	0.22682	N	0.056939	T	0.14399	0.0348	L	0.48362	1.52	0.23401	N	0.997751	B;B;B	0.22211	0.066;0.04;0.066	B;B;B	0.20577	0.03;0.013;0.03	T	0.33979	-0.9847	10	0.05959	T	0.93	-13.5015	8.4168	0.32676	0.6766:0.0:0.3234:0.0	.	635;635;635	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	L	635	ENSP00000365113:M635L;ENSP00000343446:M635L;ENSP00000365107:M635L	ENSP00000343446:M635L	M	+	1	0	MASTL	27499797	0.182000	0.23173	0.986000	0.45419	0.824000	0.46624	0.604000	0.24164	0.891000	0.36235	0.482000	0.46254	ATG	.	.		0.383	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
ERCC6	2074	hgsc.bcm.edu	37	10	50732464	50732464	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr10:50732464T>A	ENST00000355832.5	-	5	1090	c.1012A>T	c.(1012-1014)Agg>Tgg	p.R338W	ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.R338W|PGBD3_ENST00000374127.3_5'Flank|PGBD3_ENST00000603152.1_Missense_Mutation_p.R338W|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.R338W	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	338					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TGCAAAGCCCTCTTCTGGAGT	0.488								Direct reversal of damage;Nucleotide excision repair (NER)																													p.K338X		Atlas-SNP	.											.	ERCC6	162	.	0			c.A1012T						.						111.0	107.0	109.0					10																	50732464		2203	4300	6503	SO:0001583	missense	2074	exon5			AAGCCCTCTTCTG	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1012A>T	chr10.hg19:g.50732464T>A	ENSP00000348089:p.Arg338Trp	736.0	2.0		985.0	364.0	NM_000124	D3DX94|Q5W0L9	Nonsense_Mutation	SNP	ENST00000355832.5	hg19	CCDS7229.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.699856	0.88924	.	.	ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000515869;ENST00000447839	D;T;T	0.83755	-1.76;3.17;3.17	6.03	3.58	0.41010	.	.	.	.	.	D	0.87273	0.6136	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.999;0.979	D;P	0.64321	0.924;0.699	D	0.87592	0.2491	9	0.66056	D	0.02	-22.645	11.924	0.52808	0.0:0.0:0.4892:0.5108	.	338;338	E7EV46;Q03468	.;ERCC6_HUMAN	W	338	ENSP00000348089:R338W;ENSP00000423550:R338W;ENSP00000387966:R338W	ENSP00000348089:R338W	R	-	1	2	ERCC6;RP11-123B3.6	50402470	0.996000	0.38824	0.994000	0.49952	0.996000	0.88848	4.072000	0.57563	1.091000	0.41335	0.533000	0.62120	AGG	.	.		0.488	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
PDE3B	5140	hgsc.bcm.edu	37	11	14665851	14665851	+	Missense_Mutation	SNP	G	G	T	rs534967735	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr11:14665851G>T	ENST00000282096.4	+	1	583	c.230G>T	c.(229-231)cGg>cTg	p.R77L	PDE3B_ENST00000455098.2_Missense_Mutation_p.R77L|PDE3B_ENST00000534317.1_3'UTR|PSMA1_ENST00000418988.2_5'Flank	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	77					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	CCCTTCTGCCGGGCGCGCCTC	0.761													G|||	2	0.000399361	0.0008	0.0	5008	,	,		12360	0.001		0.0	False		,,,				2504	0.0				p.R77L		Atlas-SNP	.											.	PDE3B	98	.	0			c.G230T						.						6.0	6.0	6.0					11																	14665851		2032	3990	6022	SO:0001583	missense	5140	exon1			TCTGCCGGGCGCG	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.230G>T	chr11.hg19:g.14665851G>T	ENSP00000282096:p.Arg77Leu	0.0	0.0		17.0	11.0	NM_000922	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	ENST00000282096.4	hg19	CCDS7817.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690888	0.29962	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.61742	0.11;0.08	3.83	0.529	0.17095	.	2.626090	0.03438	N	0.208919	T	0.39009	0.1062	N	0.14661	0.345	0.23936	N	0.99642	B;B;B	0.31077	0.307;0.084;0.307	B;B;B	0.22880	0.042;0.022;0.042	T	0.27123	-1.0083	10	0.36615	T	0.2	.	8.2155	0.31509	0.0868:0.2956:0.6175:0.0	.	77;77;77	B7ZM37;Q13370;A7E2E5	.;PDE3B_HUMAN;.	L	77	ENSP00000282096:R77L;ENSP00000388644:R77L	ENSP00000282096:R77L	R	+	2	0	PDE3B	14622427	0.982000	0.34865	0.907000	0.35723	0.890000	0.51754	1.060000	0.30530	0.130000	0.18549	0.313000	0.20887	CGG	.	.		0.761	PDE3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000386974.1	NM_000922	
OR10V1	390201	hgsc.bcm.edu	37	11	59481145	59481145	+	Silent	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr11:59481145G>T	ENST00000307552.2	-	1	192	c.174C>A	c.(172-174)ccC>ccA	p.P58P	STX3_ENST00000300150.7_5'UTR	NM_001005324.1	NP_001005324.1	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V, member 1	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|liver(1)|lung(10)|skin(1)	16						AAAAGTACATGGGGGTGTGGA	0.448																																					p.P58P		Atlas-SNP	.											.	OR10V1	40	.	0			c.C174A						.						61.0	65.0	63.0					11																	59481145		2201	4295	6496	SO:0001819	synonymous_variant	390201	exon1			GTACATGGGGGTG	AB065807	CCDS31565.1	11q12.1	2012-08-09			ENSG00000172289	ENSG00000172289		"""GPCR / Class A : Olfactory receptors"""	15136	protein-coding gene	gene with protein product							Standard	NM_001005324		Approved		uc001nof.1	Q8NGI7	OTTHUMG00000167406	ENST00000307552.2:c.174C>A	chr11.hg19:g.59481145G>T		167.0	0.0		231.0	10.0	NM_001005324	Q6IFD9|Q96R50	Silent	SNP	ENST00000307552.2	hg19	CCDS31565.1																																																																																			.	.		0.448	OR10V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394517.1	NM_001005324	
B4GALNT3	283358	hgsc.bcm.edu	37	12	668557	668557	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr12:668557G>A	ENST00000266383.5	+	19	2871	c.2858G>A	c.(2857-2859)tGg>tAg	p.W953*		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	953					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CGAGACCGCTGGGGCGGGGAA	0.617																																					p.W953X		Atlas-SNP	.											.	B4GALNT3	64	.	0			c.G2858A						.						88.0	94.0	92.0					12																	668557		2203	4300	6503	SO:0001587	stop_gained	283358	exon19			ACCGCTGGGGCGG	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2858G>A	chr12.hg19:g.668557G>A	ENSP00000266383:p.Trp953*	69.0	0.0		93.0	34.0	NM_173593	Q6ZNC1|Q8N7T6	Nonsense_Mutation	SNP	ENST00000266383.5	hg19	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	G	41	8.958160	0.99016	.	.	ENSG00000139044	ENST00000266383	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.6164	18.2881	0.90120	0.0:0.0:1.0:0.0	.	.	.	.	X	953	.	ENSP00000266383:W953X	W	+	2	0	B4GALNT3	538818	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.809000	0.86057	2.383000	0.81215	0.462000	0.41574	TGG	.	.		0.617	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	
KRT78	196374	hgsc.bcm.edu	37	12	53237937	53237937	+	Silent	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr12:53237937G>A	ENST00000304620.4	-	6	1050	c.987C>T	c.(985-987)atC>atT	p.I329I	KRT78_ENST00000359499.4_Silent_p.I219I	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	329	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						GTAGCTGAGAGATCTGGACTT	0.517																																					p.I329I		Atlas-SNP	.											.	KRT78	41	.	0			c.C987T						.						203.0	187.0	193.0					12																	53237937		2203	4300	6503	SO:0001819	synonymous_variant	196374	exon6			CTGAGAGATCTGG	AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.987C>T	chr12.hg19:g.53237937G>A		289.0	0.0		402.0	152.0	NM_173352	A8K4D6|Q5HYM7|Q7RTT2	Silent	SNP	ENST00000304620.4	hg19	CCDS8840.1																																																																																			.	.		0.517	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406380.1	NM_173352	
OR6C75	390323	hgsc.bcm.edu	37	12	55759521	55759521	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr12:55759521G>T	ENST00000343399.3	+	1	627	c.627G>T	c.(625-627)ttG>ttT	p.L209F		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TGGTCACCTTGACATTAGTTA	0.408																																					p.L209F		Atlas-SNP	.											.	OR6C75	67	.	0			c.G627T						.						147.0	129.0	135.0					12																	55759521		2203	4300	6503	SO:0001583	missense	390323	exon1			CACCTTGACATTA		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.627G>T	chr12.hg19:g.55759521G>T	ENSP00000368987:p.Leu209Phe	406.0	1.0		466.0	174.0	NM_001005497		Missense_Mutation	SNP	ENST00000343399.3	hg19	CCDS31820.1	.	.	.	.	.	.	.	.	.	.	g	15.12	2.740123	0.49045	.	.	ENSG00000187857	ENST00000343399	T	0.40476	1.03	5.22	-0.481	0.12082	GPCR, rhodopsin-like superfamily (1);	0.201247	0.23896	N	0.043482	T	0.32224	0.0822	L	0.28274	0.84	0.09310	N	0.999996	P	0.45011	0.848	P	0.50825	0.651	T	0.15464	-1.0436	10	0.72032	D	0.01	.	3.0854	0.06276	0.2711:0.4368:0.1802:0.1119	.	209	A6NL08	O6C75_HUMAN	F	209	ENSP00000368987:L209F	ENSP00000368987:L209F	L	+	3	2	OR6C75	54045788	0.000000	0.05858	0.904000	0.35570	0.966000	0.64601	-2.394000	0.01054	-0.010000	0.14271	0.632000	0.83419	TTG	.	.		0.408	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1		
KL	9365	hgsc.bcm.edu	37	13	33638123	33638123	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr13:33638123A>G	ENST00000380099.3	+	5	2847	c.2839A>G	c.(2839-2841)Att>Gtt	p.I947V	KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	947	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		TTACAGGAAAATTATTGACAG	0.453																																					p.I947V		Atlas-SNP	.											.	KL	106	.	0			c.A2839G						.						124.0	124.0	124.0					13																	33638123		2203	4300	6503	SO:0001583	missense	9365	exon5			AGGAAAATTATTG	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.2839A>G	chr13.hg19:g.33638123A>G	ENSP00000369442:p.Ile947Val	322.0	0.0		225.0	51.0	NM_004795	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	ENST00000380099.3	hg19	CCDS9347.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.707815	0.48412	.	.	ENSG00000133116	ENST00000380099	T	0.27890	1.64	5.52	4.32	0.51571	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.111045	0.64402	D	0.000011	T	0.32071	0.0817	L	0.48260	1.515	0.50313	D	0.999868	P	0.41597	0.756	P	0.44647	0.456	T	0.02179	-1.1200	10	0.28530	T	0.3	-10.3003	12.5759	0.56363	0.8611:0.1389:0.0:0.0	.	947	Q9UEF7	KLOT_HUMAN	V	947	ENSP00000369442:I947V	ENSP00000369442:I947V	I	+	1	0	KL	32536123	1.000000	0.71417	0.817000	0.32601	0.948000	0.59901	6.653000	0.74382	0.893000	0.36288	0.533000	0.62120	ATT	.	.		0.453	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045987.1		
MAB21L1	4081	hgsc.bcm.edu	37	13	36050192	36050193	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr13:36050192_36050193GG>TT	ENST00000379919.4	-	1	639_640	c.83_84CC>AA	c.(82-84)gCC>gAA	p.A28E	NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	28					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GGATAGTTTTGGCAATGGCAGC	0.51																																					p.A28A|p.A28D		Atlas-SNP	.											.	MAB21L1	52	.	0			c.C84A|c.C83A						.																																			SO:0001583	missense	4081	exon1			AGTTTTGGCAATG|GTTTTGGCAATGG	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.83_84delinsTT	chr13.hg19:g.36050192_36050193delinsTT	ENSP00000369251:p.Ala28Glu	82.0	0.0		56.0	35.0|34.0	NM_005584	Q6I9T5	Silent|Missense_Mutation	SNP	ENST00000379919.4	hg19	CCDS9353.1																																																																																			.	.		0.510	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
NALCN	259232	hgsc.bcm.edu	37	13	101717813	101717813	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr13:101717813C>T	ENST00000251127.6	-	40	4628	c.4547G>A	c.(4546-4548)tGc>tAc	p.C1516Y		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1516					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CATTTCGTAGCACATGTGCTT	0.592																																					p.C1516Y		Atlas-SNP	.											.	NALCN	431	.	0			c.G4547A						.						175.0	135.0	149.0					13																	101717813		2203	4300	6503	SO:0001583	missense	259232	exon40			TCGTAGCACATGT	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4547G>A	chr13.hg19:g.101717813C>T	ENSP00000251127:p.Cys1516Tyr	64.0	0.0		130.0	42.0	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	hg19	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751465	0.89753	.	.	ENSG00000102452	ENST00000251127	D	0.97906	-4.6	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.98333	0.9447	L	0.55213	1.73	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.99647	1.0990	10	0.87932	D	0	.	19.8625	0.96789	0.0:1.0:0.0:0.0	.	1516	Q8IZF0	NALCN_HUMAN	Y	1516	ENSP00000251127:C1516Y	ENSP00000251127:C1516Y	C	-	2	0	NALCN	100515814	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.689000	0.91719	0.655000	0.94253	TGC	.	.		0.592	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
KLHL33	123103	hgsc.bcm.edu	37	14	20897958	20897958	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:20897958G>T	ENST00000344581.4	-	2	1099	c.877C>A	c.(877-879)Ctc>Atc	p.L293I		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	293												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		TTATACCTGAGAGTTGAAGCC	0.577																																					p.L293I		Atlas-SNP	.											.	KLHL33	37	.	0			c.C877A						.						45.0	42.0	43.0					14																	20897958		692	1591	2283	SO:0001583	missense	123103	exon2			ACCTGAGAGTTGA		CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.877C>A	chr14.hg19:g.20897958G>T	ENSP00000341549:p.Leu293Ile	66.0	0.0		76.0	24.0	NM_001109997		Missense_Mutation	SNP	ENST00000344581.4	hg19	CCDS53882.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.313218	0.23908	.	.	ENSG00000185271	ENST00000344581	T	0.67345	-0.26	4.88	3.98	0.46160	Kelch-type beta propeller (1);	0.236080	0.37393	N	0.002104	T	0.58380	0.2118	L	0.54323	1.7	0.43522	D	0.995796	B	0.19817	0.039	B	0.18871	0.023	T	0.59193	-0.7500	10	0.72032	D	0.01	.	7.2719	0.26262	0.1953:0.0:0.8047:0.0	.	293	A6NCF5	KLH33_HUMAN	I	293	ENSP00000341549:L293I	ENSP00000341549:L293I	L	-	1	0	KLHL33	19967798	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.174000	0.50847	1.256000	0.44068	0.655000	0.94253	CTC	.	.		0.577	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411038.1	XM_063481	
CHD8	57680	hgsc.bcm.edu	37	14	21878045	21878045	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:21878045G>A	ENST00000557364.1	-	11	2592	c.2329C>T	c.(2329-2331)Cgg>Tgg	p.R777W	CHD8_ENST00000430710.3_Missense_Mutation_p.R498W|CHD8_ENST00000555962.1_Intron|CHD8_ENST00000399982.2_Missense_Mutation_p.R777W			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	777	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GACTGAATCCGTTTAAATTCT	0.393																																					p.R777W		Atlas-SNP	.											.	CHD8	339	.	0			c.C2329T						.						146.0	135.0	138.0					14																	21878045		1865	4097	5962	SO:0001583	missense	57680	exon10			GAATCCGTTTAAA	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.2329C>T	chr14.hg19:g.21878045G>A	ENSP00000451601:p.Arg777Trp	331.0	0.0		311.0	30.0	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	hg19	CCDS53885.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.85|18.85	3.712158|3.712158	0.68730|0.68730	.|.	.|.	ENSG00000100888|ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364|ENST00000555935	T;T;T|.	0.74002|.	-0.8;-0.8;-0.8|.	5.0|5.0	4.08|4.08	0.47627|0.47627	.|.	0.138303|.	0.48286|.	D|.	0.000189|.	T|T	0.58293|0.58293	0.2112|0.2112	L|L	0.42245|0.42245	1.32|1.32	0.48452|0.48452	D|D	0.999657|0.999657	D|.	0.76494|.	0.999|.	D|.	0.65987|.	0.94|.	T|T	0.55068|0.55068	-0.8198|-0.8198	10|5	0.87932|.	D|.	0|.	-16.3856|-16.3856	13.372|13.372	0.60719|0.60719	0.0:0.0:0.8411:0.1589|0.0:0.0:0.8411:0.1589	.|.	498|.	Q9HCK8-2|.	.|.	W|M	498;777;497;777|2	ENSP00000406288:R498W;ENSP00000382863:R777W;ENSP00000451601:R777W|.	ENSP00000262707:R497W|.	R|T	-|-	1|2	2|0	CHD8|CHD8	20947885|20947885	0.052000|0.052000	0.20516|0.20516	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.639000|1.639000	0.37176|0.37176	1.270000|1.270000	0.44297|0.44297	0.655000|0.655000	0.94253|0.94253	CGG|ACG	.	.		0.393	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
ITPK1	3705	hgsc.bcm.edu	37	14	93483123	93483123	+	Silent	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:93483123C>T	ENST00000267615.6	-	4	317	c.144G>A	c.(142-144)gaG>gaA	p.E48E	ITPK1_ENST00000556954.1_5'UTR|ITPK1_ENST00000556603.2_Silent_p.E48E|ITPK1_ENST00000354313.3_Silent_p.E48E|ITPK1_ENST00000555495.1_5'UTR			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	48					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		GGCCCTGCTCCTCGATCGGCC	0.582																																					p.E48E		Atlas-SNP	.											.	ITPK1	53	.	0			c.G144A						.						110.0	91.0	98.0					14																	93483123		2203	4300	6503	SO:0001819	synonymous_variant	3705	exon4			CTGCTCCTCGATC	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.144G>A	chr14.hg19:g.93483123C>T		47.0	0.0		71.0	34.0	NM_001142593	Q9BTL6|Q9H2E7	Silent	SNP	ENST00000267615.6	hg19	CCDS9907.1																																																																																			.	.		0.582	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
UNC79	57578	hgsc.bcm.edu	37	14	94088075	94088075	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr14:94088075A>G	ENST00000393151.2	+	30	4496	c.4496A>G	c.(4495-4497)cAa>cGa	p.Q1499R	UNC79_ENST00000555664.1_Missense_Mutation_p.Q1499R|UNC79_ENST00000553484.1_Missense_Mutation_p.Q1521R|UNC79_ENST00000256339.4_Missense_Mutation_p.Q1322R			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1499					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCTTTCAAACAAAAATCTCTT	0.433																																					p.Q1322R		Atlas-SNP	.											.	UNC79	366	.	0			c.A3965G						.						81.0	80.0	81.0					14																	94088075		2203	4300	6503	SO:0001583	missense	57578	exon30			TCAAACAAAAATC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4496A>G	chr14.hg19:g.94088075A>G	ENSP00000376858:p.Gln1499Arg	149.0	0.0		182.0	63.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	A	18.97	3.735305	0.69189	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.26373	1.79;1.74;1.8;1.79	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	L	0.32530	0.975	0.48185	D	0.999609	D	0.63046	0.992	D	0.72982	0.979	T	0.29549	-1.0008	10	0.87932	D	0	-16.0344	16.4728	0.84119	1.0:0.0:0.0:0.0	.	1521	C9JQL1	.	R	1322;1499;1521;1499;1521	ENSP00000256339:Q1322R;ENSP00000450868:Q1499R;ENSP00000451360:Q1521R;ENSP00000376858:Q1499R	ENSP00000256339:Q1322R	Q	+	2	0	KIAA1409	93157828	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.962000	0.93254	2.296000	0.77279	0.482000	0.46254	CAA	.	.		0.433	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
OR4F15	390649	hgsc.bcm.edu	37	15	102359072	102359072	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr15:102359072A>T	ENST00000332238.4	+	1	707	c.683A>T	c.(682-684)cAt>cTt	p.H228L		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			GTTTGGAAACATTCTTCTGGT	0.463																																					p.H228L		Atlas-SNP	.											.	OR4F15	42	.	0			c.A683T						.						280.0	242.0	255.0					15																	102359072		2203	4300	6503	SO:0001583	missense	390649	exon1			GGAAACATTCTTC	BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.683A>T	chr15.hg19:g.102359072A>T	ENSP00000333184:p.His228Leu	611.0	0.0		989.0	257.0	NM_001001674	B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	ENST00000332238.4	hg19	CCDS32342.1	.	.	.	.	.	.	.	.	.	.	.	8.090	0.774339	0.16051	.	.	ENSG00000182854	ENST00000332238	T	0.00042	8.84	5.57	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.095904	0.46442	D	0.000294	T	0.00073	0.0002	N	0.03324	-0.35	0.09310	N	1	B	0.20368	0.044	B	0.23852	0.049	T	0.02026	-1.1227	9	.	.	.	.	9.5446	0.39273	0.9181:0.0:0.0819:0.0	.	228	Q8NGB8	O4F15_HUMAN	L	228	ENSP00000333184:H228L	.	H	+	2	0	OR4F15	100176595	0.000000	0.05858	0.202000	0.23494	0.201000	0.24016	-0.249000	0.08842	1.134000	0.42165	0.528000	0.53228	CAT	.	.		0.463	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674	
PDXDC1	23042	hgsc.bcm.edu	37	16	15126797	15126797	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:15126797A>T	ENST00000396410.4	+	18	1748	c.1651A>T	c.(1651-1653)Aag>Tag	p.K551*	PDXDC1_ENST00000450288.2_Nonsense_Mutation_p.K523*|PDXDC1_ENST00000447912.2_Nonsense_Mutation_p.K460*|PDXDC1_ENST00000569715.1_Nonsense_Mutation_p.K524*|PDXDC1_ENST00000325823.7_Nonsense_Mutation_p.K536*|PDXDC1_ENST00000563679.1_Nonsense_Mutation_p.K569*|PDXDC1_ENST00000535621.2_Intron	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	551					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACTCCTGAAGAAGTTAAATGA	0.408																																					p.K551X		Atlas-SNP	.											.	PDXDC1	59	.	0			c.A1651T						.						94.0	100.0	98.0					16																	15126797		2197	4300	6497	SO:0001587	stop_gained	23042	exon18			CTGAAGAAGTTAA	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1651A>T	chr16.hg19:g.15126797A>T	ENSP00000379691:p.Lys551*	124.0	0.0		138.0	52.0	NM_015027	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Nonsense_Mutation	SNP	ENST00000396410.4	hg19	CCDS32393.1	.	.	.	.	.	.	.	.	.	.	A	38	6.906433	0.97924	.	.	ENSG00000179889	ENST00000325823;ENST00000447912;ENST00000396410;ENST00000450288	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.7462	14.9371	0.70964	1.0:0.0:0.0:0.0	.	.	.	.	X	536;460;551;523	.	ENSP00000322807:K536X	K	+	1	0	PDXDC1	15034298	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.142000	0.77339	2.131000	0.65755	0.533000	0.62120	AAG	.	.		0.408	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
LAT	27040	hgsc.bcm.edu	37	16	29001267	29001267	+	Silent	SNP	C	C	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:29001267C>A	ENST00000360872.5	+	10	801	c.723C>A	c.(721-723)tcC>tcA	p.S241S	LAT_ENST00000395456.2_Silent_p.S212S|LAT_ENST00000395461.3_Silent_p.S248S|LAT_ENST00000564277.1_Silent_p.S211S|LAT_ENST00000354453.4_Silent_p.S231S|RP11-264B17.5_ENST00000561471.1_RNA|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000454369.2_Silent_p.S211S|LAT_ENST00000566177.1_Silent_p.S240S			O43561	LAT_HUMAN	linker for activation of T cells	241					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CCCTGAGTTCCCAGGAGGCAG	0.632																																					p.S248S		Atlas-SNP	.											.	LAT	22	.	0			c.C744A						.						71.0	68.0	69.0					16																	29001267		2197	4300	6497	SO:0001819	synonymous_variant	27040	exon12			GAGTTCCCAGGAG	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.723C>A	chr16.hg19:g.29001267C>A		95.0	0.0		161.0	53.0	NM_001014989	B7WPI0|C7C5T6|G5E9K3|O43919	Silent	SNP	ENST00000360872.5	hg19	CCDS10647.1																																																																																			.	.		0.632	LAT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254688.2		
MYLK3	91807	hgsc.bcm.edu	37	16	46766546	46766546	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr16:46766546C>T	ENST00000394809.4	-	4	1151	c.1036G>A	c.(1036-1038)Ggg>Agg	p.G346R	MYLK3_ENST00000536476.1_Missense_Mutation_p.G5R	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	346					cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AGCATCTCCCCAGGAGTATCC	0.607																																					p.G346R		Atlas-SNP	.											.	MYLK3	82	.	0			c.G1036A						.						20.0	15.0	17.0					16																	46766546		2011	4016	6027	SO:0001583	missense	91807	exon4			TCTCCCCAGGAGT	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.1036G>A	chr16.hg19:g.46766546C>T	ENSP00000378288:p.Gly346Arg	8.0	0.0		18.0	14.0	NM_182493	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Missense_Mutation	SNP	ENST00000394809.4	hg19	CCDS10723.2	.	.	.	.	.	.	.	.	.	.	C	9.418	1.082352	0.20309	.	.	ENSG00000140795	ENST00000394809;ENST00000536476	T;T	0.68765	-0.35;-0.35	5.51	3.57	0.40892	.	0.470755	0.15827	N	0.242698	T	0.51635	0.1686	L	0.34521	1.04	0.32663	N	0.517819	B;B	0.24533	0.105;0.105	B;B	0.20184	0.028;0.028	T	0.54153	-0.8336	10	0.30078	T	0.28	.	8.1388	0.31071	0.0:0.8171:0.0:0.1829	.	346;346	B5BUL9;Q32MK0	.;MYLK3_HUMAN	R	346;5	ENSP00000378288:G346R;ENSP00000439297:G5R	ENSP00000378288:G346R	G	-	1	0	MYLK3	45324047	0.104000	0.21937	0.653000	0.29593	0.055000	0.15305	0.836000	0.27545	0.685000	0.31468	0.655000	0.94253	GGG	.	.		0.607	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
DVL2	1856	hgsc.bcm.edu	37	17	7129551	7129551	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:7129551T>G	ENST00000005340.5	-	15	2126	c.1844A>C	c.(1843-1845)aAg>aCg	p.K615T	MIR324_ENST00000362183.1_RNA|DVL2_ENST00000574642.1_5'Flank|DVL2_ENST00000575458.1_Missense_Mutation_p.K609T	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	615					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						ACTGCCGGACTTGGACTCGGG	0.726																																					p.K615T		Atlas-SNP	.											.	DVL2	49	.	0			c.A1844C						.						24.0	31.0	29.0					17																	7129551		2200	4296	6496	SO:0001583	missense	1856	exon15			CCGGACTTGGACT	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1844A>C	chr17.hg19:g.7129551T>G	ENSP00000005340:p.Lys615Thr	14.0	0.0		25.0	14.0	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	hg19	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	T	11.61	1.690114	0.29962	.	.	ENSG00000004975	ENST00000005340	T	0.04234	3.67	5.49	4.35	0.52113	Dishevelled C-terminal (1);	0.397637	0.27586	N	0.018707	T	0.04318	0.0119	L	0.38175	1.15	0.36357	D	0.86045	B;B	0.18013	0.025;0.025	B;B	0.16289	0.015;0.015	T	0.35151	-0.9800	10	0.14252	T	0.57	-26.9546	10.3546	0.43956	0.0:0.0:0.1647:0.8353	.	609;615	B4DLQ0;O14641	.;DVL2_HUMAN	T	615	ENSP00000005340:K615T	ENSP00000005340:K615T	K	-	2	0	DVL2	7070275	0.884000	0.30299	1.000000	0.80357	0.961000	0.63080	1.600000	0.36762	2.080000	0.62538	0.533000	0.62120	AAG	.	.		0.726	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
TP53	7157	hgsc.bcm.edu	37	17	7577107	7577107	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:7577107A>T	ENST00000269305.4	-	8	1020	c.831T>A	c.(829-831)tgT>tgA	p.C277*	TP53_ENST00000359597.4_Nonsense_Mutation_p.C277*|TP53_ENST00000445888.2_Nonsense_Mutation_p.C277*|TP53_ENST00000420246.2_Nonsense_Mutation_p.C277*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.C277*|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	277	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C277*(8)|p.C277C(4)|p.?(2)|p.P278fs*28(2)|p.C277W(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.A276_C277delAC(1)|p.V274_P278del(1)|p.C277_P278insXXXXXXX(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCTCCCAGGACAGGCACAAA	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C277X	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,-1,2	TP53	33396	.	38	Substitution - Nonsense(8)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(4)|Substitution - coding silent(4)|Insertion - Frameshift(2)|Unknown(2)|Substitution - Missense(2)|Insertion - In frame(1)	upper_aerodigestive_tract(6)|breast(6)|urinary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|central_nervous_system(2)|oesophagus(2)|lung(2)|biliary_tract(1)|large_intestine(1)|ovary(1)|prostate(1)	c.T831A	GRCh37	CM065496	TP53	M		.						72.0	62.0	65.0					17																	7577107		2203	4300	6503	SO:0001587	stop_gained	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCCAGGACAGGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.831T>A	chr17.hg19:g.7577107A>T	ENSP00000269305:p.Cys277*	87.0	0.0		65.0	47.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	37	6.040834	0.97226	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.13	1.53	0.23141	.	0.044315	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0792	7.7422	0.28848	0.6581:0.0:0.3419:0.0	.	.	.	.	X	277;277;277;277;277;266;145	.	ENSP00000269305:C277X	C	-	3	2	TP53	7517832	0.987000	0.35691	1.000000	0.80357	0.977000	0.68977	0.281000	0.18810	0.383000	0.24910	0.379000	0.24179	TGT	.	.		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CRLF3	51379	hgsc.bcm.edu	37	17	29119458	29119458	+	Splice_Site	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:29119458C>T	ENST00000324238.6	-	6	1083	c.959G>A	c.(958-960)aGa>aAa	p.R320K	CRLF3_ENST00000577725.1_Intron|CTD-2349P21.9_ENST00000580085.1_lincRNA|CRLF3_ENST00000544695.1_Splice_Site_p.R204K	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	320					G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATCTACTTGCCTGAATGTTAA	0.418																																					p.R320K	Pancreas(30;346 881 29244 33464 41299)	Atlas-SNP	.											.	CRLF3	36	.	0			c.G959A						.						114.0	110.0	112.0					17																	29119458		2203	4300	6503	SO:0001630	splice_region_variant	51379	exon6			ACTTGCCTGAATG	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.959+1G>A	chr17.hg19:g.29119458C>T		116.0	0.0		131.0	46.0	NM_015986	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Missense_Mutation	SNP	ENST00000324238.6	hg19	CCDS32607.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957192	0.53293	.	.	ENSG00000176390	ENST00000324238;ENST00000544695	T;T	0.60171	0.21;0.21	5.49	5.49	0.81192	.	0.565711	0.21304	N	0.076745	T	0.44159	0.1280	N	0.17082	0.46	0.43798	D	0.996349	B	0.16396	0.017	B	0.10450	0.005	T	0.28964	-1.0027	9	.	.	.	-5.7154	19.3434	0.94355	0.0:1.0:0.0:0.0	.	320	Q8IUI8	CRLF3_HUMAN	K	320;204	ENSP00000318804:R320K;ENSP00000444188:R204K	.	R	-	2	0	CRLF3	26143584	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.595000	0.54016	2.560000	0.86352	0.591000	0.81541	AGA	.	.		0.418	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444354.1		Missense_Mutation
KRT28	162605	hgsc.bcm.edu	37	17	38955214	38955214	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:38955214A>G	ENST00000306658.7	-	2	553	c.488T>C	c.(487-489)cTg>cCg	p.L163P		NM_181535.3	NP_853513.2			keratin 28											NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30		Breast(137;0.000301)				ATCAATCTGCAGAATGACATT	0.328																																					p.L163P	Melanoma(19;789 869 15380 26882 39836)	Atlas-SNP	.											.	KRT28	65	.	0			c.T488C						.						111.0	114.0	113.0					17																	38955214		2203	4299	6502	SO:0001583	missense	162605	exon2			ATCTGCAGAATGA	AK129827	CCDS11376.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000173908	ENSG00000173908		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30842	protein-coding gene	gene with protein product			"""keratin 25D"""	KRT25D		16831889	Standard	NM_181535		Approved		uc002hvh.1	Q7Z3Y7	OTTHUMG00000133365	ENST00000306658.7:c.488T>C	chr17.hg19:g.38955214A>G	ENSP00000305263:p.Leu163Pro	595.0	0.0		783.0	217.0	NM_181535		Missense_Mutation	SNP	ENST00000306658.7	hg19	CCDS11376.1	.	.	.	.	.	.	.	.	.	.	A	19.71	3.877625	0.72294	.	.	ENSG00000173908	ENST00000306658	T	0.73789	-0.78	5.36	5.36	0.76844	Filament (1);	0.000000	0.47093	D	0.000254	D	0.91250	0.7242	H	0.98005	4.125	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94285	0.7523	10	0.87932	D	0	.	14.8194	0.70059	1.0:0.0:0.0:0.0	.	163	Q7Z3Y7	K1C28_HUMAN	P	163	ENSP00000305263:L163P	ENSP00000305263:L163P	L	-	2	0	KRT28	36208740	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.494000	0.90477	2.162000	0.67917	0.533000	0.62120	CTG	.	.		0.328	KRT28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257201.2	NM_181535	
MPP2	4355	hgsc.bcm.edu	37	17	41958848	41958848	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:41958848T>G	ENST00000461854.1	-	8	948	c.863A>C	c.(862-864)cAg>cCg	p.Q288P	MPP2_ENST00000520305.1_Missense_Mutation_p.Q125P|MPP2_ENST00000523501.1_Missense_Mutation_p.Q253P|MPP2_ENST00000377184.3_Missense_Mutation_p.Q281P|MPP2_ENST00000536246.1_Missense_Mutation_p.Q253P|MPP2_ENST00000473246.1_5'Flank|MPP2_ENST00000518766.1_Missense_Mutation_p.Q309P|MPP2_ENST00000269095.4_Missense_Mutation_p.Q264P			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	288	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		GGCATCATCCTGGTTTACGAT	0.617																																					p.Q264P		Atlas-SNP	.											.	MPP2	67	.	0			c.A791C						.						93.0	84.0	87.0					17																	41958848		2203	4300	6503	SO:0001583	missense	4355	exon7			TCATCCTGGTTTA		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.863A>C	chr17.hg19:g.41958848T>G	ENSP00000428286:p.Gln288Pro	55.0	0.0		105.0	30.0	NM_005374	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000461854.1	hg19		.	.	.	.	.	.	.	.	.	.	t	19.91	3.914920	0.72983	.	.	ENSG00000108852	ENST00000377184;ENST00000269095;ENST00000461854;ENST00000520305;ENST00000523501;ENST00000536246;ENST00000518766	T;T;T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08;3.08;3.08	5.1	4.02	0.46733	.	.	.	.	.	T	0.26593	0.0650	M	0.81682	2.555	0.58432	D	0.99999	D;D	0.63046	0.992;0.991	D;P	0.69142	0.962;0.894	T	0.01039	-1.1472	9	0.87932	D	0	.	9.17	0.37074	0.0:0.0861:0.0:0.9139	.	309;281	E7EV80;Q14168-3	.;.	P	281;264;288;125;253;253;309	ENSP00000366389:Q281P;ENSP00000269095:Q264P;ENSP00000428286:Q288P;ENSP00000428136:Q125P;ENSP00000430540:Q253P;ENSP00000438012:Q253P;ENSP00000428182:Q309P	ENSP00000269095:Q264P	Q	-	2	0	MPP2	39314374	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	3.296000	0.51802	0.964000	0.38108	0.454000	0.30748	CAG	.	.		0.617	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	protein_coding	OTTHUMT00000258388.2	NM_005374	
HOXB9	3219	hgsc.bcm.edu	37	17	46703431	46703431	+	Silent	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:46703431G>A	ENST00000311177.5	-	1	408	c.201C>T	c.(199-201)agC>agT	p.S67S	HOXB-AS4_ENST00000480386.1_RNA|HOXB9_ENST00000550387.1_Silent_p.S67S|HOXB7_ENST00000567101.2_Intron	NM_024017.4	NP_076922.1	P17482	HXB9_HUMAN	homeobox B9	67					anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|embryonic skeletal system development (GO:0048706)|mammary gland development (GO:0030879)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(1)|large_intestine(1)|liver(1)|lung(6)|prostate(1)	12						ACGCGTGCGGGCTCAGCGGCG	0.736																																					p.S67S		Atlas-SNP	.											.	HOXB9	19	.	0			c.C201T						.						4.0	6.0	5.0					17																	46703431		2030	4035	6065	SO:0001819	synonymous_variant	3219	exon1			GTGCGGGCTCAGC		CCDS11534.1	17q21.32	2011-06-20	2005-12-22		ENSG00000170689	ENSG00000170689		"""Homeoboxes / ANTP class : HOXL subclass"""	5120	protein-coding gene	gene with protein product		142964	"""homeo box B9"""	HOX2E, HOX2		1973146, 1358459	Standard	NM_024017		Approved		uc002inx.3	P17482	OTTHUMG00000159907	ENST00000311177.5:c.201C>T	chr17.hg19:g.46703431G>A		2.0	0.0		15.0	10.0	NM_024017	B2RDB7|Q9H1I1	Silent	SNP	ENST00000311177.5	hg19	CCDS11534.1																																																																																			.	.		0.736	HOXB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358101.2		
CLTC	1213	hgsc.bcm.edu	37	17	57759022	57759022	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:57759022T>C	ENST00000269122.3	+	21	3538	c.3264T>C	c.(3262-3264)caT>caC	p.H1088H	CLTC_ENST00000393043.1_Silent_p.H1088H|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1088	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TAATTGAGCATATTGGAAACT	0.388			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.H1088H		Atlas-SNP	.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	124	.	0			c.T3264C						.						103.0	99.0	101.0					17																	57759022		2203	4300	6503	SO:0001819	synonymous_variant	1213	exon21			TGAGCATATTGGA	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.3264T>C	chr17.hg19:g.57759022T>C		147.0	0.0		179.0	93.0	NM_004859	D3DU00|Q6N0A0|Q86TF2	Silent	SNP	ENST00000269122.3	hg19	CCDS32696.1																																																																																			.	.		0.388	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
KIF19	124602	hgsc.bcm.edu	37	17	72343926	72343926	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:72343926G>A	ENST00000389916.4	+	9	1073	c.935G>A	c.(934-936)gGa>gAa	p.G312E		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	312	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GACTCTCTGGGAGGAAACAGC	0.637																																					p.G312E		Atlas-SNP	.											.	KIF19	102	.	0			c.G935A						.						80.0	46.0	58.0					17																	72343926		2202	4286	6488	SO:0001583	missense	124602	exon9			CTCTGGGAGGAAA	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.935G>A	chr17.hg19:g.72343926G>A	ENSP00000374566:p.Gly312Glu	26.0	0.0		50.0	13.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	hg19	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921765	0.73213	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.76448	-1.02;-1.02	5.68	5.68	0.88126	Kinesin, motor domain (4);	.	.	.	.	D	0.90920	0.7146	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.969;0.969	D;D;D;P	0.91635	0.98;0.999;0.918;0.891	D	0.92383	0.5915	9	0.87932	D	0	.	18.629	0.91352	0.0:0.0:1.0:0.0	.	312;270;270;312	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	E	270;312	ENSP00000449134:G270E;ENSP00000374566:G312E	ENSP00000374566:G312E	G	+	2	0	KIF19	69855521	1.000000	0.71417	0.995000	0.50966	0.292000	0.27327	9.336000	0.96533	2.705000	0.92388	0.556000	0.70494	GGA	.	.		0.637	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
FASN	2194	hgsc.bcm.edu	37	17	80039104	80039104	+	Silent	SNP	G	G	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:80039104G>A	ENST00000306749.2	-	38	6749	c.6531C>T	c.(6529-6531)cgC>cgT	p.R2177R	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2177	Acyl carrier. {ECO:0000255|PROSITE- ProRule:PRU00258}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GCCGCACCTCGCGCACGGACA	0.682																																					p.R2177R	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.C6531T						.						27.0	24.0	25.0					17																	80039104		2188	4286	6474	SO:0001819	synonymous_variant	2194	exon38			CACCTCGCGCACG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6531C>T	chr17.hg19:g.80039104G>A		43.0	0.0		113.0	68.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	hg19	CCDS11801.1																																																																																			.	.		0.682	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
MPPE1	65258	hgsc.bcm.edu	37	18	11889442	11889442	+	Silent	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr18:11889442T>A	ENST00000588072.1	-	5	1659	c.438A>T	c.(436-438)ccA>ccT	p.P146P	MPPE1_ENST00000399978.2_Silent_p.P146P|MPPE1_ENST00000317235.7_Silent_p.P146P|MPPE1_ENST00000344987.7_Silent_p.P146P|MPPE1_ENST00000309976.9_Silent_p.P146P	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	146					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GTACATGACTTGGGTGTCTGA	0.488																																					p.P146P		Atlas-SNP	.											.	MPPE1	21	.	0			c.A438T						.						127.0	108.0	114.0					18																	11889442		2203	4300	6503	SO:0001819	synonymous_variant	65258	exon4			ATGACTTGGGTGT	BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.438A>T	chr18.hg19:g.11889442T>A		135.0	0.0		203.0	50.0	NM_001242904	B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Silent	SNP	ENST00000588072.1	hg19	CCDS11853.1																																																																																			.	.		0.488	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254562.2	NM_023075	
SYT4	6860	hgsc.bcm.edu	37	18	40854035	40854035	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr18:40854035T>A	ENST00000255224.3	-	2	727	c.359A>T	c.(358-360)aAt>aTt	p.N120I	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Missense_Mutation_p.N102I	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	120					exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CGGGGTTGCATTCTCCAGATC	0.433																																					p.N120I	NSCLC(85;81 1419 2855 22820 35912)	Atlas-SNP	.											.	SYT4	162	.	0			c.A359T						.						118.0	116.0	117.0					18																	40854035		2203	4298	6501	SO:0001583	missense	6860	exon2			GTTGCATTCTCCA	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.359A>T	chr18.hg19:g.40854035T>A	ENSP00000255224:p.Asn120Ile	207.0	0.0		329.0	105.0	NM_020783	B4DEU3|Q9P2K4	Missense_Mutation	SNP	ENST00000255224.3	hg19	CCDS11922.1	.	.	.	.	.	.	.	.	.	.	T	7.314	0.615635	0.14129	.	.	ENSG00000132872	ENST00000255224	T	0.37235	1.21	5.87	2.2	0.27929	.	0.335126	0.36002	N	0.002846	T	0.27489	0.0675	L	0.44542	1.39	0.33493	D	0.589003	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.25222	-1.0138	10	0.28530	T	0.3	.	9.812	0.40828	0.0:0.1939:0.0:0.8061	.	102;120	B4DEU3;Q9H2B2	.;SYT4_HUMAN	I	120	ENSP00000255224:N120I	ENSP00000255224:N120I	N	-	2	0	SYT4	39108033	1.000000	0.71417	0.949000	0.38748	0.606000	0.37113	3.844000	0.55873	0.206000	0.20587	0.533000	0.62120	AAT	.	.		0.433	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255851.2	NM_020783	
ABCA7	10347	hgsc.bcm.edu	37	19	1051263	1051263	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:1051263A>T	ENST00000263094.6	+	20	3025	c.2794A>T	c.(2794-2796)Aag>Tag	p.K932*	ABCA7_ENST00000433129.1_Nonsense_Mutation_p.K932*|ABCA7_ENST00000435683.2_Nonsense_Mutation_p.K794*	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	932	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGTCTCCAAGCAGAGTGT	0.642																																					p.K932X		Atlas-SNP	.											.	ABCA7	174	.	0			c.A2794T						.						51.0	49.0	50.0					19																	1051263		2190	4288	6478	SO:0001587	stop_gained	10347	exon20			GTCTCCAAGCAGA	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2794A>T	chr19.hg19:g.1051263A>T	ENSP00000263094:p.Lys932*	53.0	0.0		85.0	27.0	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Nonsense_Mutation	SNP	ENST00000263094.6	hg19	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	A	43	10.507155	0.99418	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7119	0.51630	1.0:0.0:0.0:0.0	.	.	.	.	X	932	.	ENSP00000263094:K932X	K	+	1	0	ABCA7	1002263	1.000000	0.71417	0.622000	0.29159	0.789000	0.44602	8.712000	0.91403	1.665000	0.50811	0.374000	0.22700	AAG	.	.		0.642	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
KHSRP	8570	hgsc.bcm.edu	37	19	6416830	6416830	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:6416830C>T	ENST00000398148.3	-	13	1338	c.1246G>A	c.(1246-1248)Ggc>Agc	p.G416S	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	416	Gly-rich.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						TTGCCTTGGCCTCTTCCTCGG	0.662																																					p.G416S	Colon(55;593 1006 2067 9135 22980)	Atlas-SNP	.											.	KHSRP	51	.	0			c.G1246A						.						17.0	20.0	19.0					19																	6416830		1939	4123	6062	SO:0001583	missense	8570	exon13			CTTGGCCTCTTCC	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1246G>A	chr19.hg19:g.6416830C>T	ENSP00000381216:p.Gly416Ser	31.0	0.0		34.0	14.0	NM_003685	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	hg19	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637286	0.87760	.	.	ENSG00000088247	ENST00000398148;ENST00000201886	T	0.54071	0.59	5.53	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.61565	0.2357	L	0.48642	1.525	0.58432	D	0.999999	D	0.61080	0.989	P	0.61722	0.893	T	0.60042	-0.7340	10	0.37606	T	0.19	.	13.5826	0.61911	0.0:0.9229:0.0:0.0771	.	416	Q92945	FUBP2_HUMAN	S	416	ENSP00000381216:G416S	ENSP00000201886:G416S	G	-	1	0	KHSRP	6367830	1.000000	0.71417	0.985000	0.45067	0.994000	0.84299	5.811000	0.69187	1.301000	0.44836	0.655000	0.94253	GGC	.	.		0.662	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
MUC16	94025	hgsc.bcm.edu	37	19	9045799	9045799	+	Silent	SNP	G	G	C	rs375775766		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:9045799G>C	ENST00000397910.4	-	5	36035	c.35832C>G	c.(35830-35832)acC>acG	p.T11944T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11946	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGGTATCAAGGTCATAGTGG	0.473																																					p.T11944T		Atlas-SNP	.											.	MUC16	4315	.	0			c.C35832G						.						167.0	158.0	161.0					19																	9045799		1958	4151	6109	SO:0001819	synonymous_variant	94025	exon5			TATCAAGGTCATA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35832C>G	chr19.hg19:g.9045799G>C		313.0	0.0		455.0	148.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ABHD8	79575	hgsc.bcm.edu	37	19	17412326	17412326	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:17412326T>A	ENST00000247706.3	-	2	339	c.100A>T	c.(100-102)Acc>Tcc	p.T34S	MRPL34_ENST00000595444.1_Intron|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000594999.1_5'Flank	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	34							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						TCTACAAAGGTGTAGCCATCG	0.672																																					p.T34S	Ovarian(156;1368 2543 15275 41187)	Atlas-SNP	.											.	ABHD8	26	.	0			c.A100T						.						18.0	22.0	21.0					19																	17412326		2192	4278	6470	SO:0001583	missense	79575	exon2			CAAAGGTGTAGCC	AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.100A>T	chr19.hg19:g.17412326T>A	ENSP00000247706:p.Thr34Ser	26.0	0.0		49.0	23.0	NM_024527	Q9HAE9	Missense_Mutation	SNP	ENST00000247706.3	hg19	CCDS12355.1	.	.	.	.	.	.	.	.	.	.	T	11.14	1.551576	0.27739	.	.	ENSG00000127220	ENST00000247706	T	0.30182	1.54	5.24	3.0	0.34707	.	0.386165	0.29722	N	0.011368	T	0.11452	0.0279	N	0.08118	0	0.27073	N	0.963261	B	0.02656	0.0	B	0.04013	0.001	T	0.20907	-1.0261	10	0.17832	T	0.49	-39.906	1.8784	0.03223	0.1671:0.0899:0.1743:0.5688	.	34	Q96I13	ABHD8_HUMAN	S	34	ENSP00000247706:T34S	ENSP00000247706:T34S	T	-	1	0	ABHD8	17273326	1.000000	0.71417	0.971000	0.41717	0.986000	0.74619	2.101000	0.41787	0.253000	0.21552	0.402000	0.26972	ACC	.	.		0.672	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462937.1	NM_024527	
ZNF681	148213	hgsc.bcm.edu	37	19	23927768	23927768	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:23927768A>T	ENST00000402377.3	-	4	725	c.584T>A	c.(583-585)gTa>gAa	p.V195E	ZNF681_ENST00000395385.3_Missense_Mutation_p.V126E	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	195					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GTAGAAATTTACTCTAGTACA	0.279																																					p.V195E		Atlas-SNP	.											.	ZNF681	76	.	0			c.T584A						.						22.0	23.0	23.0					19																	23927768		2197	4290	6487	SO:0001583	missense	148213	exon4			AAATTTACTCTAG	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.584T>A	chr19.hg19:g.23927768A>T	ENSP00000384000:p.Val195Glu	280.0	0.0		202.0	77.0	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	hg19	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	0.012	-1.690277	0.00738	.	.	ENSG00000196172	ENST00000402377;ENST00000395385;ENST00000528059;ENST00000531570	T;T;T;T	0.22539	2.83;2.83;1.95;6.31	1.39	-2.77	0.05877	.	.	.	.	.	T	0.03608	0.0103	N	0.00403	-1.54	0.26265	N	0.978515	B	0.13145	0.007	B	0.17433	0.018	T	0.40813	-0.9543	9	0.02654	T	1	.	4.9577	0.14050	0.3414:0.0:0.0:0.6586	.	195	Q96N22	ZN681_HUMAN	E	195;126;126;126	ENSP00000384000:V195E;ENSP00000378783:V126E;ENSP00000433806:V126E;ENSP00000435824:V126E	ENSP00000378783:V126E	V	-	2	0	ZNF681	23719608	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	0.407000	0.21049	-0.383000	0.07858	-0.732000	0.03574	GTA	.	.		0.279	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
ZNF230	7773	hgsc.bcm.edu	37	19	44514563	44514563	+	Silent	SNP	C	C	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:44514563C>G	ENST00000429154.2	+	5	600	c.372C>G	c.(370-372)tcC>tcG	p.S124S		NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	124	KRNB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				ATGTCCCCTCCCAGGTTGAGG	0.433																																					p.S124S	GBM(175;914 2069 22996 47111 52600)	Atlas-SNP	.											.	ZNF230	44	.	0			c.C372G						.						102.0	96.0	98.0					19																	44514563		2203	4300	6503	SO:0001819	synonymous_variant	7773	exon5			CCCCTCCCAGGTT	U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.372C>G	chr19.hg19:g.44514563C>G		193.0	0.0		134.0	95.0	NM_006300	O15322|Q504X7|Q86W84|Q9P1U6	Silent	SNP	ENST00000429154.2	hg19	CCDS33044.1																																																																																			.	.		0.433	ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460456.1		
PPP1R12C	54776	hgsc.bcm.edu	37	19	55606963	55606963	+	Silent	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:55606963T>C	ENST00000263433.3	-	10	1251	c.1236A>G	c.(1234-1236)gaA>gaG	p.E412E	PPP1R12C_ENST00000435544.2_Silent_p.E338E|PPP1R12C_ENST00000376393.2_Silent_p.E412E	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		AGGGGGCCTCTTCAAGCTGCT	0.592																																					p.E412E		Atlas-SNP	.											.	PPP1R12C	46	.	0			c.A1236G						.						9.0	11.0	10.0					19																	55606963		2192	4275	6467	SO:0001819	synonymous_variant	54776	exon10			GGCCTCTTCAAGC	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.1236A>G	chr19.hg19:g.55606963T>C		25.0	0.0		54.0	18.0	NM_017607		Silent	SNP	ENST00000263433.3	hg19	CCDS12916.1																																																																																			.	.		0.592	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
PTPRH	5794	hgsc.bcm.edu	37	19	55716907	55716907	+	Missense_Mutation	SNP	C	C	A	rs144055741	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr19:55716907C>A	ENST00000376350.3	-	4	428	c.406G>T	c.(406-408)Gcc>Tcc	p.A136S	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	136	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CAGGTCAGGGCGATGGAGCTG	0.592																																					p.A136S		Atlas-SNP	.											.	PTPRH	139	.	0			c.G406T						.						106.0	86.0	93.0					19																	55716907		2203	4300	6503	SO:0001583	missense	5794	exon4			TCAGGGCGATGGA		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.406G>T	chr19.hg19:g.55716907C>A	ENSP00000365528:p.Ala136Ser	255.0	0.0		396.0	156.0	NM_002842	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	ENST00000376350.3	hg19	CCDS33110.1	.	.	.	.	.	.	.	.	.	.	c	0.017	-1.509536	0.00984	.	.	ENSG00000080031	ENST00000376350	T	0.55413	0.52	4.23	2.09	0.27110	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.265460	0.06178	N	0.678911	T	0.28764	0.0713	N	0.04162	-0.26	0.29679	N	0.841854	B	0.14438	0.01	B	0.10450	0.005	T	0.26780	-1.0093	10	0.08599	T	0.76	.	9.1546	0.36985	0.0:0.1011:0.0:0.8989	.	136	Q9HD43	PTPRH_HUMAN	S	136	ENSP00000365528:A136S	ENSP00000365528:A136S	A	-	1	0	PTPRH	60408719	0.733000	0.28132	0.086000	0.20670	0.000000	0.00434	0.023000	0.13533	0.177000	0.19895	-2.885000	0.00097	GCC	.	C|1.000;T|0.000		0.592	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452649.1		
SIGLEC1	6614	hgsc.bcm.edu	37	20	3669214	3669214	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:3669214A>T	ENST00000344754.4	-	21	5122	c.5123T>A	c.(5122-5124)cTg>cAg	p.L1708Q	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.W1684R	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1708					cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						TGGTCAGCCCAGGGGTGGGGC	0.577																																					p.L1708Q		Atlas-SNP	.											.	SIGLEC1	210	.	0			c.T5123A						.						57.0	45.0	49.0					20																	3669214		2201	4297	6498	SO:0001583	missense	6614	exon21			CAGCCCAGGGGTG	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.5123T>A	chr20.hg19:g.3669214A>T	ENSP00000341141:p.Leu1708Gln	81.0	0.0		107.0	44.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	hg19	CCDS13060.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.06|15.06	2.720618|2.720618	0.48728|0.48728	.|.	.|.	ENSG00000088827|ENSG00000088827	ENST00000344754|ENST00000202578	T|T	0.24151|0.22134	1.87|1.97	4.76|4.76	2.43|2.43	0.29744|0.29744	.|.	.|.	.|.	.|.	.|.	T|T	0.12347|0.12347	0.0300|0.0300	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|B	0.20550|0.02656	0.046|0.0	B|B	0.14578|0.01281	0.011|0.0	T|T	0.26780|0.26780	-1.0093|-1.0093	9|9	0.87932|0.87932	D|D	0|0	.|.	4.1782|4.1782	0.10362|0.10362	0.7253:0.0:0.0972:0.1776|0.7253:0.0:0.0972:0.1776	.|.	1708|1684	Q9BZZ2|Q9BZZ2-3	SN_HUMAN|.	Q|R	1708|1684	ENSP00000341141:L1708Q|ENSP00000202578:W1684R	ENSP00000341141:L1708Q|ENSP00000202578:W1684R	L|W	-|-	2|1	0|0	SIGLEC1|SIGLEC1	3617214|3617214	0.003000|0.003000	0.15002|0.15002	0.505000|0.505000	0.27651|0.27651	0.028000|0.028000	0.11728|0.11728	1.202000|1.202000	0.32271|0.32271	0.374000|0.374000	0.24650|0.24650	0.454000|0.454000	0.30748|0.30748	CTG|TGG	.	.		0.577	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
ELMO2	63916	hgsc.bcm.edu	37	20	45004003	45004003	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:45004003T>C	ENST00000290246.6	-	13	1131	c.937A>G	c.(937-939)Agg>Ggg	p.R313G	ELMO2_ENST00000439931.2_Missense_Mutation_p.R325G|ELMO2_ENST00000488853.1_5'UTR|ELMO2_ENST00000454865.2_Missense_Mutation_p.R45G|ELMO2_ENST00000396391.1_Missense_Mutation_p.R313G|ELMO2_ENST00000352077.2_Missense_Mutation_p.R311G|ELMO2_ENST00000372176.1_Missense_Mutation_p.R225G|ELMO2_ENST00000445496.2_Missense_Mutation_p.R130G	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	313	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				ATGATGTCCCTTTGAGCCTGC	0.502																																					p.R313G		Atlas-SNP	.											.	ELMO2	51	.	0			c.A937G						.						112.0	78.0	90.0					20																	45004003		2203	4300	6503	SO:0001583	missense	63916	exon12			TGTCCCTTTGAGC	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.937A>G	chr20.hg19:g.45004003T>C	ENSP00000290246:p.Arg313Gly	152.0	0.0		206.0	76.0	NM_182764	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Missense_Mutation	SNP	ENST00000290246.6	hg19	CCDS13398.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.756808	0.69648	.	.	ENSG00000062598	ENST00000290246;ENST00000372176;ENST00000396391;ENST00000439931;ENST00000445496;ENST00000454865;ENST00000352077;ENST00000425546;ENST00000450812	T;T;T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.73	4.81	3.67	0.42095	Terpene synthase-like (1);Engulfment/cell motility, ELMO (2);	0.000000	0.85682	D	0.000000	T	0.53642	0.1809	M	0.62723	1.935	0.80722	D	1	P;D;D;D;P	0.67145	0.785;0.996;0.985;0.974;0.943	P;D;P;P;P	0.72625	0.636;0.978;0.83;0.908;0.867	T	0.54214	-0.8327	10	0.66056	D	0.02	-14.8006	10.8249	0.46627	0.0:0.0:0.1588:0.8412	.	325;45;313;130;313	B4DRL5;B4DZ20;E9PBG2;B7Z1S8;Q96JJ3	.;.;.;.;ELMO2_HUMAN	G	313;225;313;325;130;45;311;101;313	ENSP00000290246:R313G;ENSP00000361249:R225G;ENSP00000379673:R313G;ENSP00000396519:R325G;ENSP00000409920:R130G;ENSP00000415641:R45G;ENSP00000326172:R311G;ENSP00000388962:R101G;ENSP00000416181:R313G	ENSP00000290246:R313G	R	-	1	2	ELMO2	44437410	1.000000	0.71417	0.995000	0.50966	0.776000	0.43924	4.964000	0.63701	0.828000	0.34709	0.454000	0.30748	AGG	.	.		0.502	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080466.1	NM_022086	
NPBWR2	2832	hgsc.bcm.edu	37	20	62737266	62737266	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:62737266C>T	ENST00000369768.1	-	1	1258	c.919G>A	c.(919-921)Gcc>Acc	p.A307T		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	307					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					CACGAGTTGGCGTAGCTGAGG	0.597																																					p.A307T		Atlas-SNP	.											.	NPBWR2	36	.	0			c.G919A						.						197.0	132.0	154.0					20																	62737266		2202	4298	6500	SO:0001583	missense	2832	exon1			AGTTGGCGTAGCT	U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.919G>A	chr20.hg19:g.62737266C>T	ENSP00000358783:p.Ala307Thr	71.0	0.0		73.0	28.0	NM_005286	Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	ENST00000369768.1	hg19	CCDS13557.1	.	.	.	.	.	.	.	.	.	.	C	6.535	0.467050	0.12402	.	.	ENSG00000125522	ENST00000369768	T	0.37915	1.17	3.43	0.189	0.15119	GPCR, rhodopsin-like superfamily (1);	0.224693	0.35262	N	0.003338	T	0.19525	0.0469	L	0.33137	0.985	0.39667	D	0.970707	B	0.29766	0.256	B	0.26310	0.068	T	0.18366	-1.0339	10	0.06236	T	0.91	.	9.5523	0.39317	0.0:0.7615:0.0:0.2385	.	307	P48146	NPBW2_HUMAN	T	307	ENSP00000358783:A307T	ENSP00000358783:A307T	A	-	1	0	NPBWR2	62207710	0.975000	0.34042	0.272000	0.24630	0.688000	0.40055	1.370000	0.34238	0.104000	0.17725	0.491000	0.48974	GCC	.	.		0.597	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080300.1	NM_005286	
DNAJC28	54943	hgsc.bcm.edu	37	21	34860757	34860757	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr21:34860757T>A	ENST00000314399.3	-	2	1382	c.944A>T	c.(943-945)aAt>aTt	p.N315I	DNAJC28_ENST00000381947.3_Missense_Mutation_p.N315I|DNAJC28_ENST00000402202.1_Missense_Mutation_p.N315I	NM_017833.3	NP_060303.2	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	315										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(5)|skin(1)|urinary_tract(1)	18						AACAATTAAATTAAAATCATT	0.348																																					p.N315I		Atlas-SNP	.											.	DNAJC28	47	.	0			c.A944T						.						83.0	79.0	80.0					21																	34860757		2203	4300	6503	SO:0001583	missense	54943	exon2			ATTAAATTAAAAT	AK000468	CCDS13626.1	21q22.11	2011-09-02	2008-06-17	2008-06-17	ENSG00000177692	ENSG00000177692		"""Heat shock proteins / DNAJ (HSP40)"""	1297	protein-coding gene	gene with protein product	"""Orf28"""		"""chromosome 21 open reading frame 55"""	C21orf55			Standard	NM_017833		Approved	C21orf78	uc002yrw.3	Q9NX36	OTTHUMG00000065531	ENST00000314399.3:c.944A>T	chr21.hg19:g.34860757T>A	ENSP00000320303:p.Asn315Ile	402.0	0.0		535.0	37.0	NM_001040192	D3DSF2	Missense_Mutation	SNP	ENST00000314399.3	hg19	CCDS13626.1	.	.	.	.	.	.	.	.	.	.	T	19.95	3.921477	0.73213	.	.	ENSG00000177692	ENST00000381947;ENST00000314399;ENST00000402202	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.79816	0.4511	M	0.80183	2.485	0.53688	D	0.999979	D	0.89917	1.0	D	0.87578	0.998	T	0.83136	-0.0111	9	0.87932	D	0	-25.7443	14.8401	0.70217	0.0:0.0:0.0:1.0	.	315	Q9NX36	DJC28_HUMAN	I	315	.	ENSP00000320303:N315I	N	-	2	0	DNAJC28	33782627	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.094000	0.76944	2.050000	0.60909	0.528000	0.53228	AAT	.	.		0.348	DNAJC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140454.3		
ST13	6767	hgsc.bcm.edu	37	22	41223190	41223190	+	Missense_Mutation	SNP	C	C	A	rs710193	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr22:41223190C>A	ENST00000216218.3	-	11	1372	c.891G>T	c.(889-891)atG>atT	p.M297I		NM_003932.3	NP_003923.2	P50502	F10A1_HUMAN	suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)	297	Gly/Met/Pro-rich.		M -> I (in dbSNP:rs710193).		chaperone cofactor-dependent protein refolding (GO:0070389)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	dATP binding (GO:0032564)|protein binding, bridging (GO:0030674)			cervix(1)|large_intestine(1)|lung(3)|skin(1)	6						CCATTCCAGGCATTCCTCCGG	0.458																																					p.M297I		Atlas-SNP	.											.	ST13	16	.	0			c.G891T						.						53.0	58.0	56.0					22																	41223190		2203	4298	6501	SO:0001583	missense	6767	exon11			TCCAGGCATTCCT		CCDS14006.1	22q13.2	2013-01-10	2001-11-29		ENSG00000100380	ENSG00000100380		"""Tetratricopeptide (TTC) repeat domain containing"""	11343	protein-coding gene	gene with protein product	"""progesterone receptor-associated p48 protein"""	606796	"""suppression of tumorigenicity 13 (colon carcinoma) (Hsp70-interacting protein)"""			9925927, 8721986	Standard	NM_003932		Approved	SNC6, HSPABP1, HIP, P48, FAM10A1	uc003aze.3	P50502	OTTHUMG00000151201	ENST00000216218.3:c.891G>T	chr22.hg19:g.41223190C>A	ENSP00000216218:p.Met297Ile	39.0	0.0		49.0	20.0	NM_003932	O14999|Q2TU77	Missense_Mutation	SNP	ENST00000216218.3	hg19	CCDS14006.1	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812778	0.32053	.	.	ENSG00000100380	ENST00000216218	D	0.84730	-1.89	5.01	5.01	0.66863	.	0.135171	0.64402	D	0.000003	D	0.85396	0.5687	M	0.80746	2.51	0.43803	D	0.996355	B;B	0.27765	0.188;0.188	B;B	0.31101	0.124;0.124	T	0.82544	-0.0404	10	0.26408	T	0.33	.	13.9913	0.64369	0.1521:0.8479:0.0:0.0	.	287;297	B4E0U6;P50502	.;F10A1_HUMAN	I	297	ENSP00000216218:M297I	ENSP00000216218:M297I	M	-	3	0	ST13	39553136	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.292000	0.51772	2.340000	0.79590	0.555000	0.69702	ATG	.	C|0.940;T|0.060		0.458	ST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321759.1	NM_003932	
ZC3H7B	23264	hgsc.bcm.edu	37	22	41739420	41739420	+	Splice_Site	SNP	C	C	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr22:41739420C>T	ENST00000352645.4	+	13	1556	c.1299C>T	c.(1297-1299)ggC>ggT	p.G433G	ZC3H7B_ENST00000351589.4_Splice_Site_p.G433G	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	449					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TGCCCATAGGCCCCCGGGCTG	0.622																																					p.G433G		Atlas-SNP	.											.	ZC3H7B	82	.	0			c.C1299T						.						55.0	57.0	56.0					22																	41739420		2203	4298	6501	SO:0001630	splice_region_variant	23264	exon13			CATAGGCCCCCGG		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.1298-1C>T	chr22.hg19:g.41739420C>T		50.0	0.0		108.0	36.0	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Silent	SNP	ENST00000352645.4	hg19	CCDS14013.1																																																																																			.	.		0.622	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	Silent
ARAF	369	hgsc.bcm.edu	37	X	47428285	47428285	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chrX:47428285G>T	ENST00000377045.4	+	11	1439	c.1245G>T	c.(1243-1245)caG>caT	p.Q415H		NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	415	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	AGACTGCCCAGGGCATGGAGT	0.657											OREG0019759	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q418H		Atlas-SNP	.											.	ARAF	67	.	0			c.G1254T						.						29.0	24.0	26.0					X																	47428285		2203	4300	6503	SO:0001583	missense	369	exon11			TGCCCAGGGCATG	X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.1245G>T	chrX.hg19:g.47428285G>T	ENSP00000366244:p.Gln415His	62.0	0.0	946	106.0	84.0	NM_001256196	P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	ENST00000377045.4	hg19	CCDS35232.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990746	0.74589	.	.	ENSG00000078061	ENST00000377045	D	0.83163	-1.69	5.33	4.47	0.54385	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85366	0.5680	L	0.41356	1.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84916	0.0851	10	0.87932	D	0	.	7.5126	0.27583	0.1992:0.0:0.8008:0.0	.	415;281	P10398;B4DV85	ARAF_HUMAN;.	H	415	ENSP00000366244:Q415H	ENSP00000366244:Q415H	Q	+	3	2	ARAF	47313229	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.143000	0.64826	1.008000	0.39264	0.422000	0.28245	CAG	.	.		0.657	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056418.1		
OPHN1	4983	hgsc.bcm.edu	37	X	67283856	67283856	+	Silent	SNP	T	T	A			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chrX:67283856T>A	ENST00000355520.5	-	21	2639	c.1998A>T	c.(1996-1998)ccA>ccT	p.P666P	OPHN1_ENST00000484842.1_5'UTR|OPHN1_ENST00000540071.1_Intron	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	666	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						CGTCCACCTCTGGGCAGGGCT	0.582																																					p.P666P		Atlas-SNP	.											.	OPHN1	75	.	0			c.A1998T						.						84.0	69.0	74.0					X																	67283856		2203	4300	6503	SO:0001819	synonymous_variant	4983	exon21			CACCTCTGGGCAG	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1998A>T	chrX.hg19:g.67283856T>A		114.0	0.0		216.0	168.0	NM_002547	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Silent	SNP	ENST00000355520.5	hg19	CCDS14388.1																																																																																			.	.		0.582	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547	
RBMXL3	139804	hgsc.bcm.edu	37	X	114425456	114425456	+	Silent	SNP	A	A	T			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chrX:114425456A>T	ENST00000424776.3	+	1	1494	c.1452A>T	c.(1450-1452)ggA>ggT	p.G484G	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	484	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCAACAGTGGAGGCTGCTCGC	0.637																																					p.G484G		Atlas-SNP	.											.	RBMXL3	83	.	0			c.A1452T						.						35.0	37.0	36.0					X																	114425456		692	1591	2283	SO:0001819	synonymous_variant	139804	exon1			CAGTGGAGGCTGC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1452A>T	chrX.hg19:g.114425456A>T		33.0	0.0		62.0	13.0	NM_001145346	B4DXC0	Silent	SNP	ENST00000424776.3	hg19	CCDS55478.1																																																																																			.	.		0.637	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
SYCP2	10388	hgsc.bcm.edu	37	20	58444857	58444857	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr20:58444857delC	ENST00000357552.3	-	36	3962	c.3737delG	c.(3736-3738)agafs	p.R1246fs	SYCP2_ENST00000371001.2_Frame_Shift_Del_p.R1246fs			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1246					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ACTTACCTCTCTTTTGCTTTG	0.299																																					p.R1246fs		Atlas-Indel,Pindel	.											.	SYCP2	204	.	0			c.3738delA						.						109.0	105.0	107.0					20																	58444857		2199	4296	6495	SO:0001589	frameshift_variant	10388	exon35			.	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3737delG	chr20.hg19:g.58444857delC	ENSP00000350162:p.Arg1246fs	279.0	0.0		195.0	70.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Frame_Shift_Del	DEL	ENST00000357552.3	hg19	CCDS13482.1																																																																																			.	.		0.299	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
ZNF141	7700	hgsc.bcm.edu	37	4	367384	367397	+	Frame_Shift_Del	DEL	AAAAATTCATACTG	AAAAATTCATACTG	-	rs544940326		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	AAAAATTCATACTG	AAAAATTCATACTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr4:367384_367397delAAAAATTCATACTG	ENST00000240499.7	+	4	1307_1320	c.1158_1171delAAAAATTCATACTG	c.(1156-1173)aaaaaaattcatactggafs	p.KIHTG387fs	ZNF141_ENST00000505939.1_Intron|ZNF141_ENST00000512994.1_Intron	NM_003441.2	NP_003432.1	Q15928	ZN141_HUMAN	zinc finger protein 141	387					anatomical structure morphogenesis (GO:0009653)|limb morphogenesis (GO:0035108)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(3)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	18						ATGAACATAAAAAAATTCATACTGGAGAGAAACC	0.411																																					p.386_390del		Atlas-Indel,Pindel	.											.	ZNF141	48	.	0			c.1157_1170del						.																																			SO:0001589	frameshift_variant	7700	exon4			.	L15309	CCDS33931.1	4p16.3	2013-01-08	2006-06-13			ENSG00000131127		"""Zinc fingers, C2H2-type"", ""-"""	12926	protein-coding gene	gene with protein product		194648	"""zinc finger protein 141 (clone pHZ-44)"""	D4S90		8268908	Standard	NM_003441		Approved	pHZ-44	uc003gaa.2	Q15928		ENST00000240499.7:c.1158_1171delAAAAATTCATACTG	chr4.hg19:g.367384_367397delAAAAATTCATACTG	ENSP00000240499:p.Lys387fs	111.0	0.0		125.0	17.0	NM_003441	Q6DK07	Frame_Shift_Del	DEL	ENST00000240499.7	hg19	CCDS33931.1																																																																																			.	.		0.411	ZNF141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357710.1	NM_003441	
MYO5A	4644	hgsc.bcm.edu	37	15	52638630	52638630	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr15:52638630delA	ENST00000399231.3	-	30	4130	c.3887delT	c.(3886-3888)ttgfs	p.L1296fs	MYO5A_ENST00000553916.1_Frame_Shift_Del_p.L1296fs|MYO5A_ENST00000399233.2_Frame_Shift_Del_p.L1293fs|MYO5A_ENST00000356338.6_Frame_Shift_Del_p.L1296fs|MYO5A_ENST00000358212.6_Frame_Shift_Del_p.L1296fs	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1296					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TACATCTTCCAAAAGTATTGT	0.299																																					p.L1296fs		Atlas-Indel,Pindel	.											.	MYO5A	145	.	0			c.3888delG						.						170.0	156.0	160.0					15																	52638630		1829	4073	5902	SO:0001589	frameshift_variant	4644	exon30			.		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3887delT	chr15.hg19:g.52638630delA	ENSP00000382177:p.Leu1296fs	278.0	0.0		269.0	107.0	NM_001142495	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Frame_Shift_Del	DEL	ENST00000399231.3	hg19	CCDS42037.1																																																																																			.	.		0.299	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
CEP85	64793	hgsc.bcm.edu	37	1	26570728	26570729	+	Frame_Shift_Ins	INS	-	-	G	rs368381610		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr1:26570728_26570729insG	ENST00000252992.4	+	3	258_259	c.127_128insG	c.(127-129)cggfs	p.R43fs	CEP85_ENST00000451429.2_Intron	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	43						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						GGAGCCCTTTCGGAGCCGCTTC	0.51																																					p.R43fs		Atlas-INDEL	.											.	CEP85	61	.	0			c.127_128insG						.																																			SO:0001589	frameshift_variant	64793	exon3			.	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.129dupG	chr1.hg19:g.26570730_26570730dupG	ENSP00000252992:p.Arg43fs	196.0	0.0		282.0	20.0	NM_022778	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Frame_Shift_Ins	INS	ENST00000252992.4	hg19	CCDS277.1																																																																																			.	.		0.510	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009492.2	NM_022778	
ITGA3	3675	hgsc.bcm.edu	37	17	48165169	48165170	+	Frame_Shift_Ins	INS	-	-	G			TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:48165169_48165170insG	ENST00000320031.8	+	24	3311_3312	c.2981_2982insG	c.(2980-2985)ctggtgfs	p.V995fs	ITGA3_ENST00000007722.7_Frame_Shift_Ins_p.V995fs	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	995					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						GAGCTGTGGCTGGTGCTGGTGG	0.644																																					p.L994fs		Atlas-INDEL	.											.	ITGA3	128	.	0			c.2981_2982insG						.																																			SO:0001589	frameshift_variant	3675	exon24			.	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.2983dupG	chr17.hg19:g.48165171_48165171dupG	ENSP00000315190:p.Val995fs	69.0	0.0		165.0	12.0	NM_005501	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Frame_Shift_Ins	INS	ENST00000320031.8	hg19	CCDS11558.1																																																																																			.	.		0.644	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501	
FAM134C	162427	hgsc.bcm.edu	37	17	40733882	40733889	+	Frame_Shift_Del	DEL	CAGAAGTT	CAGAAGTT	-	rs546107864		TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	CAGAAGTT	CAGAAGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr17:40733882_40733889delCAGAAGTT	ENST00000309428.5	-	9	1402_1409	c.1343_1350delAACTTCTG	c.(1342-1350)gaacttctgfs	p.ELL448fs	FAM134C_ENST00000543197.1_Frame_Shift_Del_p.ELL253fs|FAM134C_ENST00000585894.1_Frame_Shift_Del_p.ELL351fs	NM_178126.3	NP_835227.1	Q86VR2	F134C_HUMAN	family with sequence similarity 134, member C	448						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	11		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		CCGACTGGTCCAGAAGTTCAAAGTCATC	0.572																																					p.448_451del		Atlas-Indel,Pindel	.											.	FAM134C	26	.	0			c.1344_1351del						.																																			SO:0001589	frameshift_variant	162427	exon9			.	BC049370	CCDS11432.1	17q21.2	2007-05-01							27258	protein-coding gene	gene with protein product						12477932	Standard	NM_178126		Approved	DKFZp686B1036, FLJ33806	uc002ial.2	Q86VR2		ENST00000309428.5:c.1343_1350delAACTTCTG	chr17.hg19:g.40733882_40733889delCAGAAGTT	ENSP00000309432:p.Glu448fs	47.0	0.0		97.0	22.0	NM_178126	B3KR75	Frame_Shift_Del	DEL	ENST00000309428.5	hg19	CCDS11432.1																																																																																			.	.		0.572	FAM134C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450536.1	NM_178126	
CRELD2	79174	hgsc.bcm.edu	37	22	50315943	50315980	+	Intron	DEL	CCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG	CCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG	-	rs377640443|rs562885075|rs542695980|rs113299196|rs7410276|rs12160965|rs386822607|rs386822606|rs564615833|rs368043307|rs71805922|rs386822608|rs73891177	byFrequency	TCGA-CC-5263-01A-01D-A12Z-10	TCGA-CC-5263-10B-01D-A12Z-10	CCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG	CCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b3dc66b5-ad21-46ef-bea2-13b364e8f7ee	e354902e-c055-43ca-ad8a-29b0cd8fd07d	g.chr22:50315943_50315980delCCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG	ENST00000328268.4	+	6	666				CRELD2_ENST00000403427.3_Intron|CRELD2_ENST00000404488.3_Splice_Site_p.PQQSGPASPILTR198fs|CRELD2_ENST00000444954.1_Intron|CRELD2_ENST00000407217.3_Intron	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2							endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		GCCCCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCGCCTTGCTGTCTGTCTCT	0.618																																					p.198_207del		Atlas-INDEL	.											.	CRELD2	57	.	0			c.593_620del						.																																			SO:0001627	intron_variant	79174	exon6			.	BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.593-280CCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG>-	chr22.hg19:g.50315943_50315980delCCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG		57.0	0.0		112.0	32.0	NM_001135101	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Frame_Shift_Del	DEL	ENST00000328268.4	hg19	CCDS14082.1																																																																																			.	.		0.618	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317409.1	NM_024324	
